at SciVerse ScienceDirect

Biomaterials 34 (2013) 3053e3063

Contents lists available

Biomaterials

journal homepage: www.elsevier .com/locate/biomater ia ls

A small molecule approach to engineering vascularized tissue

Joyce Doorn a,1, Hugo A.M. Fernandes a,1, Bach Q. Le a, Jeroen van de Peppel b,Johannes P.T.M. van Leeuwen b, Margreet R. De Vries a,b,c,d, Zeen Aref c, Paul H.A. Quax c,Ola Myklebost d, Daniel B.F. Saris a, Clemens A. van Blitterswijk a, Jan de Boer a,*aMIRA Institute for Biomedical Technology and Technical Medicine, Department of Tissue Regeneration, University of Twente, Drienerlolaan 5, 7522 NB Enschede, The Netherlandsb Erasmus MC, Department of Internal Medicine, Dr. Molenwaterplein 50, 3015 GE Rotterdam, The Netherlandsc Einthoven Laboratory for Experimental Vascular Medicine, Department of Surgery, Leiden University Medical Centre, PO Box 9600, 2300 RC Leiden, The NetherlandsdOslo University Hospital, Department of Tumor Biology, The Norwegian Radium Hospital, Montebello, 0310 Oslo, Norway

a r t i c l e i n f o

Article history:Received 26 October 2012Accepted 30 December 2012Available online 29 January 2013

Keywords:AngiogenesisMesenchymal stem cellsStem cellCell signaling

* Corresponding author. Fax: þ31 534 892 150.E-mail address: j.deboer@utwente.nl (J. de Boer).

1 These authors contributed equally.

0142-9612/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.biomaterials.2012.12.037

a b s t r a c t

The repertoire of growth factors determines the biological engagement of human mesenchymal stromalcells (hMSCs) in processes such as immunomodulation and tissue repair. Hypoxia is a strong modulatorof the secretome and well known stimuli to increase the secretion of pro-angiogenic molecules. In thismanuscript, we employed a high throughput screening assay on an hMSCs cell line in order to identifysmall molecules that mimic hypoxia. Importantly, we show that the effect of these small molecules wascell type/species dependent, but we identified phenanthroline as a robust hit in several cell types. Weshow that phenanthroline induces high expression of hypoxia-target genes in hMSCs when comparedwith desferoxamine (DFO) (a known hypoxia mimic) and hypoxia incubator (2% O2). Interestingly,our microarray and proteomics analysis show that only phenanthroline induced high expressionand secretion of another angiogenic cytokine, interleukin-8, suggesting that the mechanism ofphenanthroline-induced hypoxia is distinct from DFO and hypoxia and involves the activation of othersignaling pathways. We showed that phenanthroline alone was sufficient to induce blood vessel for-mation in a Matrigel plug assay in vivo paving the way to its application in ischeamic-related diseases.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Human mesenchymal stromal cells (hMSCs) secrete a broadpanel of factors that have trophic effects (e.g., anti-apoptotic, pro-angiogenic and anti-scarring) and immunomodulatory effects [1].Several clinical trials have been completed or are currently on theway investigating the use of hMSCs for the treatment of, amongstothers, autoimmune diseases [2e5], myocardial infarcts [reviewedin Ref. [6]], solid organ/graft transplantations [7,8] and ischemicwounds [9]. Debate exists on the mechanisms underlying the ef-fects of infused MSCs. Although differentiation of MSCs into cells ofthe target tissue has been shown [10e12], low engraftment per-centages, the short window in which effects are observed and thefact that conditioned medium alone also has effects, support a tro-phic effect [13e16].

Several studies have demonstrated that culture of hMSCs underhypoxic conditions, which closely resemble oxygen concentrations

All rights reserved.

in natural bone marrow (1e7%) [17], results in enhanced secretionof pro-angiogenic trophic factors e of which most importantlyvascular endothelial growth factor (VEGF) e but also improvessurvival, engraftment and differentiation of implanted cells [18e22]. Cellular responses to hypoxia are mainly regulated byhypoxia-inducible factors (HIFs)-heterodimers consisting of ana and b subunit [23,24]. The HIF-1a isoform is ubiquitouslyexpressed in all cell types and, upon hydroxylation by prolyl hy-droxylase domain proteins (PHDs), it is rapidly degraded by theproteasome [25]. PHD’s inactivation leads to accumulation andstabilization of HIF-1a and subsequent translocation into the nu-cleus where it binds to hypoxia responsive elements (HREs) andinitiates transcriptional activation of HIF-target genes [23,24].Subsets of genes containing an HRE have been identified, includingangiogenic, endothelial and metabolism-related genes.

Culture under hypoxia is expensive and, most importantly,restricted to an in vitro scenario. Alternatively, small moleculescan be used that, similarly to hypoxia, activate HIF-1-target genesbut are cheap and easy to use. In addition, controlled release ofthese molecules in an in vivo set-up is possible in a spatially andtemporally controlled manner. Spatial control using antibodies

J. Doorn et al. / Biomaterials 34 (2013) 3053e30633054

specific for certain tissues or cell types coupled to liposomes waspioneered in the early 80’s and has been broadly used ever since[26e28]. More recently, using phage display libraries, it waspossible to identify small peptides possessing high-affinity forcertain proteins and therefore use these instead of proteins [29].Temporal control of drug release can be achieved using controlledhydrolysis of polymers, changes in polymer matrices leadingto differences in diffusion rate, changes in cellular environmentsuch as pH, temperature or enzymatic activity or even via externalstimuli such as an electric field or ultrasounds and containingencapsulated drugs and therefore, tuning the release profile[29e35].

In the past, our lab has shown that by using a small moleculewe can modulate the composition of trophic factors secreted byhMSCs and control their differentiation into the osteogenic lineage[36]. Nevertheless, the effects observed with hMSCs could not beextrapolated to different cell types or species, clearly demon-strating that the biological function attributed to some moleculesin one species or cell type differ depending on the cellular context.For example, we have shown that the same molecule that inducedosteogenesis in hMSCs (dibutyryl-cAMP) led to a distinct pheno-type in MSCs from another species, i.e. adipogenesis in rat MSCs[37]. Based on this observation and on the fact that previousscreens for activators of the HIF pathway have been performedmostly with cancer cells lines [21,38,39], we decided to developa new screening strategy based on a more clinically relevant celltype. We generated a cell line using human immortalized MSCscontaining an HRE-GFP reporter (HRE-GFP iMSCs) and used high-throughput screening (HTS) to identify compounds that activatethe HIF-1 pathway.

Table 1Primer sequences.

Gene Forward primer Reverse primer

18S CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCTVEGF-A Commercially obtained from SA biosciences

2. Materials and methods

2.1. Ethics statement

All animal experiments were performed in compliance with Dutch governmentguidelines and approved by the Institutional Committee for Animal Welfare of theLeiden University Medical Center (LUMC).

2.1.1. Cell cultureBone marrow aspirates (5e15 mL) were obtained from patients with written

informed consent and isolated as previously described [40]. Human mesenchymalstromal cells (hMSCs) were expanded in proliferation medium consisting of alphaminimal essential medium (a-MEM; Gibco, Carlsbad, CA), 10% fetal bovine serum(Lonza, Verviers, Belgium), 0.2 mM ascorbic acid (Sigma Aldrich, St. Louis, MO), 2 mM

L-Glutamine (Gibco), 100 U/mL of penicillin and 100 mg/mL of streptomycin (Invi-trogen, Carlsbad, CA) and 1 ng/mL of basic fibroblast growth factor (bFGF, Instru-chemie, Delfzijl, The Netherlands). Basic medium consisting of proliferation mediumwithout bFGF was used during the experiments. Human umbilical vein endothelialcells (HUVECs) were commercially obtained from Lonza and cultured in EndothelialGrowth Medium-2 (EGM-2) with addition of the microvascular bullet kit (MV, allfrom Clonetics, Lonza), containing hEGF, hydrocortisone, gentamicin, 5% FBS, VEGF,hFGF-B, R3-IGF-1 and ascorbic acid. Cells were kept at 37 �C and 5% CO2. Mediumwas refreshed three times per week and cells were trypsinised when a confluency of70e80% was reached. MG-63 cells were cultured in basic medium and ACL cellswere cultured in DMEMHigh Glucose (PAA) containing 10% FBS and 0.2 mM ascorbicacid.

2.1.2. LOPAC screenTo perform the screen, 4000 HRE-GFP iMSCs (see Supplementary information

on preparation of the cell line) were seeded in black 96-well plates (BD Bio-sciences) and allowed to attach overnight. The next day, the LOPAC� library, a libraryconsisting of 1280 pharmacologically active compounds, was added. As negative andpositive controls, basic medium and 100 mM desferoxamine (DFO, Sigma Aldrich) inbasic medium were added respectively. After one day of incubation with the testcompounds, an Alamar Blue assay was performed to assess cell numbers/metabolicactivity [41] and GFP intensity was measured as readout for the HRE activity. Briefly,medium containing 10% (v/v) Alamar Blue solution (Biosource, Camarillo, CA) wasadded and incubated at 37 �C for 4 h. Then, fluorescencewasmeasured at 590 nm ona Victor plate reader (Perkin Elmer,Wellesley, MA). Upon removal of the Alamar Bluesolution, cells were washed with phosphate buffered saline (PBS; Life Technologies)and GFP intensity was measured at 520 nm on a Victor plate reader.

2.1.3. Hit validationObtained hits were further tested. Briefly, four different concentrations of each

hit were tested for their capacity to induce HRE activity. In addition, twelve com-pounds previously identified in an HRE screen using a cancer cell line [38] weretested along with our hits. These experiments were performed as described abovefor the primary screen.

Based on the HRE-GFP activity (high signal and low cytotoxicity) we selecteda concentration for subsequent experiments with primary human mesenchymalstromal cells (hMSCs).

2.1.4. Gene expression analysishMSCs (or when mentioned MG-63 and ACL cells) were seeded in triplicate in

6-well plates at 5000 cells/cm2 and allowed to attach for 10e15 h in basic me-dium. Upon reaching near confluency, cells were treated as described above. After2 days of treatment and 2 subsequent days of incubation with fresh medium, cellswere lysed immediately with TRIzol. RNA was isolated using a Bioke RNA IInucleospin RNA isolation kit (Machery Nagel) and RNA concentrations weremeasured using an ND100 spectrophotometer (Nanodrop technologies, USA).cDNA was synthesized from 100 ng of RNA, using iScript (BioRad) according to themanufacturer’s protocol. For qualitative PCR, a master mix, containing distilledwater, forward primer, reverse primer (Sigma Genosys), BSA, and SYBR green I mix(all from Invitrogen) was prepared. Real-time qPCR was performed in a Light-Cycler (Roche). Light-Cycler data was analyzed using the fit points method ofLight-Cycler software. The baseline was set at the lower log-linear part abovebaseline noise and the crossing temperature (Ct value) was determined. Ct valueswere normalized to the 18S housekeeping gene and DCt (Ct, control � Ct, sample) wasused to calculate the upregulation in gene expression [42]. Primer sequences arelisted in Table 1.

2.1.5. Protein expression analysishMSCs were seeded at 5000 cells/cm2 in T25 flasks. Upon reaching near-

confluence, medium was changed for basic medium, basic medium with 150 mM

DFO or 200 mM Phenanthroline (Phen, Sigma Aldrich) or cells were added to a hyp-oxia chamber (2% O2). After 2 days, cells were lysed with 250 mL RIPA buffer withaddition of protease/phosphatase inhibitors (Roche). Total protein concentrationswere determined using a BCA kit (Pierce) and 10 mg of total protein was used todetermine concentrations of VEGF, IL-8, basic fibroblast growth factor (bFGF),growth-colony stimulating factor (G-CSF) and epidermal growth factor (EGF) usinga Luminex assay (Invitrogen) according to the manufacturer’s protocol. Briefly, cellsand standards were incubated with fluorescent beads, followed by incubation witha biotinylated detection antibody. After incubation with streptavidin-R-Phycoery-thrin and washing, both the fluorescence of the coupled beads and the R-phycoer-ythrin were measured using a Luminex� FlexMapTM (Luminex).

2.1.6. Whole genome expression analysishMSCs were seeded in T25 flasks at 5000 cells/cm2 and allowed to attach

overnight in proliferation medium. The next day, medium was added with the fol-lowing conditions; basic medium, basic medium supplemented with 150 mM DFO orbasic medium supplemented with 200 mM Phen. After 48 h, RNA was isolated asdescribed above. From 500 ng of RNA, cRNA was synthesized using the IlluminaTotalPrep RNA amplification Kit (Ambion), according to the manufacturer’s protocoland the quality of RNA and cRNA was verified on a Bioanalyzer 2100 (Agilent).Microarrays were performed using Illumina HT-12 v4 expression Beadchips, ac-cording to the manufacturer’s protocol.

2.1.7. ProliferationhMSCs and HUVECs were seeded in triplicate in 6-well plates at 3000 cells/cm2

and allowed to attach overnight in culture medium as described above (see cellculture). Then, cells were washed and conditioned medium (CM, seeSupplementary information for details on preparation) was added. After 3 days,proliferation of hMSCs was determined by measuring the metabolic activity usinga 10% (v/v) Alamar Blue (Invitrogen) and for HUVECs, nuclei were stained with DAPI(Sigma Aldrich) and counted.

2.1.8. Scratch wound healing assayHUVECs were seeded in triplicate in 6-well plates at 10,000 cells/cm2 and

allowed to attach for 10e15 h in culture medium as described above (see cellculture). When the cells reached near confluency, a wound was created byscratching the surface with a pipette tip, and the medium was changed to differenttypes of conditioned medium. After 12 and 20 h pictures were taken to examinemigration of cells into the wound.

J. Doorn et al. / Biomaterials 34 (2013) 3053e3063 3055

2.1.9. In vivo murine matrigel plug assayIn vivo angiogenesis analysis was performed using a Matrigel plug assay in male

C57/BL6mice (age 8weeks) (Charles River). Growth factor reducedMatrigel (0.5mL)(BD Biosciences) was injected into the subcutaneous space on the dorsal side of miceon both the left and right flank. Matrigel was mixed at 4 �C with PBS, DFO (150 mM)or Phen (200 mM) (n ¼ 7 mice per group). Mice were sacrificed 7 days post-implantation. Matrigel plugs were excised and processed for histological analysis.Paraffin sections (5 mM) were stained with Hematoxylin, Phloxine and Saffron (HPS)or anti-CD31 (PECAM, Abcam, Cambridge, UK). Vascular ingrowth was scored bymeasuring the maximum ingrowth depth of capillary structures in 6 HPS stainedsections per plug (one plug per mouse, 7 mice per group, expressed in mm). Quan-tification was performed in a double-blinded fashion by two individuals usingmorphometric image analysis methods (Qwin, Leica Imaging Systems). The endo-thelial nature of the infiltrating capillary structures was confirmed by the CD31staining.

2.1.10. StatisticsData was analyzed using one-way ANOVA followed by Tukey’s multiple com-

parison’s test (P < 0.05). For the analysis of the ingrowth in the Matrigel plug sta-tistical analysis was performed using ANOVA and unpaired t test.

3. Results

3.1. HRE activity in immortalized human mesenchymal stromalcells

The first step to identify compounds capable of inducing HREactivity was to generate a reporter cell line inwhich the GFP gene isdriven by a HRE element (reporter construct pCDNA3/HRE-GFP)(Fig. 1A). The uniqueness of our assay lies in the cellular back-ground; humanMSCs, a clinically relevant cell type for regenerativemedicine as well as for cancer-related diseases [43]. Upon trans-fection of immortalized hMSCs and selectionwith G418we selected21 clones for further analysis. Using a known hypoxia mimic e DFOe we selected the clone with the highest HRE-GFP activity after24 h exposure (Supplementary Fig. 1). To further confirm the abilityof the selected clone to respond to hypoxia, we reduced the con-centration of oxygen (O2) by increasing the number of cells per welland analyzed HRE-GFP activity [44]. As expected, this increase incell density led to a dose-dependent increase in HRE-GFP activity(Fig. 1B).

3.1.1. Testing of known HRE activatorsTo the best of our knowledge, this is the first HRE assay per-

formed in hMSCs and as such, we decided to test compoundspreviously described as HRE activators in a cancer cell line (ME-180cells from human cervical cancer cells) [38] in our model. Twelvecompounds were tested at four different concentrations (1 nM,10 nM, 1 mM and 100 mM), with DFO as a positive control, and HREactivity was measured after 24 h. Our results showed that exposureof HRE-GFP iMSCs to 100 mM DFO results in a 2.8-fold increase in

5xHRE VEGF GFPE1b

min-P

A B

Fig. 1. Generation of the HRE-reporter cell line. A, schematic representation of the reportdifferent cell concentrations. Legend: 5 � HRE ¼ 5 copies of the 35 bp fragment derived froP ¼ 32 bp of the adenovirus E1b minimal promoter.

HRE activity and a 38% reduction in metabolic activity relative tocontrol (Fig. 2A). For the twelve compounds tested, concentrationsthat reduced metabolic activity more than 50% compared to 100 mMDFO were excluded (Fig. 2B). To our surprise, of these twelvecompounds only 1,10-phenanthroline was able to induce HRE-GFPactivity to the same level as 100 mM DFO (Fig. 2A). These resultsclearly highlight the importance of the cellular background on theregulation of HIF signaling.

3.1.2. Screening for new HRE activators: the LOPAC libraryIn order to find new small molecules capable of activating the

HRE we screened a library of pharmacological active compounds(LOPAC) using our HRE-GFP iMSCs cell line. Again, the well-knownhypoxia mimic DFO was used as a positive control. Our resultsshowed that DFO significantly decreased cell viability after 24 hexposure (24% reduction in viability: Bas ¼ 100 � 5 vs. DFO ¼ 76� 3%; Supplementary Fig. 2A). In addition, HRE activity was sig-nificantly increased relative to the control when DFO was added(2.5-fold increase in HRE activity: Bas ¼ 100 � 11 vs. DFO ¼ 249� 33%; Supplementary Fig. 2B). Given the fact that only one con-centration per molecule was tested e thus reducing our chances tofind hits, we decided to use a relaxed criteria to define a hit e anymolecule that did not inhibit cell viability more than 24% (DFOreference value) and that showed an increase in HRE activity higherthan 1.5-fold relative to the control. Based on these criteria weidentified three hits: 1,10-phenanthroline monohydrate (Phen),quinacrine dihydrochloride (both in plate 13) and rottlerin (plate14) (Fig. 3A). Interestingly, one of the hits (1,10-phenanthrolinemonohydrate) is the same as the compound previously identifiedas an HRE activator in the cancer cell line (1,10-phenanthroline).

Selected hits were further tested using the same concentrationrange described above. As in the screening assay, 100 mM DFO wasused as a positive control and, metabolic activity was again partiallyinhibited compared with the control (Supplementary Fig. 3A). Ofthe four different concentrations tested per compound, the onesthat reduced metabolic activity more than 50% compared to 100 mMDFO were excluded from further analysis (Supplementary Fig. 3A).Moreover, only 1 mM quinacrine dihydrochloride and 100 mM Phenwere able to induce HRE activity to a similar level as 100 mM DFO(Fig. 3B), but since quinacrine dihydrochloride did not affect VEGFgene expression, this compound was excluded from further anal-ysis (Supplementary Fig. 3B).

3.2. Expression and secretion of angiogenic growth factors

To analyze if different mechanisms are involved in DFO andPhen-induced hypoxia we performed a whole genome expression

43.5

2.5

1.5

GFP

/Ala

mar

0.51

0

5E3 c

ells

10E3 c

ells

40E3 c

ells

80E3 c

ells

100E

3 cells

2

3

er construct used (modified from Ref. [66]). B, GFP/Alamar represents HRE activity atm the VEGF HRE; VEGF ¼ 385 bp of the 50 flanking region of the VEGF gene; E1b min-

1.5

1.0

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

0.5

0.0

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 nM

10 nM 1 uM

Basic

100 u

M DFO 1 nM

10 nM

100 u

M

1 uM

Basic

100 u

M DFO 1 nM

10 nM

100 u

M

1 uM

Basic

100 u

M DFO 1 nM

10 nM

100 u

M

1 uM

Basic

100 u

M DFO 1 nM

10 nM 1 uM

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 nM

10 nM 1 u

M10

0 uM

Basic

100 u

M DFO 1 n

M10

nM 1 uM

1.5

1.0

0.5

0.0

2.0

1.5

1.0

0.5

0.0

2.0

1.5

1.0

0.5

0.0

2.0

1.5

1.0

0.5

0.0

2.0

1.5

1.0

0.5

0.0

Sulfasalazine Prednisone Triamterene 1,10-Phenanthroline 7,12-Dimethylbenz[a] anthracene

Benzo[k]flouranthene

2.0

1.0

0.5

0.0

1.5

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

GFP

/Ala

mar

2.0

1.0

0.5

0.0

1.5

2.0

1.0

0.5

0.0

1.5

2.0

1.0

0.5

0.0

1.5

GFP

/Ala

mar

2.0

1.0

0.5

0.0

1.5

Benzo[b]fluoranthene 5-Chloro-7-iodo-8-quinolinol

Cobalt(II) sulfateheptahydrate

7-Diethylamino-4- methylcoumarin

Dibenz[a,h]anthracence 2-Aminoanthracene

1.751.501.35

0.750.500.35

1.00

0.00

300000

200000

100000

Alam

ar B

lue

(A.U

.)

300000

200000

100000

0

300000

200000

100000

0

300000

200000

100000

0

250000

200000

150000

100000

50000

0

250000

200000

150000

100000

50000

0

250000

200000

150000

100000

50000

0

250000

200000

150000

100000

50000

0

250000

200000

150000

100000

50000

0

250000

200000

150000

100000

50000

00

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

300000

200000

100000

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

Alam

ar B

lue

(A.U

.)

sulfasalazine prednisone Triamterene 1,10-Phonanthroline 7,12-Dimethylbenz[a] anthracene

Benzo[k]fluoranthene

0

300000

200000

100000

0

Benzo[b]fluoranthene 5-Chloro-7-lcde -8-quinolinol

2-AminoanthraceneDibenz[a,h]anthracene7-Diethylamino-4- methylcoumarin

Cobalt[II] sulfate hepeahydrate

*

A

B

Fig. 2. Hypoxia mimics identified using a cancer cell line. A, twelve previously identified hypoxia mimics tested on our human HRE-GFP reporter cell line. Note that only one compound induces HRE activity. B, The capacity of the hypoxiamimics identified in a cancer cell line to activate the HIF pathway in hMSCs was tested at different concentrations. An arrow indicates a decrease in metabolic activity of more than 50% compared with DFO. An asterisk (*) denotes nostatistical significant difference (One-way Anova and Tukey’s test, P < 0.05).

J.Doorn

etal./

Biomaterials

34(2013)

3053e3063

3056

Fig. 3. HTS assay on human HRE-GFP reporter cell line. A, HRE-GFP cells were seeded in sixteen 96-well plates (4000 cells/well) in basic medium. One day later the LOPAC librarywas added to the wells and two days later we measured GFP and Alamar Blue as readout for HRE activity and metabolic activity, respectively. Here are represented the wells withhits (top: GFP/Alamar and bottom Alamar Blue alone); Note: The same setup used in the top left plate for the controls was used in all cases. B, effect of different concentrations of thethree identified hits in HRE activity. An asterisk (*) denotes no statistical significant difference (One-way Anova and Tukey’s test, P < 0.05).

J. Doorn et al. / Biomaterials 34 (2013) 3053e3063 3057

analysis of primary hMSCs treated for two days with both com-pounds and compared this with cells grown under hypoxic condi-tions (2% O2) and normoxia. Heatmaps in Fig. 4 show the expressionlevels of previously identified HRE-containing genes [45], groupedby function. Both DFO and Phen increased expression of genesinvolved in metabolism, cell growth and survival as well as endo-thelial genes, but Phen markedly induced higher expression ascompared with DFO. Gene Ontology (GO) analysis showed anenrichment of terms associated with cell death regardless of thetreatment used, whereas terms associated with cell cycle, regu-lation of cell migration, blood vessel development and regulation ofmuscle contraction were mainly enriched when hMSCs wheretreated with Phen and DFO (Supplementary Fig. 4B). Interestingly,using our experimental setup, hMSCs exposure to 2% O2 does notseem to be sufficient to induce a characteristic hypoxia response.For example, considering a 1.5 < log2FC < �1.5 and an adjusted Pvalue <0.05 we found, compared with control, 11 genes regulatedby hypoxia (in contrast with 455 in DFO and 892 in Phen) for onedonor, whereas for the other donor we found 9 genes regulated byhypoxia (in contrast with 369 in DFO and 911 in Phen) (see dataset1). Remarkably, interleukin-8 (IL-8) was highly induced by Phen(top gene), whereas DFO and hypoxia did not affect its expression.

We then examined if two of the highly regulated genes (IL-8 andVEGF) were also highly expressed at a protein level when comparedwith the control. As shown in Fig. 5A, Phen indeed increased thesecretion of IL-8 to 300e500 pg/mL, whereas in DFO and hypoxia-treated cells IL-8 levels were comparable to control (15e25 pg/mL).In contrast, although VEGF secretion was induced by all threetreatments, it was higher in DFO-treated cells (140 pg/mL) than inPhen-treated cells (65 pg/mL), even though microarray datashowed higher expression of VEGF after treatment with Phen.Secretion of growth-colony stimulating factor (G-CSF) and basicfibroblast growth factor (bFGF) was lower in the Phen-treatmentgroup compared to DFO and hypoxia. To investigate the presenceof trophic factors, conditioned medium (CM) was preparedfrom DFO-, Phen- or hypoxia-treated hMSCs, and used to cultureHUVECs and MSCs. After 2 days of treatment and 2 more days ofincubation with fresh medium, VEGF was still highly expressedin Phen-treated cells, whereas expression levels in DFO- orhypoxia-treated cells were comparable to non-treated cells(Fig. 5B). In MSCs, Phen-CM was the only medium to significantlyincrease proliferation compared to non-CM whereas in HUVECSboth DFO-, Phen- and hypoxia-treated cells increased proliferation(Supplementary Fig. 9A and B). To investigate the effect of trophic

Cell growth and Apoptosis Cell metabolism

DDIT4BNIP3RORAMCL1IGFBP1 BCL12 BCL2L11

BCL2L13

BCL2L12BCL2L12

MCL1RORAIGFBP1Bcl2

BclxBclx

Bcl2

BADBADCTGFCTGFENG

CXCL12PAWR

NPM3BIRC5CXCL12CXCL12

NOXA1

NDUFA4L2PFKFB3PFKFB3PFKFB4PFKFB4AK3L1PGK1PGK1ALDOC

ALDOAASNSGAPDHGPX3LDHAENO1LDHALDHAPFKLADPGKENOSFENOPH1DERAPFKMALDH1B1

PSAT1GBE1PPP1R3PFKP

ANGPTL4

ANGPTL4PGFNGFARNTLEIF1FOXD1

FOXO4FOXO3

FOXO1HIF1aNARNTANGPTL5

ANGPT1ANGPT1

ANGPTL2

HIF1aHIF1aHIF1a

ARNT2

Foxc2

EIF5EIF4E3

ANG

II-8VEGFA

TP53BP2TP53INP1TP53INP1GPERHSP90AA1GPERGSK3 BASPHD2SUMO1P3MDM2TP53INP2GPERESRRASUMO1HSP90AA1

HSP90AA1

HSP90AB1

HSP90B1

TP53BP2

TP53I3

TP53I13

TP53BP1ARD1A

TP53I11

TP53

TP53I3

ASPHD1

TP53BP2

SIAH2

SIAH1SIAH1SIAH1

OS9ING4VHL

VEGFAVEGFAHMOX1ADMTFRCLE PLE PVEGFB

VEGFBLTFEDN1ADRBK1

FECH

HEBP2HEBP1

VEGFC

ETS1ETS1ID2ID2

ID2MMP1FURINGrp94

CITED2

3

0

-3

HDAC3

HDAC7AHDAC7HBXIPCEBPaHDAC7HDAC1HDAC2ARNT

SMAD3CITED4MYC

MYCSTAT3

ETS1

Others

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Phen

DFO

hypo

xia

Endothelial genes Protein modification Oxygen supply Transcriptional cofactors

Hif 1a Stability/Activation

Fig. 4. Phenanthroline induces strong expression of HRE-containing genes, compared to DFO and hypoxia culture. Primary hMSCs were cultured in the presence of 150 mM DFO, 200 mM Phen or in an hypoxia chamber (2% O2). After 2 days,whole genome expression analysis was performed and the expression of known HRE-containing genes was examined. Of the three culture methods, most genes were strongest induced using Phen. Heatmaps show the relative expressionof denoted genes compared to cells in basic medium, with all genes statistically significant regulated compared to cells in basic medium (P < 0.05).

J.Doorn

etal./

Biomaterials

34(2013)

3053e3063

3058

Fig. 5. Phenanthroline induces secretion of IL-8, but DFO induces higher secretion of VEGF. A, hMSCs were cultured in the presence of 150 mM DFO, 200 mM Phen or in hypoxia(2% O2) for 2 days, after which cells were lysed. Protein concentrations of IL-8, VEGF, bFGF and G-CSF were determined in cell lysates and as shown, only Phen induced secretion ofhigh levels of Il-8, which were not affected by DFO or hypoxia. In contrast, VEGF secretion was increased by all three culture methods, but highest by DFO. B, hMSCs were cultured inthe presence of DFO, Phen or in a hypoxia chamber for 2 days. After refreshing the medium and 2 more days of culture in basic medium, expression of VEGF was examined. Onlyafter treatment with Phen expression of these genes was still enhanced, whereas in DFO and hypoxia cultures expression levels had returned to basal levels. C, CM was prepared byculturing cells in the presence of 150 mM DFO, 200 mM Phen or in a hypoxia chamber (2% O2), after which the mediumwas changed and cells were kept in culture for 2 more days. Asa control non-treated cells were incubated with medium. CM was then used to culture HUVECs for a scratch wound healing assay. Migration of cells was increased in CM, but nodifferences between the treatments was observed although the remaining open area was smaller after culture of the cells in Phen-CM, suggesting a higher migration rate of the cellsin this type of medium. D, response of different cell types to Phen. Note that regardless of the cell type used, Phen induces high expression of VEGF compared to the control. D231and D142; donor number as specified in the laboratory database, (*) denotes P < 0.05, (**) denotes P < 0.01, (##) denotes P < 0.01 compared to basic, DFO and hypoxia (one-wayAnova and Tukey’s test).

J. Doorn et al. / Biomaterials 34 (2013) 3053e3063 3059

J. Doorn et al. / Biomaterials 34 (2013) 3053e30633060

factors on gene expression of HUVECs, cells were seeded onMatrigel in different types of CM. As shown in SupplementaryFig. 9C, whereas expression of endothelial genes was slightlydecreased in basic-CM, DFO- and Phen-CM increased expression ofthese genes and demonstrated similar effects as hypoxia-CM.Similarly, a scratch wound healing assay demonstrated thatmigration of HUVECs was increased by CM, but no differences wereobserved between these groups (Fig. 5C). The observed effects werenot restricted to hMSCs. When human osteoblasts (MG-63 cells) orhuman anterior cruciate ligament derived cells (ACL) were exposedto Phen for two days a clear up-regulation of VEGF was observedcompared to the control (Fig. 5D). A synergistic effect of DFO andhypoxia (two days exposure) was not observed in any of the donorstested whereas one of the donors showed a statistically significantsynergistic effect of Phen and hypoxia (Supplementary Fig. 8).

3.3. In vivo blood vessel formation

Having shown that exposure of hMSCs to DFO and Phen caninduce the secretion of trophic factors we decided to test if bothcompounds can act in vivo in a similar manner. Ultimately, wetested the efficacy of DFO and Phen as factors that can stimulate thehypoxia driven angiogenic response in vivo by incorporating DFO(150 mM) or Phen (200 mM) in Matrigel plugs (without incorporationof any cells) that are injected subcutaneously in mice. After 7 daysa significantly increased capillary ingrowth could be observed inthe DFO-containing as well as the Phen-containing matrigel plugsthat were implanted into mice (Fig. 6). The capillary ingrowth afterinjecting DFO and Phen did not differ significantly, however itshould be noted that in the Phen-treated group two mice showedexcessive capillary ingrowth that resulted in the presence ofcapillary structures throughout the total plug (Fig. 6C). Thosestructures were functional as demonstrated by the presence oferythrocytes in the lumen (Fig. 6D).

4. Discussion

Pre-conditioning or “training” of hMSCs prior to in vivo deliverycan alter their differentiation status and the secretion of trophicfactors, which might increase their therapeutic value [18e22,46].Hypoxia pre-conditioning increases the secretion of pro-angiogenicand pro-survival factors improving engraftment of infused MSCs.Treatment of MSCs with growth factors, such as epidermal growthfactor or sonic hedgehog, has similar effects [47e49], but relies onthe use of recombinant proteins, which are expensive and posechallenges to incorporate into drug delivery systems while main-taining their bioactivity. Although some of the core components ofthe hypoxia pathway are conserved between cell types, variationsoccur between different cell types and species, which can result ina distinct activation pattern of HIF target genes [21,50,51].

To the best of our knowledge, this is the first screen for activa-tors of the HIF-1 pathway using hMSCs. Due to their heterogeneity,primary hMSCs pose additional issues for screening assays andtherefore, we used a clonally expanded immortalized cell linereasoning that the cellular components of the hypoxia pathwaywillclosely resemble those in primary hMSCs [52]. Surprisingly, of the12 previously identified hypoxia mimics [38], only 1 was able toactivate the HRE reporter in HRE-GFP iMSCs, thus clearly demon-strating the cell type specificity for mechanisms regulating hypoxia.Phen can act as a chelator and form a complex with iron [53], buteven thoughmost molecules have a describedmolecular target, thelack of specificity should not be ignored [54].

Treatment of hMSCs with Phen results in enhanced secretion ofVEGF and IL-8, both involved in proliferation, survival, sproutingand angiogenesis [55]. The effects of Phen-CM on proliferation and

migration of HUVECs were comparable to those of hypoxia-CM,even though hMSCs numbers were significantly decreased aftertreatment with Phen while preparing CM. In our experimentalsetup we observed that the effects of both DFO and Phen regardingmetabolic activity are donor- and dose-dependent and in eithercase showed cytotoxic effects compared with the control(Supplementary Figs. 5 and 6). Besides optimizing exposure andconcentration one can envision a strategy where toxic effects areminimized and cell survival is optimized. For example, a screeningsimilar to the one performed in this study can be devised in anattempt to find compounds that increase cell proliferation andsurvival while the cells are exposed to the hypoxia mimic.

Interestingly, only Phen was able to induce expression of Il-8,suggesting mechanistic differences between Phen and other waysof hypoxia induction. Whole genome analysis showed that,although DFO and the 2% O2 increase expression of several hypoxiatarget genes, only hMSCs exposed to Phen showed a dramaticincrease in IL-8 expression. Although known to be regulated byhypoxia [56,57] IL-8 can also be increased by hypoxia-independentmechanisms. One hypothesis for the increase of IL-8 solely in Phen-treated cells could be that Phen activates another signaling path-way that in turn activates IL-8 transcription. A candidate pathway isthe NF-kB pathway, which activation leads to IL-8 expression[58,59] and indeed, our microarray data shows that expression ofRelA e a NF-kB target genee is higher in the presence of Phen thanin hypoxia or DFO-treated cells. Alternatively, increased stability ofthe heterodimeric complex in the nuclei can explain the strongeractivation of HIF target genes, as we also observed a higherexpression of P300, a known co-activator of HIF, in Phen-treatedcells [21,60]. IL-8 is also a known chemo-attractant for inflamma-tory cells [61,62]. Although some controversy persists on the role ofinflammatory cells on tissue regeneration e it seems that undercertain conditions this can be highly beneficial e co-cultures ofhMSCs with peripheral mononuclear cells enhances expression ofbone relatedmarkers and inflammation during bone repair leads tolocal recruitment of osteoprogenitors [63,64].

Furthermore, we showed for the first time that in vivo deliveryof Phen to the matrigel as a single factor is sufficient to enhancevessel formation in vivo. Compared with DFO, the stronger activa-tion of HIF target genes by Phen suggests this compound is morepotent, which was partially reflected in the Matrigel plug assay,where Phen induced extensive capillary growth in 2 out of 7 micecompared to moderate growth in DFO-plugs (although overall, thedifferences to DFO did not differ significantly). Our in vitro datasuggests that the mechanism by which Phen enhances vesselsformation in vivo can involve differentiation of progenitor cells suchas MSCs into cells from the endothelial lineage. Gene expressionanalysis of iMSCs treated with Phen showed an increase inendothelial-related genes (Supplementary Fig. 7B). This observa-tion was corroborated by the tube formation assay usingiMSCs (iMSCs were used because they are clonally expandedtherefore ruling out different responses to the treatments by sub-populations of cells) where we showed that tube-like structureswere only presented after 14 d in iMSCs pre-treated with Phen(Supplementary Fig. 7A). The involvement of matrix degradingenzymes in blood vessel formation is well known [65]. However,ourmicroarray data does not show differential expression of matrixdegrading enzymes upon treatment with DFO or Phen, indicatingthat under our experimental conditions other mechanisms areinvolved in in vivo vessel formation. Nevertheless, in vivo immu-nocytochemistry for matrix degrading enzymes as well as theirrespective inhibitors should be performed in the future to havea temporal and spatially understanding of their expression levels.Local release of DFO and Phen can increase hypoxia levels thereforetriggering a cascade of events leading to the formation of blood

Fig. 6. In vivo capillary ingrowth in matrigel containing DFO or Phen. Matrigel plugs (0.5 mL) containing either PBS, DFO (150 mM) or Phen (200 mM) were injected subcutaneouslyand analyzed for capillary ingrowth after 7 days. A, vessel ingrowth was scored morphometrically and expressed as mean � SEM per group (n ¼ 7) in mm ingrowth. B, theendothelial nature of the ingrowing cells structures is confirmed by CD31 staining. C, in two plugs in the Phen treated group extraordinary ingrowth of capillary like structuresthroughout the total plug could be observed, demonstrated a clear lumen surrounded by CD31 positive cells. D, the functionality of the vessels was confirmed by the presence oferythrocytes in the lumen of the vessels.

J. Doorn et al. / Biomaterials 34 (2013) 3053e3063 3061

J. Doorn et al. / Biomaterials 34 (2013) 3053e30633062

vessels. Recruitment of different cell types to the vicinity of the plugshould be analyzed in detail as some of the secreted factors playa role in recruitment of inflammatory cells that can enhance vesselformation or even the recruitment of fully differentiated endothe-lial cells that will eventually form new blood vessels. Our datasuggest that Phen offers a cheap and easy alternative for hypoxiacultures and in addition, Phen could be applied directly in an in vivosetup.

5. Conclusions

Our results showed that small molecules could be used tocontrol the secretome of hMSCs. Moreover, we showed that theactivity of previously identified hypoxia mimics is dependent onthe cell type. By identified phenanthroline as a potent hypoxiamimic in several cell types we paved the way to its broad appli-cation in ischemic-related diseases. Our in vivo data clearly showedthe potential of phenanthroline to induce blood vessel formation.

Conflict of interest

The authors declare no conflict of interests.

Acknowledgments

We would like to thank Roderick Beijersbergen and Pasi Hal-onen for technical support and thoughtful discussions, and BramKoopman and Lorenzo Moroni for technical support. Furthermore,the authors gratefully acknowledge the support of the TeRM SmartMix Program of the Netherlands Ministry of Economic Affairs andthe Netherlands Ministry of Education, Culture and Science (JD, JdBand CvB), the STW program (HF, JdB and CvB), the BMM PENTproject (PQ, MV and ZA), the OM at the Norwegian Stem Cell Centrefrom the Norwegian Research Council (OM) and Erasmus MC (JvPand HvL).

Appendix A. Supplementary information

Supplementary information related to this article can be foundat http://dx.doi.org/10.1016/j.biomaterials.2012.12.037.

References

[1] Haynesworth SE, Baber MA, Caplan AI. Cytokine expression by humanmarrow-derived mesenchymal progenitor cells in vitro: effects of dex-amethasone and IL-1 alpha. J Cell Physiol 1996;166(3):585e92.

[2] Le Blanc K, Frassoni F, Ball L, Locatelli F, Roelofs H, Lewis I, et al. Mesenchymalstem cells for treatment of steroid-resistant, severe, acute graft-versus-hostdisease: a phase II study. The Lancet 2008;371(9624):1579e86.

[3] Caplan AI. Why are MSCs therapeutic? New data: new insight. J Pathol 2009;217(2):318e24.

[4] Baker M. Stem-cell drug fails crucial trials. Nat News 2009.[5] Garcia-Olmo D, Herreros D, Pascual I, Pascual JA, Del-Valle E, Zorrilla J, et al.

Expanded adipose-derived stem cells for the treatment of complex perianalfistula: a phase II clinical trial. Dis Colon Rectum 2009;52:79e86.

[6] Menasche P. Cardiac cell therapy: lessons from clinical trials. J Mol Cell Cardiol2010;50(2):258e65.

[7] Bartholomew A, Sturgeon C, Siatskas M, Ferrer K, McIntosh K, Patil S, et al.Mesenchymal stem cells suppress lymphocyte proliferation in vitro and pro-long skin graft survival in vivo. Exp Hematol 2002;30(1):42e8.

[8] Chabannes D, Hill M, Merieau E, Rossignol J, Brion R, Soulillou JP, et al. A rolefor heme oxygenase-1 in the immunosuppressive effect of adult rat and hu-man mesenchymal stem cells. Blood 2007;110(10):3691e4.

[9] Falanga V, Iwamoto S, Chartier M, Yufit T, Butmarc J, Kouttab N, et al. Autol-ogous bone marrow-derived cultured mesenchymal stem cells delivered ina fibrin spray accelerate healing in murine and human cutaneous wounds.Tissue Eng 2007;13:1299e312.

[10] Orlic D, Kajstura J, Chimenti S, Bodine DM, Leri A, Anversa P. Bone marrowstem cells regenerate infarcted myocardium. Pediatr Transplant 2003;7-(Suppl. 3):86e8.

[11] Quevedo HC, Hatzistergos KE, Oskouei BN, Feigenbaum GS, Rodriguez JE,Valdes D, et al. Allogeneic mesenchymal stem cells restore cardiac function inchronic ischemic cardiomyopathy via trilineage differentiating capacity. ProcNatl Acad Sci U S A 2009;106(33):14022e7.

[12] Nagaya N. Transplantation of mesenchymal stem cells improves cardiacfunction in a rat model of dilated cardiomyopathy. Circulation 2005;112(8):1128e35.

[13] Shabbir A, Zisa D, Suzuki G, Lee T. Heart failure therapy mediated by thetrophic activities of bone marrow mesenchymal stem cells: a noninvasivetherapeutic regimen. Am J Physiol Heart Circ Physiol 2009;296(6):1888e97.

[14] Uemura R, Xu M, Ahmad N, Ashraf M. Bone marrow stem cells prevent leftventricular remodeling of ischemic heart through paracrine signaling. Circ Res2006;98(11):1414e21.

[15] Leiker M, Suzuki G, Iyer VS, Canty Jr JM, Lee T. Assessment of a nuclear affinitylabeling method for tracking implanted mesenchymal stem cells. Cell Trans-plant 2008;17(8):911e22.

[16] Crisostomo P, Markel TA, Wang Y, Meldrum D. Surgically relevant aspects ofstem cell paracrine effects. Surgery 2008;143(5):577e81.

[17] Lennon DP, Edmison JM, Caplan AI. Cultivation of rat marrow-derived mes-enchymal stem cells in reduced oxygen tension: effects on in vitro and in vivoosteochondrogenesis. J Cell Physiol 2001;187(3):345e55.

[18] Hu X, Yu SP, Fraser JL, Lu Z, Ogle ME, Wang J-A, et al. Transplantation ofhypoxia-preconditioned mesenchymal stem cells improves infarcted heartfunction via enhanced survival of implanted cells and angiogenesis. J ThoracCardiovasc Surg 2008;135(4):799e808.

[19] Hung S-C, Pochampally RR, Chen S-C, Hsu S-C, Prockop DJ. Angiogenic effectsof human multipotent stromal cell conditioned medium activate the PI3K-Aktpathway in hypoxic endothelial cells to inhibit apoptosis, increase survival,and stimulate angiogenesis. Stem Cells 2007;25(9):2363e70.

[20] Hung SC, Pochampally RR, Hsu SC, Sanchez C, Chen SC, Spees J, et al. Short-term exposure of multipotent stromal cells to low oxygen increases theirexpression of CX3CR1 and CXCR4 and their engraftment in vivo. PLoS ONE2007;2(5):e416.

[21] Lendahl U, Lee KL, Yang H, Poellinger L. Generating specificity and diversity inthe transcriptional response to hypoxia. Nat Rev Genet 2009;10(12):821e32.

[22] Volkmer E, Kallukalam BC, Maertz J, Otto S, Drosse I, Polzer H, et al. Hypoxicpreconditioning of human mesenchymal stem cells overcomes hypoxia-induced inhibition of osteogenic differentiation. Tissue Eng Part A 2010;16(1):153e64.

[23] Harris AL. Hypoxia a key regulatory factor in tumour growth. Nat Rev Cancer2002;2(1):38e47.

[24] Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 2003;3(10):721e32.

[25] Jaakkola P, Mole DR, Tian Y-M, Wilson MI, Gielbert J, Gaskell SJ, et al. Targetingof HIF-1a to the von HippeleLindau ubiquitylation complex by O2-regulatedprolyl hydroxylation. Science 2001;292(5516):468e72.

[26] Heath T, Fraley R, Papahdjopoulos D. Antibody targeting of liposomes: cellspecificity obtained by conjugation of F(ab’)2 to vesicle surface. Science 1980;210(4469):539e41.

[27] Leserman L, Barbet J, Kourilsky F, Weinstein J. Targeting to cells of fluorescentliposomes covalently coupled with monoclonal antibody or protein A. Nature1980;288(5791):602e4.

[28] Leserman L, Machy P, Barbet J. Cell-specific drug transfer from liposomesbearing monoclonal antibodies. Nature 1981;293(5829):226e8.

[29] Chan JM, Zhang L, Tong R, Ghosh D, Gao W, Liao G, et al. Spatiotemporalcontrolled delivery of nanoparticles to injured vasculature. Proc Natl Acad SciU S A 2010;107(5):2213e8.

[30] Dhar S, Kolishetti N, Lippard SJ, Farokhzad OC. Targeted delivery of a cisplatinprodrug for safer and more effective prostate cancer therapy in vivo. Proc NatlAcad Sci U S A 2011;108(5):1850e5.

[31] Kolishetti N, Dhar S, Valencia PM, Lin LQ, Karnik R, Lippard SJ, et al. Engi-neering of self-assembled nanoparticle platform for precisely controlledcombination drug therapy. Proc Natl Acad Sci U S A 2010;107(42):17939e44.

[32] Rothenfluh DA, Bermudez H, O’Neil CP, Hubbell JA. Biofunctional polymernanoparticles for intra-articular targeting and retention in cartilage. NatMater 2008;7(3):248e54.

[33] Nembrini C, Stano A, Dane KY, Ballester M, van der Vlies AJ, Marsland BJ, et al.Nanoparticle conjugation of antigen enhances cytotoxic T-cell responses inpulmonary vaccination. Proc Natl Acad Sci U S A 2011;108(44):E989e97.

[34] Service RF. Nanoparticle trojan horses gallop from the lab into the clinic.Science 2010;330(6002):314e5.

[35] Ganta S, Devalapally H, Shahiwala A, Amiji M. A review of stimuli-responsive nanocarriers for drug and gene delivery. J Control Release2008;126(3):187e204.

[36] Doorn J, van de Peppel J, van Leeuwen JPTM, Groen N, van Blitterswijk CA, deBoer J. Pro-osteogenic trophic effects by PKA activation in human mesen-chymal stromal cells. Biomaterials 2011;32(26):6089e98.

[37] Siddappa R, Mulder W, Steeghs I, van de Klundert C, Fernandes H, Liu J, et al.cAMP/PKA signaling inhibits osteogenic differentiation and bone formation inrodent models. Tissue Eng Part A 2009;15(8):2135e43.

[38] Xia M, Huang R, Sun Y, Semenza GL, Aldred SF, Witt KL, et al. Identification ofchemical compounds that induce HIF-1a activity. Toxicol Sci 2009;112(1):153e63.

[39] Chau NM, Rogers P, Aherne W, Carroll V, Collins I, McDonald E, et al. Identi-fication of novel small molecule inhibitors of hypoxia-inducible factor-1 that

J. Doorn et al. / Biomaterials 34 (2013) 3053e3063 3063

differentially block hypoxia-inducible factor-1 activity and hypoxia-induciblefactor-1alpha induction in response to hypoxic stress and growth factors.Cancer Res 2005;65(11):4918e28.

[40] Fernandes H, Mentink A, Bank R, Stoop R, van Blitterswijk C, de Boer J.Endogenous collagen influences differentiation of human multipotent mes-enchymal stromal cells. Tissue Eng Part A 2010;16(5):1693e702.

[41] O’Brien J, Wilson I, Orton T, Pognan F. Investigation of the Alamar Blue(resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity.Eur J Biochem 2000;267(17):5421e6.

[42] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(�Delta Delta C(T)) method. Methods 2001;25(4):402e8.

[43] Roodhart JML, Daenen LGM, Stigter ECA, Prins H-J, Gerrits J, Houthuijzen JM,et al. Mesenchymal stem cells induce resistance to chemotherapy through therelease of platinum-induced fatty acids. Cancer Cell 2011;20(3):370e83.

[44] Liu J, Barradas A, Fernandes H, Janssen F, Papenburg B, Stamatialis D, et al.In vitro and in vivo bioluminescent imaging of hypoxia in tissue-engineeredgrafts. Tissue Eng Part C Methods 2010;16(3):479e85.

[45] Wenger RH. Integration of oxygen signaling at the consensus HRE. Sci STKE2005;2005(306):re12.

[46] Di Santo SYZ, Wyler von Ballmoos M, Voelzmann J, Diehm N, Baumgartner I,Kalka C. Novel cell-free strategy for therapeutic angiogenesis: in vitro gen-erated conditioned medium can replace progenitor cell transplantation. PLoSONE 2009;4(5):e5643.

[47] Amin AH, Abd Elmageed ZY, Nair D, Partyka MI, Kadowitz PJ, Belmadani S,et al. Modified multipotent stromal cells with epidermal growth factor restorevasculogenesis and blood flow in ischemic hind-limb of type II diabetic mice.Lab Invest 2010;90(7):985e96.

[48] Pola R, Ling LE, Silver M, Corbley MJ, Kearney M, Blake Pepinsky R, et al. Themorphogen Sonic Hedgehog is an indirect angiogenic agent upregulating twofamilies of angiogenic growth factors. Nat Med 2001;7(6):706e11.

[49] Kusano KF, Pola R, Murayama T, Curry C, Kawamoto A, Iwakura A, et al. Sonichedgehog myocardial gene therapy: tissue repair through transient recon-stitution of embryonic signaling. Nat Med 2005;11(11):1197e204.

[50] Kelly BD, Hackett SF, Hirota K, Oshima Y, Cai Z, Berg-Dixon S, et al. Cell type-specific regulation of angiogenic growth factor gene expression and inductionof angiogenesis in nonischemic tissue by a constitutively active form ofhypoxia-inducible factor 1. Circ Res 2003;93(11):1074e81.

[51] Benita Y, Kikuchi H, Smith AD, Zhang MQ, Chung DC, Xavier RJ. An integrativegenomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genesthat formthecoreresponsetohypoxia.NucleicAcidsRes2009;37(14):4587e602.

[52] Ebert AD, Svendsen CN. Human stem cells and drug screening: opportunitiesand challenges. Nat Rev Drug Discov 2010;9(5):367e72.

[53] Maxwell P, Salnikow K. HIF-1: an oxygen and metal responsive transcriptionfactor. Cancer Biol Ther 2004;3(1):29e35.

[54] Murray AJ. Pharmacological PKA inhibition: all may not be what it seems. SciSignal 2008;1(22):re4.

[55] Li A, Dubey S, Varney ML, Dave BJ, Singh RK. IL-8 directly enhanced endo-thelial cell survival, proliferation, and matrix metalloproteinases productionand regulated angiogenesis. J Immunol 2003;170(6):3369e76.

[56] Kim KS, Rajagopal V, Gonsalves C, Johnson C, Kalra VK. A novel role ofhypoxia-inducible factor in cobalt chloride- and hypoxia-mediated expres-sion of IL-8 chemokine in human endothelial cells. J Immunol 2006;177(10):7211e24.

[57] Galindo M, Santiago B, Alcami J, Rivero M, Martín-Serrano J, Pablos JL. Hypoxiainduces expression of the chemokines monocyte chemoattractant protein-1(MCP-1) and IL-8 in human dermal fibroblasts. Clin Exp Immunol 2001;123(1):36e41.

[58] Karashima T, Sweeney P, Kamat A, Huang S, Kim SJ, Bar-Eli M, et al. Nuclearfactor-kappaB mediates angiogenesis and metastasis of human bladder cancerthrough the regulation of interleukin-8. Clin Cancer Res 2003;9(7):2786e97.

[59] Chan DA, Kawahara TLA, Sutphin PD, Chang HY, Chi J-T, Giaccia AJ. Tumorvasculature is regulated by PHD2-mediated angiogenesis and bone marrow-derived cell recruitment. Cancer Cell. 2009;15(6):527e38.

[60] Ruas JL, Berchner-Pfannschmidt U, Malik S, Gradin K, Fandrey J, Roeder RG,et al. Complex regulation of the transactivation function of hypoxia-induciblefactor-1 alpha by direct interaction with two distinct domains of the CREB-binding protein/p300. J Biol Chem 2010;285(4):2601e9.

[61] Hechtman D, Cybulsky M, Fuchs H, Baker J, Gimbrone M. Intravascular IL-8.Inhibitor of polymorphonuclear leukocyte accumulation at sites of acuteinflammation. J Immunol 1991;147(3):883e92.

[62] Henkels KM, Frondorf K, Gonzalez-Mejia ME, Doseff AL, Gomez-Cambronero J.IL-8-induced neutrophil chemotaxis is mediated by Janus kinase 3 (JAK3).FEBS Lett 2011;585(1):159e66.

[63] Navarro M, Pu F, Hunt JA. The significance of the host inflammatory responseon the therapeutic efficacy of cell therapies utilising human adult stem cells.Exp Cell Res 2012;318(4):361e70.

[64] Ranganath SH, Levy O, Inamdar MS, Karp JM. Harnessing the mesenchymalstem cell secretome for the treatment of cardiovascular disease. Cell Stem Cell2012;10(3):244e58.

[65] Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of thetumor microenvironment. Cell 2010;141(1):52e67.

[66] Shibata T, Akiyama N, Noda M, Sasai K, Hiraoka M. Enhancement of geneexpression under hypoxic conditions using fragments of the human vascularendothelial growth factor and the erythropoietin genes. Int J Radiat Oncol1998;42(4):913e6.