International Journal of Cardiology 171 (2014) 199–208

Contents lists available at ScienceDirect

International Journal of Cardiology

j ourna l homepage: www.e lsev ie r .com/ locate / i j ca rd

Bone marrow mesenchymal stromal cells rescue cardiac function instreptozotocin-induced diabetic rats

Gustavo Monnerat-Cahli a, Mayra Trentin-Sonoda b, Bárbara Guerra a, Gabriel Manso a, Andrea C.F. Ferreira a,Diorney L.S.G. Silva a, Danielle C. Coutinho c, Marcela S. Carneiro-Ramos c, Deivid C. Rodrigues a,Mauricio C. Cabral-da-Silva a, Regina C.S. Goldenberg a, José H.M. Nascimento a,Antonio C. Campos de Carvalho a,d, Emiliano Medei a,⁎a Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasilb Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, Santo Andre, Brasilc Department of Morphology, Institute of Biological Sciences, Federal University of Minas Gerais, Belo Horizonte, Brasild Instituto Nacional de Cardiologia, Rio de Janeiro, Brasil

⁎ Corresponding author at: Instituto de Biofísica CarloChagas Filho, 373-CCS-Bloco G, Rio de Janeiro, RJ 219425626555.

E-mail address: emedei70@biof.ufrj.br (E. Medei).

0167-5273/$ – see front matter © 2013 Elsevier Ireland Lhttp://dx.doi.org/10.1016/j.ijcard.2013.12.013

a b s t r a c t

a r t i c l e i n f o

Article history:

Received 3 June 2013Received in revised form 5 November 2013Accepted 10 December 2013Available online 18 December 2013

Keywords:Mesenchymal stromal cellsDiabetesCardiac electrophysiologyImmunoregulationAMPK

Objectives: In the present study, we investigated whether MSC-transplantation can revert cardiac dysfunction instreptozotocin-induced diabetic rats and the immunoregulatory effects of MSC were examined.Background: Cardiac complications are one of the main causes of death in diabetes. Several studies have shownanti-diabetic effects of bone marrow mesenchymal stromal cells (MSC).Methods/results: The rats were divided in three groups: Non-diabetic, Diabetic and Diabetic-Treatedwith 5 × 106

MSC 4 weeks after establishment of diabetes. Fourweeks afterMSC-therapy, systemicmetabolic parameters, im-munological profile and cardiac function were assessed. MSC-transplantation was able to revert the hyperglyce-mia and bodyweight loss of the animals. In addition, after MSC-transplantation a decrease in corticosterone andIFN-γ sera levels without restoration of insulin and leptin plasma levels was observed. Also, MSC-therapy im-proved electrical remodeling, shortening QT and QTc in the ECG and action potential duration of left ventricularmyocytes. No arrhythmic events were observed after MSC-transplantation. MSC-therapy rescued the cardiac

beta-adrenergic sensitivity by increasing beta-1 adrenergic receptor expression. Both alpha and beta cardiacAMPK and p-AMPK returned to baseline values after MSC-therapy. However, total ERK1 and p-ERK1/2 werenot different among groups.Conclusion: The results indicate that MSC-therapy was able to rescue cardiac impairment induced by diabetes,normalize cardiac AMPK subunit expression and activity, decrease corticosterone and glycemia and exert sys-temic immunoregulation.

© 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Diabetes mellitus (DM) is a chronic metabolic disease characterizedby hyperglycemia and, among other features, several cardiac complica-tions [1]. In this context, diabetic cardiomyopathy is a major cause ofmorbidity and mortality [2–6]. Among the cardiac electrical alterations,QT and QTc interval, aswell as QT dispersion are increased. Accordingly,these pro-arrhythmic electrocardiographic changes are caused by theprolongation of the action potential duration [2,3] as a consequence ofcardiac electrical remodeling that occurs in this disease [2]. One of the

s Chagas Filho-UFRJ, Av. Carlos1-902, Brasil. Tel./fax: +55 21

td. All rights reserved.

earliest signs of diabetic cardiomyopathy is mild left ventricular diastol-ic dysfunction,which is followed by systolic alterationswith diminutionof cardiac adrenergic sensitivity compromising the normal mechanicalcardiac performance [7].

The sustained hyperglycemia is one of the most important factorscontributing to cardiac impairment as a consequence of energy unbal-ance. AMP-activated protein kinase (AMPK) has recently emerged as apotential key factor in numerous cardiac complications and also in dia-betes [8]. AMPK acts as an energy sensor and compensates for decreasedenergy use by upregulating sources of energy and downregulating pro-cesses of energy consumption that are not crucial to the cell. In addition,changes in its activity have been associated with diabetes-related hyp-oxia state [9]. Thus, AMPK activity and phosphorylation state can be ei-ther downregulated [10,11] or upregulated [12], in streptozotocin-induced (STZ-induced) diabetic cardiomyopathy. While decreasedAMPK activity was associated with inflammatory response [13] it has

200 G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

been demonstrated that the activation of AMPK was linked to an anti-inflammatory response in diabetic rats [14].

Inflammation has also been demonstrated to play an important roleon pathological processes in diabetes. Therefore, changes in the levels ofkey cytokines/chemokines, such as interleukin (IL)-1ß, tumor necrosisfactor (TNF)-α and IL-6 were described either in plasma and/or heartof streptozotocin-induced diabetes rats [13–16].

Since about 70% of pancreatic beta-cells are already destroyed by thetime type-1 diabetes is diagnosed, efforts have been made to replacethese cells or to improve function of the remaining pancreatic cells[17]. In this context, autologous bone marrow cell transplantation hasemerged as a new option to treat type-1 diabetes in patients as de-scribed in pioneer work published by Voltarelli et al. [18]. In animalmodels, the small population of mononuclear bone marrow cellsnamed “mesenchymal stromal cells” (MSC) also refereed as “mesenchy-mal stem cells” [19] was successfully used in STZ-induced diabetes ei-ther in rats [20–22] or mice [23,24]. The advantageous effects inducedby MSC could be due of the potent immunomodulatory properties ofthese cells. Their immunoregulatory actions can modulate differenttypes of cells, like antigenpresenting and effector T and B cells, being ap-plicable to several autoimmune disease and inflammatory processes[23,25–27]. In this context, it has been described that MSC-therapyameliorated myocardial inflammation, reducing cytokine productionand improving cardiacmechanical function on a rat model ofmyocardi-tis [25]. In fact, it was also demonstrated that MSC-therapy decreasesthe expression of proinflammatory cytokines improving cardiac func-tion on an experimental model of inflammatory cardiomyopathy [27].Additionally, it has been demonstrated that MSC-therapy can promotea cytokine profile shift from proinflammatory to anti-inflammatory inthe pancreas of diabetic mice, unraveling an anti-diabetic effect inducedby MSC-transplantation [23]. All of these beneficial effects observedwith MSC-therapy on animal models are supporting nine clinical trialscurrently aiming to test the therapeutic effect of this cell population inpatients with type-1 diabetes (www.clinicaltrials.gov).

Cumulative evidence suggests that the anti-diabetic potential ofMSC-therapy involves an immunoregulatory mechanism. While previ-ous investigations have mainly focused on how MSC-therapy is able toreverse the hyperglycemic state of the streptozotocin-induced diabetesmodel (largely studying the pancreatic histoarchitecture and immuno-logical pancreatic microenvironment), here we aimed to investigatewhether MSC-therapy, modulating the systemic inflammatory state, isable to rescue the altered cardiac function in STZ-induced hyperglyce-mic rats.

2. Methods

2.1. Animals and experimental protocol

MaleWistar rats (118.6 ± 8.0 g)were kept at constant temperature (23 °C) in a stan-dard light/dark cycle (12 h/12 h) with free access to standard chow and water. The ani-mals were divided in 3 groups: control non-diabetic (NORMAL), diabetic (DM) anddiabetic treated with MSC (DM + MSC). Diabetes was induced by a single injection ofstreptozotocin (Sigma-Aldrich) (80 mg/kg i.v.) in 0.05 M citrate buffer (pH 4.5), in anes-thetized (Isoflurane, Baker) animals. Animals fromNORMAL group received the same vol-ume of vehicle. Four weeks after establishment of diabetes (blood glucose higher than300 mg/dL), diabetic ratswere randomly separated in two groups: one that received a sin-gle transplantation of MSC (5 × 106) by systemic injection (retro-ocular plexus)(DM + MSC), and the second group, which receive only vehicle injection (DM). Fourweeks after transplantation all animals were sacrificed with carbon dioxide asphyxiationfollowed by cervical dislocation. The protocols used in the present study were approvedby the Animal Care and Use Committee at the Federal University of Rio de Janeiro (n°:26). The authors of this manuscript have certified that they comply with the Principlesof Ethical Publishing in the International Journal of Cardiology.

2.2. Blood glucose and glucose tolerance test

Blood glucose levelswere determined using a glucose reagent strip and a standard au-tomated glucometer (AccuChek Advantage II, Roche, Ireland). Briefly, animals were fastedovernight for 12 h and blood was obtained from the tip of the tail vein of the fully awake,non-anesthetized animal. After determination of the fasting blood glucose level, the

animals were loaded by gavage with 3.5 g glucose/kg body weight, and blood glucoselevels were measured 15, 30, 60, 90 and 120 min later.

2.3. Serum insulin, leptin and corticosterone

Serum insulin and corticosterone concentrations were measured using commercialradioimmunoassay kits, based on the presence of specific antibodies adhered to the inter-nal surface of propylene tubes (ImmuChemTMCoated Tube Insulin 125I RIA kit) and dou-ble antibody (ImmuChemTM Double Antibody Corticosterone 125I RIA kit). Insulin (MPBiomedicals, LLC®, sensitivity of 5.5 μl U/ml) inter- and intra assay coefficients of variationvaried from 5.0 to 8.9% and from 3.2 to 12.2%, respectively; Corticosterone (MP Biomedi-cals, LLC®, sensitivity of 25 ng/ml) inter and intra assay coefficients of variation variedfrom 6.5 to 7.2% and 4.4 to 10.3%, respectively (OH, USA). Serum leptin concentrationswere measured using a specific radioimmunoassay (RIA) for rat leptin obtained fromthe Millipore Corporation (MA, U.S.A). Intra- and interassay coefficients of variationwere 2.0–4.6% and 3.0–5.7% respectively, and the sensitivity was 0.639 ng/ml using100 μl sample size. To obtain material to carry out these assays, the total amount of theblood extracted for serum isolation was about 1 ml.

2.4. Multipotent mesenchymal stem cell isolation and culture

The total rat bone marrow was harvested by flushing the tibias and femurs withDulbecco's modified Eagle medium (DMEM, Gibco-Invitrogen, USA) and the cell suspen-sion centrifuged in Histopaque gradient at 400 ×g for 30 min (Histopaque 1.083 g/ml,1:1, Sigma-Aldrich, USA). Mononuclear cells were collected from the histopaque-medium interface. Cells were washed in Phosphate-Buffered Saline (PBS) three times,counted in a hemocytometer, and checked for viability using 0.4% trypan blue. Cellswere then plated at a density of 1.2 × 106 cells/cm2 and maintained at 37 °C in a 5% CO2

incubator for 1 week, during which medium was changed at least twice, washing awayall floating hematopoietic cells. Culture medium used was DMEM supplemented with20% fetal bovine serum (Gibco-Invitrogen, USA), 2 mM L-glutamine (Sigma-Aldrich),and antibiotics (100 U/ml penicillin G and 100 μg/ml streptomycin, Gibco). At approxi-mately 80–90% confluence, adherent cells were detached from the culture flasks with0.25% trypsin-EDTA (Sigma-Aldrich) replated at a density of 1.2 × 104 cells/cm2 and fur-ther propagated until passage 3.

2.5. ECG and action potential recording

Electrocardiogram recording was carried out in conscious animals by noninvasivemethod. Electrodes were positioned in DI derivation and connected by flexible cables toa differential AC amplifier (model 1700, A-M Systems, USA), with signal low-pass filteredat 500 Hz and digitized at 1 kHz by a 16-bit A/D converter (Minidigi 1-D, Axon Instru-ments, USA) using Axoscope 9.0 software (Axon Instruments, USA). Data were stored ina PC for offline processing.

To assess action potential recording, muscle strips were obtained and pinned to thebottom of a tissue bath in order to expose the endocardial side. The preparations weresuperfused with Tyrode's solution containing (in mM): 150.8 NaCl, 5.4 KCl, 1.8 CaCl2, 1.0MgCl2, 11.0 D-glucose, 10.0 HEPES (pH 7.4 adjustedwith NaOH at 37.0 ± 0.5 °C) saturat-edwith carbogenmixture (95%O2/5%CO2) at aflowof 5 ml/min (GilsonMINIPULS 3). Thetissue was stimulated at four different basic cycle lengths. Transmembrane potential wasrecorded using glass microelectrodes (10–40 MΩ DC resistance) filled with 2.7 M KClconnected to a high input impedancemicroelectrode amplifier (MEZ7200, Nihon Kohden,Japan). Amplified signals were digitized (1440 Digidata A/D interface, Axon Instrument,Inc.) and stored in a computer for later analysis using software LabChart 7.3(ADInstruments, Australia). The following parameters were analyzed: resting membranepotential (RMP), action potential amplitude (APA) and action potential duration at 90%(APD90), 50% (APD50) and 30% (APD30) repolarization. The Maximum rate of depolariza-tion (Vmax) was calculated using five-point linear regression centered on the sample.The Maximum Negative Slope (Max. Neg. Slope) was calculated by the steepest downhillslope starting 5 ms after the peak using a linear regression during a window of 4 ms. TheAP triangulation was calculated by subtracting APD40 from APD90.

2.6. Cardiac mechanical function

In order to assess cardiacmechanical function the hearts were rapidly excised, cannu-lated by the aorta and perfused at constant flow 10 mL/min with Krebs–Henseleit buffersolution (KHB) containing (in mmol/L) NaCl 118.0, NaHCO3 25.0, KCl 4.7, KH2PO4 1.2,MgSO4.7H2O 1.2, CaCl2 1.25, and glucose 11.0. The KHB solution was saturated withcarbogen gas (pH = 7.4) and held at 37.0 ± 0.5 °C. A small latex balloon, connected toa pressure transducer (MLT0380, ADInstruments, Australia), was inserted in the left ven-tricle, through the left atrium, and adjusted to an initial diastolic pressure of 10 mmHg.The transducer was connected to an amplifier (ML110, ADInstruments, Australia), to reg-ister the intraventricular pressures developed by the left ventricle (Left Ventricle devel-oped pressure — LVDP). The pressure recordings were acquired at 1.0 kHz by ananalogic-digital interface (PowerLab 400, ADInstruments, Australia) and stored in a com-puter for an offline analysis using LabChart 7.3 (ADInstruments, Australia). Next, a dose-response curve with adrenergic agonist was performed (Isoproterenol: 0.1 nM, 0.3 nM,0.8 nM, 1 nM, 10 nM, 100 nM; 500 nM; 1 μM).

201G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

2.7. RT-PCR and western blot

The mRNA levels of the Beta1 Adrenergic receptor gene in the left ventricle heart tis-sue were quantified by qRT-PCR (qRT-PCR). GAPDH mRNA levels were used for normali-zation. The primer sequences were: Beta1 Adrenergic receptor forward: CTGCTACAACGACCCCAAG, reverse: TCTTCACCTGTTTCTGGGC; and GAPDH forward: TGATTCTACCCACGGCAAGT, reverse: AGCATCACCCCATTTGATGT. To assess protein levels, total protein was ex-tracted from the left ventricles and 70 μg of protein were resolved on SDS-PAGE (10%polyacrylamide) and then transferred onto nitrocellulose membranes. After 1 h ofblocking with 5% milk in Tris-buffered saline, the membranes were probed with one ofthe following primary antibodies: AMPK-α (phosphorylated 1:250 and total 1:500, CellSignaling Technology®, Inc. USA, catalog no. 9957) and AMPK-β1 (phosphorylated1:1000 and total 1:2000, Cell Signaling Technology®, Inc., USA, catalog no. 9957) over-night. GAPDH was used as loading control for protein quantification (1:20,000). Afterfinal washes, the blots were then incubated with either IRDye Goat-Anti-Rabbit or Goat-Anti-mouse IRDye® 680 CW secondary antibody (Rockland Immunochemicals®Gilbertsville, PA). Images of the blots were acquired with an infrared scanner fromLICOR and analyzed using Odyssey software. ERK1 (1:500, Santa Cruz Biotechnologies cat-alog no. SC-93) and p-ERK1/2 (1:250, Santa Cruz Biotechnologies catalog no. sc-16982)followed the same protocol of incubations but with secondary antibodies conjugated tohorseradish peroxidase (HRP) anti-rabbit (1:2500, Santa Cruz Biotechnologies catalogno. SC-2004) or anti-mouse (1:10000, Santa Cruz Biotechnologies catalog no SC-2005),developed by chemiluminescent reaction (ECL prime, GE) and detected by exposure ofthe blot to x-ray film (Kodak T-Mat S/RA X-ray Film). Optical density of the bands wasquantified using Image J software (NIH, http://rsbweb.nih.gov/ij/).

2.8. Inflammatory plasma profile

Blood was extracted and centrifuged at 3000 rpm for 15 min to isolate the serum.Luminex Performance Rat Cytokine Panel (R&D System)was used tomeasure levels of cy-tokines and the plates were read on Luminex® 100/200 (BioRad).

2.9. Statistical analysis

Data are presented asmean ± SEM.Multiple comparisons between groupswere per-formed using analysis of variance (ANOVA), followed by a Bonferroni or Newman-Keulsmultiple comparison test. Data showing non Gaussian distribution (Kolgomorov-Smirnovtest) were compared by Kruskal-Wallis test followed by Dunn's multiple comparison test.Values of P b 0.05 were considered statistically significant. All analysis were made usingGraphPad Prism 5.0 (GraphPad Software, USA).

3. Results

3.1. MSC-transplantation improves glucose levels restoring corticosteronesera concentration

High blood glucose and decreased levels of insulin and leptin are thehallmarks of STZ-induced diabetes in rats. As shown in Fig. 1 the animalsused in this study reproduce this pattern, as well as a decrease on bodyweight, after a single dose of streptozotocin. The transplanted cells weresystemically distributed and could be tracked for up to 7 days aftertransplantation (See Supplementary Fig. 1). Treatment with a singletransplantation ofMSC promoted an improvement in fasting serumglu-cose levels, leading to values similar to NORMAL rats (Fig. 1A). In addi-tion MSC-transplantation reduced body weight loss (Fig. 1B) andrestored corticosterone levels (Fig. 1C). However, the improvement inglucose control and the gain in body weight were not associated withan increase neither in leptin nor in insulin plasma levels (Fig. 1D, E).In fact, the DM + MSC rats were still intolerant to glucose as observedin Fig. 1F (Also in online Supplementary Table 1). Additionally, nodiffer-encewas observed in the heart weight/bodyweight ratio among groups(NORMAL: 0.4 ± 0.01; DM: 0.5 ± 0.01; DM + MSC: 0.5 ± 0.04;P N 0.05). No difference in survival was observed among the studiedgroups; about more than 90% of rats survived in each group.

3.2. Systemic inflammatory profile after 4-weeks of MSC-therapy

Among 9 cytokines studied, IFN-γ serum concentration detected inDM + MSC returned to values comparable to NORMAL rats. In addition,the plasma concentration of other six proinflammatory cytokines ana-lyzed on DM + MSC group was not different when compared to theserum concentration of these inflammatory mediators on NORMALgroup. Conversely, DM rats show a significant increment of these

proinflamatory molecules when compared to serum concentration ofthe NORMAL group. Cytokine serum concentrations of bothDM + MSC and DM did not show statistical difference, except for IFN-γ. The serum concentration of the classical antiinflammatory cytokineIL-4 was similar among groups. The other antiinflammatory cytokinestudied, IL-10, had higher concentration in serum of both DM andDM + MSC groups when compared to NORMAL rats. (See bars graphson Fig. 2).

3.3. MSC-therapy reverses cardiac electrical remodeling

Four-weeks after cell transplantation DM + MSC group presentedan improvement in QT and corrected QT interval (QTc) in comparisonto the DMgroup, but no differences in RR interval and QRS complex du-ration were observed among groups (Fig. 3) (Online SupplementaryTable 2). In addition, no arrhythmic events were observed.

Cardiac action potential analysis revealed that duration at 90% of re-polarization was significantly prolonged in DM compared to NORMALanimals, and it was significantly shortened in DM + MSC rats whencompared to DManimals (Fig. 4). These resultswere not rate dependent(Fig. 4B). Pro-arrhythmic markers such as triangulation and the maxi-mal velocity of repolarization, which were increased in the DM group,were also improved after MSC-transplantation (Fig. 4C, D). No differ-ences in other action potential parameters were observed amonggroups (Online Supplementary Table 3).

3.4. MSC-transplantation preserves heart mechanical function underadrenergic challenge

No difference under basal conditions was observed on LVDP amonggroups (Fig. 5A, see inset bars graph). The hearts from the DM + MSCrats responded adequately to an adrenergic challenge, increasing LVDP(Fig. 5A, B). However, the DM groupwas not able to increase developedpressure under the same conditions (Fig. 5A; Online SupplementaryTables 4–6). Mechanistically, we demonstrated that MSC-therapy res-cued mRNA levles of beta-1 adrenergic receptors in the left ventricleof diabetic rats (Fig. 5C).

3.5. MSC-therapy modulates AMPK but not ERK signaling pathways in theheart

To assess the impact of the MSC-therapy upon signaling pathwaysactivated in the heart, two protein kinaseswere investigated: (i) the ex-pression and activity of AMPK and (ii) the expression of ERK1 andphospho-ERK1/2 (p-ERK1/2) were compared among the three groups.

MSC-transplantation restored total AMPK α and β subunit expres-sion, which were altered in DM hearts (Fig. 6A, B). In fact, MSC-therapy also rescued the levels of p-AMPK α and p-AMPK β subunitsin hearts from diabetic animals, which are downregulated in non-treated diabetic rats (Fig. 6A, B). The levels of the other protein kinasestudied, ERK1 and p-ERK1/2 were not different among groups (Fig. 6C).

4. Discussion

Results from our observations further confirm that transplantationof MSC can reverse STZ-induced hyperglycemia. The novel finding re-ported here is that MSC improves cardiac function in diabetic rats.

In accordance with our data, previous studies have demonstratedthat MSC-transplantation in diabetic rats decreases hyperglycemia andpromotes an increase in body weight of the diabetic animals[20–22,28]. However, previous to this work it was unclear whetherthis cell therapy could revert the one of the major causes of morbidityand mortality in diabetic patients, the diabetic cardiomyopathy [4]. Inorder to assess how MSC decreased sera glucose levels, the followinghormones that play a key role in maintaining glycemic homeostasis

Fig. 1.MSC-transplantation induced hyperglycemia reversion in diabetic rats: (A) Blood glucose throughout the protocol. (B) MSC-transplantation increases bodyweight. (C-E) Serum levelsof corticosterone, leptin and insulin 4-weeks after MSC-transplantation. (F) Oral test to glucose tolerance 4-weeks after MSC-therapy. The results are expressed as mean ± SEM.*** P b 0.001 vs. NORMAL and DM + MSC; # P b 0.001 vs. NORMAL; ** P b 0.01 vs. NORMAL; P b 0.05 vs. DM. w: weeks. N = 8 to 10/group. White square = NORMAL; whitetriangle = DM; black circle = DM + MSC; white bars = NORMAL; gray bars = DM; black bars = DM + MSC.

202 G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

were measured in serum from all groups studied: (i) corticosterone,(ii) insulin and (iii) leptin.

Corticosterone is typically increased in diabetes [29,30]. It was re-ported that specific inactivation of the glucocorticoids receptors(GCCR) in the liver by the Cre/loxP system resulted in amelioration ofSTZ-induced hyperglycemia and caused hypoglycemia upon prolongedfasting [31]. Also, inflammation [32] high serum concentration of corti-costerone was observed. Therefore, it has been described that the acti-vation of the hypothalamic-hypophysis-adrenal axis by IL-6, IL-1ß,and TNF-α is an essential protective host response to inflammation[33]. This was supported by work of Fattori et al. showing that IL-6-deficient-mice were not able to produce corticosterone after inflamma-tion challenge [34]. Interestingly, our results showed that MSCtransplanted animals show corticosterone serum levels similar to the

non-diabetic group and significantly lower values than DM group. Thisfinding could be attributed, at least in part, to immunoregulatory prop-erties that have been largely attributed toMSC [21]. In this context, hereMSC-therapy reverted the diabetes-induced high serum concentrationof IFN-γ an important proinflammatory marker. In fact, conversely tothe data obtained when comparing the DM to the NORMAL group, theDM + MSC rats showed serum concentrations of all cytokines not tobe different when compared to NORMAL rats. This novel and significantfinding provides new insights into the mechanisms of MSC-inducednormoglycemia. In agreementwith this result, the bodyweight gain ob-served in the treated animals reflects the improvement of themetabolicstate induced byMSC-therapy. The data are also in accordancewith pre-vious work transplanting MSC in STZ-induced diabetes in rats [21]. Incontrast with these results, we did not find an enhancement neither

Fig. 2. Systemic immunomodulation after 4-weeks of MSC-transplantation: Bars graphs summarize the serum immunomodulatory effect on both pro and anti-inflammatory cytokinesstudied. The results are expressed as mean ± SEM. * P b 0.05 vs. NORMAL; ** P b 0.01 vs. NORMAL; *** P b 0.001 vs. NORMAL; # P b vs. DM + MSC. N = 5 to 7 per group. Whitebars = NORMAL; gray bars = DM; black bars = DM + MSC.

203G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

Fig. 3.MSC transplantation reverses cardiac electric remodeling: (A) Representative traces of electrocardiogram4-weeks after transplantation showsQT interval shortening afterMSC trans-plantation (bottompanel). (B-E) bar graphs summarize the ECG parametersmeasured 4-weeks afterMSC transplantation. The results are expressed as mean ± SEM. ** P b 0.01 vs. NOR-MAL; # P b 0.05 vs. DM + MSC; N: NORMAL: 12; DM: 9; DM + MSC: 12. White bars = NORMAL; gray bars = DM; black bars = DM + MSC.

204 G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

insulin nor leptin plasma levels after MSC-transplantation. In fact, eventhough the treated animals showed low glycemic values, the oral glu-cose tolerance test in this group showed that they were still intolerantto glucose, as also observed in the non-treated group. These data sup-port the low sera insulin concentration observed in both MSC-treatedand untreated diabetic groups. Among the few manuscripts showingthe anti-diabetic effect of MSC on STZ-induced diabetic rat model,Boumaza et al. have shown a slight increment of sera insulin levels,but the authors reported that only 2 of 8 rats sustained sera insulinlevels 21 days after MSC-transplantation [21].

Among the complications of diabetic cardiomyopathy, the electricalremodeling helps to create a cardiac microenvironment that evokesfatal ventricular arrhythmias [2,3]. Since previous publications haveshown data that consistently support a beneficial effect of MSC-transplantation on the heart [35,36] we set out to study whether ananti-diabetic effect of MSC-transplantation could revert the STZ-induced cardiac electrical remodeling in diabetic rats. In our study we

did not observe arrhythmic event in any of the animals studied. Thisdata are in agreement with other studies [37].

A preserved mechanical function and beta-adrenergic sensitivity iscrucial to maintain cardiovascular performance. While STZ-induced di-abetes in rats did not impair basal cardiac contraction and relaxationperformance for at least 2 months after diabetic induction, an early de-crease in cardiac beta-adrenergic sensitivity was described [38]. Addi-tionally, this has been shown not to be totally reestablished evenunder insulin treatment in the same animal model [39]. In the presentstudy, the effects of cellular therapy with MSC on the preservation ofthe adrenergic sensitivity, increasing LVDP, led to a cardiac performancesimilar toNORMAL rats under adrenergic stimulus. Supporting this data,we demonstrated that treated diabetic rats rescue beta1-adrenergic re-ceptor gene expression in the heart, while non-treated rats presented adownregulation of this transcript.

The cardiac benefits promoted by MSC-therapy in STZ–induced dia-betic rats could be also attributed to changes in various cardiac

Fig. 4. MSC-therapy reverses cardiac action potential prolongation after 4-weeks: (A) Representative action potential traces from left ventricle endocardial tissue from all studied group.(B) The graphs summarize the action potential duration (APD) at 90% of repolarization under different basic cycle length (BCL) of stimulation (300, 500, 800 and 1000 ms). (C, D) Thebar graphs summarize the triangulation duration and maximal negative slope of repolarization, respectively. The results are expressed as mean ± SEM. *** P b 0.001 vs. NORMAL andDM + MSC; ** P b 0.01 vs. NORMAL and DM + MSC; * P b 0.01 vs. NORMAL; # P b 0.05 vs. DM + MSC; N: NORMAL: 8; DM: 8; DM + MSC: 13. White square = NORMAL; whitetriangle = DM; black circle = DM + MSC; white bars = NORMAL; gray bars = DM; black bars = DM + MSC.

205G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

intracellular signaling networks, as a consequence of the improvementof the systemic metabolic profile. Here we have focused and studiedtwo important kinases that play a vital role in STZ-induced diabetic car-diomyopathy, the AMPK and a member of the mitogen-activated pro-tein kinase (MAPK) family, ERK.

In this context, previous studies have reported a downregulation ofcardiac p-AMPK-α in the samemodel used in the presentwork as a con-sequence of energy unbalance [11]. Our data shows thatMSC transplan-tation can preserve AMPK protein expression and function. Theseresults could be related to the improvement in glucose homeostasis in-duced by MSC-therapy, since similar results (increase in AMPK) weredescribed after glycemic stabilization by long-term insulin treatmentin the type-1 diabetesmicemodel [10]. Even though the actual informa-tion available about mechanical or electrophysiological changes as a

Fig. 5.Heartmechanical function is conservedwhen challenged by adrenergic stimulus by restorationpercentage (%) of LVDP increment as a function of isoproterenol concentration. The inset showLVDPmeasurement in 1 μMof ISO. (C) The expression of beta-1 adrenergic receptor mRNA in l** P b 0.01 vs. NORMAL and DM + MSC; # P b 0.01 vs. NORMAL; * P b 0.05 vs. DM + MSC;isoproterenol. White square = NORMAL; white triangle = DM; black circle = DM + MSC; w

result of activation or inactivation of AMPK in such conditions is ex-tremely limited, the authors speculate that theMSC-therapy, improvingthe metabolic balance - reflected by the AMPK result obtained here –

has contributed to normalize the electrophysiological and mechanicalcardiac function [10].

The expression and activation of the other kinase studied ERK, isusually associated with myocardial protection activating a “survival”pathway during stress conditions. In a diabetic rat model, Laviola et al.observed no change in heart p-ERK 6-weeks after STZ-induced diabetes.Conversely, it was demonstrated that after a longer period (20 weeks)of diabetes in rats, there is a downregulation of p-ERK in the heart[40]. In the presentworkwe did not observe significant changes neitherin total ERK1 nor in p-ERK1/2 in the diabetic hearts. In addition, MSC-therapy did not promote activation of this kinase.

of beta-1 adrenergic receptor expression afterMSC transplantation: (A) The graph shows thes that there is no difference among groups under basal condition. (B) The bar graph showseft ventricle tissue from the three groups. The results are expressed as mean ± SEM.N: NORMAL: 8; DM: 8; DM + MSC: 9. LVDP: left ventricular developed pressure; ISO:hite bars = NORMAL; gray bars = DM; black bars = DM + MSC.

Fig. 6. The role of kinases on MSC-transplantation induced hyperglycemia reversion in diabetic rats heart: (A-C) top: representative immunoblotting of the protein of interest and the controlload protein (GAPDH). Bottom: The bar graph summarizes the corresponding densitometricmeasurements of AMPK-α and p-AMPK-α (A). (B) AMPK-β 1 and p-AMPK-β. (C) Total ERK1,p-ERK1/2 and the ratio of p-ERK1/2/Total ERK1 in heart. The results are expressed asmean ± SEM. * P b 0.05 vs. NORMAL and DM + MSC;N: NORMAL: 8; DM: 7; DM + MSC: 8. Whitebars = NORMAL; gray bars = DM; black bars = DM + MSC.

206 G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

207G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

4.1. Clinical perspective and study limitations

Cellular therapy using stem cells represents a potential strategy totreat several cardiovascular and metabolic diseases. In this context,bone marrow mesenchymal stromal cells emerge as a potential candi-date for use in type-1 diabetes patients. This is supported by variouspreclinical studies demonstrating the anti-diabetic effect and the lackof arrhythmic events induced by MSC-transplantation [37]. These suc-cessful results have motivated the registration of at least 9 clinical trialsin diabetes (http://www.clinicaltrials.gov) using cell-based therapies.The present work not only confirmed the anti-diabetic potential ofMSC-therapy, but additionally, showed that this therapy is capable toreverse diabetes-induced cardiac alterations.

While in themicemodel of type-1 diabetes themechanismbywhichMSC-transplantation improved sera glycemic values is well established,in rats it remains largely unknown. In mice insulin levels are increasedafter MSC-transplantation, as a consequence of the improvement inthe inflammatory pancreatic microenvironment [23,24]. In STZ-induced diabetic rats no evidence supports these data. In addition, ourresults showed that MSC-transplantation improved corticosterone, butnot insulin and leptin sera concentration. This divergence between dif-ferent animal models is part of the study limitation and requires carefulexamination before bringing this MSC-therapy to the clinical practice.Another limitation of the present work is the fact that we transplantedMSC from “non-diabetic” rats to diabetic ones. Autologous transplanta-tion in humans may show different results because MSC isolated fromdiabetic animals have impaired paracrine potential [41]. However, it iswell known that MSC show a low immunogenicity in allogeneic trans-plantation [42].

In summary, our results shown thatMSC-transplantation: (i) can de-crease hyperglycemia and increase bodyweight in STZ-induced diabeticrats, normalizing sera corticosterone concentration, but without nor-malizing insulin and leptin levels; (ii) induce a plasma immunomodula-tory response, decreasing IFN-γ serum levels and partially reversingother proinflammatory cytokines studied; (iii) rescue cardiac electricaland mechanical function and ameliorate cardiac beta-adrenergic sensi-tivity; (iv) restore AMPK cardiac expression and activity to values com-parable to non-diabetic rats.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.ijcard.2013.12.013.

Acknowledgments

This work was funded by the Brazilian National Research Council(CNPq, grants: 308168/2012-7 and 475218/2012-4), the Carlos ChagasFilho Rio de Janeiro State Research Foundation (FAPERJ, grants: E-26/103.222/2011 and E-26/111.171/2011) and National Institutes of Sci-ence and Technology for Biology Structural and Bioimaging (grant:573767/2008-4), Brazil. All authors take responsibility for all aspectsof the reliability and freedom from bias of the data presented andtheir discussed interpretation.

References

[1] Grundy SM, Benjamin IJ, Burke GL, et al. Diabetes and cardiovascular disease: a state-ment for healthcare professionals from the American Heart Association. Circulation1999;100(10):1134–46.

[2] Kahn JK, Sisson JC, Vinik AI. QT interval prolongation and sudden cardiac death in di-abetic autonomic neuropathy. J Clin Endocrinol Metab 1987;64(4):751–4.

[3] Magyar J, Rusznák Z, Szentesi P, Szûcs G, Kovács L. Action potentials and potassiumcurrents in rat ventricular muscle during experimental diabetes. J Mol Cell Cardiol1992;24(8):841–53.

[4] Garcia MJ, McNamara PM, Gordon T, Kannel WB. Morbidity and mortality in dia-betics in the Framingham population. Sixteen year follow-up study. Diabetes1974;23(2):105–11.

[5] Vinik AI, Ziegler D. Diabetic cardiovascular autonomic neuropathy. Circulation2007;115(3):387–97.

[6] An D, Rodrigues B. Role of changes in cardiac metabolism in development of diabeticcardiomyopathy. Am J Physiol Heart Circ Physiol 2006;291(4):H1489–506.

[7] Nishio Y, Kashiwagi A, Kida Y, et al. Deficiency of cardiac beta-adrenergic receptor instreptozocin-induced diabetic rats. Diabetes 1988;37(9):1181–7.

[8] Arad M, Seidman CE, Seidman JG. AMP-activated protein kinase in the heart: roleduring health and disease. Circ Res 2007;100(4):474–88.

[9] Hardie DG. AMP-activated/SNF1 protein kinases: conserved guardians of cellularenergy. Nat Rev Mol Cell Biol 2007;8(10):774–85.

[10] Pei H, Qu Y, Lu X, et al. Cardiac-derived adiponectin induced by long-terminsulin treatment ameliorates myocardial ischemia/reperfusion injury intype 1 diabetic mice via AMPK signaling. Basic Res Cardiol 2013;108(1):322.

[11] Murça TM, Moraes PL, Capuruço CA, et al. Oral administration of an angiotensin-converting enzyme 2 activator ameliorates diabetes-induced cardiac dysfunction.Regul Pept 2012;177(3):107–15.

[12] Torres-Jacome J, Gallego M, Rodríguez-Robledo JM, Sanchez-Chapula JA, Casis O. Im-provement of the metabolic status recovers cardiac potassium channel synthesis inexperimental diabetes. Acta Physiol (Oxf) 2013;207(3):447–59.

[13] Ko HJ, Zhang Z, Jung DY, et al. Nutrient stress activates inflammation and reducesglucose metabolism by suppressing AMP-activated protein kinase in the heart. Dia-betes 2009;58(11):2536–46.

[14] Zhao Y, Tan Y, Xi S, et al. A novel mechanism by which SDF-1β protects cardiac cellsfrom palmitate-induced ER stress and apoptosis via CXCR7 and AMPK/p38 MAPK-mediated IL-6 generation. Diabetes 2013;62(7):2545–58.

[15] Westermann D, Van Linthout S, Dhayat S, et al. Tumor necrosis factor-alpha antago-nism protects from myocardial inflammation and fibrosis in experimental diabeticcardiomyopathy. Basic Res Cardiol 2007;102(6):500–7.

[16] Guo Z, Xia Z, Jiang J, McNeill JH. Downregulation of NADPH oxidase, antioxidantenzymes, and inflammatory markers in the heart of streptozotocin-induceddiabetic rats by N-acetyl-L-cysteine. Am J Physiol Heart Circ Physiol 2007;292:H1728–36.

[17] Notkins AL, Lernmark A. Autoimmune type 1 diabetes: resolved and unresolved is-sues. J Clin Invest 2001;108(4):1247–52.

[18] Voltarelli JC, Couri CE, Stracieri AB, et al. Autologous nonmyeloablative hematopoiet-ic stem cell transplantation in newly diagnosed type 1 diabetes mellitus. JAMA2007;297(9):1568–76.

[19] Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: na-ture, biology, and potential applications. Stem Cells 2001;19(3):180–92.

[20] Abdel Aziz MT, El-Asmar MF, Haidara M, et al. Effect of bone marrow-derived mes-enchymal stem cells on cardiovascular complications in diabetic rats. Med Sci Monit2008;14(11):BR249–55.

[21] Boumaza I, Srinivasan S, Witt WT, et al. Autologous bone marrow-derivedrat mesenchymal stem cells promote PDX-1 and insulin expression in theislets, alter T cell cytokine pattern and preserve regulatory T cells in theperiphery and induce sustained normoglycemia. J Autoimmun 2009;32(1):33–42.

[22] Katuchova J, Tothova T, Farkasova Iannaccone S, et al. Impact of different pancreaticmicroenvironments on improvement in hyperglycemia and insulin deficiency in di-abetic rats after transplantation of allogeneic mesenchymal stromal cells. J Surg Res2012;178(1):188–95.

[23] Ezquer FE, Ezquer ME, Contador D, Ricca M, Simon V, Conget PA. MSC anti-diabeticeffect is unrelated to their trans-differentiation potential but to their capability to re-store Th1/Th2 balance and to modify the pancreatic microenvironment. Stem Cells2012;30(8):1664–74.

[24] Lee RH, Seo MJ, Reger RL, et al. Multipotent stromal cells from humanmarrow hometo and promote repair of pancreatic islets and renal glomeruli in diabetic NOD/scidmice. Proc Natl Acad Sci U S A 2006;103(46):17438–43.

[25] Okada H, Suzuki J, Futamatsu H, Maejima Y, Hirao K, Isobe M. Attenuation ofautoimmune myocarditis in rats by mesenchymal stem cell transplantationthrough enhanced expression of hepatocyte growth factor. Int Heart J 2007;48(5):649–61.

[26] Poynter JA, Herrmann JL, Manukyan MC, et al. Intracoronary mesenchymal stemcells promote postischemic myocardial functional recovery, decrease inflammation,and reduce apoptosis via a signal transducer and activator of transcription 3 mech-anism. J Am Coll Surg 2011;213(2):253–60.

[27] Savvatis K, van Linthout S, Miteva K, et al. Mesenchymal stromal cells but not cardiacfibroblasts exert beneficial systemic immunomodulatory effects in experimentalmyocarditis. PLoS One 2012;7(7):e41047.

[28] Park JH, Hwang I, Hwang SH, Han H, Ha H. Human umbilical cord blood-derivedmesenchymal stem cells prevent diabetic renal injury through paracrine action.Diabetes Res Clin Pract 2012;98(3):465–73.

[29] Repetto EM, Sanchez R, Cipelli J, et al. Dysregulation of corticosterone secretion instreptozotocin-diabetic rats: modulatory role of the adrenocortical nitrergic system.Endocrinology 2010;151(1):203–10.

[30] Yue JT, Riddell MC, Burdett E, Coy DH, Efendic S, Vranic M. Amelioration of hypogly-cemia via somatostatin receptor type 2 antagonism in recurrently hypoglycemic di-abetic rats. Diabetes 2013;62(7):2215–22.

[31] Opherk C, Tronche F, Kellendonk C, et al. Inactivation of the glucocorticoid re-ceptor in hepatocytes leads to fasting hypoglycemia and ameliorates hyper-glycemia in streptozotocin-induced diabetes mellitus. Mol Endocrinol 2004;18(6):1346–53.

[32] Braun TP, Zhu X, Szumowski M, et al. Central nervous system inflammation inducesmuscle atrophy via activation of the hypothalamic–pituitary–adrenal axis. J ExpMed2011;208(12):2449–63.

[33] Elenkov IJ, Iezzoni DG, Daly A, Harris AG, Chrousos GP. Cytokine dysregulation, in-flammation and well-being. Neuroimmunomodulation 2005;12(5):255–69.

[34] Fattori E, Cappelletti M, Costa P, et al. Defective inflammatory response in interleukin6-deficient mice. J Exp Med 1994;180(4):1243–50.

208 G. Monnerat-Cahli et al. / International Journal of Cardiology 171 (2014) 199–208

[35] Berry MF, Engler AJ, Woo YJ, et al. Mesenchymal stem cell injection after myocardialinfarction improves myocardial compliance. Am J Physiol Heart Circ Physiol2006;290(6):H2196–203.

[36] Hou M, Yang KM, Zhang H, et al. Transplantation of mesenchymal stem cells fromhuman bone marrow improves damaged heart function in rats. Int J Cardiol2007;115(2):220–8.

[37] Wei F, Wang TZ, Zhang J, et al. Mesenchymal stem cells neither fully acquire theelectrophysiological properties of mature cardiomyocytes nor promote ventriculararrhythmias in infarcted rats. Basic Res Cardiol 2012;107(4):274.

[38] Lahaye SeD, Gratas-Delamarche A, Malardé L, et al. Intense exercise training inducesadaptation in expression and responsiveness of cardiac β-adrenoceptors in diabeticrats. Cardiovasc Diabetol 2010;9(4):72–9.

[39] Dinçer UD, Bidasee KR, Güner S, Tay A, Ozçelikay AT, Altan VM. The effect of diabeteson expression of beta1-, beta2-, and beta3-adrenoreceptors in rat hearts. Diabetes2001;50(2):455–61.

[40] Laviola L, Belsanti G, Davalli AM, et al. Effects of streptozocin diabetes anddiabetes treat-ment by islet transplantation on in vivo insulin signaling in rat heart. Diabetes2001;50(12):2709–20.

[41] Jin P, Zhang X, Wu Y, et al. Streptozotocin-induced diabetic rat-derivedbone marrow mesenchymal stem cells have impaired abilities in proliferation,paracrine, antiapoptosis, and myogenic differentiation. Transplant Proc 2010;42(7):2745–52.

[42] Schu S, Nosov M, O'Flynn L, et al. Immunogenicity of allogeneic mesenchymal stemcells. J Cell Mol Med 2012;16(9):2094–103.