This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Environmental Toxicology and Pharmacology 29 (2010) 144–149

Contents lists available at ScienceDirect

Environmental Toxicology and Pharmacology

journa l homepage: www.e lsev ier .com/ locate /e tap

Alpha-lipoic acid regulates heme oxygenase gene expression and nuclear Nrf2activation as a mechanism of protection against arsenic exposure in HepG2 cells

Selene G. Huerta-Olveraa,c, José Macías-Barragáne, Martha E. Ramos-Márquezf,Juan Armendáriz-Borundac,d, Fernando Díaz-Barrigab, Fernando Siller-Lópezg,h,∗

a Doctorado en Ciencias Biomédicas Básicas, Universidad Autónoma de San Luis Potosí, Mexicob Unidad de Toxicología Ambiental, Facultad de Medicina, Universidad Autónoma de San Luis Potosí, Mexicoc OPD Hospital Civil de Guadalajara, Mexicod Instituto de Biología Molecular en Medicina, Universidad de Guadalajara, Mexicoe Doctorado en Ciencias Biomédicas, Universidad de Guadalajara, Mexicof Instituto de Enfermedades Crónico-degenerativas, Universidad de Guadalajara, Mexicog Instituto de Oftalmología y Ciencias Visuales, Universidad de Guadalajara, Mexicoh Centro de Investigación en Inmunología y Dermatología, Universidad de Guadalajara, Mexico

a r t i c l e i n f o

Article history:Received 20 June 2009Received in revised form26 November 2009Accepted 23 December 2009Available online 7 January 2010

Keywords:Alpha-lipoic acidArsenicHeme oxygenaseNrf2Antioxidant gene expressionHepG2

a b s t r a c t

Oxidative stress is a known mechanism induced, among other things, by arsenic toxicity. As a response,the cell triggers the synthesis of antioxidant and stress response elements like glutathione and heme oxy-genase. Alpha-lipoic acid (ALA) is a well-known antioxidant that confers protection to oxidative stressconditions. We analyzed the effect of ALA pretreatment on Nrf2-responsive gene expression of HepG2cells exposed to As3+. Cells were treated with 5 mM ALA and 8 h later exposed to 50 �M As3+ for 24 h, ana-lyzing MTT-activity, glutathione content, Nrf2 induction and antioxidant gene expression. As3+ increasedglutathione (154%), heme oxygenase, glutamate cystein ligase, modifier subunit and metallothionein (35-fold, 10-fold and 9-fold, respectively). ALA prevented the strong expression of heme oxygenase by As3+

exposure (from 35- to 5-times of control cells), which correlated with the reduction of Nrf2 observed inAs3+ group. ALA pretreatment can down-modulate the response mediated by Nrf2 and provide protectionto As3+ exposed HepG2 cells.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Arsenic is ubiquitous at low concentrations in the natural envi-ronment. Nonetheless, it is a worldwide contaminant that affectsmillions of people living in areas with unusually high levels ofarsenic in soil or drinking water. Chronic exposure of humansis associated with cancer, anemia, peripheral neuropathy, liverand kidney damage, and irritation of the skin and mucous mem-branes (ATSDR, 2007). Trivalent arsenic (As3+) has a strong reactionwith sulfhydryl groups in proteins and therefore inactivates manyenzymes like succinic dehydrogenase and DNA ligase which leadsto declining ATP levels and failures in DNA repair process (Li andRossman, 1989; Repetto et al., 1994). Importantly, a significantmechanism of toxic action is the generation of free radicals during

∗ Corresponding author at: Instituto de Oftalmología y Ciencias Visuales, Depar-tamento de Fisiología, Centro Universitario de Ciencias de la Salud, Universidad deGuadalajara, Guadalajara, Jal., Mexico; Sierra Mojada 950, Edif. O. Guadalajara, Jal.México, CP 44340, Mexico. Tel.: +52 33 1058 5200x3723; fax: +52 33 1058 5200.

E-mail address: fsiller@cucs.udg.mx (F. Siller-López).

As3+ metabolism in cells (Lin et al., 2005a). As3+-mediated pro-duction of free radicals is a complex process which involves thegeneration of a variety of reactive oxygen species (ROS) includ-ing superoxide (O2

•−), singlet oxygen (1O2) and hydrogen peroxide(H2O2) which cause oxidative stress (Flora et al., 2007). Under stressconditions a significant cellular defense is evoked with the synthe-sis of phase II biotransformation enzymes; i.e., antioxidant enzymesand stress response proteins. Synthesis of glutathione (GSH) andheme oxygenase-1 (HMOX1) are two of the most relevant mecha-nisms of defense that protects the cell against an oxidative insult(Dickinson et al., 2003).

GSH is a tripeptide acting as a scavenger of free radicals, detox-ifies electrophiles as a part of phase II detoxification reactions andplays a role in a number of important cellular processes. The het-erodimeric enzyme �-glutamate cysteine ligase (�-GCL) consistingof a catalytic (GCLC) and a modifier subunit (GCLM), catalyzesthe first, rate-limiting step in the de novo synthesis of GSH. Arelated cellular strategy of protein synthesis that protects againstinflammatory processes and oxidative tissue damage is HMOX1,an inducible isozyme highly regulated by a vast array of stimuliwith a common characteristic to cause oxidative stress (e.g., heat

1382-6689/$ – see front matter © 2010 Elsevier B.V. All rights reserved.doi:10.1016/j.etap.2009.12.004

Author's personal copy

S.G. Huerta-Olvera et al. / Environmental Toxicology and Pharmacology 29 (2010) 144–149 145

shock, UV radiation, ischemia-reperfusion, heavy metals, heme)(Shibahara, 1988). HMOX1 is the first and the rate-limiting enzymein the degradation of heme that yields equimolar amounts ofbiliverdin IX, carbon monoxide and free iron, all of them with signif-icant biological properties, such as antioxidant, anti-inflammatoryand antiapoptotic functions (Morse and Choi, 2005).

The mechanism of induction of �-GCL and HMOX1 genesis largely mediated through the transcriptional regulation oncis-acting DNA sequences located at the promoter regionknown as antioxidant response elements (AREs). Nuclear factor(erythroid-derived 2)-like 2 (Nrf2) has been identified as the keytranscriptional factor that mediates the oxidative inducer signal toAREs (Alam and Cook, 2003).

Like oxidative inducer agents, some important dietary antioxi-dants are known to act through the Nrf2 signaling pathway as partof the mechanism of cellular protection. Alpha-lipoic acid (ALA) isa natural antioxidant that scavenges ROS, regenerates endogenousantioxidants like vitamins C and E, and increases intracellular GSHconcentration (Packer et al., 1995). A significant mechanism of pro-tection of ALA has been related to the induction of ARE-responsivegenes via the Nrf2 signaling pathway (Ogborne et al., 2005). SinceAs3+ and ALA share the same Nrf2 activating route, the aim of thiswork consisted in the analysis of the effects of ALA pretreatmenton HepG2 cells subsequently exposed to As3+ and then evaluatedthe regulation on the induction of intracellular GSH levels and ARE-responsive antioxidant genes.

2. Materials and methods

2.1. Materials

Cell culture media (Dulbecco’s modified Eagle’s medium, DMEM), Glutamax®

and non-essential amino acids were obtained from Gibco BRL Life Technologies(Grand Island, NY). Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan,UT). TrizolTM, random hexamer, dNTPs, MMLV-reverse transcriptase, Universal Mas-ter Mix gene-specific qPCR LUXTM-fluorogenic primers and unlabeled primers werepurchased from Invitrogen. Alpha-lipoic acid, sodium arsenite (As3+) and all otherreagents were of analytical grade, and unless otherwise stated were obtained fromSigma Chemical (St. Louis, MO).

2.2. Cell culture

HepG2 cells (CRL-10741) obtained from the American Type Culture Collection(Manassas, VA) were routinely grown in a monolayer culture in the presence ofDMEM-8% FBS, 1% Glutamax® and 1% non-essential amino acids. Cells were grownat 37 ◦C in 6-well plates (Corning, Corning, NY), in a humidified atmosphere of 5%CO2. Cells were trypsinized and diluted every 3–4 days at 1:3 ratio.

2.3. Experimental design

HepG2 cells were seeded at a density of 1 × 106 cells/well 24 h before 50 �MAs3+ or 5 mM ALA exposure. Concentration of As3+ was chosen based on prior stud-ies of our group where 50 �M As3+ resulted in a minimal reduction in cell viabilityon HepG2 cells and still was able to induce a strong expression of stress genes andrelated proteins. Concentration of ALA was the same as used by Muller and Menzel(1990) which was able to protect rat hepatocytes from cadmium toxicity and alsoshowed no signs of toxicity on HepG2 cells in previous experiments by our group.After exposure for 8 h, cells were washed twice with PBS and collected for analysisof MTT-metabolic activity, GSH levels, analysis of gene expression of several stressand antioxidant-related genes and Nrf2 induction. Analysis at this time point wasconducted to evaluate the stress and antioxidant status of the cell in response to ALAtreatment at the precise moment of a subsequent exposure to As3+, as is explainedlater in the second set of studies. Assays of 8 h post-As+3 exposure were used to com-pare the selectivity on the cellular response . . . with the known ALA antioxidant. Theprotective effects of ALA were studied in a second set of experiments by pretreatingHepG2 cells with ALA for 8 h and later replacing culture medium with fresh media ormedia containing 50 �M As3+. Protection conferred by the antioxidant was analyzedby the same biochemical and molecular assays 24 h post-As3+ exposure.

2.4. Biochemical assays

2.4.1. Metabolic activity, MTT assayThe citotoxicity of As3+ was determined with a 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide (MTT) test according to Tada et al. (1986). The assaymeasures the conversion of MTT to insoluble formazan by dehydrogenase enzymes

of intact mitochondria of living cells. A solution of 5 mg/ml MTT in saline solutionwas added to control and metal-exposed HepG2 cells. The cells were incubated for4.5 h at 37 ◦C thereafter 5% SDS/0.05 N HCl was added and maintained overnight at37 ◦C to solubilize the formazan produced. Each sample was transferred to a 96-well plate where spectrophotometric readouts were taken at 570 nm with a 620 nmreference to eliminate the effect of cell debris and precipitated proteins which maybe produced by the acidic detergent addition. The data are expressed as a percentagerelated to untreated control cells.

2.4.2. Glutathione contentGSH was determined using the enzymatic recycling method described by Tietze

(1969) using DTNB (5,5′-dithiobis 2-nitrobenzoic acid). Briefly, at indicated timesHepG2 cells were washed twice and harvested in PBS. Cell suspension was mixedwith solubilization buffer containing trichloroacetic acid and samples were cen-trifuged at 13,000 rpm for 20 min at 4 ◦C. Then 200 �l of each sample was mixedwith 0.05 M phosphate buffer pH 7.1, 1 mM EDTA pH 7.0 and finally 10 mM DNTBsolution was added, mixed and absorbance was read at 412 nm in a microplatereader (�-Quant; Biotek). GSH levels of the sample were quantified against a stan-dard curve generated with known concentrations of GSH. Results are expressed asnmol of GSH per mg of protein.

2.4.3. Protein determinationTotal protein concentration was determined according to the Bradford method

(Bradford, 1976). Two hundred microliters of dye from the Bradford reagent wasmixed with 5 �l of each sample. After being incubated for 20 min at room tem-perature, absorbances were read at 595 nm in a microplate reader. The proteinconcentration from each sample was calculated according to linearized bovineserum albumin absorbance curve.

2.4.4. Molecular assay. Quantitative RT-PCRTotal RNA was isolated by the acid guanidinium-phenol chloroform method

using TRIzol reagent, and was treated with DNase I previous to the synthesis ofthe first-strand cDNA. Two micrograms of total RNA was reverse-transcribedby MMLV reverse transcriptase (200 U) using 1 �g of random hexamer.The reverse transcribed product was amplified by qPCR Master Mix andby the designed LUXTM-fluorogenic primers for each of the human genesselected. Primer sequences were as follows: �-Glutamylcystein ligase catalyticsubunit (GCLC); F: AAACAAGCACCCTCGCTTCAGT, R: CGACATCCTTTTCTCCTCTC-CTATGTCG[FAM]. �-Glutamylcystein ligase modulator subunit (GCLM); F:GAAAGCATTCCTGACATTCAAGC, R: CGGTCTCCTCTACTTTTCACAATGACCG-[JOE].Superoxide dismutase 1 (SOD1); F: CACCGCCTCTATCCAGAAAACACGGTG[HEX],R: GTCTCCAACATGCCTCTCTTCATC. Glutathione S-transferase A1 (GSTA1);F: CGACGCTGGTG-GAACTTCTCTACTACGTCG[HEX], R: AGGGAAGCTGG-AGATAAGACTGGA. Heme oxygenase 1 (HMOX1); F: ACATTGCCAGTGCCACCAAG,R: CGCATATCTCCAGGGAGTTCATGCG[FAM]. Metallothionein 1A (MT1A); F:CACTCTTCTCCTGCAAATGCAAAGAGTG[FAM], R: GGCACACTT-GGCACAGCTCA.Caspase 3 (CASP3); F: CGGCTAAAATACCAGTGGAGGCCG, R: CATCCTTT-GAATTTCGCCAAGA[JOE] (where “F” indicates forward primers correspondingto the sense strand whereas antisense reverse primers are designated with an“R”) and as an internal control for normalizing the qRT-PCR experiments weselected the Certified LUXTM Primer set for the housekeeping gene hypoxanthinephosphoribosyltransferase 1 (HPRT1). qPCR was performed using the Rotor-GeneTM

6000 Real Time (Corbett Life Sciences, Sydney, Australia) with a multiplex of twosets of the primer pairs described above carrying a different fluorogenic label each,and were run for 2 min at 50 ◦C, 5 min at 95 ◦C, and 40 cycles of 30 s at 95 ◦C, and40 s at 60 ◦C. The results were indicated as the fold of change of gene expressionnormalized to the levels of the respective HPRT1 transcripts and related to thelevels of the corresponding gene of the control sample.

2.4.5. Western blotting analysisNuclear fractions were isolated and Nrf2 was determined as described previ-

ously (Buckley et al., 2003). Briefly, harvested cells were pelleted and resuspendedin 475 �l of cytosolic extraction buffer (10 mM Tris-base, 60 mM KCl, 1 mM EDTA,1 mM DTT, protease inhibitor cocktail) and kept on ice for 10 min. Subsequently,25 �l of 10%, v/v, Igepal CA-630 (tert-Octylphenoxy poly(oxyethylene)ethanol) wasadded to the cell suspension and mixed with gentle pipetting for 10–15 s. Thismixture was spun at 12,000 × g for 5 min at 4 ◦C. The resultant supernatant wasremoved as the cytosolic fraction. The pellet, which contained the nuclear-enrichedfraction, was then resuspended again in nuclear extraction buffer (20 mM Tris-base, 400 mM NaCl, 1.5 mM MgCl2, 1.5 mM EDTA, 1 mM DTT, 25%, v/v, glycerol,protease inhibitor cocktail). All collected fractions were assayed for protein con-centration by the Bradford method. Independent verification of the relative purityof subcellular fractions was analyzed as described below. �-Actin as the house-keeping protein and Nrf2 protein harvested from HepG2 cells were detected byWestern blotting. Ten micrograms of proteins from cytoplasm or nuclear extractswere loaded on a 12% denaturing SDS-polyacrylamide gel and electroblotted onto0.2 �m nitrocellulose membranes using the Bio-Rad Trans-Blot system (Bio-Rad).Protein immunoblot analysis was carried out using anti-human Nrf2 (1:500) or anti-human �-actin (1:1000) polyclonal primary antibodies (Santa Cruz Biotechnology),and horseradish peroxidase-conjugated goat anti-rabbit IgG (1:6000) (Sigma) as

Author's personal copy

146 S.G. Huerta-Olvera et al. / Environmental Toxicology and Pharmacology 29 (2010) 144–149

Fig. 1. Effect of ALA and As3+ on HepG2 cellular metabolic activity and glutathione content. HepG2 cells were exposed to 50 �M As3+ or 5 mM ALA for 8 h and (A) harvestedfor analysis of metabolic activity by the MTT-reduction assay or (B) harvested for analysis of glutathione content. Values represent mean ± SD of at least three separateexperiments, each performed in quadruplicate (GSH is represented in percentage). *P < 0.05 when compared to the respective group according to ANOVA analysis.

secondary antibody. Blots were developed using the enhanced chemiluminescenceimmunoblot-detecting reagent (Amersham Biosciences).

2.5. Statistical analysis

Values are expressed as means ± SD of at least three independent experiments,each performed at least in duplicate. Statistics were performed by one-way ANOVAfollowed by Bonferroni post hoc test using SigmaStat 3.0 statistics software. P < 0.05was considered statistically significant.

3. Results

3.1. Alpha-lipoic acid protects cellular integrity of HepG2 cellsexposed to As3+

The 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bro-mide (MTT) assay assesses the reduction of MTT to formazancatalyzed by mitochondrial succinate dehydrogenase. Cellularmetabolic activity measured through this technique is consideredto correlate with the number of viable cells. By assaying MTT-activity, no significant toxicity was apparent at 50 �M As3+ (Fig. 1A).The protective effect of 8-h prior incubation with 5 mM ALA on via-bility of HepG2 cells exposed for 24 h to 50 �M As3+ is shown inFig. 2A. A 116% MTT-activity was observed after 8 h of ALA treat-ment and this activity decreased just below control levels (96%)when 50 �M As3+ was added to the media.

3.2. Response in glutathione content by As3+ exposure to HepG2cells

GSH is an important peptide involved in the cellular protectionagainst several kinds of toxic insults. At 8 h after metalloid expo-

sure, 50 �M As3+ evoked an elevation in the synthesis of GSH (154%)(Fig. 1B) and the response augmented to 188% at 24 h post-exposure(Fig. 2B). No significant response on GSH levels were observed whenthe cells were pretreated with ALA in relation to control cells (Figs.1B and 2B).

3.3. Effect of ALA and As3 on key antioxidant and stress enzymesgene expression

Transcriptional regulation of antioxidant and stress responsegenes represents a protective defense against a toxic insult tothe cell. In this study we evaluated several enzymes involvedwith the protection against oxidative stress toxicity such as theGSH-synthesizing subunits, GCLC and GCLM; the GSH-mediateddetoxifying enzyme, GSTA1; the destroying superoxide radical,superoxide dismutase, SOD1; the stress response enzymes, HMOX1and MT1A, and the apoptotic protein, CASP3. When we comparedthe effects on gene expression by the toxic As3+ and the antioxi-dant molecule ALA, a significant difference on induction on GCLM,HMOX1 and MT1A was observed (Fig. 3A). As3+ significantly upreg-ulated the expression of HMOX1 (28-fold, 35-fold) and increasedthe expression of GCLM (7-fold, 10-fold) and MT1A (4-fold, 9-fold)at 8 h (Fig. 3A) and 24 h post-exposure (Fig. 4A), respectively. Nosignificant regulation by As3+ was observed on the rest of the genesanalyzed. On the other hand, ALA showed a slight increase on GCLC(4-times) and GCLM (7-times) at 8 h after exposure (Fig. 3A) whichdeclined to control levels thereafter (Fig. 4A). ALA pretreatmentproduced a remarked prevention of the highly induced expressiongenerated by As3+ on HMOX1 and MT1A, decreasing respectively

Fig. 2. Effect of ALA pretreatment on As3+-exposed HepG2 cellular metabolic activity and glutathione content. HepG2 cells were pretreated for 8 h with 5 mM ALA and thenexposed to 50 �M As3+ for 24 h and (A) harvested for analysis of metabolic activity by the MTT-reduction assay or (B) harvested for analysis of glutathione content. Valuesrepresent mean ± SD of at least three separate experiments, each performed in duplicate or triplicate (GSH is represented in percentage). *P < 0.05 when compared to therespective group according to ANOVA analysis.

Author's personal copy

S.G. Huerta-Olvera et al. / Environmental Toxicology and Pharmacology 29 (2010) 144–149 147

Fig. 3. Effect of ALA and As3+ on antioxidant enzymes gene expression and nuclear Nrf2 content. HepG2 cells were exposed for 8 h to 50 �M As3+ or 5 mM ALA and (A)harvested for analysis of key antioxidant gene expression by RT-qPCR (dotted line = 1, expression of HPRT1 as the housekeeping control gene). Values represent mean ± SD ofat least three separate experiments, each performed in duplicate. *P < 0.05 when compared to the corresponding group. †P < 0.05 when compared to control group accordingto ANOVA analysis. (B) HepG2 cells were exposed to 50 �M As3+ or 5 mM ALA for 8 h and harvested for protein analysis of Nrf2 and �-actin as the internal control by Westernblotting. The experiment was carried out at least 3 times; each performed by duplicate and gave similar results. A representative result is shown.

Fig. 4. Effect of ALA pretreatment on As3+-driven gene expression and nuclear Nrf2 content. HepG2 cells were pretreated for 8 h with 5 mM ALA and then exposed to 50 �MAs3+ for 24 h and (A) harvested for analysis of key antioxidant gene expression by RT-qPCR (dotted line = 1, expression of HPRT1 as the housekeeping control gene). Valuesrepresent mean ± SD of at least three separate experiments, each performed in duplicate. *P < 0.05 when compared to the respective group. †P < 0.05 when compared to controlgroup according to ANOVA analysis. (B) HepG2 cells were pretreated for 8 h with 5 mM ALA and then exposed to 50 �M As3+ for 24 h and harvested for protein analysisof Nrf2 and �-actin as the internal control by Western blotting. The experiment was performed at least 3 times; each performed by duplicate and gave similar results. Arepresentative result is shown.

from 35-times to 5-times and from 9-times to same values as con-trol cells (Fig. 4A).

3.4. ALA and As3+ induction of Nrf2 nuclear activation

Analysis of the transcriptional factor Nrf2 was assessed byWestern blot assays of HepG2 cells nuclear fractions (Fig. 3B).In concordance with the literature, nuclear protein levels of Nrf2were strongly induced in the presence of ALA or As3+. A significantincrease in Nrf2 expression was observed at 8 h after treatmentwith 5 mM ALA or 50 �M As3+ compared with control cells (Fig. 3B),and the relation of the Nrf2 signal of ALA/control and As3+/controlcells decreased but remained significant thereafter (Fig. 4B). Simi-lar to HMOX1 results, pretreatment with 5 mM ALA before 50 �MAs3+ significantly prevented the increase in Nrf2 nuclear intensityshown by ALA or As3+ exposure alone.

4. Discussion

Degree of arsenic toxicity depends on dose and duration ofexposure. Arsenic toxicity is related to the inhibition of biologi-cal function of various proteins by reacting with their sulfhydrylgroups (particularly by As3+), by the substitution of As5+ for phos-phorus in many biochemical reactions or by the generation of freeradicals and subsequent damage to critical biomolecules (ATSDR,2007; Valko et al., 2006). After chronic exposure to sublethal As3+

concentrations there is a persistent cellular stress response thatultimately results in depletion of cell’s defense mechanisms andmanifestation of As3+ related diseases.

In the present study, we showed the subtoxic effects of 50 �MAs3+ on HepG2 cells as evidenced by disturbance on cellularmetabolic activity and the tendency to increase GSH levels. Thecellular protective response evoked by this metalloid involved theNrf2 pathway activation and the expression of antioxidant andstress response genes like GCLM, MT1A and HMOX1. Also, ourresults suggested that pretreatment with the antioxidant ALA pre-vents the As3+-induced Nrf2 activation and the strong expressionof stress genes.

We first investigated the effect of As3+ on cellular metabolicactivity by MTT assay. The selected dose of 50 �M As3+ had noapparent effect on HepG2 cell viability either at 8 h or 24 h post-exposure (Figs. 1A and 2A), which is in agreement with previousreports where a minimal toxicity was observed at the selected doseand a clear As3+ time–dose-dependent toxicity is demonstratedby the MTT metabolic assay (Chan et al., 2006; Lin et al., 2005b;Tchounwou et al., 2003). The effect of 50 �M As3+ on the vitalcellular antioxidant GSH of HepG2 cells was also studied in ourwork. The proved sublethal dose of As3+ evoked a cellular responseof protection by a tendency to increase GSH levels at 8 h and 24 h(Figs. 1B and 2B), an effect that has also been observed on severaltypes of cellular lines exposed to As3+ (Kito et al., 2002; Lee and Ho,1995; Ochi, 1997; Oketani et al., 2002; Schuliga et al., 2002). There-fore, we hypothesized that the observed increase of GSH after As3+

exposure is caused by an adaptive mechanisms due to a subtle aug-ment in oxidative stress toxicity. On the other hand, treatment ofHepG2 cells with the antioxidant ALA showed no signs of metabolicdisturbance (Figs. 1A and 2A) and no significant modification onGSH levels compared to control cells (Figs. 1B and 2B). Moreover,pretreatment with 5 mM ALA prevented the observed changes of

Author's personal copy

148 S.G. Huerta-Olvera et al. / Environmental Toxicology and Pharmacology 29 (2010) 144–149

As3+ on metabolic mitochondrial activity (Fig. 2A) and GSH levels (Fig. 2B).

ALA and its reduced form – dihydrolipoic acid (DHLA) – havethe capacity to scavenge ROS, regenerate physiological antioxi-dants, induce expression of antioxidant and detoxication genes(Bilska and Wlodek, 2005; Packer et al., 1995; Smith et al., 2004)and directly chelate arsenite (Spuches et al., 2005). Those are theproposed mechanisms to circumvent the toxicity of As3+ and main-tain a stable cellular metabolic activity at the concentration of As3+

tested.Expression of antioxidant and stress genes as a cellular response

to As3+ stimuli and their modulation by ALA pretreatment weremonitored in our study. Both time and dose are important fac-tors in determining not only which genes are regulated, but also towhat extent their expression is increased or decreased. We stud-ied by RT-qPCR effects of exposure to 50 �M As3+, 5 mM ALA andthe combination of both compounds on expression of antioxidant,stress response and apoptotic genes of HepG2 cells (Figs. 3A and4A) and the accompanying Nrf2 induction (Figs. 3B and 4B). Aselective and increased expression of HMOX1, GCLM and MT1Agenes was mounted after 8 h and 24 h post-exposure to 50 �MAs3+. No changes at either time were registered on expression ofGCLC, SOD1, GSTA1 and CASP3 genes. Furthermore, selectivity forinduction of the modifier subunit (GCLM) over the catalytic subunit(GCLC) of GCL (the rate-limiting enzyme in glutathione biosyn-thesis), suggests also the dependence for larger amounts of theregulatory GCLM subunit to increase GCL activity. In addition, noapoptotic caspase mRNA was induced, confirming the relative lowtoxicity of the selected As3+ concentration used in the study. Asobserved, the multicomponent cellular response evoked by As3+

does not require the expression of all ARE-driven genes but appar-ently only those needed to restore redox homeostasis and reduceoxidative damage. Differential expression of antioxidant and stressresponse genes by As3+ stimulation suggests the importance of acombination of different redox-sensitive upstream activators orthe signal transduction of pathways other than those mediatedby Nrf2 such as AP-1 or NF-�B. Treatment of HepG2 cells with5 mM ALA displayed a similar pattern of response as 50 �M As3+

at 8 h post-exposure on GSH-synthesizing and GSTA1, SOD1 andCASP3 genes; however, no significant induction on HMOX1 andMT1A genes was observed by the antioxidant (Fig. 3A). Particularly,increase on HMOX1 expression has been described as an impor-tant mechanism of protection by ALA exposure (Cheng et al., 2006;Fujita et al., 2008; Ogborne et al., 2005). In our study, we detecteda low increase on HMOX1 response by ALA (8 h, 2.2 times versuscontrol) that decreased afterwards to 1.3-times at the end of thestudy. This finding was consistent with several reports linking theHMOX1 cytoprotection with low (less than 5-fold) induction of theenzyme (Cheng et al., 2006; Suttner and Dennery, 1999; Yeh et al.,2008), while high levels of HMOX1 expression (greater than 15-fold) were associated with significant oxygen cytotoxicity (Suttnerand Dennery, 1999; Weng et al., 2000) such as that found in theAs3+ groups (Figs. 3A and 4A).

Potential biomarkers of sustained oxidative damage or antiox-idant status could be derived from HMOX1 and MT1A geneexpression based on the results obtained by differential geneexpression between As3+ and ALA. These facts agree with the pro-posed action of these genes as indicators of oxidative stress (Penget al., 2000; Xiao et al., 2003). Both molecular biomarkers appear tobe more sensitive on early cellular damage and could be used as acomplementary tool with general toxicity assays like MTT-viabilityor trypan-blue exclusion tests to address adequate oxidative stressand damage indicators (Blumberg, 2004). Assurance of the validityon the use of these markers could also be drawn from the results ofALA pretreatment shown in Fig. 4A. Pre-incubation of HepG2 cells

with ALA and the subsequent exposure to As3+, rendered obliter-ation of high As3+-induced gene expression of HMOX1 and MT1A,confirming the participation of ALA on As3+ toxicity by free radi-cal reduction, direct As3+ chelation, augmented excretion of As3+

into extracellular space and consequent unavailability of the met-alloid, or by interference on the redox signaling pathway requiredfor antioxidant gene expression (Biewenga et al., 1997; Bilska andWlodek, 2005).

Oxidants and antioxidants could share a mechanism of cellu-lar protection by induction of the antioxidant cellular responsethrough the pathway of activation Nrf2 transcription factor andsubtle differences on its regulation can be found at different levels(Dinkova-Kostova and Talalay, 2008; Xiao et al., 2003; Yeh et al.,2008). It has been observed that specific patterns of electrophilemodification of critical Keap1 cysteine residues could trigger aswitching from Cul3-dependent ubiquitination from Nrf2 to Keap1,leading to Nrf2 activation (Hong et al., 2005). ALA and sulforaphane,a naturally occurring isothiocyanate present in broccoli sprouts,stimulates p38 MAPK phosphorylation required for the Nrf2-Keaprelease and subsequent Nrf2 nuclear translocation (Ogborne et al.,2005; Yeh and Yen, 2005); meanwhile, As3+ induction of Nrf2 isindependent of the previously identified cysteine residue in Keap1that is required for Nrf2 activation by tert-butylhydroquinone orsulforaphane (Wang et al., 2008). Arsenic stimulates induction ofNrf2-responsive genes through ROS generation and MAPK signal-ing (Cooper et al., 2007; Pi et al., 2003), and through stabilization ofNrf2 protein (He et al., 2006). In this manuscript, both ALA and As3+

alone significantly activated the nuclear factor Nrf2 (Figs. 3B and4B); though, an antagonist effect was observed when both com-pounds were sequentially administered to HepG2 cells (Fig. 4B).It remains to be determined whether this effect could be derivedfrom the possible role of As3+ on a particular signaling mechanismrequired by ALA to achieve Nrf2 activation, or to an dose relatedNrf2-independent stimulus that could render a decrease in Nrf2decline (Suh et al., 2004; Yeh and Yen, 2005).

Interestingly, no correlation was obtained with the nuclear Nrf2signal and expression of Nrf2-ARE-driven genes under study (datanot shown). Further studies are needed to delineate the role ofthe relative proportion of other transcription factors associated orindependent to Nrf2 that could attach to multiple binding sites ofthe reported genes. As pointed out earlier, the activation of selec-tive signaling pathways and the extent and association of distinctredox-sensitive transcriptional factors like Nrf2 with coactiva-tors/repressors, signaling kinases, and transcription factors (e.g.,MafG, MafK, AP-1 or NF-�B) in the nucleus altogether with post-translational modifications, may play a fine tune on the final out-come of the antioxidant cellular response to oxidative stress agents.

In conclusion, pretreatment of HepG2 cells with the antiox-idant ALA avert the As3+-induced oxidative toxicity by the freeradical scavenging, metal chelating properties and Nrf2-activatingpathways of ALA. Thus, our investigation suggests that ALA supple-mentation may be a suitable remedy for prevention of As3+ toxicityand may potentially play an important role in the protection of pop-ulations chronically exposed to arsenic. Along with these lines ofreasoning, monitoring individual antioxidant status and genomicfactors like HMOX1 or MT1A expression could be used as sensitivebiomarkers of cellular oxidative stress.

Conflicts of interest

The authors declare that there are no conflicts of interest.

Acknowledgement

This work was supported by the Consejo Nacional de Ciencia yTecnología (CONACyT), México (Grant No. J062448). S.G.H.O. and

Author's personal copy

S.G. Huerta-Olvera et al. / Environmental Toxicology and Pharmacology 29 (2010) 144–149 149

J.M.B. were recipients of CONACyT scholarship fund 169506 and179334, respectively.

References

Alam, J., Cook, J.L., 2003. Transcriptional regulation of the heme oxygenase-1 genevia the stress response element pathway. Curr. Pharm. Des. 9, 2499–2511.

ATSDR, 2007. Toxicological Profile for Arsenic. US Department of Health and HumanServices, Atlanta.

Biewenga, G.P., Haenen, G.R., Bast, A., 1997. The pharmacology of the antioxidantlipoic acid. Gen. Pharmacol. 29, 315–331.

Bilska, A., Wlodek, L., 2005. Lipoic acid—the drug of the future? Pharmacol. Rep. 57,570–577.

Blumberg, J., 2004. Use of biomarkers of oxidative stress in research studies. J. Nutr.134, 3188S–3189S.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72, 248–254.

Buckley, B.J., Marshall, Z.M., Whorton, A.R., 2003. Nitric oxide stimulates Nrf2 nucleartranslocation in vascular endothelium. Biochem. Biophys. Res. Commun. 307,973–979.

Cooper, K.L., Liu, K.J., Hudson, L.G., 2007. Contributions of reactive oxygen speciesand mitogen-activated protein kinase signaling in arsenite-stimulated hemeoxygenase-1 production. Toxicol. Appl. Pharmacol. 218, 119–127.

Chan, J.Y., Siu, K.P., Fung, K.P., 2006. Effect of arsenic trioxide on multidrug resistanthepatocellular carcinoma cells. Cancer Lett. 236, 250–258.

Cheng, P.Y., Lee, Y.M., Shih, N.L., Chen, Y.C., Yen, M.H., 2006. Heme oxygenase-1contributes to the cytoprotection of alpha-lipoic acid via activation of p44/42mitogen-activated protein kinase in vascular smooth muscle cells. Free Radic.Biol. Med. 40, 1313–1322.

Dickinson, D.A., Moellering, D.R., Iles, K.E., Patel, R.P., Levonen, A.L., Wigley, A.,Darley-Usmar, V.M., Forman, H.J., 2003. Cytoprotection against oxidative stressand the regulation of glutathione synthesis. Biol. Chem. 384, 527–537.

Dinkova-Kostova, A.T., Talalay, P., 2008. Direct and indirect antioxidant properties ofinducers of cytoprotective proteins. Mol. Nutr. Food Res. 52 (Suppl 1), S128–138.

Flora, S.J., Flora, G., Saxena, G., Mishra, M., 2007. Arsenic and lead induced free radicalgeneration and their reversibility following chelation. Cell Mol. Biol. (Noisy-le-grand) 53, 26–47.

Fujita, H., Shiosaka, M., Ogino, T., Okimura, Y., Utsumi, T., Sato, E.F., Akagi,R., Inoue, M., Utsumi, K., Sasaki, J., 2008. Alpha-lipoic acid suppresses6-hydroxydopamine-induced ROS generation and apoptosis through the stim-ulation of glutathione synthesis but not by the expression of heme oxygenase-1.Brain Res. 1206, 1–12.

He, X., Chen, M.G., Lin, G.X., Ma, Q., 2006. Arsenic induces NAD(P)H-quinone oxi-doreductase I by disrupting the Nrf2 × Keap1 × Cul3 complex and recruitingNrf2 × Maf to the antioxidant response element enhancer. J. Biol. Chem. 281,23620–23631.

Hong, F., Sekhar, K.R., Freeman, M.L., Liebler, D.C., 2005. Specific patterns of elec-trophile adduction trigger Keap1 ubiquitination and Nrf2 activation. J. Biol.Chem. 280, 31768–31775.

Kito, M., Akao, Y., Ohishi, N., Yagi, K., Nozawa, Y., 2002. Arsenic trioxide-inducedapoptosis and its enhancement by buthionine sulfoximine in hepatocellularcarcinoma cell lines. Biochem. Biophys. Res. Commun. 291, 861–867.

Lee, T.C., Ho, I.C., 1995. Modulation of cellular antioxidant defense activities bysodium arsenite in human fibroblasts. Arch. Toxicol. 69, 498–504.

Li, J.H., Rossman, T.G., 1989. Inhibition of DNA ligase activity by arsenite: a possiblemechanism of its comutagenesis. Mol. Toxicol. 2, 1–9.

Lin, L., Stringfield, T.M., Shi, X., Chen, Y., 2005a. Arsenite induces a cell stress-response gene, RTP801, through reactive oxygen species and transcriptionfactors Elk-1 and CCAAT/enhancer-binding protein. Biochem. J. 392, 93–102.

Lin, L.M., Li, B.X., Xiao, J.B., Lin, D.H., Yang, B.F., 2005b. Synergistic effect of all-trans-retinoic acid and arsenic trioxide on growth inhibition and apoptosis in humanhepatoma, breast cancer, and lung cancer cells in vitro. World J. Gastroenterol.11, 5633–5637.

Morse, D., Choi, A.M., 2005. Heme oxygenase-1: from bench to bedside. Am. J. Respir.Crit. Care Med. 172, 660–670.

Muller, L., Menzel, H., 1990. Studies on the efficacy of lipoate and dihydrolipoate inthe alteration of cadmium2+ toxicity in isolated hepatocytes. Biochim. Biophys.Acta 1052, 386–391.

Ochi, T., 1997. Arsenic compound-induced increases in glutathione levels in culturedChinese hamster V79 cells and mechanisms associated with changes in gamma-glutamylcysteine synthetase activity, cystine uptake and utilization of cysteine.Arch. Toxicol. 71, 730–740.

Ogborne, R.M., Rushworth, S.A., O’Connell, M.A., 2005. Alpha-lipoic acid-inducedheme oxygenase-1 expression is mediated by nuclear factor erythroid 2-relatedfactor 2 and p38 mitogen-activated protein kinase in human monocytic cells.Arterioscler. Thromb. Vasc. Biol. 25, 2100–2105.

Oketani, M., Kohara, K., Tuvdendorj, D., Ishitsuka, K., Komorizono, Y., Ishibashi, K.,Arima, T., 2002. Inhibition by arsenic trioxide of human hepatoma cell growth.Cancer Lett. 183, 147–153.

Packer, L., Witt, E.H., Tritschler, H.J., 1995. Alpha-lipoic acid as a biological antioxi-dant. Free Radic. Biol. Med. 19, 227–250.

Peng, J., Jones, G.L., Watson, K., 2000. Stress proteins as biomarkers of oxida-tive stress: effects of antioxidant supplements. Free Radic. Biol. Med. 28,1598–1606.

Pi, J., Qu, W., Reece, J.M., Kumagai, Y., Waalkes, M.P., 2003. Transcription factorNrf2 activation by inorganic arsenic in cultured keratinocytes: involvement ofhydrogen peroxide. Exp. Cell Res. 290, 234–245.

Repetto, G., Sanz, P., Repetto, M., 1994. Comparative in vitro effects of sodium arsen-ite and sodium arsenate on neuroblastoma cells. Toxicology 92, 143–153.

Schuliga, M., Chouchane, S., Snow, E.T., 2002. Upregulation of glutathione-relatedgenes and enzyme activities in cultured human cells by sublethal concentrationsof inorganic arsenic. Toxicol. Sci. 70, 183–192.

Shibahara, S., 1988. Regulation of heme oxygenase gene expression. Semin. Hematol.25, 370–376.

Smith, A.R., Shenvi, S.V., Widlansky, M., Suh, J.H., Hagen, T.M., 2004. Lipoic acid asa potential therapy for chronic diseases associated with oxidative stress. Curr.Med. Chem. 11, 1135–1146.

Spuches, A.M., Kruszyna, H.G., Rich, A.M., Wilcox, D.E., 2005. Thermodynamicsof the As(III)-thiol interaction: arsenite and monomethylarsenite complexeswith glutathione, dihydrolipoic acid, and other thiol ligands. Inorg. Chem. 44,2964–2972.

Suh, J.H., Shenvi, S.V., Dixon, B.M., Liu, H., Jaiswal, A.K., Liu, R.M., Hagen, T.M., 2004.Decline in transcriptional activity of Nrf2 causes age-related loss of glutathionesynthesis, which is reversible with lipoic acid. Proc. Natl. Acad. Sci. U.S.A. 101,3381–3386.

Suttner, D.M., Dennery, P.A., 1999. Reversal of HO-1 related cytoprotection withincreased expression is due to reactive iron. FASEB J. 13, 1800–1809.

Tada, H., Shiho, O., Kuroshima, K., Koyama, M., Tsukamoto, K., 1986. An improvedcolorimetric assay for interleukin 2. J. Immunol. Methods 93, 157–165.

Tchounwou, P.B., Yedjou, C.G., Dorsey, W.C., 2003. Arsenic trioxide-induced tran-scriptional activation of stress genes and expression of related proteins in humanliver carcinoma cells (HepG2). Cell Mol. Biol. (Noisy-le-grand) 49, 1071–1079.

Tietze, F., 1969. Enzymic method for quantitative determination of nanogramamounts of total and oxidized glutathione: applications to mammalian bloodand other tissues. Anal. Biochem. 27, 502–522.

Valko, M., Rhodes, C.J., Moncol, J., Izakovic, M., Mazur, M., 2006. Free radicals, metalsand antioxidants in oxidative stress-induced cancer. Chem. Biol. Interact. 160,1–40.

Wang, X.J., Sun, Z., Chen, W., Li, Y., Villeneuve, N.F., Zhang, D.D., 2008. Activation ofNrf2 by arsenite and monomethylarsonous acid is independent of Keap1–C151:enhanced Keap1–Cul3 interaction. Toxicol. Appl. Pharmacol. 230, 383–389.

Weng, Y.H., Tatarov, A., Bartos, B.P., Contag, C.H., Dennery, P.A., 2000. HO-1 expres-sion in type II pneumocytes after transpulmonary gene delivery. Am. J. Physiol.Lung Cell. Mol. Physiol. 278, L1273–1279.

Xiao, G.G., Wang, M., Li, N., Loo, J.A., Nel, A.E., 2003. Use of proteomics to demonstratea hierarchical oxidative stress response to diesel exhaust particle chemicals ina macrophage cell line. J. Biol. Chem. 278, 50781–50790.

Yeh, C.T., Ching, L.C., Yen, G.C., 2008. Inducing gene expression of cardiac antioxidantenzymes by dietary phenolic acids in rats. J. Nutr. Biochem..

Yeh, C.T., Yen, G.C., 2005. Effect of sulforaphane on metallothionein expression andinduction of apoptosis in human hepatoma HepG2 cells. Carcinogenesis 26,2138–2148.