Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8

http://dx.doi.org/100006-8993/& 2014 El

Abbreviations: AD

DG, dentate gyrus

aminobutyric acid;

nACSF, normal ar

depression; L-LTP,

YAC, yeast artificinCorresponding aE-mail addresses

bretthryciw@gmail.jgil@uvic.ca (J. Gil-M

Research Report

YAC128 Huntington's disease transgenic mice showenhanced short-term hippocampal synaptic plasticityearly in the course of the disease

Mohamed Ghilana,b, Crystal A. Bostroma, Brett N. Hryciwa,b, JessicaM. Simpsona,b, Brian R. Christiea,c,d, Joana Gil-Mohapela,n

aDivision of Medical Sciences, Island Medical Program, University of Victoria, Victoria, BC, CanadabDepartment of Biology, University of Victoria, Victoria, BC, CanadacBrain Research Centre and Program in Neuroscience, University of British Columbia, Vancouver, BC, CanadadDepartment of Cellular and Physiological Sciences, University of British Columbia, Vancouver, BC, Canada

a r t i c l e i n f o

Article history:

Accepted 7 June 2014

Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by

a polyglutamine expansion in the gene encoding the protein huntingtin. The disease

Available online 17 June 2014

Keywords:

Cognition

Hippocampus

Huntington's disease

Long-term potentiation

Short-term plasticity

YAC128 transgenic mice

.1016/j.brainres.2014.06.01sevier B.V. All rights res

, Alzheimer's disease;

; E-LTP, early long-term

HD, Huntington's disea

tificial cerebrospinal fluid

late long-term potentiat

al chromosomeuthor. Fax: þ1 350 772 55: mohamedghilan@gmailcom (B.N. Hryciw), jess.mohapel).

a b s t r a c t

progresses over decades, but often patients develop cognitive impairments that precede

the onset of the classical motor symptoms. Similar to the disease progression in humans,

the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive

dysfunction that precedes the onset of the neuropathological and motor impairments

characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and

long-term synaptic plasticity in the hippocampus, two related biological models of learning

and memory processes, were altered in YAC128 mice in early stages of disease progression.

We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in

paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced

post-tetanic and short-term potentiation are apparent in YAC128 mice after high-

frequency stimulation at this time. Early and late forms of long-term plasticity were not

altered at this stage. Together these findings indicate that there may be elevated

neurotransmitter release in response to synaptic stimulation in YAC128 mice during the

1erved.

ANOVA, analysis of variance; CA1, Cornu ammonis 1; CS, conditioning stimulus;

potentiation; fEPSPs, field excitatory post-synaptic potentials; GABA, gamma-

se; HFS, high-frequency stimulation; I/O, Input/Output; MPP, medial perforant path;

; NMDA, N-methyl-D-aspartate; LFS, low-frequency stimulation; LTD, long-term

ion; LTP, long-term potentiation; PCR, polymerase chain reaction; WT, wild-type;

05..com (M. Ghilan), crystal.bostrom@gmail.com (C.A. Bostrom),.nathan@gmail.com (J.M. Simpson), brain64@uvic.ca (B.R. Christie),

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8118

initial phase of disease progression. These abnormalities in short-term plasticity detected

at this stage in YAC128 HD transgenic mice indicate that aberrant information processing

at the level of the synapses may contribute, at least in part, to the early onset of cognitive

deficits that are characteristic of this devastating neurodegenerative disorder.

& 2014 Elsevier B.V. All rights reserved.

1. Introduction

Huntington's disease (HD) is an autosomal dominant neuro-degenerative disorder that affects approximately 1 in 20,000people worldwide (Harper, 1996). HD typically has an adultonset and is characterized by a variety of psychiatric, cogni-tive, and motor symptoms, culminating in death within 12–15years of the time of onset (Folstein, 1989). The earliestsymptoms of HD include mood swings, depression, irritability,and impaired learning andmemory. As the disease progresses,concentration on intellectual tasks becomes increasingly diffi-cult, and eventually patients may develop severe dementia(Harper, 1996). Interestingly, the cognitive deficits usuallyappear years before the onset of the classical motor symp-toms. Furthermore, post-mortem studies suggest that the firstcognitive symptoms appear in the absence of significantneurodegeneration and cell death (Vonsattel et al., 1985). Thus,it may be that impairments in cognition are caused by changesin neuronal communication preceding neuronal cell loss innon-striatal brain regions.

Changes in synaptic efficacy in the hippocampus arethought to underlie cognitive processes such as learningand memory (Bliss and Collingridge, 1993; Bruel-Jungermanet al., 2007a, 2007b; Citri and Malenka, 2008). Various studieshave reported impairments in long-term potentiation (LTP) inthe Cornu ammonis 1 (CA1) sub-region of the hippocampus ofknock-in (Lynch et al., 2007; Simmons et al., 2009) and R6/2transgenic (Murphy et al., 2000) HD mice, which express exon1 of the human HD gene with approximately 150 CAG repeats(Mangiarini et al., 1996). Conversely, enhanced LTP has alsobeen observed in the CA1 of yeast artificial chromosome(YAC) 72 HD mice (Usdin et al., 1999), which express the full-length human HD gene with 72 CAG repeats (Hodgson et al.,1999). This alteration was detected at 6 months of age, a time-point prior to the development of the behavioral phenotype.However, by 10 months, LTP could no longer be induced inthese full-length HD transgenic mice, a deficit that appears tobe associated with an increase in the resting levels of Ca2þ

within YAC neurons (Usdin et al., 1999).YAC128 HD transgenic mice express the full-length human

HD gene with 128 CAG repeats (Slow et al., 2003) and faithfullyrecapitulate many features of the human condition(Gil-Mohapel, 2012). These mice develop behavioral abnorm-alities that follow a biphasic pattern with an initial phase ofhyperactivity followed by the onset of motor deficits, whichcan be detected as early as 2 months and clearly by 4 monthsof age and finally by hypokinesis (Graham et al., 2006a, 2006b;Slow et al., 2003; Van Raamsdonk et al., 2007, 2005b, 2005c).Furthermore, YAC128 mice also develop mild cognitive defi-cits, which precede the onset of motor abnormalities and canbe detected as early as 2 months of age and progressively

deteriorate with the course of the disease (Van Raamsdonket al., 2005c). These mice also develop a depressive-likebehavior at the early stage of 3 months of age (Pouladiet al., 2009). At the neuropathological level, significant atro-phy of the striatum, globus pallidus and cortex can bedetected by stereological methods at 9 months of age (Slowet al., 2003; Van Raamsdonk et al., 2005a). However, subtleearly striatal neuropathological changes can be observed withmore sophisticated techniques (i.e., magnetic resonance ima-ging) as early as 3 months of age (Carroll et al., 2011). We haverecently reported deficits in adult hippocampal neurogenesis,a form of structural plasticity, in this full-length HD trans-genic mouse model (Simpson et al., 2011). Importantly,deficits in hippocampal neurogenesis can be detected as earlyas 3 months of age (Simpson et al., 2011), before the onset ofovert motor symptoms and the appearance of striatal neuro-pathological deficits (Slow et al., 2003). As alterations in bothstructural and functional hippocampal plasticity mightunderlie some of the early cognitive deficits characteristic ofthis HD transgenic mouse model (Van Raamsdonk et al.,2005c), in the present study we examined whether functional(i.e., synaptic) short- and long-term plasticity were alsoaltered during the early stages of the disease in YAC128HD mice.

2. Results

2.1. Normal basal synaptic transmission but reducedpaired-pulse depression in the dentate gyrus of YAC128 miceduring the early stages of disease progression

We evaluated synaptic transmission in 3- and 6-month oldYAC128 animals by constructing a field excitatory post-synaptic potential (fEPSP) Input/Output (I/O) curve in responseto a series of ascending stimulus intensities. For both age groups,the slope of the fEPSP significantly increased with increasingstimulation [repeated measures analysis of variance (ANOVA);F(1,806)¼1805.0, P¼0.0000]. There were no significant main effectsfor either genotype (F(1,806)¼0.0006, P¼0.98), or age (F(1,806)¼0.0005, P¼0.98), and no significant interaction was observedbetween age and genotype (F(1,806)¼0.16, P¼0.69) (I/O curve;Figs. 1A and B). This data indicate that synaptic transmissionis not significantly altered in the dentate gyrus (DG) of YAC128HD mice at the early stages of disease progression, and that atthis time they retain a normal capacity to exhibit single evokedresponses in response to synaptic stimulation.

In addition to single pulse stimulation, paired-pulse plasti-city was also assessed. To isolate excitatory responses, in theseexperiments the hippocampal slices were bathed in normalartificial cerebrospinal fluid (nACSF) containing the gamma-

Fig. 1 – The size of the evoked response is normal but paired-pulse depression is reduced in the dentate gyrus of 3- and6-month old YAC128 HDmice. Field electrophysiology recordings were obtained from YAC128mice at two ages: 3 and 6monthsof age. (A, B) A stimulus response curve was generated to examine field excitatory postsynaptic potentials (fEPSPs) by increasingthe pulse width in successive stimulations. No significant differences were observed for the two age groups analyzed. Insets for(A) and (B) show representative traces from 60, 150, and 300 μs obtained from WT and YAC128 DG slices from mice at 3 and 6months of age, respectively. (C, D) Paired-pulse (PP) plasticity was assessed by administering two pulses (50% maximumstimulus strength) sequentially (25–200 ms interpulse interval). Significant differences were observed at the 25, 100, and 150msintervals for 3-month old DG slices, and at the 25, 50, and 75 ms intervals for 6-month old DG slices, with YAC128 HD miceshowing reduced PP depression in response to the second stimulus in comparison to their age-matched WT littermates. Insetsfor C and D show representative traces at 50 ms interpulse intervals obtained fromWT and YAC128 DG slices. Three-month oldcohort: WT males (n¼2 mice, 4 slices), WT females (n¼3 mice, 7 slices), YAC128 males (n¼2 mice, 4 slices), YAC128 females(n¼3 mice, 6 slices); Six-month old cohort: WT males (n¼3 mice, 6 slices), WT females (n¼2 mice, 4 slices), YAC128 males (n¼2mice, 4 slices), YAC128 females (n¼3 mice, 6 slices). *, Po0.05 and **, Po0.01 as compared with age-matched WT controls; seetext for additional statistical details. For all graphs, YAC128, white; WT, black. For all insets, YAC128, gray; WT, black. Insetscale bars: A¼2 μs horizontal, 0.5 mV vertical; B¼2 μs horizontal, 0.3 mV vertical, C and D¼5ms horizontal, 0.2 mV vertical.

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8 119

aminobutyric acid (GABA)A antagonist bicuculline methiodide(5 mM) to block tonic inhibition (Chapman et al., 1998; Hanseand Gustafsson, 1992). Although this did not alter single evokedresponses, 3-month old YAC128 DG slices showed significantlyless paired-pulse depression than wild-type (WT) slices at 25,100 and 150ms intervals (Po0.05). This reduction in paired-pulse depression was also observed in 6-month old YAC128 DGslices at 25, 50, and 75ms intervals (Po0.01) (Figs. 1C and D).These results provide evidence for reduced paired-pulsedepression in the DG of YAC128 mice when compared withtheir age-matched WT controls during the initial phase of thedisease. This reduction in paired-pulse depression is indicative

of early alterations in presynaptic vesicle release at synapses inthe YAC128 mouse hippocampus.

2.2. Sustained post-tetanic and short-term potentiation inthe dentate gyrus of YAC128 mice during the early stages ofdisease progression

Post-tetanic potentiation is thought to result from multiplemechanisms, including enhanced neurotransmitter release(i.e., presynaptic changes) and alterations in receptor sensi-tivity (i.e., postsynaptic changes) that can last for a period ofminutes following the application of high-frequency

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8120

stimulation (HFS) (Citri and Malenka, 2008; Zucker andRegehr, 2002). The first minute after application of LTP-inducing HFS is thought to depend on enhanced presynapticneurotransmitter release (Citri and Malenka, 2008). Robustpost-tetanic potentiation one minute after stimulus wasobserved both in 3-month old WT (140.44727.90%) andYAC128 (131.66716.78%) DG slices, as well as 6-month oldWT (70.6579.62%) and YAC128 (124.69714.11%) DG slices(Fig. 2C). A 2-way ANOVA revealed no significant main effectof age (F(1,58)¼0.61, P¼0.44). However, a significant main effectof genotype (F(1,58)¼6.29, P¼0.015) and a significant interactionbetween age and genotype (F(1,58)¼6.29, P¼0.037) were detected,with DG evoked responses from WT slices showing an age-dependent reduction in post-tetanic potentiation (Po0.05). Thatis, slices from 6-month old WT animals showed less post-tetanic potentiation than their 3-month oldWT counterparts. Incontrast, YAC128 DG slices did not exhibit a similar age-dependent change in post-tetanic potentiation (P¼0.99)(Fig. 2C). Thus, 6-month old YAC128 mice did not show thenormal age-related decline in post-tetanic potentiation follow-ing HFS. This indicates that 6-month old YAC128 HD miceexhibit enhanced transmitter release in response to HFS.Together with the decrease in paired-pulse depression observedin these animals (Fig. 1), these results provide further evidencethat YAC128 mice show changes in presynaptic release proper-ties in the hippocampal DG before the onset of the character-istic striatal neuropathological deficits associated with HD (Slowet al., 2003; Van Raamsdonk et al., 2005a).

Postsynaptic changes in receptor sensitivity are thoughtto contribute to post-tetanic potentiation, however the timecourse of these changes are thought to have a slower decaytime constant (Zucker and Regehr, 2002). To determine ifthere might be any post-synaptic changes in these animals,we also analyzed evoked responses during the first fiveminutes following the application of HFS (Fig. 2D). A robustshort-term potentiation was also observed both in 3-monthold WT (143.40726.80%) and YAC128 (125.65714.56%) DGslices during the first five minutes following HFS. Short-term potentiation was reduced in 6-month old WT DG slices(69.11710.91%), while age-matched YAC128 DG slices wereable to maintain it at high levels (112.23714.60%) (Fig. 2D).However, a 2-way ANOVA failed to reveal a significant maineffect of genotype (F(1,58)¼0.49, P¼0.49), although a signifi-cant main effect of age was detected (F(1,58)¼6.24, P¼0.015)with slices from 6-month old animals showing a reductionin short-term potentiation when compared to slices from3-month old animals (Po0.05) (Fig. 2D). Nevertheless, atrend towards a significant interaction between age andgenotype was noted (F(1,58)¼3.18, P¼0.08). Indeed, when thetwo age groups are analyzed independently, no significantdifferences in short-term potentiation are evident at 3months of age between the two genotypes (Student's t-Test,P¼0.14). However, by 6 months of age, short-term potentia-tion is enhanced in YAC128 DG slices as compared to WTcontrol slices (Student's t-Test, Po0.001). Together with thefindings of reduced paired-pulse depression (Figs. 1C and D)and sustained post-tetanic potentiation (Fig. 2C), theseresults provide further evidence for enhanced short-termplasticity in YAC128 HD mice early in the course of thedisease.

2.3. Normal NMDA receptor-dependent long-termpotentiation in the dentate gyrus of YAC128 mice during theearly stages of disease progression

N-methyl-D-aspartate (NMDA) receptor-dependent LTP can bedivided into an early form that is independent of proteinsynthesis and a late form, which is maintained throughprotein synthesis (Citri and Malenka, 2008). Early LTP(E-LTP) was measured 30-min post HFS both in 3-month oldWT (60.31713.18%) and YAC128 (60.0378.44%) DG slices, aswell as in 6-month old WT (34.9678.15%) and YAC128(55.08710.06%) DG slices. No significant main effects ofgenotype (F(1,58)¼1.02, P¼0.32) or age (F(1,58)¼0.03, P¼0.87)and no significant interaction between age and genotype(F(1,58)¼0.03, P¼0.87) were observed (Fig. 2E).

Late LTP (L-LTP) was measured 60-minutes post-HFS bothin 3-month old WT (35.29712.37%) and YAC128 (32.0276.93%)DG slices, and in 6-month old WT (25.6077.27%) and YAC128(26.1477.46%) DG slices. Again, no significant main effects ofgenotype (F(1,58)¼0.03, P¼0.87) and age (F(1,58)¼0.83, P¼0.37)and no significant interaction between age and genotype(F(1,58)¼0.05, P¼0.83) were observed (Fig. 2F). Thus, while3- and 6-month old YAC128 mice show alterations in short-term plasticity in the hippocampal DG, the ability to induceand sustain LTP in this hippocampal sub-region appears to beintact up until 6 months of age.

2.4. Normal long-term depression in the dentate gyrus ofYAC128 mice during the early stages of disease progression

Application of low-frequency stimulation (LFS) resulted insubsequent long-term depression (LTD) in 3-month old WT(�18.6676.00%) and YAC128 (�16.7373.73%) DG slices, aswell as 6-month old WT (�29.0073.57%) and YAC128(�23.5673.48%) DG slices (Figs. 3A and B). A significant maineffect of age (F(1,53)¼4.25, Po0.05) was detected. However,further post-hoc analysis failed to reveal any significantdifferences between groups (P40.05). Additionally, no signifi-cant main effect of genotype (F(1,53)¼0.78, P¼0.38), and nosignificant interaction between age and genotype(F(1,53)¼0.18, P¼0.68) were observed. Thus, the ability toinduce and sustain LTD in the hippocampal DG of 3- and6-month old YAC128 HD mice appears to be unaffected.

3. Discussion

To date, much of the research on the mechanisms underlyingHD has focused on striatal degeneration, which primarilyaccounts for the motor impairments characteristic of thisdisorder. While other brain regions have received less atten-tion, HD patients also show cell loss in non-striatal brainregions, including the hippocampus (Rosas et al., 2003; Spargoet al., 1993; Vonsattel and DiFiglia, 1998). Hippocampaldysfunction in the absence of cell loss has also been repeat-edly shown in various HD transgenic mouse models. Indeed,alterations in functional (i.e., synaptic) (Gibson et al., 2005;Murphy et al., 2000) as well as structural (i.e., adult hippo-campal neurogenesis) (Fedele et al., 2011; Gil et al., 2005, 2004;Lazic et al., 2006, 2004; Phillips et al., 2005) plasticity have

Fig. 2 – YAC128 mice show sustained post-tetanic and short-term potentiation and no changes in LTP in the dentate gyrusearly in the course of the disease. (A, B) N-methyl-D-aspartate (NMDA) receptor dependent long-term potentiation (LTP) isunaffected in the DG of 3- and 6-month old YAC128 mice in comparison to their WT littermates. (C) WT mice show an age-dependent reduction in NMDA receptor-dependent post-tetanic potentiation (PTP) in the hippocampal DG. Such age-dependent reduction in PTP is not present in the DG of 6-month old YAC128 HD mice. (D) NMDA receptor-dependent short-term potentiation (STP) is reduced in the DG of 6-month old mice in comparison to their 3-month old counterparts. (E, F) DGearly protein synthesis-dependent (E-LTP) and late protein synthesis-independent LTP (L-LTP) are unaffected in YAC128 HDtransgenic mice both at 3 and 6 months of age. Three-month cohort: WT males (n¼4 mice, 6 slices), WT females (n¼3 mice,7 slices), YAC128 males (n¼8 mice, 10 slices), YAC128 females (n¼5 mice, 10 slices); Six-month old cohort: WT males (n¼2mice, 5 slices), WT females (n¼4 mice, 8 slices), YAC128 males (n¼2 mice, 4 slices), YAC128 females (n¼4 mice, 12 slices).*, Po0.05; see text for additional statistical details. For all graphs, YAC128, white; WT, black.

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8 121

Fig. 3 – YAC128 HD mice do not show changes in dentate gyrus LTD at 3 and 6 months of age. Post-tetanic depression andlong-term depression (LTD) are unaffected in the DG of 3- (A) and 6- (B) month old YAC128 mice in comparison to their age-matched WT littermate controls. Three-month cohort: WT males (n¼3 mice, 6 slices), WT females (n¼4 mice, 7 slices),YAC128 males (n¼6 mice, 8 slices), YAC128 females (n¼5 mice, 8 slices); six-month old cohort: WT males (n¼3 mice, 6 slices),WT females (n¼4 mice, 8 slices), YAC128 males (n¼2 mice, 5 slices), YAC128 females (n¼5 mice, 10 slices). For all graphs,YAC128, white; WT, black.

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8122

been repeatedly shown in the R6 lines. Additionally, we haverecently reported a specific reduction of adult hippocampalneurogenesis in YAC128 transgenic HD mice (Simpson et al.,2011). Importantly, both in R6/2 and YAC128 HD mice, suchfunctional and/or structural alterations can be detected in theabsence of cell loss in this brain region (Mangiarini et al.,1996; Slow et al., 2003) and very early in the course of thedisease, before the onset of motor deficits and/or the appear-ance of marked striatal neuropathology (Gil et al., 2005;Murphy et al., 2000; Simpson et al., 2011). Cognitive processes,such as learning and memory, are thought to depend, at leastin part, on changes in synaptic efficacy and neurogenesis inthe hippocampus (Bliss and Collingridge, 1993; Bruel-Jungerman et al., 2007a, 2007b; Citri and Malenka, 2008).Indeed, the hippocampal functional and structural deficitsobserved in these HD transgenic mouse models are accom-panied by an impairment of hippocampal-dependent beha-viors (i.e., spatial learning and memory) (Murphy et al., 2000;Nithianantharajah et al., 2008; Van Raamsdonk et al., 2005c)and/or the development of hippocampal-dependent affectivebehaviors (i.e., depressive-like phenotypes) (Pang et al., 2009;Pouladi et al., 2009), which at least in R6/1 mice, appear to berelated to a reduction in the expression of serotonin receptorsin the hippocampus (Pang et al., 2009). Together, thesestudies suggest that alterations in hippocampal functional(i.e., synaptic) and structural (i.e., adult neurogenesis) plasti-city may contribute to the changes in cognition and/or thedevelopment of affective behaviors (i.e., depression) thathave been repeatedly reported in human carriers of the HDmutation early on in the course of the disease (Albert et al.,1981; Butters et al., 1985; Caine et al., 1977; Huber andPaulson, 1987; Labuschagne et al., 2013; Stout et al., 2012).In addition, treatment of R6/1 (Grote et al., 2005) and R6/2(Peng et al., 2008) HD mice with the selective serotoninreuptake inhibitors fluoxetine (Grote et al., 2005) or sertraline(Peng et al., 2008) was shown to rescue the neurogenic deficitsobserved in these mice while also improving their cognitivefunction (Grote et al., 2005), motor performance, brain

atrophy, and survival (Peng et al., 2008), further suggestingthat changes in hippocampal plasticity have a functionalimpact in HD and that its modulation can be oftherapeutic value.

Here we report, for the first time, alterations in hippo-campal short-term plasticity in the YAC128 HD transgenicmouse model that can be detected early on in the course ofthe disease. We observed a significant reduction in paired-pulse depression in these animals at 3 and 6 months of age(Figs. 1C and D). Paired-pulse depression can result from theinactivation of voltage-dependent Naþ or Ca2þ channels, orfrom a temporary depletion of the readily releasable pool ofneurotransmitter vesicles docked at the presynaptic terminal(Citri and Malenka, 2008). One simple explanation for thereduction in paired-pulse depression could be that there isresidual Ca2þ left over from the first action potential, and thisCa2þ contributes to additional transmitter release in responseto the second stimulus. We observed a reduction in paired-pulse depression in YAC128 HD mice, suggesting that trans-mitter release is increased in response to the second pulse.

We also evaluated post-tetanic potentiation (during thefirst minute following HFS; Fig. 2C) and short-term potentia-tion (during the initial five minutes following HSF; Fig. 2D).Post-tetanic potentiation is a reliable phenomenon thatoccurs immediately following the application of HFS in thesesynapses (within one minute), and it is thought to reflectenhanced neurotransmitter release (Citri and Malenka, 2008).Short-term potentiation occurs over a slightly longer timecourse (approximately five minutes) and it is believed toreflect both enhanced neurotransmitter release (i.e., presy-naptic changes) and the initial increase in the postsynapticreceptor response (Citri and Malenka, 2008; Zucker andRegehr, 2002). Interestingly, while WT mice showed an age-related reduction in post-tetanic potentiation, YAC128 HDmice showed enhanced post-tetanic potentiation when com-pared to their age-matched WT controls (Fig. 2C). Similarly,YAC128 HD mice fail to show an age-related reduction inshort-term potentiation that was observed in age-matched

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8 123

WT mice (Fig. 2D). This finding of enhanced short-termpotentiation in the DG of 6 month-old YAC128 mice suggeststhat they may show enhanced post-tetanic transmitterrelease and an increase in post-synaptic receptor sensitivitynot normally found in age-matched WT animals.

The presynaptic changes that occur during short-termplasticity are thought to be largely due to a sustained increasein presynaptic intracellular Ca2þ concentration in response tothe administration of HFS trains. This increased residual Ca2þ

combined with the additional Ca2þ influx that is triggered bythe following action potential results in enhanced neuro-transmitter release (Zucker and Regehr, 2002). In YAC128mice, there is a maintained capacity to show post-tetanicpotentiation with age (i.e., up to 6 months of age). While thismay be beneficial for enabling synaptic plasticity, it may alsobe that this contributes to an increased susceptibility toexcitotoxicity in DG neurons at this time. In agreement withthis hypothesis, previous studies in R6/2 (Klapstein andLevine, 2005) and YAC128 (Graham et al., 2009) HD transgenicmice have shown that the development of striatal excitotoxi-city follows a biphasic pattern, whereby an increased sus-ceptibility to striatal excitotoxic insults can be observed earlyon, before the development of overt behavioral phenotypes.In R6/2 mice, corticostriatal fEPSPs show increased sensitivityto an ischemic insult (i.e., excitotoxicity) before the onset ofovert behavioral deficits (i.e., around 3–4 weeks of age),whereas at later time points (i.e., after the development ofovert behavioral symptoms) R6/2 corticostriatal fEPSPs main-tain a relative tolerance to ischemia (Klapstein and Levine,2005). Similarly, YAC128 mice display enhanced striatalsensitivity to quinolinic acid in vivo while showing increasedNMDA receptor-mediated membrane currents in striatalmedium spiny neurons before the development of overtbehavioral deficits, whereas symptomatic YAC128 micebecome resistant to quinolinic acid-induced striatal neuro-toxicity and present reduced NMDA receptor-mediated mem-brane currents in striatal medium spiny neurons (Grahamet al., 2009). On the other hand, this initial increased sensi-tivity to glutamate-mediated excitotoxicity is believed toresult in Ca2þ overload (Bezprozvanny and Hayden, 2004)and eventually lead to neuronal degeneration in the HDstriatum (Estrada Sánchez et al., 2008; Gil and Rego, 2008).Indeed, previous studies using in vivo microdialysis haveshown increased glutamate release in the striatum of R6/1HD transgenic mice (NicNiocaill et al., 2001), which expressexon 1 of the human HD gene with approximately 115 CAGrepeats (Mangiarini et al., 1996). In addition, in vitro studiesusing YAC128 striatal neurons have demonstrated that repe-titive pulses of glutamate result in apoptosis through theactivation of glutamate receptors (including the NMDA recep-tor), which lead to an increase in intracellular Ca2þ concen-tration with a consequent Ca2þ overload of the mitochondriaand the opening of the mitochondrial permeability transitionpore and induction of the mitochondrial apoptotic pathway(i.e., release of cytochrome c and activation of caspases)(Tang et al., 2005). Moreover, NMDA receptor-mediated tran-sients are also significantly enhanced in YAC72 striatalneurons, leading to an elevation of the intracellular Ca2þ

concentration and the activation of the intrinsic mitochon-drial apoptotic pathway (Zeron et al., 2004). Indeed, in the

YAC72 HD mouse model, an increase in glutamate-mediatedexcitotoxicity has been shown to selectively affect striatalmedium-sized spiny neurons as well as cortical neurons (i.e.,the most affected neuronal populations in the HD brain), withno effect on cerebellar granule cells, which are spared in HD(Zeron et al., 2002). To date, no study has evaluated whetheran increase in excitotoxicity also occurs in the hippocampus(in particular in the DG) of HD transgenic mouse models.However, in a lesion model of HD, intrastriatal injections ofthe NMDA receptor agonist quinolinic acid resulted in exci-totoxicity and oxidative stress not only in the striatum butalso in the hippocampus of quinolinic acid-treated rats(Maksimović et al., 2001). Given the enhanced short-termplasticity in YAC128 hippocampal DG neurons reported here,future studies are warranted to complement these resultsand further evaluate by in vivo microdialysis neurotransmit-ter (i.e., glutamate) release in the hippocampal DG of thesetransgenic HD mice and to determine whether this specificneuronal population also becomes more susceptible to exci-totoxicity during the course of the disease.

Our results further support the idea that dysregulation ofsynaptic function in YAC128 mice begins with increased excit-ability, resulting in elevated intracellular Ca2þ levels and, conse-quently, increased neurotransmitter release (i.e., enhanced post-tetanic potentiation). On the other hand, our findings furthersuggest that enhanced postsynaptic receptor sensitivity maylead to further overstimulation of post-synaptic neurons. Thisis significant, as elevated neurotransmitter release coupled withreceptor hypersensitivity may result in intracellular Ca2þ over-load and neuronal cell death (Bezprozvanny and Hayden, 2004).Additionally, decreased clearance of glutamate at the synapsethrough a reduction in glutamate uptake by the glial glutamatetransporter GLT-1 could also contribute to elevated glutamatelevels at the synapse and consequently, the increased hippo-campal short-term plasticity reported here. In agreement,reduced GLT-1 mRNA levels and decreased glutamate uptakehave been described in HD post-mortem brains (Arzberger et al.,1997; Hassel et al., 2008) while decreased levels of GLT-1 andimpaired glutamate transport have been shown in the striatumof R6/2 HD transgenic mice (Behrens et al., 2002; Estrada-Sánchezet al., 2009, 2010). Furthermore, a reduction in GLT-1-mediatedglutamate uptake (that appears to result from impaired GLT-1palmitoylation) can also be detected in the striatum of YAC128HD transgenic mice as early as 3 months of age, prior to obviousneuropathological findings, and in the cortex by 12 months(Huang et al., 2010). To date, no studies have evaluated whetherdeficits in GLT-1-mediated glutamate reuptake also occur in thehippocampus of HD transgenic mice. Future studies are thuswarranted to test whether an impairment in glutamate clearancemay also contribute to the increase in hippocampal short-termplasticity reported here.

Interestingly, we did not find any significant changes in thesize of evoked responses in the DG of 3- and 6-month oldYAC128 mice. This is similar to previous reports on evokedpotentials in the CA1 region of both knock-in (Usdin et al., 1999)and R6 transgenic HD mouse models (Milnerwood et al., 2006;Murphy et al., 2000; Usdin et al., 1999). However, contrary to ourobservations in the DG of YAC128 mice, these studies showedimpairments in CA1 post-tetanic potentiation following HFS inknock-in (Usdin et al., 1999) and R6/1 (Murphy et al., 2000) HD

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8124

mice. Moreover, paired-pulse facilitation was decreased in theCA1 of knock-in (Usdin et al., 1999), and unaffected in the CA1of R6/2 (Murphy et al., 2000) and R6/1 (Milnerwood et al., 2006)mice. These discrepancies are likely indicative of differentmechanisms operating within these two sub-regions of thehippocampus (i.e., the CA1 and the DG). Furthermore, differ-ences between the mouse models used, age of the animals, andstage of disease progression at the time of experimentation arealso variables that should be taken into consideration whencomparing results from different studies. It is important to note,however, that the YAC128 HD mouse model presents a slowprogression of the disease, and that the accelerated phenotypesof other HD transgenic mice (such as the R6 lines) do not mimicwell the adult onset and slow progression of symptoms that ischaracteristic of the human condition (Crook and Housman,2011; Gil-Mohapel, 2012; Heng et al., 2008; Ramaswamy et al.,2007). Moreover, our findings are in accordance with a recentstudy showing evidence of enhanced synaptic plasticity in pre-manifest HD carriers (Beste et al., 2014). Using behavioral andelectrophysiological measurements, these authors have shownthat the efficacy of protocols used to induce neural plasticityduring processes of attention selection is increased in pre-manifest HD patients. This increase in synaptic plasticity inbrain regions associated with attention selection is thought tobe the result of the excitotoxic mechanisms that underlie thepathophysiology of HD (Beste et al., 2014), further supportingthe idea that the enhancement in short-term synaptic plasticitywe observed in the hippocampus of early symptomatic YAC128HD mice may be related to an increase in excitotoxicity in thisbrain region.

In spite of our findings of abnormal hippocampal short-termplasticity in HD YAC128 mice during the early stages of diseaseprogression, long-term changes in hippocampal synaptic plas-ticity (i.e., LTP and LTD) were not apparent up to 6 months ofage. Both protein synthesis independent E-LTP and proteinsynthesis dependent L-LTP were not impaired in 3- and 6-month old YAC128 HD mice. This is similar to a previous reportin the R6/2 mouse model, where normal levels of LTP were alsoobserved during the pre-symptomatic stage. Deficits in LTPwere only apparent at later stages of the disease when anincrease in the number of neuronal intranuclear inclusions inthis hippocampal sub-region became apparent (Murphy et al.,2000). Interestingly, although some EM48 nuclear immunoreac-tivity (indicative of mutant huntingtin nuclear localization) canbe detected in the CA3 and DG sub-regions of the YAC128hippocampus as early as 3 months of age (Van Raamsdonket al., 2005a), obvious neuronal intranuclear inclusions are notapparent in the hippocampus of these HD transgenic mice up to18 months of age, when animals have reached a late-stage ofdisease progression (Slow et al., 2005). Additionally, eventhough a relationship exists between LTP and adult hippocam-pal neurogenesis (Bruel-Jungerman et al., 2007a, 2007b) wherebynew DG neurons present a low threshold for LTP induction andthe ability to produce stable LTP more readily than matureneurons (Saxe et al., 2006; Snyder et al., 2005), we were unableto detect a decrease in this form of synaptic plasticity in the DGof YAC128 mice at an age when a reduction in adult hippo-campal neurogenesis can already be noticed (Simpson et al.,2011). It might be that a substantial decrease in neurogenesis(such as that detected at later stages of the disease; Simpson

et al., 2011) is necessary in order to impact the ability to induceLTP. Thus, it is possible that as the disease progresses andYAC128 mice present with substantial neuronal intranuclearinclusions in the hippocampus and/or show a drastic reductionin hippocampal neurogenesis, impairments in DG LTP can alsobe noticed. Future experiments will clarify if that is indeed thecase. In the current study we also found that the capacity forLTD was not altered in the DG of YAC128 mice during the earlystages of disease progression. This suggests that compensatorymechanisms may be engaged to help maintaining a balancebetween LTP and LTD in a degenerating system. Future studiesare warranted in order to test this hypothesis.

Finally, it is important to note that although significantatrophy of the striatum, globus pallidus and cortex can only bedetected by stereological methods at 9 months of age in YAC128HD mice (Slow et al., 2003; Van Raamsdonk et al., 2005a), subtleearly striatal neuropathological changes can be observed bymagnetic resonance imaging as early as 3 months of age(Carroll et al., 2011). Thus, the cognitive deficits seen in earlysymptomatic YAC128 mice (Van Raamsdonk et al., 2005c) likelyreflect a combination of both corticostriatal dysfunction (Carrollet al., 2011) and deficits in hippocampal structural (Simpsonet al., 2011) and short-term synaptic plasticity, as described in thepresent study.

4. Conclusions

We demonstrate that YAC128 transgenic mice showenhanced short-term plasticity in the hippocampal DG earlyon during the course of the disease. Our results indicate thatin the YAC128 DG, presynaptic terminals sustain increasedneurotransmitter release and enhanced postsynaptic recep-tor sensitivity with repeated HFS. We speculate that thismechanism, while perhaps beneficial during the initial stagesof the disease, might eventually render these neurons sus-ceptible to excitotoxicity and neurodegeneration as the dis-ease progresses. Importantly, these findings indicate thatearly on during the course of the disease (i.e., before theonset of motor striatal neuropathology) aberrant informationprocessing at the level of the synapses can already bedetected in the hippocampal DG of YAC128 HD mice. Thesealterations in functional plasticity (i.e., short-term synapticplasticity), together with a simultaneous reduction in struc-tural plasticity (i.e., adult hippocampal neurogenesis)(Simpson et al., 2011), and early neuropathological changesin the corticostriatal circuitry (Carroll et al., 2011), mayunderlie some of the cognitive (Van Raamsdonk et al.,2005c) and affective (Pouladi et al., 2009) deficits that can alsobe detected in this transgenic HD mouse model at this earlystage of disease progression. Similar alterations might alsocause the subtle changes in cognitive function that can bedetected in pre-manifest HD carriers, providing potentialtargets for therapeutic interventions before the onset of theclassical motor symptoms seen in HD.

Finally, it is worth noting that synaptic dysfunction is alsopresent in other neurodegenerative diseases that are asso-ciated with cognitive impairments such as Alzheimer's Dis-ease (AD). In the case of AD, changes in synapse structureand function as well as frank synapse and neuronal loss are

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8 125

thought to contribute to the dysfunction of hippocampalcircuits involved in learning and memory thus causing thecognitive deficits characteristic of this disorder (Klyubin et al.,2012; Nisticò et al., 2012; Spires-Jones and Knafo, 2012).Indeed, similar to our findings in YAC128 HD mice, a recentstudy has shown enhanced short-term plasticity in thehippocampus of 3xTgAD mice, pointing toward an heigh-tened excitation state in the hippocampus of these ADtransgenic mice as an early step in the neuropathologicalmechanisms that culminate in neuronal excitotoxicity andimpaired memory performance observed in this diseasemodel (Davis et al., 2014). Abnormal short-term hippocampalplasticity associated with a dysregulation of intracellular Ca2þ

concentration was also found in a different AD transgenicmouse model, the Tg2576 mouse (Lee et al., 2012). Hence,alterations in hippocampal short-term synaptic plasticitymight represent a common mechanism in the developmentof cognitive deficits associated with neurodegenerative pro-cesses such as those present in AD and HD. Given the gradualand slow progression of these diseases, early identification ofsubtle changes in short-term synaptic plasticity may prove tobe crucial in revealing optimal therapeutic windows. Addi-tionally, therapeutic strategies aimed at rescuing these def-icits in synaptic plasticity may be valuable in slowingcognitive decline not only in HD but also other neurodegen-erative diseases such as AD that are characterized by hippo-campal dysfunction and cognitive decline.

5. Experimental procedure

5.1. Animals

YAC128 transgenic mice (Slow et al., 2003) and their WTlittermates were used for these experiments (YAC128¼19;WT¼15). The YAC128 transgenic colony was maintained onthe FVB/N background strain (Charles River, Wilmington, MA,USA). Animals were sexed, weaned, and ear-punched at post-natal day 24 and group-housed with minimal enrichment(free access to tubes or nestlets) and ad libitum access to foodand water. The colony was maintained in a normal 12 h light/dark cycle and ambient temperature and humidity. Allexperimental procedures were conducted in accordance withthe University of Victoria Animal Care Committee and theCanadian Council for Animal Care policies. All efforts weremade to minimize animal suffering and the number ofanimals used in these experiments.

5.2. Genotyping

Ear tissue samples for DNA extraction were placed in 100 mLLysis Solution (40 mL Tris pH 9, 50 mL KCl, 20 mL Proteinase K,20 mL Tween 20, 870 mL Milli-Q H2O) in a nuclease-free 1.5 mLEppendorf tube and incubated in an Eppendorf Thermomixer R(Eppendorf, Mississauga, ON, Canada) at 55 1C and 300 RPM for3 h. Samples were then centrifuged at 21,000g for 3min and thesupernatant transferred to a new tube. 20 mL of RNAse A wereadded to samples followed by vortexing and incubation at roomtemperature for 2 min. 200 mL of lysis buffer followed by 200 mLof anhydrous ethyl alcohol were then added to the solution and

vortexed. Lysates were transferred to clean spin columns andcentrifuged at 10,000g for 1min. 500 mL of wash buffer wereadded, followed by a 10,000g centrifugation for 1 min. 500 mL ofwash buffer II were then added followed by a 21,000g centrifu-gation for 3 min. Elution buffer was added and samples wereincubated for 1min at room temperature before centrifugationat 21,000g for 1 min.

The polymerase chain reaction (PCR) was performed bymixing 10.8 mL nuclease-free H2O, 2.5 mL PCR reaction buffer,3 mL (50 mM) MgCl2, 4 mL (2.5 mM) deoxyribonucleotide tripho-sphate (dNTP), 0.5 mL of each forward and reverse primer,0.75 mL of each positive control primer, 2 mL DNA, and 0.2 mLTaq DNA polymerase (Invitrogen, Burlington, ON, Canada). Thecycling parameters employed were: first cycle of 3 min at 94 1C,then 35 cycles of 30 s at 94 1C, 30 s at 63 1C, and 30 s at 72 1Cfollowed by 10min at 72 1C and an infinite hold at 4 1C untilelectrophoresis was performed. The following primers wereused to test for genotype: LYA1¼50 CCTGCTCGCTTCGCT-ACTTGGAGC 30, LYA2¼50 GTCTTGCGCCTTAAACCAACTTGG30, RYA1¼50 CTTGAGATCGGGCGTTCGACTCGC 30, RYA2¼50 CC-GCACCTGTGGCGCCGGTGATGC 30. The following positive con-trol primers were used: actin R¼50 AGCCTCAGGGCATCGGAACC30 and actin F¼50 GGAGACGGGGTCACCCACAC 30. PCR productswere run on a 1.5% agarose gel with 10,000� SYBR-safe andvisualized under a BioRad trans-illuminator (BioRad, Missis-sauga, ON, Canada).

5.3. Electrophysiology

5.3.1. Slice preparationAt either 3 or 6 months of age, mice were anesthetized withisoflurane (Abbott Laboratories, North Chicago, IL, USA),rapidly decapitated, and their brains removed in oxygenated(95% O2/5% CO2), ice-cold nACSF [(in mM) 125 NaCl, 2.5 KCl,1.25 NaHPO4, 25 NaHCO3, 2 CaCl2, 1.3 MgCl2, and 10 dextrose,pH 7.3]. Transverse hippocampal slices (350 mm) were sec-tioned using a Vibratome 1500 (Ted Pella Inc., Redding, CA,USA). Sections were collected in order using a modified 24-well plate and kept in continuously oxygenated nACSF at35 1C. Sections were allowed to rest for a minimum of 1.5 hbefore recordings commenced.

5.3.2. Field electrophysiological recordingsField recordings were collected as previously described (Eadieet al., 2012). A single glass-recording electrode (1–2 MΩ) wasutilized to record fEPSPs. The recording electrode was filledwith nACSF and placed in the medial perforant path (MPP)approximately 200 mm from the stimulating electrode. Stimu-lation magnitude was set to elicit a response of approxi-mately 50%. Paired-pulse recordings were conducted on naiveslices bathed in nACSF containing the GABAA receptorantagonist bicuculline methiodide (5 mM; Sigma-Aldrich, Oak-ville, ON, Canada) for 10 min prior to and during all paired-pulse stimulation paradigms to reduce tonic inhibition in theDG (Chapman et al., 1998; Hanse and Gustafsson, 1992) andisolate the excitatory component of synaptic transmission.Recordings were obtained using subsequent interpulse inter-vals of 25, 50, 75, 100, 150, and 200 ms (5� ; 20 s betweenpairings; 2.5 min between paired-pulse protocols).

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8126

A separate cohort of slices was utilized for long-termplasticity experiments. A stable baseline (minimum 20 min)of the slope of fEPSPs (elicited every 15 s) was establishedbefore a conditioning stimulus (CS) was delivered to inducelong-term synaptic plasticity. Baseline stimulation para-meters were returned to following the CS (for a minimumof 60 min). An I/O curve was constructed by increasing thestimulation magnitude in a step-wise fashion (30- to 300-mspulse width; 30-ms intervals). All analyses were conductedusing Axon ClampFit 10.2 software (Molecular Devices, Sun-nyvale, CA, USA).

5.3.3. Conditioning stimulation protocolsLTP of fEPSPs was induced by administering four trains of 50pulses at 100 Hz, 30 s apart (HFS). Bicuculline methiodide wasapplied to the bath for 10 min prior to and during HFS. LTD offEPSPs was induced by administering 900 pulses at 1 Hz overa 15-min period (LFS).

5.4. Statistical analysis

All statistical analyses were performed using the Statistica 7.0software (StatSoft, Tulsa, OK, USA). Group data are presentedas mean7standard error of the mean. For all analyses, nosignificant differences between sexes were obtained (data notshown) and therefore data from males and females werecombined. Data from I/O experiments were analyzed by arepeated measures analysis of variance (ANOVA). Data frompaired-pulse depression experiments and differencesbetween the slopes of the fEPSPs obtained during the firstpulse of the paired-pulse depression experiments were ana-lyzed using individual two-tail unpaired Student t-Tests aspreviously described (Usdin et al., 1999). Data from LTP andLTD experiments were analyzed with a two-way ANOVA forgenotype and age. The slopes of the fEPSPs were analyzedwith a one-way repeated-measures ANOVA (with genotype asthe within-subjects variable and stimulation strength as thebetween-subjects variable). Post-hoc analyzes were per-formed using the Tukey post-hoc test. A P value of o0.05was considered statistically significant.

Acknowledgments

The authors would like to thank Dr. Michael Hayden (Centre forMolecular Medicine and Therapeutics, University of BritishColumbia, Vancouver, BC, Canada) for donating the YAC128breeding pairs used to initiate the colony at the University ofVictoria. The authors would also like to acknowledge JenniferGraham for breeding and maintaining the YAC128 mousecolony. J.M.S. was supported by scholarships from the NaturalSciences and Engineering Research Council of Canada (NSERC)and the Michael Smith Foundation for Health Research (MSFHR;Canada). B.R.C. is a Michael Smith Senior Scholar and issupported by grants from NSERC, the Canadian Institutes ofHealth Research (CIHR), MSFHR, and the Canada Foundation forInnovation (CFI). J.G.M. acknowledges post-doctoral fundingfrom the MSFHR and research funding from the Ciência SemFronteiras/CNPq (Science Without Borders) funding program ofthe Brazilian Federal Government.

r e f e r e n c e s

Albert, M.S., Butters, N., Brandt, J., 1981. Development of remotememory loss in patients with Huntington’s disease. J. Clin.Neuropsychol. 3, 1–12.

Arzberger, T., Krampfl, K., Leimgruber, S., Weindl, A., 1997.Changes of NMDA receptor subunit (NR1, NR2B) andglutamate transporter (GLT1) mRNA expression inHuntington’s disease—an in situ hybridization study. J.Neuropathol. Exp. Neurol. 56, 440–454.

Behrens, P.F., Franz, P., Woodman, B., Lindenberg, K.S.,Landwehrmeyer, G.B., 2002. Impaired glutamate transport andglutamate–glutamine cycling: downstream effects of theHuntington mutation. Brain 125, 1908–1922.

Beste, C., Stock, A.K., Ness, V., Hoffmann, R., Saft, C., 2014.Evidence for divergent effects of neurodegeneration inHuntington’s disease on attentional selection and neuralplasticity: implications for excitotoxicity. Brain Struct. Funct.(Electronic publication ahead of print).

Bezprozvanny, I., Hayden, M.R., 2004. Deranged neuronal calciumsignaling and Huntington disease. Biochem. Biophys. Res.Commun. 322, 1310–1317.

Bliss, T.V.P., Collingridge, G.L., 1993. A synaptic model of memory:long-term potentiation in the hippocampus. Nature 361,31–39.

Bruel-Jungerman, E., Davis, S., Laroche, S., 2007a. Brain plasticitymechanisms and memory: a party of four. Neurosci 13,492–505.

Bruel-Jungerman, E., Rampon, C., Laroche, S., 2007b. Adulthippocampal neurogenesis, synaptic plasticity and memory:facts and hypotheses. Rev. Neurosci. 18, 93–114.

Butters, N., Wolfe, J., Martone, M., Granholm, E., Cermak, L.S.,1985. Memory disorders associated with huntington’s disease:verbal recall, verbal recognition and procedural memory.Neuropsychologia 23, 729–743.

Caine, E.D., Ebert, M.H., Weingartner, H., 1977. An outline for theanalysis of dementia. Neurology 27, 1087–1092.

Carroll, J.B., Lerch, J.P., Franciosi, S., Spreeuw, A., Bissada, N.,Henkelman, R.M., Hayden, M.R., 2011. Natural history ofdisease in the YAC128 mouse reveals a discrete signature ofpathology in Huntington disease. Neurobiol. Dis. 43, 257–265.

Chapman, C.A., Perez, Y., Lacaille, J.C., 1998. Effects of GABA(A)inhibition on the expression of long-term potentiation in CA1pyramidal cells are dependent on tetanization parameters.Hippocampus 8, 289–298.

Citri, A., Malenka, R.C., 2008. Synaptic plasticity: multiple forms,functions, and mechanisms. Neuropsychopharmacology 33,18–41.

Crook, Z.R., Housman, D., 2011. Huntington’s disease: can micelead the way to treatment? Neuron 69, 423–435.

Davis, K.E., Fox, S., Gigg, J., 2014. Increased hippocampalexcitability in the 3xTgAD mouse model for Alzheimer’sdisease in vivo. PLoS One 9, e91203.

Eadie, B.D., Cushman, J., Kannangara, T.S., Fanselow, M.S.,Christie, B.R., 2012. NMDA receptor hypofunction in thedentate gyrus and impaired context discrimination in adultFmr1 knockout mice. Hippocampus 22, 241–254.

Estrada Sanchez, A.M., Mejıa-Toiber, J., Massieu, L., 2008.Excitotoxic neuronal death and the pathogenesis ofHuntington’s disease. Arch. Med. Res. 39, 265–276.

Estrada-Sanchez, A.M., Montiel, T., Massieu, L., 2010. Glycolysisinhibition decreases the levels of glutamate transporters andenhances glutamate neurotoxicity in the R6/2 Huntington’sdisease mice. Neurochem. Res. 35, 1156–1163.

Estrada-Sanchez, A.M., Montiel, T., Segovia, J., Massieu, L., 2009.Glutamate toxicity in the striatum of the R6/2 Huntington’sdisease transgenic mice is age-dependent and correlates with

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8 127

decreased levels of glutamate transporters. Neurobiol. Dis. 34,

78–86.Fedele, V., Roybon, L., Nordstrom, U., Li, J.Y., Brundin, P., 2011.

Neurogenesis in the R6/2 mouse model of Huntington’s

disease is impaired at the level of NeuroD1. Neuroscience 173,

76–81.Folstein, M.F., 1989. Heterogeneity in Alzheimer’s Disease.

Neurobiol. Aging 10, 434–435.Gibson, H.E., Reim, K., Brose, N., Morton, A.J., Jones, S., 2005. A

similar impairment in CA3 mossy fibre LTP in the R6/2 mouse

model of Huntington’s disease and in the complexin II

knockout mouse. Eur. J. Neurosci. 22, 1701–1712.Gil, J.M., Mohapel, P., Araujo, I.M., Popovic, N., Li, J.Y., Brundin, P.,

Petersen, A., 2005. Reduced hippocampal neurogenesis in R6/2

transgenic Huntington’s disease mice. Neurobiol. Dis. 20,

744–751.Gil, J.M., Rego, A.C., 2008. Mechanisms of neurodegeneration in

Huntington’s disease. Eur. J. Neurosci. 27, 2803–2820.Gil, J.M.A.C., Leist, M., Popovic, N., Brundin, P., Petersen, A., 2004.

Asialoerythropoetin is not effective in the R6/2 line of

Huntington’s disease mice. BMC Neurosci. 10, 1–10.Gil-Mohapel, J.M., 2012. Screening of therapeutic strategies for

Huntington’s disease in YAC128 transgenic mice. CNS

Neurosci. Ther. 18, 77–86.Graham, R.K., Deng, Y., Slow, E.J., Haigh, B., Bissada, N., Lu, G.,

Pearson, J., Shehadeh, J., Bertram, L., Murphy, Z., Warby, S.C.,

Doty, C.N., Roy, S., Wellington, C.L., Leavitt, B.R., Raymond, L.

a., Nicholson, D.W., Hayden, M.R., 2006a. Cleavage at the

Caspase-6 Site Is Required for Neuronal Dysfunction and

Degeneration Due to Mutant Huntingtin. Cell 125, 1179–1191.Graham, R.K., Pouladi, M.A., Joshi, P., Lu, G., Deng, Y., Wu, N.-P.,

Figueroa, B.E., Metzler, M., Andre, V.M., Slow, E.J., Raymond, L.,

Friedlander, R., Levine, M.S., Leavitt, B.R., Hayden, M.R., 2009.

Differential susceptibility to excitotoxic stress in YAC128

mouse models of Huntington disease between initiation and

progression of disease. J. Neurosci. 29, 2193–2204.Graham, R.K., Slow, E.J., Deng, Y., Bissada, N., Lu, G., Pearson, J.,

Shehadeh, J., Leavitt, B.R., Raymond, L. a, Hayden, M.R., 2006b.

Levels of mutant huntingtin influence the phenotypic severity

of Huntington disease in YAC128 mouse models. Neurobiol.

Dis. 21, 444–455.Grote, H.E., Bull, N.D., Howard, M.L., van Dellen, A., Blakemore, C.,

Bartlett, P.F., Hannan, A.J., 2005. Cognitive disorders and

neurogenesis deficits in Huntington’s disease mice are

rescued by fluoxetine. Eur. J. Neurosci. 22, 2081–2088.Hanse, E., Gustafsson, B., 1992. Long-term potentiation and field

EPSPs in the lateral and medial perforant paths in the dentate

gyrus in vitro: a comparison. Eur. J. Neurosci. 4, 1191–1201.Harper, P.S., 1996. New genes for old diseases: the molecular basis

of myotonic dystrophy and Huntington’s disease. The

Lumbeian Lecture 1995. J. R. Coll. Physicians Lond. 30, 221–231.Hassel, B., Tessler, S., Faull, R.L.M., Emson, P.C., 2008. Glutamate

uptake is reduced in prefrontal cortex in Huntington’s disease.

Neurochem. Res. 33, 232–237.Heng, M.Y., Detloff, P.J., Albin, R.L., 2008. Rodent genetic models of

Huntington disease. Neurobiol. Dis. 32, 1–9.Hodgson, J.G., Agopyan, N., Gutekunst, C.-A., Leavitt, B.R.,

LePiane, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon,

K., Nasir, J., Jamot, L., Li, X.-J., Stevens, M.E., Rosemond, E.,

Roder, J.C., Phillips, A.G., Rubin, E.M., Hersch, S.M., Hayden, M.

R., 1999. A YAC mouse model for Huntington’s disease with

full-length mutant Huntingtin, cytoplasmic toxicity, and

selective striatal neurodegeneration. Neuron 23, 181–192.Huang, K., Kang, M.H., Askew, C., Kang, R., Sanders, S.S., Wan, J.,

Davis, N.G., Hayden, M.R., 2010. Palmitoylation and function of

glial glutamate transporter-1 is reduced in the YAC128 mouse

model of Huntington disease. Neurobiol. Dis. 40, 207–215.

Huber, S.J., Paulson, G.W., 1987. Memory impairment associated

with progression of Huntington’s disease. Cortex 23, 275–283.Klapstein, G.J., Levine, M.S., 2005. Age-dependent biphasic

changes in ischemic sensitivity in the striatum of

Huntington’s disease R6/2 transgenic mice. J. Neurophysiol.

93, 758–765.Klyubin, I., Cullen, W.K., Hu, N., Rowan, M.J., 2012. Alzheimer’s

disease Aβ assemblies mediating rapid disruption of synaptic

plasticity and memory. Mol. Brain 5, 1–10.Labuschagne, I., Jones, R., Callaghan, J., Whitehead, D., Dumas, E.

M., Say, M.J., Hart, E.P., Justo, D., Coleman, A., Dar Santos, R.C.,

Frost, C., Craufurd, D., Tabrizi, S.J., Stout, J.C., 2013. Emotional

face recognition deficits and medication effects in pre-

manifest through stage-II Huntington’s disease. Psychiatry

Res. 207, 118–126.Lazic, S.E., Grote, C.A.H., Armstrong, R.J.E., Blakemore, C.,

Hannan, A.J., Dellen, A., Van, Barker, R.A., 2004. Decreased

hippocampal cell proliferation in R6/1 Huntington ’ s mice.

Neuroreport 15, 811–813.Lazic, S.E., Grote, H.E., Blakemore, C., Hannan, A.J., van Dellen, A.,

Phillips, W., Barker, R.A., 2006. Neurogenesis in the R6/1

transgenic mouse model of Huntington’s disease: effects of

environmental enrichment. Eur. J. Neurosci. 23, 1829–1838.Lee, S.H., Kim, K.R., Ryu, S.Y., Son, S., Hong, H.S., Mook-Jung, I.,

Lee, S.H., Ho, W.K., 2012. Impaired short-term plasticity in

mossy fiber synapses caused by mitochondrial dysfunction of

dentate granule cells is the earliest synaptic deficit in a mouse

model of Alzheimer’s disease. J. Neurosci. 32, 5953–5963.Lynch, G., Kramar, E. a, Rex, C.S., Jia, Y., Chappas, D., Gall, C.M.,

Simmons, D.A, 2007. Brain-derived neurotrophic factor

restores synaptic plasticity in a knock-in mouse model of

Huntington’s disease. J. Neurosci. 27, 4424–4434.Maksimovic, I., Jovanovic, M., Colic, M., Mihajlovic, R., Micic, D.,

Selakovic, V., Ninkovic, M., Malicevic, Z., Rusic-Stojiljkovic, M.,

Jovicic, A., 2001. Oxidative damage and metabolic dysfunction

in experimental Huntington’s disease: selective vulnerability

of the striatum and hippocampus. Vojnosanit. Pregl. 58,

237–242.Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A.,

Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies,

S.W., Bates, G.P., 1996. Exon 1 of the HD gene with an

expanded CAG repeat is sufficient to cause a progressive

neurological phenotype in transgenic mice. Cell 87, 493–506.Milnerwood, A.J., Cummings, D.M., Dallerac, G.M., Brown, J.Y.,

Vatsavayai, S.C., Hirst, M.C., Rezaie, P., Murphy, K.P.S.J., 2006.

Early development of aberrant synaptic plasticity in a mouse

model of Huntington’s disease. Hum. Mol. Genet. 15,

1690–1703.Murphy, K.P.S.J., Carter, R.J., Lione, L.A., Mangiarini, L., Mahal, A.,

Bates, G.P., Dunnett, S.B., Morton, A.J., 2000. Abnormal

synaptic plasticity and impaired spatial cognition in mice

transgenic for exon 1 of the human Huntington’s disease

mutation. J. Neurosci. 20, 5115–5123.NicNiocaill, B., Haraldsson, B., Hansson, O., Connor, W.T.O.,

Brundin, P., 2001. Altered striatal amino acid neurotransmitter

release monitored using microdialysis in R6/1 Huntington

transgenic mice. Eur. J. Neurosci. 13, 206–210.Nistico, R., Pignatelli, M., Piccinin, S., Mercuri, N.B., Collingridge,

G., 2012. Targeting synaptic dysfunction in Alzheimer’s

disease therapy. Mol. Neurobiol. 46, 572–587.Nithianantharajah, J., Barkus, C., Murphy, M., Hannan, A.J., 2008.

Gene-environment interactions modulating cognitive

function and molecular correlates of synaptic plasticity in

Huntington’s disease transgenic mice. Neurobiol. Dis. 29,

490–504.Pang, T.Y.C., Du, X., Zajac, M.S., Howard, M.L., Hannan, A.J., 2009.

Altered serotonin receptor expression is associated with

b r a i n r e s e a r c h 1 5 8 1 ( 2 0 1 4 ) 1 1 7 – 1 2 8128

depression-related behavior in the R6/1 transgenic mousemodel of Huntington’s disease. Hum. Mol. Genet. 18, 753–766.

Peng, Q., Masuda, N., Jiang, M., Li, Q., Zhao, M., Ross, C. a, Duan,W., 2008. The antidepressant sertraline improves thephenotype, promotes neurogenesis and increases BDNF levelsin the R6/2 Huntington’s disease mouse model. Exp. Neurol.210, 154–163.

Phillips, W., Morton, A.J., Barker, R.A., 2005. Abnormalities ofneurogenesis in the R6/2 mouse model of Huntington’sdisease are attributable to the in vivo microenvironment. J.Neurosci. 25, 11564–11576.

Pouladi, M.A., Graham, R.K., Karasinska, J.M., Xie, Y., Santos, R.D.,Petersen, A., Hayden, M.R., 2009. Prevention of depressivebehaviour in the YAC128 mouse model of Huntington diseaseby mutation at residue 586 of huntingtin. Brain 132, 919–932.

Ramaswamy, S., McBride, J.L., Kordower, J.H., 2007. AnimalModels of Huntington’s Disease. ILAR J. 48, 356–373.

Rosas, H.D., Koroshetz, W.J., Chen, Y.I., Skeuse, C., Vangel, M.,Cudkowicz, M.E., Caplan, K., Marek, K., Seidman, L.J., Makris,N., Jenkins, B.G., Goldstein, J.M., 2003. Evidence for morewidespread cerebral pathology in early HD. Neurology 60,1615–1620.

Saxe, M.D., Battaglia, F., Wang, J.-W., Malleret, G., David, D.J.,Monckton, J.E., Garcia, A.D.R., Sofroniew, M. V, Kandel, E.R.,Santarelli, L., Hen, R., Drew, M.R., 2006. Ablation ofhippocampal neurogenesis impairs contextual fearconditioning and synaptic plasticity in the dentate gyrus.Proc. Natl. Acad. Sci. USA 103, 17501–17506.

Simmons, D.A., Rex, C.S., Palmer, L., Pandyarajan, V., Fedulov, V.,Gall, C.M., Lynch, G., 2009. Up-regulating BDNF with anampakine rescues synaptic plasticity and memory inHuntington’s disease knockin mice. Proc. Natl. Acad. Sci. USA106, 4906–4911.

Simpson, J.M., Gil-Mohapel, J., Pouladi, M.A., Ghilan, M., Xie, Y.,Hayden, M.R., Christie, B.R., 2011. Altered adult hippocampalneurogenesis in the YAC128 transgenic mouse model ofHuntington disease. Neurobiol. Dis. 41, 249–260.

Slow, E.J., Graham, R.K., Osmand, A.P., Devon, R.S., Lu, G., Deng, Y.,Pearson, J., Vaid, K., Bissada, N., Wetzel, R., Leavitt, B.R.,Hayden, M.R., 2005. Absence of behavioral abnormalities andneurodegeneration in vivo despite widespread neuronalhuntingtin inclusions. Proc. Natl. Acad. Sci. USA 102,11402–11407.

Slow, E.J., van Raamsdonk, J., Rogers, D., Coleman, S.H., Graham, R.K., Deng, Y., Oh, R., Bissada, N., Hossain, S.M., Yang, Y.-Z., Li, X.J.,Simpson, E.M., Gutekunst, C.A., Leavitt, B.R., Hayden, M.R., 2003.Selective striatal neuronal loss in a YAC128 mouse model ofHuntington disease. Hum. Mol. Genet. 12, 1555–1567.

Snyder, J.S., Hong, N.S., McDonald, R.J., Wojtowicz, J.M., 2005. Arole for adult neurogenesis in spatial long-term memory.Neuroscience 130, 843–852.

Spargo, E., Everall, I.P., Lantos, P.L., 1993. Neuronal loss in thehippocampus in Huntington’s disease: a comparison with HIVinfection. J. Neurol. Neurosurg. Psychiatry 56, 487–491.

Spires-Jones, T., Knafo, S., 2012. Spines, plasticity, and cognition

in Alzheimer’s model mice. Neural Plast. 2012, 319836.Stout, J.C., Jones, R., Labuschagne, I., O’Regan, A.M., Say, M.J.,

Dumas, E.M., Queller, S., Justo, D., Santos, R.D., Coleman, A.,

Hart, E.P., Durr, A., Leavitt, B.R., Roos, R.A., Langbehn, D.R.,

Tabrizi, S.J., Frost, C., 2012. Evaluation of longitudinal 12 and

24 month cognitive outcomes in premanifest and early

Huntington’s disease. J. Neurol. Neurosurg. Psychiatry 83,

687–694.Tang, T., Slow, E., Lupu, V., Stavrovskaya, I.G., Sugimori, M., Llina, R.,

Kristal, B.S., Hayden, M.R., Bezprozvanny, I., 2005. Disturbed Ca2þ

signaling and apoptosis of medium spiny neurons in

Huntington’s disease. Proc. Natl. Acad. Sci. USA 102, 2602–2607.Usdin, M.T., Shelbourne, P.F., Myers, R.M., Madison, D.V., 1999.

Impaired Synaptic Plasticity in Mice Carrying the Huntington’s

Disease Mutation. Hum. Mol. Genet. 8, 839–846.Van Raamsdonk, J.M., Murphy, Z., Selva, D.M., Hamidizadeh, R.,

Pearson, J., Petersen, A., Bjorkqvist, M., Muir, C., Mackenzie, I.

R., Hammond, G.L., Vogl, A.W., Hayden, M.R., Leavitt, B.R.,

2007. Testicular degeneration in Huntington disease.

Neurobiol. Dis. 26, 512–520.Van Raamsdonk, J.M., Murphy, Z., Slow, E.J., Leavitt, B.R., Hayden,

M.R., 2005a. Selective degeneration and nuclear localization of

mutant huntingtin in the YAC128 mouse model of Huntington

disease. Hum. Mol. Genet. 14, 3823–3835.Van Raamsdonk, J.M., Pearson, J., Bailey, C.D.C., Rogers, D.A.,

Johnson, G.V.W., Hayden, M.R., Leavitt, B.R., 2005b. Cystamine

treatment is neuroprotective in the YAC128 mouse model of

Huntington disease. J. Neurochem. 95, 210–220.Van Raamsdonk, J.M., Pearson, J., Slow, E.J., Hossain, S.M., Leavitt,

B.R., Hayden, M.R., 2005c. Cognitive dysfunction precedes

neuropathology and motor abnormalities in the YAC128

mouse model of Huntington’s disease. J. Neurosci. 25,

4169–4180.Vonsattel, J., DiFiglia, M., 1998. Huntington disease. J.

Neuropathol. Exp. Neurol. 57, 369–384.Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D.,

Richardson, E.P.J., 1985. Neuropathological classification of

Huntington’s disease. J. Neuropathol. Exp. Neurol. 44, 559–577.Zeron, M.M., Fernandes, H.B., Krebs, C., Shehadeh, J., Wellington, C.

L., Leavitt, B.R., Baimbridge, K.G., Hayden, M.R., Raymond, L.A.,

2004. Potentiation of NMDA receptor-mediated excitotoxicity

linked with intrinsic apoptotic pathway in YAC transgenic

mouse model of Huntington’s disease. Mol. Cell. Neurosci. 25,

469–479.Zeron, M.M., Hansson, O., Chen, N., Wellington, C.L., Leavitt, B.R.,

Brundin, P., Hayden, M.R., Raymond, L.A., 2002. Increased

Sensitivity to N-methyl-D-aspartate receptor-mediated

exitotoxicity in a mouse model of Huntington’s Disease.

Neuron 33, 849–860.Zucker, R.S., Regehr, W.G., 2002. Short-term synaptic plasticity.

Annu. Rev. Physiol. 64, 355–405.