Aust. J. Agric. Res., 1993, 44, 41-51

A Polymerase Chain Reaction Assay for Cucumber Mosaic Virus in Lupin Seeds

S. lie,^ C. R. W i l ~ o n , ~ > ~ R. A. C. ones^*^ and M. G. K. ~ o n e s ~ 9 ~

A Centre for Agricultural Biotechnology, School of Biological and Environmental Sciences, Murdoch University, Perth, W.A. 6150.

Western Australian Department of Agriculture, Baron Hay Court, South Perth, W.A. 6151. Cooperative Research Centre for Legumes in Mediterranean Agriculture, University of

Western Australia, Nedlands, W.A. 6009. Current address: Dept of Primary Industry, Fisheries & Energy,

Newtown Research Laboratories, Hobart, Tas. 7001.

Abstract

Seed is the main source of infection of narrow-leafed lupin (Lupinus angustifolius) crops by cucumber mosaic virus (CMV). The ELISA procedure is currently used for large-scale, routine testing of lupin seed samples, but a more sensitive, reliable and labour-saving assay is needed which detects levels of seed infection as low as 0.1%. A Polymerase Chain Reaction (PCR) using ground dry seed samples was developed for this purpose. Primers based on concensus sequences of eight published CMV coat protein cDNAs (RNA3) of CMV subgroups 1 and 2 were used. The assay involved (1) a reverse transcription step for cDNA synthesis and (2) amplification of a specific fragment (482-501 bp depending on the strain) by PCR. Two methods of extracting virus from infected lupin material were used: (i) a rapid procedure which was effective for samples with higher levels of infection, e.g. infected leaves and 20.5% infected seed; (ii) a phenol-chloroform procedure, which led to greater sensitivity, enabling reliable detection of 0.1% seed infection. It detected CMV in 16 commercial seed samples (0.1-8% seed infection) belonging to seven cultivars from 12 different localities. Both methods were suitable for routine testing of the flour derived from grinding dry seed. On dissection of infected seeds, CMV was detected in the cotyledons and embryo and usually in or on the testa. The PCR assay detected virus from both CMV subgroups, but only subgroup 2 was found in lupin seed samples. The two CMV subgroups can be distinguished by digestion of amplified DNA with the restriction enzyme EcoRI; only CMV strains of subgroup 2 are digested to yield two fragments of size 330 and 170 bp.

Keywords: Cucumber Mosaic Virus (CMV), Polymerase Chain Reaction (PCR), Lupinus angustifolius, lupin seed, routine testing.

Introduction

Narrow-leafed lupin (Lupinus angustifolius) is the most widely grown grain legume in Australia. About 80% of the national crop is produced in Western Australia, where it is grown in rotation with cereals or ley pastures. Cucumber mosaic cucumovirus (CMV) is a threat to the lupin industries in both Western and south-eastern Australia (Bowyer and Keirnan 1981; Alberts et al. 1985; Jones 1987, 1988). Infection with CMV causes individual crop failures and widespread losses, and disrupts both breeding and trialing programs, and certified seed production (Jones 1988, 1991; Jones and McLean 1989). CMV epidemics depend on a source of the virus and presence of aphid vectors. CMV is seed-borne and

S. Wylie et al.

seed-infected plants constitute the primary infection source from which spread develops. Planting of seed stocks with little or no infection is the most important control measure. Sowing seed with <0.5% infection is recommended for grain crops, while a 0% tolerance is recommended for seed certification stocks (Jones and Proudlove 1991).

Since 1988, the Western Australian Department of Agriculture has provided a seed testing service for growers' seed samples to help them decide whether they can sow their own seed without undue risk from CMV infection or whether purchase of 'cleaner' seed is needed. This service is widely used with 1 652 samples being tested in 1991/92 following the 1991 growing season (D. A. Nicholas, pers. comm.). For the currently used test, dry seed samples are ground to a fine powder in a mill and tested by enzyme-linked immunosorbent assay (ELISA) as described by Jones and Proudlove (1991). This test is sensitive enough to detect one infected seed in 100. The service is based on samples of 1000 seeds which are initially divided into 10 lots of 100 each before grinding, extraction and testing. Limitations to the current ELISA test include a requirement for greater sensitivity, the need for a regular supply of high quality CMV antiserum (free from cross reactivity with plant proteins) and its dependence on operator skill to avoid test failure. An assay based on the Polymerase Chain Reaction (PCR: Saiki et al. 1985, 1988; Innes et al. 1990), which involves the enzymatic amplification of a DNA or RNA fragment defined by two oligonucleotide primers, is potentially able to overcome these limitations. It should have greater sensitivity and does not require antiserum. Also, savings in the time and cost of routine tests are potentially possible. A PCR assay for CMV detection in ground samples of dry lupin seeds was therefore developed. It involved examination of extraction procedures, choice of PCR primers, reverse transcription, cycling conditions and optimization of the assay.

Materials and Methods

Lupin Seed and Seedlings

The CMV-infected seed stocks used to develop the PCR procedure were of cw. Wandoo (28% infection) and Gungurru (0.1, 0.5, 1, 2, 3 and 5% infection). Healthy seed stocks were of cw. Danja and Gungurru. These stocks had been previously tested by ELISA after growing on seedlings or by testing ground seed samples as described by Jones (1988) or Jones and Proudlove (1991) respectively. Before testing by PCR, lupin seed was ground in a mill (Glen Creston) fitted with a 2 mm sieve. To produce healthy and CMV-infected seedlings for testing, the infected seed of cv. Wandoo was grown in sand in a glasshouse. Once established, the PCR procedure was tested with 16 commercial seed stocks previously identified as CMV-infected by ELISA.

CMV Isolates from Subterranean Clover

Subterranean clover isolates SL from Victoria, and SN isolate from Western Australia (Jones and McKirdy 1990) were grown in Nicotiana glutinosa plants.

Eztraction of Half Seeds

Individual seeds from the 28% CMV-infected (cv. Wandoo) source were split in two and one half tested for CMV using PCR. If CMV was present, the remaining half-seed was added to a known number of uninfected seeds so that a defined level of infection could be established.

Detection of CMV by PCR in Lupin Seeds

For example, one half-seed in 500 uninfected seeds gave an infection level equivalent to one infected whole seed in 1000.

CMV RNA Extraction

Two methods for CMV-RNA extraction were used. The first method was a modification of the rapid DNA-extraction method of Edwards et

al. (1991). For leaf material, 5 mm diameter discs were punched from infected or healthy lupin seedlings and macerated with a glass rod in extraction buffer; for seeds, 100 mg of ground seed flour was used. Samples were placed in a 1.5 mL microcentrifuge tube with 400 pL of extraction buffer (200 mM Tris-HC1 pH 7.5, 250 mM sodium chloride, 25 mM EDTA, 0.5% SDS), then vortexed for 5 s, centrifuged at 13000 g for I min, and 300 pL of extract transferred to a fresh microcentrifuge tube. Nucleic acids were precipitated by addition of 1 volume ice-cold isopropanol and then cooled to -80°C for 15 min. Following centrifugation (13 000 g for 5 min), the supernatant was discarded, the pellet air-dried and resuspended in 50 pL TE (10 mM Tris-HC1 pH 7.4, 1 mM EDTA).

The second method was modified from Schuler and Zielinski (1989): 100 mg of ground seed flour was placed in a 1.5 mL microcentrifuge tube and 500 pL of extraction buffer (50 mM Tris-HC1 pH 8.5, 10 mM EDTA, 200 mM NaCl) and 500 pL of phenol: chloroform: isoamyl alcohol (50: 50 : 1) added. After vortexing for I min, the tube was centrifuged at 13 000 g for a further minute. The aqueous layer was transferred to a new tube and one volume of chloroform : isoamyl alcohol (50 : 1) added, vortexed for 1 min, and centrifuged at 13 000 g for 1 min. The aqueous layer was transferred to a new tube, and 1 volume of cold isopropanol added, mixed by inverting and cooled to -80°C for 15 min. After thawing, the solution was centrifuged for 3 min, the supernatant removed and the pellet air-dried. After resuspension in 100 pL TE (pH 7.4), 4 pL of 5 M NaCl and 250 pL cold ethanol were added and the tube incubated on ice for 20 min. The tubes were centrifuged for 3 rnin at 13000 g. The supernatant was removed and the pellet was then air dried before resuspension in 500 pL TE and stored at -20°C.

Primers

CMV has an RNA genome of three single stranded positive sense RNAs (Peden and Symons 1973). The coat protein gene is coded by RNA3, and is expressed from a subgenomic RNA, RNA4. Eight sequences of cDNA of the coat protein gene were available when the project started (Table 1).

Table 1. CMV viral sequences

CMV isolate Reference

Subgroup 1

Subgroup 2

Owen et al. (1990) Owen et al. (1990) Quemada et al. (1989) Cuozzo et al. (1988) Hayakawa et al. (1989) Hidaka et al. (1985) Quemada et al., (1989) Gould and Symons (1982)

These sequences included those of isolates from subgroups (= serotypes) 1 and 2 (Owen and Palukaitis 1988; Wahyuni and Francki 1992). The coat protein cDNA sequences were matched and concensus regions identified for all eight sequences. The cDNA sequences for the CMV coat protein gene were taken either from the published papers or from Genbank and EMBL computer databases. Sequences were initially compared by visual inspection, and subsequently by programs of the University of Wisconsin Genetics Computer Group (GCG), via satellite linkage to the University of Georgia, U.S.A.

S. Wylie et al.

The sequence of primers chosen were

CMV primer 1 (downstream): 5' GCCGTAAGCTGGATGGACAA 3'

CMV primer 2 (upstream): 5' TATGATAAGAAGCTTGTTTCGCG 3' (one

redundancy as indicated.) A

These sequences were identical in the CMV coat protein genes of all eight isolates, with the following exceptions: in primer 1, 3' T (A in primer) replaced by a G (CMV-WL), and an A replacing the G for CMV-0 in primer 2. The predicted length of amplified sequence using these primers is 501 bp for CMV of subgroup 2, and 482-487 bp for subgroup 1, depending on the virus strain present.

Reverse Transcription and PCR Amplification

Reagents employed in the reverse transcription reaction were supplied by Perkin Elmer Cetus, and after optimization (see later), the following conditions were used: 4 mM MgC12, 50 mM KCI, 10 mM Tris-HC1 pH 8.3, 1 mM deoxynucleoside triphosphates; 0.5 pL of primer 1 (96 p ~ ) , 5 units RNase inhibitor and 12 - 5 units M-MLV reverse transcriptase were added. RNA extracts (0.5 pL) were then added to aliquots (9.5 pL) of the reaction mixture. The mixture was overlaid with one drop of paraffin oil and incubated at 42OC (15 rnin), 9g°C (5 min) in a Perkin Elmer Cetus Thermal Cycler (model TC1). Following reverse transcription, the reaction volume was increased to 50 pL maintaining conditions of 4 mM MgCl2, 50 mM KC1, 10 mM Tris HC1 pH 8.3, and with the addition of 1.25 units AmpliTaq DNA polymerase and 0.5 pL primer 2 (101 p ~ ) . The tubes were briefly centrifuged to combine the aqueous phases.

The following thermal cycling sequence was used: initial template denaturation at 92'C for 3 min followed by 35 cycles of primer annealing and extension at 60°C for 1 min and strand separation at 95OC for 1 min. An additional period of 7 mins at 60°C followed cycling. Aliquots (10 pL) of PCR-product were analysed by electrophoresis on a 2.0% agarose gel containing 0.5 pg/mL ethidium bromide in Tris-Borate EDTA buffer as described by Sambrook et al. (1989).

Restriction Digests of PCR Products

Restriction analyses were done of the amplified fragments from 14 lupin seed samples by Bam HI, Hind I11 and Eco RI restriction endonucleases (Bethesda Research Laboratories). Amplified fragments from CMV SL and SN in N. glutinosa were also analysed by Eco RI. Aliquots of 6 pL amplified DNA fragments were diluted 2 fold in sterile distilled water and then 2 pL of React buffer (IOxBRL), and 0.7' pL of enzyme added. Tubes were incubated at 37OC for 1.5 h. The digests were analysed by gel electrophoresis as described above, and size fragments compared with size standards (@X174/Hae I11 digest, X Hind I11 digest).

Results

Optimization of Conditions

In initial runs, electrophoresis of PCR products from CMV-infected lupin leaves and ground seed flour from infected cv. Wandoo yielded a single band of an expected size, of approximately 500 bp (Fig. 1). In initial experiments, random hexamers were used to prime the reverse transcriptase assay. These worked well for CMV-infected leaves and allowed detection of up to one infected seed in 200. However, they produced copies of all RNAs present and when primer 1 was used for reverse transcription, it consistently provided stronger DNA signals: 0.5 pL of primer 1 (96 p ~ ) was optimal for reverse transcription. A MgC12 concentration of 4 mM was found to be best for both reverse transcriptase and PCR (Fig. 2). A

Detection of CMV by PCR in Lupin Seeds

range of concentrations of reverse transcriptase were studied. Best results were obtained with a reverse transcriptase concentration of 12.5 U/10 pL.

Fig. 1. Rapid and phenol-chloroform extraction procedures for PCR assay of CMV. Lane 1: 0X174/Hae I11 marker; lanes 2, 3: phenol- chloroform extraction of infected leaves and seeds respectively, cv. Wandoo; lanes 4, 5: rapid extraction of leaves and seeds respectively, cv. Wandoo (100 seeds, 28% infection); lanes 6, 7: control extraction from non-infected leaves and seeds respectively, cv. Danja (uninfected); lane 8: X Hind I11 marker.

Fig. 2. Effect of Mg2+ concentration on the PCR assay for CMV. Lane 1: Cetus RNA control; lane 2: negative control (no template); lane 3: blank; lanes 4, 5: 1 . 2 mM MgC12; lanes 6, 7: 1 .7 mM MgC12; lanes 8, 9: 2 . 2 mM MgC12; lanes 10, 11: 2 . 7 mM MgC12; lane 12: marker 0x174 Hae 111; lanes 13, 14: 3.2 mM MgC12; lanes 15, 16: 3.7 mM MgC12; lanes 17, 18: 4 . 2 mM MgC12; lanes 19, 20: 4.7 mM MgC12.

Polymerase Chain Reaction

Ampli Taq DNA polymerase gave best results at a concentration of 1.25 U/50 pL, and 0.5 pL primer 2 (101 pM) was optimal for the polymerase chain reaction. In initial experiments, three-step thermal cycling was used (annealing 45-60°C, extension 72"C, strand separation 96°C). An annealing temperature of 60°C gave no spurious bands, and also allowed complete chain extension to occur, and so a two-step thermal cycle of 95°C melting temperature for 1 min followed by 1 min

S. Wylie et al.

annealing and extension at 60°C for 35 cycles was used routinely. This was more rapid than a three-step cycle. The following controls were tested: extracts of non infected lupin leaves and seeds, a known RNA positive control, a known CMV positive extract. Whenever the reactions were successful, a band of the expected size occurred. No false positives were observed, i.e. presence of the expected band in any negative control. Thus the primers were specific for detection of CMV. However, for routine work it is necessary to take precautions to prevent contamination of seed samples during and after grinding, and of reagents.

Location of Virus Within the Seed

It was possible that CMV was not present in all parts of the seed, and that this might affect extraction. Infected cv. Wandoo seeds were separated into four parts, testa, embryo and two cotyledons, and each part tested using PCR. Of six infected seeds that were analysed, the virus was found in both cotyledons and the embryo of all the seeds, and was present in or on the testa of five of the six infected seeds.

Sensitivity of the Assay

The rapid extraction method was suitable for detection of CMV in leaf material of infected plants and gave good PCR bands (Fig. 1). However, dilution of this extract (10-64 fold) gave more consistent results, reliably detecting one infected leaf sample in 1000. In contrast, an infection level of one infected seed (cv. Wandoo) in 200 was the lowest level reliably detected. However, the method is rapid (25 min), simple and does not involve noxious compounds. The more rigorous phenol-chloroform extraction method provided a nucleic acid product pure enough that dilution prior to the PCR assay was unnecessary. Sensitivity was increased so that an infection level of one CMV-infected seed in 1000 was readily detectable (Fig. 3); the absolute limit of detection was not determined, but samples of one CMV-infected seed in 2000 were also detected (Fig. 3).

Fig. 3. Sensitivity of PCR assay. Lanes 1 and 7: marker 0x174 Hae I11 digest; lane 2: negative control (non infected seed extract); lanes 3-6: one half seed cv. Wandoo, CMV- infected added to the following numbers of uninfected seeds, lane 3, 50; lane 4, 250; lane 5, 500; lane 6, 1000 (equivalent to detection of one infected whole seed in totals of 100, 500, 1 000 and 2 000 seeds respectively).

Detection of CMV by PCR in Lupin Seeds

Testing of Commercial Seed Samples

The longer extraction procedure was tested with 16 CMV-infected commercial seed samples with levels of infection ranging from 0.1 to 8.0% as determined by ELISA; two of the samples had been stored at 4OC for 5 years before testing. The samples consisted of seven cultivars (Danja, Chittick, Gungurru, Merrit, Wandoo, Yandee and Yorrel) from 12 localities within Western Australia (Badgingarra, Coorow, Corrigin, Cunderdin, Esperance, Goomalling, Jerramungup, Jurien, Kellerberrin, Merredin, Pingelly and Tincurrin). All infected samples were detected (see Fig. 4).

Fig. 4. PCR assay on two clover isolates of CMV and on CMV-infected lupin seed from diverse geographical origins in Western Australia (lanes 2-10), and restriction digests of amplified DNA using Eco RI (lanes 11-19). Lanes 1, 20, 0x174 Hae 111 marker; lanes 2, 11, cv. Danja (Pingelly); lanes 3, 12, cv. Danja (Merredin); lanes 4, 13, cv. Yorrel (Cunderdin); lanes 5, 14, cv. Merrit (Merredin); lanes 6, 15, cv. Gungurru (Tincurrin); lanes 7, 16, cv. Chitick (Esperance); lanes 8, 17, cv. Yandee (Esperance); lanes 9, 18, CMV subgroup 1 isolate SL ex subterranean clover (Victoria); lanes 10, 19, isolate SN ex subterranean clover (W.A.).

Restriction Digests of PCR Products

Undigested and Eco RI-digested PCR-amplified DNA is shown in Fig. 4. The samples were from the assays of seeds of six different cultivars (lanes 2-8) from six different locations in Western Australia (similar results for further cultivars were obtained which are not shown in Fig. 4). This showed that all of these undigested samples gave bands of about 500 bp, and all were digested by Eco RI (lanes 11-17) to yield two bands of about 330 and 170 bp. These PCR products were not digested by Bam HI, and were slightly reduced in size (by 9 bp) when digested with Hind 111, because there is a Hind I11 site in primer 2 (result not shown). In addition, lanes 9 and 10 were the amplified products of subterranean clover CMV isolates of subgroups 1 and 2 (SL and SN respectively). The band size for isolate SL (lane 9) was less that that of subgroup 2 PCR products, being about 485 bp. When treated with Eco RI, it was not digested (lane 18), in contrast to subgroup 2 strains from lupin and subterranean clover. This result showed that although the CMV strains detected in lupin seeds in Western Australia were all in subgroup 2, the PCR assay would also detect subgroup 1 strains if present. Furthermore, this observation provides a method to distinguish between the 2 CMV subgroups.

S. Wylie et al.

Discussion

Lupin seeds are large and contain many storage proteins and carbohydrates. When infected by CMV, they may contain variable levels of the virus, which may not be distributed evenly within the seed. This makes extraction and detection of CMV in large batches of dry seeds a more difficult prospect than detection of virus in expressed sap from leaf samples. However, the results presented indicate that the PCR approach can be used as a more sensitive alternative to ELISA for routine assay of CMV in seeds of narrow-leafed lupin.

Our rapid PCR extraction procedure gave clear signals of the expected size on electrophoresis of PCR products from CMV-infected lupin leaf samples. Dilution of the extract improved amplification presumably by decreasing the concentration of inhibitory components of sap. The rapid procedure also allowed detection of CMV in ground dry seed samples containing up to one infected seed in 200, and is therefore suitable for use when seed infection is 20.5%. However, for reliable detection of CMV in lupin seed with 0.1-0.5% infection, it is necessary to use the longer procedure involving phenol-chloroform extraction.

The limit of detection of the current ELISA test for CMV in lupin seeds is one infected seed in 100. Thus, samples of 1000 seeds must be counted out in 10 lots of 100 each, and 10 ELISA tests done. In the 1991/92 testing season, CMV was detected in 28% of the samples (D. A. Nicholas, pers. comm.), yet the 72% of uninfected samples still had to be tested in 10 batches of 100 seeds each. The ability to detect one CMV-infected seed in a batch of 1000 by PCR is therefore important, because analysis of 1000 seeds as single batches will greatly reduce the workload. If negative when tested by PCR, no further testing at lower grouping levels is required. There is also a time saving in carrying out the PCR procedure compared with ELISA, and 40-96 samples, depending on the thermal cycler model used, can be tested simultaneously in a session. ELISA assays depend on a consistent supply of high quality antiserum to CMV for their specificity. This may not always be available, and it is more convenient to synthesize CMV-specific PCR primers as required.

In developing a similar PCR assay for detection of plum pox potyvirus (PPV) in stone fruit tree tissues, Wetzel et al. (1991~) also encountered problems of low sensitivity caused by a host component in sap extracts. They subsequently suggested a method in which virus was initially trapped using antibodies to the viral antigen, and excess sap was removed before PCR (Wetzel et al. 1991b). However, an aim of our work was to avoid a requirement for CMV antiserum in routine testing, hence the phenol-chloroform extraction was used, and this effectively overcame the problems caused by host components. PCR has also been used to detect bean yellow mosaic virus (BYMV) in leaves of gladiolus (Vunsh et al. 1990). To test for BYMV in gladiolus corms, an additional purification step using Sephadex G-50 was required for successful detection by PCR (Vunsh et al. 1991). This eliminated inhibitory substances in corms, and parallels the need for greater purity of extracts for sensitive detection of CMV in lupin seeds. Vunsh et al. (1990) found PCR to be more sensitive than ELISA and molecular hybridization for BYMV detection. Wetzel et al. (1991~) also found the PCR method to be more sensitive than molecular hybridization for PPV detection.

Computer analysis (GCG-GAP program) of the CMV cDNA sequences for RNA3 indicated about 96-97% homology of sequences within CMV subgroups,

Detection of CMV by PCR in Lupin Seeds

and about 70-71% homology between the two subgroups. Since our primers were from remarkably highly conserved regions of CMV RNA3, they should detect all CMV strains, and our results confirm that CMV of both subgroups 1 and 2 is detected by the assay. The ability to distinguish between CMV strains of subgroups 1 and 2 on the basis of presence or absence of an EcoRI restriction site in the PCR-amplified DNA provides useful additional information, and is a simple alternative to more time-consuming serological typing to identify CMV subgroups.

Restriction digests of PCR products of CMV in seed samples from 12 locations in Western Australia and from seven cultivars, all yielded the same restriction pattern which was that of subgroup 2. This is consistant with the placing of a strain of CMV originating from lupin cv. Yandee from Western Australia (YWA) into subgroup 2 by serology (Wahayuni and Francki 1992); YWA = isolate LY of Jones (1988). However, restriction digestion of PCR products of subterranean clover isolate SL gave the restriction pattern expected for subgroup 1. Both subgroups infect subterranean clover in Western Australia (Jones and McKirdy 1990; Wahayuni and Francki 1992). One reason why subgroup 1 strains are less prevalent or absent in lupins in the field might be that they may cause more severe effects in lupins and tend to prevent grain production, thereby affecting carry-over of the virus in the seed.

The enzymes and reagents used were derived from a commercial PCR kit, with a single tube procedure allowing the use of separate enzymes for reverse transcription and PCR amplification. The conditions were optimized and quantities of reagents were reduced to minimize overall costs. Alternative approaches are now possible, such as the use of a single thermostable DNA polymerase (e.g. TET-Z, Amersham) which might be used both for reverse transcription and PCR amplification. As with ELISA tests for CMV, the PCR assay essentially provides information on presence or absence of virus in a given sample. Future quantification of the PCR reaction would be useful to help distinguish different levels of infection without having to resort to grouping. The promise of future automation of PCR procedures (e.g. Kemp 1989) is also attractive for decreasing inputs and speeding up sample throughput in routine testing (Jones and Torrance 1986).

Acknowledgments

We thank the Western Australian Grains Research Committee and the Grains Research and Development Corporation for funding this work, Ms K. Francki for technical assistance, and Mr D. A. Nicholas (Officer in Charge, CMV testing service) for supplies of commercial lupin seed samples.

References Alberts, E., Hanna, J., and Randles, J. W. (1985). A'n epidemic of cucumber mosaic virus in

South Australian lupins. Australian Journal of Agricultural Research 36, 267-73. Bowyer, J. W., and Keirnan, E. (1981). Cucumber mosaic virus in lupin. Australasian Plant

Pathology 10, 27-9. Cuozzo, M., O'Connell, K., Kaniewski, W., Fang, R. X., Chua, N. H., and Turner, N. E.

(1988). Viral protection in transgenic tobacco plants expressing the cucumber mosaic virus coat protein or its anti-sense RNA. Biotechnology 6, 549-57.

Edwards, K., Johnstone, C. and Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19, 1349.

S. Wylie et al.

Gould, A. R, and Symons, R. H. (1982). Cucumber mosaic virus RNA3: determination of the nucleotide sequence provides the amino acid sequence of protein 3a and viral coat protein. European Journal of Biochemistry 126, 217-26.

Hayakawa, T., Mizukami, M., Nakajima, M., and Suzuki, M. (1989). Complete nucleotide sequence of RNA3 from cucumber mosaic virus (CMV) strain 0 : comparative study of nucleotide sequences and amino acid sequences among strains 0, Q, D and Y. Journal of General Virology 70, 499-504.

Hidaka, S., Tsunasawa, S., Yoon, J. O., Narita, K., Takanami, Y., Kubo, S., and Miura, K. (1985). Messenger RNA structure participating in the initiation acid synthesis of cucumber mosaic virus coat protein. Journal of Biochemistry 97, 161-71.

Innes, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (1990) (Eds). 'PCR Protocols. A Guide to Methods and Applications.' (Academic Press: San Diego.) 1482 p.

Jones, R. A. C. (1987). Cucumber mosaic virus in lupins. Western Australian Journal of Agrzculture, FouTth Series 28, 50-4.

Jones, R. A. C. (1988). Seed-borne Cucumber mosaic virus infection of narrow-leafed lupin (Lupinus angustifolius) in Western Australia. Annals of Applied Biology 113, 507-18.

Jones, R. A. C. (1991). Reflective mulch decreases the spread of two non-persistently aphid-transmitted viruses to narrow-leafed lupin (Lupinus angustifolius). Annals of Applied Biology 118, 79-95.

Jones, R. A. C., and McKirdy, S. J. (1990). Seed-borne cucumber mosaic virus infection of subterranean clover in Western Australia. Annals of Applied Biology 116, 73-86.

Jones, R. A. C., and McLean, G. D. (1989). Virus diseases of lupins (a review). Annals of Applied Biology 114, 609-37.

Jones, R. A. C., and Proudlove, W. (1991). Further studies on cucumber mosaic virus infection of narrow-leafed lupin (Lupinus angustifolius): seed-borne infection, aphid transmission, spread and effects on grain yield. Annals of Applied Biology 118, 319-29.

Jones, R. A. C., and Torrance, L. (1986) (Eds). 'Developments and Applications in Virus Testing.' (Association of Applied Biologists: Wellesbourne.) 300 p.

Kemp, D. (1989). Blue genes: colourimetric detection of PCR products for diagnostics. Todays Life Science 1, 64-73.

Owen, J., and Palukaitis, P. (1988). Characterization of cucumber mosaic virus I. Molecular heterogeneity mapping of RNA3 of eight CMV strains. Virology 166, 495-502.

Owen, J., Skintakn, M., Aeschleman, P., Ben Tahar, S., and Palukaitis, P. (1990). Nucleotide sequence and evolutionary relationships of cucumber mosaic virus (CMV) strains: CMV RNA3. Journal of General Virology 71, 2243-9.

Peden, K. W., and Symons, R. H. (1973). Cucumber mosaic virus contains a functionally divided genome. Virology 53, 487-92.

Quemada, H., Kearney, C., Gonsalves, D., and Slightom, J. L. (1989). Nucleotide sequences of the coat protein genes and flanking regions of cucumber mosaic virus strains C and WL RNA 3. Journal of General Vzrology 70, 1065-73.

Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985). Enzymatic amplification of P-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia. Science 230, 1350-4.

Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-91.

Sambrook, J., Fritsch, E. F., and Maniatis T. (1989) (Eds). 'Molecular Cloning, a Laboratory Manual.' 2nd Edn. Vols 1-3. (Cold Spring Harbor.)

Schuler, M. A., and Zielinski, R. E. (1989). 'Methods in Plant Molecular Biology.' (Academic Press: San Diego.) 171 p.

Vunsh, R. A., Arie, R., and Stein, A. (1990). The use of the polymerase chain reaction (PCR) for the detection of bean yellow mosiac virus in gladiolus. Annals of Applied Biology 117, 561-9.

Vunsh, R. A., Arie, R. and Stein, A. (1991). Detection of bean yellow mosaic virus in gladioli corms by the polymerase chain reaction. Annals of Applied Biology 119, 289-94.

Wahyuni, W. S., and Francki, R. I. B. (1992). Responses of some grain and pasture legumes to 16 strains of cucumber mosaic virus (CMV). Australian Journal of Agricultural Research 43, 465-77.

Detection of CMV by PCR in Lupin Seeds

Wetzel, T., Candresse, T., Ravelonandro, M., and Dunez, J. (1991a). A polymerase chain reaction assay adapted to plum pox potyvirus detection. Journal of Virological Methods 33, 355-65.

Wetzel, T., Candresse, T., Ravelonandro, M., and Dunez, J. (1991b). An immunocap ture/polymerase chain reaction assay for plum pox potyvirus detection. Proceedings of the Eighth Conference of the Australasian Plant Pathology Society, Sydney. p. 10.

Manuscript received 13 May 1992, accepted 27 July 1992