Transcriptional and post-translational regulation of mouse cationtransport regulator homolog 1

Kentaro Oh-hashi • Yuki Nomura • Kiyo Shimada •

Hisashi Koga • Yoko Hirata • Kazutoshi Kiuchi

Received: 23 January 2013 / Accepted: 17 April 2013

� Springer Science+Business Media New York 2013

Abstract Recently, cation transport regulator homolog 1

(Chac1) has been identified as a novel pro-apoptotic factor

in cells under endoplasmic reticulum (ER) stress. Of the

three major ER stress sensors, it is suggested that ATF4

participates in the transcriptional regulation of Chac1 gene

expression. The precise characterization of the Chac1

promoter, however, has not yet been elucidated. In this

study, we detected the induction of Chac1 mRNA expres-

sion using DNA array analysis and RT-PCR of thapsigar-

gin (Tg)-inducible genes in Neuro2a cells. Chac1 mRNA

expression was also induced immediately following treat-

ment with tunicamycin (Tm) and brefeldin A. Character-

ization of the mouse Chac1 promoter activity using a

luciferase reporter assay revealed that the CREB/ATF

element and amino acid response element in the mouse

Chac1 promoter are functional and respond to Tm stimu-

lation and ATF4 overexpression. Mutations in either ele-

ment in the Chac1 promoter did not inhibit the

responsiveness of this promoter to Tm and ATF4; however,

mutations in both of these elements dramatically decreased

the basal activity and response to ER stress stimuli. In

addition to the transcriptional regulation, we found that

Chac1 protein expression was only detected in the presence

of MG132, a proteasome inhibitor, even though mouse

Chac1 gene was transiently overexpressed in Neuro2a

cells. Taken together, we are the first to demonstrate the

transcriptional and post-translational regulation of Chac1

expression in a neuronal cell line.

Keywords ER stress � ATF4 � Chac1

Abbreviations

AARE Amino acid response element

AP1 Activator protein 1

ATF Activating transcription factor

BFA Brefeldin A

bZIP Basic leucine zipper

Chac1 Cation transport regulator homolog 1

C/EBP CCAAT-enhancer-binding protein

CHOP C/EBP homologous protein

CREB cAMP response element binding protein

CRELD2 Cysteine-rich with EGF-like domains 2

eIF2a Eukaryotic translation initiation factor 2A

ER Endoplasmic reticulum

ERSE ER stress response element

GADD153 Growth arrest and DNA-damage-inducible

protein 153

GRP78 78 kDa glucose-regulated protein

IRE1 Inositol-requiring enzyme 1

MANF Mesencephalic astrocyte-derived

neurotrophic factor

Nrf2 Nuclear factor (erythroid-derived 2)-like 2

PKA Protein kinase A

PERK PRKR-like endoplasmic reticulum kinase

RT-PCR Reverse transcription polymerase chain

reaction

Kentaro Oh-hashi, Yuki Nomura contributed equally to this study.

K. Oh-hashi (&) � Y. Nomura � Y. Hirata � K. Kiuchi

Department of Biomolecular Science, Faculty of Engineering,

Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan

e-mail: oohashi@gifu-u.ac.jp

K. Shimada � H. Koga

Kazusa DNA Research Institute, 2-6-7 Kazusa-Kamatari,

Kisarazu, Chiba 292-0818, Japan

Y. Hirata � K. Kiuchi

United Graduate School of Drug Discovery and Medical

Information Sciences, Gifu University, 1-1 Yanagido,

Gifu 501-1193, Japan

123

Mol Cell Biochem

DOI 10.1007/s11010-013-1663-1

Tg Thapsigargin

Tm Tunicamycin

TRIB3 Tribbles homolog 3

Introduction

The endoplasmic reticulum (ER) is responsible for the

folding and modification of newly synthesized transmem-

brane and secretory proteins [1, 2]. Some pathophysio-

logical conditions disrupt ER function and cause the

accumulation of unfolded and/or misfolded proteins in the

ER [3, 4]. These conditions, known as ER stress, activate

various stress responses that are mediated by the three ER-

resident stress sensors PERK-ATF4 [5], IRE1 [6], and

ATF6 [7]. A variety of genes have been identified as the

downstream targets of these sensors [8–11]. Recently, we

found that the induction of CRELD2 and MANF mRNA

expression in Neuro2a cells is ER stress-dependent using

DNA array analysis and RT-PCR [12, 13]. It has been

reported that ATF6 and/or IRE1 regulate the transcription

of the CRELD2 and MANF genes via the ER stress

response element (ERSE) or ERSE-II in the 50 flanking

promoter region of each gene, respectively [12, 14]. ER-

resident chaperones, such as GRP78 [15, 16], which are

responsible for proper protein folding in the ER, are well-

known targets of ATF6 and IRE1. Furthermore, a few

factors involved in ER-associated degradation (e.g., ER

degradation-enhancing a-mannosidase-like protein and E3

ubiquitin-protein ligase HRD1) have also been reported to

be the targets of IRE1 [17, 18].

ATF4 is preferentially translated in response to various

types of environmental stress signals including ER stress

[19], which induce eIF2a phosphorylation. In addition to

ER-resident PERK [5], other kinases, such as GCN2 [20],

heme-regulated inhibitor [21] and double-stranded RNA-

dependent kinase [22] which are activated by serum starva-

tion, oxidative stress and viral infection, respectively, have

been reported to participate in various cellular processes

through the eIF2a-ATF4 pathway [23, 24]. Therefore, this

pathway has been referred to as the integrated stress response

and implicated in various diseases (e.g., neurodegenerative

diseases and inflammations) [19, 25, 26]. In our DNA array

analysis, we also found that the downstream targets of the

PERK-ATF4 pathway GADD153/CHOP [27], TRIB3 [28]

and Chac1 [29] were remarkably upregulated in Tg-treated

Neuro2a cells. The GADD153/CHOP promoter contains

multiple stress responsive elements, including an activator

protein 1 (AP1) element, amino acid response element

(AARE) and ERSE. The roles each of these elements plays in

this promoter have been characterized under various stimuli

[30–33]. The transcriptional regulation of the TRIB3 gene

via the ATF4-CHOP pathway has also been studied in detail

[28]. Chac1 was first identified as a novel ER stress-inducible

gene in endothelial cells treated with oxidized phospholipids

[29]. It has been suggested that ATF4 plays an important role

in the regulation of Chac1 gene expression [29, 34–37], but a

detailed characterization of the Chac1 gene promoter has not

yet been reported. An analysis of the 50-flanking nucleotide

sequence of the mouse Chac1 gene suggests that there are

two putative consensus sequences, a CREB/ATF element

and AARE), in this region; however, relationships between

the two and their functions in regulating Chac1 promoter

activity under ER stress have not been elucidated. Therefore,

we isolated a mouse Chac1 promoter fragment, which was

approximately 400 bp length, and characterized its promoter

activity in response to ER stress stimuli and ATF4 overex-

pression. In addition to the transcriptional regulation of the

Chac1 gene, we also investigated the involvement of the

proteasome pathway in the post-translational instability of

the Chac1 protein.

Materials and methods

Materials

Thapsigargin (Tg), tunicamycin (Tm), brefeldin A (BFA),

forskolin (F) were obtained from Sigma-Aldrich. MG132

was purchased from Peptide Institute. Antibodies against

Chac1 and actin were purchased from Abcam and Cal-

biochem, respectively.

Construction of plasmids

For generating the reporter construct of the mouse Chac1

promoter, genomic DNA from Neuro2a cells was extrac-

ted, and the mouse Chac1 promoter (-334/?112) was

amplified using polymerase chain reaction (PCR). The

PCR product was then cloned into the pGL3-Basic

(pGL3b) vector (Promega). Other constructs containing

either deleted or mutated mouse Chac1 promoters were

also prepared by PCR. The promoter region was defined

using the NCBI Reference Sequences NM_026929.4 and

NM_024111.3. For generating mouse ATF4, cDNA was

amplified from Neuro2a cell-derived mRNA by reverse

transcriptional-polymerase chain reaction (RT-PCR) and

then cloned into the pFLAG-CMV vector. Mouse Chac1

cDNA was amplified from C57/BL6 mouse brain-derived

mRNA by RT-PCR and cloned into the pcDNA3.1 vector.

Cell culture and treatment

We used Neuro2a cells for characterization of Chac1 gene

according to our previous studies about ER stress response

Mol Cell Biochem

123

[12, 13]. Neuro2a cells were maintained in Dulbecco’s

modified eagles minimum essential medium containing

8 % fetal bovine serum. The transfection of each vector

used in this study was performed using the Lipofectamine-

Plus reagent (Life Technologies) according to the manu-

facturer’s instructions. Neuro2a cells were treated with

thapsigargin (Tg) (0.1 lM), tunicamycin (Tm) (2 lg/ml),

brefeldin A (BFA) (5 lg/ml), serum starvation (serum free,

SF), forskolin (F) (10 lM) or MG132 (MG) (20 lM) for

the indicated times.

RT-PCR

To estimate the expression level of each gene by RT-PCR,

total RNA was extracted from cells lysed with Trizol (Life

Technologies) [12, 13]. After incubation of total RNA for

10 min at 72 �C, cDNA was generated by reverse transcrip-

tion using total RNA (0.5 lg/10 ll), DTT (10 mM), dNTP

(0.5 mM), random ninemers (0.05 lg/10 ll), RNaseOUT (2

U/10 ll) (Life Technologies) and prime superscript III

RNase- reverse transcriptase (RT) (25 U/10 ll) (Life Tech-

nologies) for 60 min at 42 �C according to the manufacturer’s

instructions. Specific cDNAs were mixed and amplified using

a PCR reaction mixture containing the indicated primer pair

(1 lM), dNTP (0.1 mM), rTaq (0.25 U/10 ll) (Taq PCR kit,

Takara). The following RT-PCR primers were used in this

study: Chac1 sense primer, 50-CATAGGGGCAGCGACA-

AGATG-30, Chac1 antisense primer 50-CTGTGTGGCAAT-

GACCTCTTC-30, GADD153 sense primer 50-GAATAACA

GCCGGAACCTGA-30, GADD153 antisense primer 50-GGACGCAGGGTCAAGAGTAG-30, GRP78 sense primer

50-ACCAATGACCAAAACCGCCT-30, GRP78 antisense

primer 50-GAGTTTGCTGATAATTGGCTGAAC-30, GAPDH

sense primer, 50-ACCACAGTCCATGCCATCAC-30 and

GAPDH antisense primer, 50-TCCACCACCCTGTTGC

TGTA-30. The typical reaction conditions were 30 s at

96 �C, 30 s at 58 �C and 30 s at 72 �C. The results represent

20–28 cycles of amplification. The cDNA amplification

products were separated by electrophoresis on 2.0 % agarose

gels and visualized using ethidium bromide. The relative

mRNA level of Chac1 gene was calculated by comparison of

GAPDH-normalized values with the level of untreated

control cells using NIH imaging.

Reporter assay

Each reporter construct (0.1 lg) and the pGL4.70 (Rluc)

(0.04 lg) vector (Promega), an internal control, were

transfected into Neuro2a cells in a 48-well plate as previ-

ously described [12]. Twenty-four hours after transfection,

the cells were treated with Tm (2 lg/ml) or vehicle for

12 h. To determine the effect of ATF4 overexpression on

the reporter activity, the ATF4-expression vector or empty

vector (mock) (0.01 lg) was co-transfected with the

reporter construct into cells that were then cultured for

36 h. After each treatment, the cells were lysed with

1 9 passive lysis buffer (Promega) for 15 min at room

temperature and briefly centrifuged. The luciferase activity

in each lysate was measured using a Dual-Luciferase assay

system (Promega). The reporter activity in each lysate was

normalized to the co-transfected Renilla luciferase activity

and shown as the relative luciferase activity.

Western blot analysis

Cells were lysed with homogenate butter [20 mM Tris–

HCl (pH 8.0) containing 137 mM NaCl, 2 mM EDTA,

10 % glycerol, 1 % TritonX-100, 1 mM PMSF, 10 lg/ml

leupeptin and 10 lg/ml pepstatin A]. After the protein

concentration was determined, each cell lysate was dis-

solved in sodium dodecyl sulfate (SDS)-Laemmli sample

buffer [62.5 mM Tris–HCl (pH 6.8), 2 % SDS and 10 %

glycerol]. Equal amounts of cell lysate were separated on 8

or 12.5 % SDS–polyacrylamide electrophoresis gels,

immunoblotted onto polyvinylidene difluoride membrane

(GE Healthcare) and identified by enhanced chemilumi-

nescence (GE Healthcare) using antibodies against Chac1

(1:1,000) and actin (1: 5,000).

Statistical analysis

The results are expressed mean ± SD of the indicated

number. Statistical analysis was carried out by one way-

ANOVA followed by Fischer’s PLSD test. p \ 0.05 was

considered to be statistically significant.

Results

ER stress-upregulated Chac1 mRNA expression

in Neuro2a cells

The expression of Chac1, a novel ER stress-inducible gene,

has been reported to be upregulated under certain patho-

physiological conditions [29, 34–37]. Mungrue et al.

reported that Chac1 is a downstream target of ATF4 [29];

however, the precise mechanism of its transcriptional

regulation under ER stress has not yet been characterized.

Previously, we reported that the expression of the CRELD2

and MANF genes increased in Tg-treated Neuro2a cells

using DNA array analysis [12, 13]. This comprehensive

analysis also showed that Chac1 mRNA might be included

in the Tg-inducible genes. Therefore, we examined the ER

stress-induced expression of mouse Chac1 mRNA in

Neuro2a cells by RT-PCR. As shown in Fig. 1A, Tg

Mol Cell Biochem

123

treatment caused Chac1 mRNA expression, as well as

GADD153 and GRP78 mRNA expression, to increase in a

time-dependent manner. The relative mRNA level of

Chac1 gene, which was normalized with that of GAPDH

gene, was increased by 1.5-, 1.8-, and 2.3-fold after Tg

stimulation for 4, 8, and 12 h, respectively. Other ER

stress-inducing reagents, such as Tm and BFA (1.7- and

1.5-fold comparing with untreated control cells), but not

serum free (SF, 1.0-fold), also enhanced the expression

levels of Chac1 mRNA as well as those of GADD153 and

GRP78 mRNA (Fig. 1B).

Characterization of ER stress-induced mouse Chac1

promoter activity in Neuro2a cells

As shown in Fig. 2, the nucleotide sequence of the mouse

Chac1 promoter region is similar to the human Chac1

promoter region. They contain a highly homologous

domain around the CREB/ATF element and AARE (I and

II in Fig. 2), which seem to be recognized by ATF4 and its

related transcription factors.

To evaluate the roles these elements in regulating the

Chac1 promoter activity, various luciferase reporter

BA

Con Tg Tm BFA SF

GAPDH

Chac1

0 4 8 12

GRP78GRP78

GADD153GADD153

GAPDH

Chac1

Time (h)

Fig. 1 ER stress-induced

Chac1 mRNA expression in

Neuro2a cells. A Neuro2a cells

were treated with 0.1 lM Tg for

the indicated times. B Neuro2a

cells were treated with Tg

(0.1 lM), Tm (2 lg/ml), BFA

(5 lg/ml), serum free (SF) or

vehicle (Con) for 8 h. The total

RNA isolated from each sample

was subjected to RT-PCR as

described in the ‘‘Materials and

methods’’ section

ACCGTTTAGACCACTGAGAGGGCCTTCCCGGGAGA----CGGCGGGTGCCCGCGCCCATT **** *** * * ****** ** * ******* ****AGGGGCCCAGGTCATGAG-GGGGCGGCTGGGGAGACGCCCGCCCGGTGCCC--GCCCTGG

CTAAGGCCCGTTCCCGGTGCCAGCAGCCTGACGCAATCTGACTCGCCCTTGCTGCATGCC *** ** *** **** ** ************* ** *****************GCCCGGCGGGTGCCCCCTGCCCGCCGCCTGACGCAATCCGAGGCGCCCTTGCTGCATGCC

AGTTCTGGGGAAACCTTCCCTGCCGTTGCATCACTCCTGCCAGGTCTGCCACGGGAGGAG * **** ******* **************************** ****** **** *GGCGCTGGAGAAACCTCCCCTGCCGTTGCATCACTCCTGCCAGGTTTGCCAC-AGAGGTG

GAGCCGAACCAATCAGCACGCGCGTTGGCCCTGGGGCGGGCTGCTCTGGTACCCACTCGG**** ************ ***** ** **** **GAGCTGAACCAATCAGCGGGCGCG------CT-----GGGC-----------CC------

AGGGCGGCGCGGTTAACCGAGAAGCAAAATCTAAAGGTGATTGGCCAGAAAGAGATTTGC ************* ******** **** *** ********** ** * *******---GCGGCGCGGTTAAGTGAGAAGCAGAATCCGAAGTTGATTGGCCAAAAGGGGATTTGC

CCCGCCCCAATCATCGGGACAGCTGGAGGCAGTCTGAGGGCCTTCCTGGCCGGAGGGTTT*** ********* ** * ******* ** ** * * * *** *** ** *****CCCACCCCAATCACCGCGGCAGCTGGCCGCGGTGGGCGTGGTCTCCCGGCAAGAAGGTTT

AAAGAGCGCCTCTGGAGGGACCACTCAGCTGGAACGACCGATCGGTGCCAGGCCAGGTGT**** ******* *** * ********** * ***** ******************AAAGGGCGCCTCCATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGT

ACGCGTCCGTCGGTCCTTCCGTGCCCGTGCCGGAGACCAGTCTCGGAGGCCACCCGGGTC ************* ********************* * ******* ** *** *GTGCGTCCGTCGGTCTTTCCGTGCCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCC

mouse

human

+142

-334

+127

-318I

II

Fig. 2 Nucleotide sequences of

the 50-flanking region of the

mouse and human Chac1 gene.

Nucleotide sequences conserved

between the 50-flanking

promoter region of the mouse

and human Chac1 genes are

indicated with asterisks. The

conserved CREB/ATF element

(I) and AARE (II) are shown in

a box. The transcriptional

direction and putative

transcriptional start sites of the

mouse and human Chac1 gene

are shown with arrows and

arrowheads, respectively

Mol Cell Biochem

123

constructs containing serial deletions or various mutations in

the promoter region of the mouse Chac1 gene were trans-

fected into Neuro2a cells (Fig. 3). The Chac1 promoter

containing both the CREB/ATF element and AARE (-334/

?112, -262/?112) appeared to have a higher basal pro-

moter activity compared with other deleted reporter con-

structs (-210/?112, -136/?122), and responded to Tm

treatment (Fig. 3A) and ATF4 overexpression (Fig. 3B).

Deletion of the CREB/ATF element (-210/?112) reduced

the basal promoter activity by more than 50 % but this

deleted promoter significantly responded to above two

stimulations. The basal reporter activity of the Chac1 pro-

moter construct without both the elements (-136/?112) was

less than one-tenth of that of the intact constructs (-334/

?112 and -262/?112). Furthermore, the deletion of these

two elements abolished the responsiveness to Tm treatment

and ATF4 overexpression.

To examine the effects of another stimulus known to

regulate the activity of the CREB/ATF element on the

expression of Chac1 mRNA, Neuro2a cells were treated

with forskolin, a well-known activator of the PKA-CREB

cascade (Fig. 4). Although the forskolin treatment induced

the phosphorylation of CREB (data not shown), it failed to

induce Chac1 mRNA expression or enhance the Chac1

luciferase reporter activity (-262/?112 and -136/?112).

To confirm the role of each element in regulating ER

stress responsiveness more precisely, we examined pro-

moter activities of Chac1 reporter constructs containing

mutations in the CREB/ATF element and/or the AARE

(Fig. 5). As shown in Fig. 5A, the Chac1 promoters (-262/

?112 m1 and m2) appeared to have lower basal promoter

activities compared with the intact construct (-262/?112).

These mutant Chac1 reporter constructs, however, signifi-

cantly responded to Tm treatment (Fig. 5A(a)) and ATF4

overexpression (Fig. 5A(b)). Mutations in both of these

elements (-262/?112 m3) almost completely abolished

the promoter responsiveness to these stimuli, similar to the

deletion of the distal region of the Chac1 promoter without

both the elements (-136/?112) (Fig. 3). In the Chac1

promoter construct that only contained the AARE

(Fig. 5B), each type of mutation introduced in the AARE

(-210/?112 m1, m2 and m3) reduced the basal promoter

Relative luciferase activity

0 5 10 15 20 25 30

-136/+112

-210/+112

-262/+112

-334/+112

pGL3b

CREB/ATF AARE

pGL3b

-334/+112

-262/+112

-210/+112

-136/+112

CREB/ATF AARE

0 200 400 600 800 1000

Relative luciferase activity

Tm−+−+−+−+−+

−+

−+

−+−+−+

ATF4

*

*

*

*

*

*

B

A

Fig. 3 Activation of the Chac1 promoter in Neuro2a cells treated

with Tm and overexpressing ATF4. A Neuro2a cells were transfected

with various luciferase reporter constructs containing successive

deletions of the promoter sequence in the mouse Chac1 gene. After

24 h, the cells were incubated with or without Tm (2 lg/ml) for 12 h

and the resulting luciferase activity was measured. The basal

luciferase activity and the luciferase activity of Tm-treated cells are

shown as open and closed columns, respectively. B An ATF4

expression vector or an empty vector (mock) was co-transfected with

each of the reporter constructs into Neuro2a cells. After 36 h, the

resulting luciferase activity was measured. The luciferase activity in

mock and ATF4 co-transfected cells are shown as open and closedcolumns, respectively. Values represent the mean ± SD from three

independent cultures and are expressed relative to the basal activity of

the pGL3-Basic vector. Data were analyzed by one way-ANOVA

followed by Fischer’s PLSD test to evaluate the effects of Tm

treatment (A) or ATF4 overexpression (B) on each Chac1 promoter

activity; values marked with an asterisk are significantly different

from the untreated Chac1 promoter activity (p \ 0.05)

Mol Cell Biochem

123

activity and rendered the mutant construct unresponsive to

Tm treatment (Fig. 5B(a)) and ATF4 overexpression

(Fig. 5B(b)).

Post-translational regulation of Chac1

via the proteasome pathway in Neuro2a cells

In addition to the transcriptional regulation of the mouse

Chac1 gene expression, we also investigated the expression

of the mouse Chac1 protein in Neuro2a cells transiently

transfected with the mouse Chac1 gene because the

intrinsic Chac1 protein expression level could not be

detected in cells cultured in the presence or absence of ER

stress stimuli (data not shown). The expression of the

Chac1 protein could only be detected 36 h after transfec-

tion in cells treated with MG132, a proteasome inhibitor

(Fig. 6). Furthermore, the expression of the intrinsic Chac1

mRNA was hardly affected by MG132 treatment, which is

unlike the effects seen with the Tg and Tm treatments.

Discussion

The induction of Chac1 mRNA expression in several

models [34–37] has been reported since Chac1 was first

identified as a novel ER stress-inducible gene in endothe-

lial cells treated with oxidized phospholipids [29]. Our

study using DNA array analysis and RT-PCR shows that

Tg-triggered ER stress also increases the expression level

of Chac1 mRNA in a neuronal cell line, Neuro2a cells. We

also discovered that Chac1 expression is regulated by both

transcriptional and post-translational mechanisms. The

expression pattern of Chac1 mRNA in Neuro2a cells is

similar to other typical ER stress-inducible genes, such as

GADD153/CHOP [27] and GRP78 [15, 16]. In the 50

upstream region of the mouse Chac1 gene, there are two

consensus sequences, a CREB/ATF element and an AARE,

that are well conserved between the mouse and human

Chac1 promoter region. Typically, the three ER-resident

stress sensors PERK [5], IRE1 [6] and ATF6 [7] are

simultaneously activated in response to various stimuli that

trigger ER dysfunction and induce the expression of sev-

eral downstream target genes [8–11]. The active form of

PERK phosphorylates eIF2a, which induces ATF4 trans-

lation. Furthermore, phospho-eIF2a inhibits global protein

synthesis [23]. It has been demonstrated that the increased

level of ATF4 generated in response to ER stress specifi-

cally recognizes the AARE/NSRE and induces the tran-

scription of target genes, such as GADD153/CHOP [27,

33], TRIB3 [28] and asparagines synthetase [38]. Regard-

ing the regulation of the Chac1 promoter, Romanski et al.

[35] recently reported that the CREB/ATF element, just

upstream of the AARE, in the human Chac1 promoter

specifically responds to ATF4 overexpression by enhanc-

ing the promoter activity in human aortic endothelial cells.

In our study, we show that while the CREB/ATF element

in the mouse Chac1 promoter, which is well conserved

with the human Chac1 promoter, is important for the basal

promoter activity, Chac1 reporter constructs lacking the

CREB/ATF element (-210/?112) or containing a muta-

tion in the CREB/ATF element (-262/?112 m1) still

respond to Tm treatment and ATF4 overexpression. Fur-

thermore, mutations in the AARE of the mouse Chac1

Con Tm F

GAPDH

Chac1

A B0 250 500 750 1000

Relative luciferase activityTm F

pGL3b

-262/+112

-136/+112

+−

− −

+ −

+−

− −

+ −

+−

− −

+ −

*

*

Fig. 4 Forskolin failed to induce Chac1 mRNA expression or

enhance its promoter activity in Neuro2a cells. A Neuro2a cells were

treated with 10 lM forskolin (F), 2 lg/ml Tm or vehicle (Con) for

12 h. The total RNA isolated from each sample was subjected to RT-

PCR as described in the ‘‘Materials and methods’’ section. B Neuro2a

cells were transfected with the indicated Chac1 reporter construct.

After 24 h, the cells were incubated with forskolin, Tm, or vehicle for

12 h and the resulting luciferase activity was measured. Values

represent the mean ± SD from three independent cultures and are

expressed relative to the basal activity of the pGL3-Basic vector. Data

were analyzed by one way-ANOVA followed by Fischer’s PLSD test

to evaluate the effect of each treatment on the Chac1 promoter

activity; values marked with an asterisk are significantly different

from the Tm-treated Chac1 promoter activity (p \ 0.05)

Mol Cell Biochem

123

promoter (-262/?112 m2) also appeared to have no effect

on the response of the promoter to these stimuli. Taken

together, the results from our mutant and deletion Chac1

reporter constructs suggest that while the CREB/ATF ele-

ment and AARE in the mouse Chac1 promoter respond to

ER stress stimuli, they do not act in a synergistic manner.

These two elements, however, may work together to

maintain the basal activity of the Chac1 promoter because

mutations in both of these elements (-262/?112 m3)

significantly decrease the reporter activity compared with

the single mutation Chac1 reporter constructs (-262/?112

m1 and m2).

A

tcgc

tcgc

-262 +112

CREB/ATF AARE

cagcag

-262/+112-262/+112 m1-262/+112 m2-262/+112 m3

0 100 200 300 400ATF4

pGL3b

-262/+112 m1

-262/+112 m2

-262/+112 m3

-262/+112CREB/ATF AARE

Relative luciferase activity

pGL3b

-262/+112 m1

-262/+112 m2

-262/+112 m3

-262/+112CREB/ATF AARE

Relative luciferase activity

0 100 200 300 400 500 600Tm−+−+−+−+−+

−+−+−+−+−+

*

*

*

*

*

*

(b)

(a)

-210 +112AARE

caggac

gcga

-210/+112-210/+112 m1-210/+112 m2-210/+112 m3

0 20 40 60 80 100 120

Relative luciferase activity

-210/+112 m1

-210/+112 m2

-210/+112 m3

-136/+112

-210/+112

pGL3bAARE

0 100 200 300 400

Relative luciferase activity

Tm

pGL3b

-136/+112

-210/+112

-210/+112 m1

-210/+112 m2

-210/+112 m3

AARE

B

−+−+−+−+−+−+

ATF4

−+−+−+−+−+−+

*

*

(b)

(a)

Fig. 5 Mutagenesis analysis of

the mouse Chac1 promoter. The

mutated sequences of the

CREB/ATF element and AARE

in the mouse Chac1 promoter

are shown in small letters. A,

B Neuro2a cells were

transfected with the indicated

luciferase reporter construct.

After 24 h, the cells were

incubated with or without Tm

(2 lg/ml) for 12 h, and the

resulting luciferase activity was

measured. The basal luciferase

activity and the luciferase

activity of the Tm-treated cells

are shown as open and closedcolumns, respectively (a). The

ATF4 expression vector or an

empty vector (mock) was co-

transfected with each of the

reporter constructs into Neuro2a

cells. After 36 h, the resulting

luciferase activity was measured

(b). The luciferase activity in

mock and ATF4 co-transfected

cells are shown as open and

closed columns, respectively.

Values represent the

mean ± SD from three

independent cultures and are

expressed relative to the basal

activity of the pGL3-Basic

vector. Data were analyzed by

one way-ANOVA followed by

Fischer’s PLSD test to evaluate

the effect of Tm treatment (a) or

ATF4 overexpression (b) on

each Chac1 promoter activity;

values marked with an asteriskare significantly different from

the untreated Chac1 promoter

activity (p \ 0.05)

Mol Cell Biochem

123

ATF4, also known as CREB2, is one of the CREB/ATF

family transcription factors [39]. It is well known that

CREB is phosphorylated by several kinases, including

PKA and MAP kinases, to regulate the expression of var-

ious different genes [40]. In this study, CREB was well

phosphorylated when cells were treated with forskolin

(data not shown). The Chac1 mRNA expression pattern

and the results from our luciferase reporter assays after

each of these treatments (Fig. 4) indicate that the PKA-

dependent signaling pathway does not induce the expres-

sion of the Chac1 gene through the CREB/ATF element

and AARE. We also examined the effect of PMA, a potent

PKC activator, on Chac1 transcription, but it neither

induced Chac1 mRNA expression nor enhanced the lucif-

erase reporter activity (data not shown). Therefore, our

results suggest that the expression of the mouse Chac1

gene is specifically upregulated by ER stress-triggering

stimuli.

It has been reported that Chac1 mRNA expression

increases in several pathological conditions [29, 34–37], but

the mechanism regulating Chac1 protein expression has not

been well characterized. Mungre et al. [29] demonstrated

that the overexpression of a GFP-tagged Chac1 caused

HEK293 and human aortic endothelial cells to undergo

apoptotic cell death though the activation of the apoptosis-

promoting factors caspase-3 and AIF and the suppression of

the apoptosis-inhibitory factor TNFRSF6B. The Chac1

protein expression pattern, however, has not yet been

studied. In this study, we transfected Neuro2a cells with a

mouse Chac1 gene construct that did not contain any epi-

tope-tags, but Chac1 protein could only be detected in cells

treated MG132. We also examined the intrinsic expression

of Chac1 protein in the presence or absence of MG132 and

other ER stress stimuli, but no specific signal could be

detected under our experimental conditions (data not

shown). As Chac1 protein is rapidly degraded in the pro-

teasome pathway and extremely unstable in cells, the

amount of intrinsic protein would be below the detection

level of our experimental techniques. Protein degradation

through the proteasome followed by ubiquitination is an

important mechanism that regulates various cellular signals

and processes, including the cell cycle, differentiation and

apoptosis [41]. Similarly, the expression of many factors

involved in the ER stress response has been reported to be

regulated in a transcriptional and translational manner by a

proteasome-dependent pathway. In the case of ATF4

expression, Jiang and Wek reported that proteasome inhi-

bition leads to the accumulation of ATF4 protein without

affecting the expression level of ATF4 mRNA [24]. They

also showed that the expression levels of GADD153 mRNA

and protein increased as a result of MG132-induced ATF4

stabilization and phospho-eIF2a-required ATF4 accumu-

lation. In this study, we also found that the amount of ATF4

protein increased in Neuro2a cells treated with MG132.

This ATF4 protein increase was more apparent with

MG132 treatment than with Tg or Tm treatment (data not

shown). Furthermore, the accumulation of ATF4 protein in

MG132-treated Neuro2a cells was independent of the

expression level of Chac1 mRNA. We also observed that

there was only a marginal increase in GADD153 mRNA

expression during proteasome inhibition. Even though the

precise mechanism preventing MG132 from significantly

inducing the expression of Chac1 and GADD153 mRNA in

Neuro2a cells despite the increase in ATF4 protein remains

unknown, differences in the MG132-stabilizing factors

between mouse embryonic fibroblasts and Neuro2a cells

may influence ATF4-mediated gene expression following

proteasome inhibition. It has been demonstrated that tran-

scription factors consisting of a basic leucine zipper domain

(bZIP) similar to ATF4 are capable of interacting with other

bZIP factors [42]. It has also been reported that ATF4

cooperates with C/EBPb [38], GADD153 [43], and Nrf2

[44] to enhance the expression of target genes. Therefore,

further studies characterizing these factors in several cell

types may be required to elucidate the transcriptional and

post-transcriptional regulation of Chac1 expression.

In conclusion, we first characterized two ATF4

responsive elements, CREB/ATF and AARE, in mouse

Con Tm

GAPDH

Chac1

Tg MG

GADD153

Chac1

Con MGTmTg

Actin

A BkDa

25

50

37

37

Fig. 6 Proteasome inhibition increased the Chac1 protein expression

level in Neuro2a cells. A Neuro2a cells were treated with 0.1 lM Tg,

2 lg/ml Tm, 20 lM MG132 (MG), or vehicle (Con) for 12 h. The

total RNA isolated from each sample was subjected to RT-PCR as

described in the ‘‘Materials and methods’’ section. B Twenty-four

hours after transfection of Chac1 expression construct, the cells were

incubated with Tg, Tm, MG132 (MG) or vehicle (Con) for 12 h. The

expression of Chac1 and actin was detected using the western blot

analysis described in the ‘‘Materials and methods’’ section

Mol Cell Biochem

123

Chac1 promoter using luciferase reporter assay. As it has

been demonstrated that a variety of signals triggered by ER

stress, oxidative stress and viral infection are integrated

into ATF4 pathways via eIF2a phosphorylation [19–22],

further characterization of Chac1 promoter in different

types of cells might contribute to understand various cel-

lular processes and diseases (e.g., neurodegenerative dis-

eases and inflammations) [25, 26]. In this study, we also

demonstrated that Chac1 protein is unstable within the cells

and its intracellular amount might be definitely regulated

via a proteasome system. Very recently, Kumar et al. [45]

reported that the pro-apoptotic feature of Chac1 is attrib-

uted to the specific degradation of glutathione through its

own c-glutamyl-cyclotransferase activity. Therefore, our

findings about the Chac1 promoter would support the

phenomena that the perturbation of cellular redox status

occurs in response to ER stress [46]. Further character-

ization of Chac1 may give new insight into preventing the

onset and progression of the various diseases caused by the

stress responses via the eIF2a-ATF4 pathway.

References

1. Gething MJ, Sambrook J (1992) Protein folding in the cell.

Nature 355:33–45

2. Helenius A, Marquardt T, Braakman I (1992) The endoplasmic

reticulum as a protein-folding compartment. Trends Cell Biol

2:227–231

3. Kim I, Xu W, Reed JC (2008) Cell death and endoplasmic

reticulum stress: disease relevance and therapeutic opportunities.

Nat Rev Drug Discov 7:1013–1030

4. Lindholm D, Wootz H, Korhonen L (2006) ER stress and neu-

rodegenerative diseases. Cell Death Differ 13:385–392

5. Harding HP, Zhang Y, Ron D (1999) Protein translation and

folding are coupled by an endoplasmic-reticulum-resident kinase.

Nature 397:271–274

6. Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP,

Clark SG, Ron D (2002) IRE1 couples endoplasmic reticulum

load to secretory capacity by processing the XBP-1 mRNA.

Nature 415:92–96

7. Zhu C, Johansen FE, Prywes R (1997) Interaction of ATF6 and

serum response factor. Mol Cell Biol 17:4957–4966

8. Okada T, Yoshida H, Akazawa R, Negishi M, Mori K (2002)

Distinct roles of activating transcription factor 6 (ATF6) and

double-stranded RNA-activated protein kinase-like endoplasmic

reticulum kinase (PERK) in transcription during the mammalian

unfolded protein response. Biochem J 366:585–594

9. Rutkowski DT, Kaufman RJ (2003) All roads lead to ATF4. Dev

Cell 4:442–444

10. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001)

XBP1 mRNA is induced by ATF6 and spliced by IRE1 in

response to ER stress to produce a highly active transcription

factor. Cell 107:881–891

11. Lee AH, Iwakoshi NN, Glimcher LH (2003) XBP-1 regulates a

subset of endoplasmic reticulum resident chaperone genes in the

unfolded protein response. Mol Cell Biol 23:7448–7459

12. Oh-hashi K, Koga H, Ikeda S, Shimada K, Hirata Y, Kiuchi K

(2009) CRELD2 is a novel endoplasmic reticulum stress-induc-

ible gene. Biochem Biophys Res Commun 387:504–510

13. Oh-hashi K, Tanaka K, Koga H, Hirata Y, Kiuchi K (2012) Intra-

cellular trafficking and secretion of mouse mesencephalic astro-

cyte-derived neurotrophic factor. Mol Cell Biochem 363:35–41

14. Mizobuchi N, Hoseki J, Kubota H, Toyokuni S, Nozaki J, Naitoh

M, Koizumi A, Nagata K (2007) ARMET is a soluble ER protein

induced by the unfolded protein response via ERSE-II element.

Cell Struct Funct 32:41–50

15. Yamamoto K, Sato T, Matsui T, Sato M, Okada T, Yoshida H,

Harada A, Mori K (2007) Transcriptional induction of mamma-

lian ER quality control proteins is mediated by single or com-

bined action of ATF6a and XBP1. Dev Cell 13:365–376

16. Wang M, Ye R, Barron E, Baumeister P, Mao C, Luo S, Fu Y,

Luo B, Dubeau L, Hinton DR, Lee AS (2010) Essential role of

the unfolded protein response regulator GRP78/BiP in protection

from neuronal apoptosis. Cell Death Differ 17:488–498

17. Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori

K (2003) A time-dependent phase shift in the mammalian

unfolded protein response. Dev Cell 4:265–271

18. Yamamoto K, Suzuki N, Wada T, Okada T, Yoshida H, Kaufman

RJ, Mori K (2008) Human HRD1 promoter carries a functional

unfolded protein response element to which XBP1 but not ATF6

directly binds. J Biochem 144:477–486

19. Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, Ron

D (2000) Regulated translation initiation controls stress-induced

gene expression in mammalian cells. Mol Cell 6:1099–1108

20. Berlanga JJ, Santoyo J, De Haro C (1999) Characterization of a

mammalian homolog of the GCN2 eukaryotic initiation factor 2akinase. Eur J Biochem 265:754–762

21. Chen JJ, London IM (1995) Regulation of protein synthesis by

heme-regulated eIF-2a kinase. Trends Biochem Sci 20:105–108

22. Clemens MJ, Elia A (1997) The double-stranded RNA-dependent

protein kinase PKR: structure and function. J Interferon Cytokine

Res 17:503–524

23. Vattem KM, Wek RC (2004) Reinitiation involving upstream

ORFs regulates ATF4 mRNA translation in mammalian cells.

Proc Natl Acad Sci USA 101:11269–11274

24. Jiang HY, Wek RC (2005) Phosphorylation of the a-subunit of

the eukaryotic initiation factor-2 (eIF2a) reduces protein syn-

thesis and enhances apoptosis in response to proteasome inhibi-

tion. J Biol Chem 280:14189–14202

25. Lange PS, Chavez JC, Pinto JT, Coppola G, Sun CW, Townes

TM, Geschwind DH, Ratan RR (2008) ATF4 is an oxidative

stress-inducible, prodeath transcription factor in neurons in vitro

and in vivo. J Exp Med 205:1227–1242

26. Woo CW, Cui D, Arellano J, Dorweiler B, Harding H, Fitzgerald

KA, Ron D, Taba I (2009) Adaptive suppression of the ATF4-

CHOP branch of the unfolded protein response by toll-like

receptor signalling. Nat Cell Biol 11:1473–1480

27. Luethy JD, Fargnoli J, Park JS, Fornace AJ Jr, Holbrook NJ

(1990) Isolation and characterization of the hamster gadd153

gene. Activation of promoter activity by agents that damage

DNA. J Biol Chem 265:16521–16526

28. Ohoka N, Yoshii S, Hattori T, Onozaki K, Hayashi H (2005)

TRB3, a novel ER stress-inducible gene, is induced via ATF4-

CHOP pathway and is involved in cell death. EMBO J

24:1243–1255

29. Mungrue IN, Pagnon J, Kohannim O, Gargalovic PS, Lusis AJ

(2009) CHAC1/MGC4504 is a novel proapoptotic component of

the unfolded protein response, downstream of the ATF4-ATF3-

CHOP cascade. J Immunol 182:466–476

30. Guyton KZ, Xu Q, Holbrook NJ (1996) Induction of the mam-

malian stress response gene GADD153 by oxidative stress: role

of AP-1 element. Biochem J 314:547–554

31. Oh-hashi K, Maehara K, Isobe K (2004) Hydrogen peroxide

induces GADD153 in Jurkat cells through the protein kinase

C-dependent pathway. Redox Rep 9:173–178

Mol Cell Biochem

123

32. Ma Y, Brewer JW, Diehl JA, Hendershot LM (2002) Two distinct

stress signaling pathways converge upon the CHOP promoter

during the mammalian unfolded protein response. J Mol Biol

318:1351–1365

33. Bruhat A, Jousse C, Carraro V, Reimold AM, Ferrara M, Fa-

fournoux P (2000) Amino acids control mammalian gene tran-

scription: activating transcription factor 2 is essential for the

amino acid responsiveness of the CHOP promoter. Mol Cell Biol

20:7192–7204

34. Magne L, Blanc E, Legrand B, Lucas D, Barouki R, Rouach H,

Garlatti M (2011) ATF4 and the integrated stress response are

induced by ethanol and cytochrome P450 2E1 in human hepa-

tocytes. J Hepatol 54:729–737

35. Romanoski CE, Che N, Yin F, Mai N, Pouldar D, Civelek M, Pan

C, Lee S, Vakili L, Yang WP, Kayne P, Mungrue IN, Araujo JA,

Berliner JA, Lusis AJ (2011) Network for activation of human

endothelial cells by oxidized phospholipids: a critical role of

heme oxygenase 1. Circ Res 109:e27–e41

36. Goebel G, Berger R, Strasak AM, Egle D, Muller-Holzner E,

Schmidt S, Rainer J, Presul E, Parson W, Lang S, Jones A,

Widschwendter M, Fiegl H (2012) Elevated mRNA expression of

CHAC1 splicing variants is associated with poor outcome for

breast and ovarian cancer patients. Br J Cancer 106:189–198

37. Galluzzi L, De Santi M, Crinelli R, De Marco C, Zaffaroni N,

Duranti A, Brandi G, Magnani M (2012) Induction of endo-

plasmic reticulum stress response by the indole-3-carbinol cyclic

tetrameric derivative CTet in human breast cancer cell lines.

PLoS One 7:e43249

38. Siu F, Bain PJ, LeBlanc-Chaffin R, Chen H, Kilberg MS (2002)

ATF4 is a mediator of the nutrient-sensing response pathway that

activates the human asparagine synthetase gene. J Biol Chem

277:24120–24127

39. Hai T, Hartman MG (2001) The molecular biology and nomen-

clature of the activating transcription factor/cAMP responsive

element binding family of transcription factors: activating tran-

scription factor proteins and homeostasis. Gene 273:1–11

40. Johannessen M, Delghandi MP, Moens U (2004) What turns

CREB on? Cell Signal 16:1211–1227

41. Navon A, Ciechanover A (2009) The 26 S proteasome: from basic

mechanisms to drug targeting. J Biol Chem 284:33713–33718

42. Newman JR, Keating AE (2003) Comprehensive identification of

human bZIP interactions with coiled-coil arrays. Science

300:2097–2101

43. Su N, Kilberg MS (2008) C/EBP homology protein (CHOP)

interacts with activating transcription factor 4 (ATF4) and neg-

atively regulates the stress-dependent induction of the asparagine

synthetase gene. J Biol Chem 283:35106–35117

44. He CH, Gong P, Hu B, Stewart D, Choi ME, Choi AM, Alam J

(2001) Identification of activating transcription factor 4 (ATF4)

as an Nrf2-interacting protein. Implication for heme oxygenase-1

gene regulation. J Biol Chem 276:20858–20865

45. Kumar A, Tikoo S, Maity S, Sengupta S, Sengupta S, Kaur A, Kumar

A, Bachhawat AK (2012) Mammalian proapoptotic factor ChaC1

and its homologues function as c-glutamyl cyclotransferases acting

specifically on glutathione. EMBO Rep 13(12):1095–1101

46. McCullough KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ

(2001) Gadd153 sensitizes cells to endoplasmic reticulum stress

by down-regulating Bcl2 and perturbing the cellular redox state.

Mol Cell Biol 21:1249–1259

Mol Cell Biochem

123