Toll-Like Receptor–Mediated Signaling in HumanAdipose-Derived Stem Cells: Implications

for Immunogenicity and Immunosuppressive Potential

Eleuterio Lombardo, Ph.D.,1,2,* Olga DelaRosa, Ph.D.,1,* Pablo Mancheno-Corvo,1

Ramon Menta,1 Cristina Ramırez,1 and Dirk Buscher, Ph.D.1

Human adipose-derived stem cells (hASCs) are mesenchymal stem cells with reduced immunogenicity and thecapability to modulate immune responses. These properties make hASCs of special interest as therapeutic agentsin the settings of chronic inflammatory and autoimmune diseases. Exogenous and endogenous toll-like receptor(TLR) ligands have been linked with the perpetuation of inflammation in a number of chronic inflammatorydiseases such as inflammatory bowel disease and rheumatoid arthritis because of the permanent exposure of theimmune system to TLR-specific stimuli. Therefore, hASCs employed in therapy are potentially exposed to TLRligands, which may result in the modulation of hASC activity and therapeutic potency. In this study, wedemonstrate that hASCs possess active TLR2, TLR3, and TLR4, because activation with specific ligands resultedin induction of nuclear factor kappa B–dependent genes, such as manganese superoxide dismutase and therelease of interleukin (IL)-6 and IL-8. TLR3 and TLR4 ligands increased osteogenic differentiation, but no effecton adipogenic differentiation or proliferation was observed. Moreover, we show that TLR activation does notimpair the immunogenic and immunosuppressive properties of hASCs. These results may have importantimplications with respect to the safety and efficacy of hASC-based cell therapies.

Introduction

Toll-like receptors (TLRs) are broadly expressed inimmune and non-immune cells and are important sen-

sors for the detection of foreign pathogens and endogenousdanger signals.1,2 TLRs activate a rapid effector response,which implies innate and adaptive immune responses.3

Ligand recognition results in the recruitment of intracellularToll=Interleukin1 Receptor (TIR)-domain-containing adaptorproteins, including myeloid-differentiation primary-responseprotein 88 (MyD88) and Toll=interleukin (IL)-1R domain-containing adaptor-inducing interferon (IFN)-b (TRIF),leading to the activation of MyD88-dependent or MyD88-independent pathways.4–6 TLR triggering leads to activationof nuclear factor kappa B (NF-kB) and mitogen-activatedprotein kinase (MAPK) signalling pathways, which results inthe induction of pro-inflammatory cytokines, including tumornecrosis factor-alpha (TNFa), IL-6, IL-1b, and type I IFN andthe up-regulation of co-stimulatory molecules.

Eleven human TLRs have been identified that recognizedistinct microbial products from bacteria, viruses, protozoa,and fungi. Thus, TLR2 recognizes peptidoglycans (PGNs),

lipoproteins, and lipoteichoic acids from gram-positive bac-teria; TLR3 recognizes double-stranded RNA (dsRNA) andpoly-inosinic acid:cytidylic acid poly I:C, a synthetic dsRNAanalog; TLR4 recognizes gram-negative lipopolysaccharide(LPS); TLR5 senses bacterial flagellin; and TLR9 detects un-methylated bacterial DNA.1,4 In addition, the recognition ofendogenous ligands by TLRs (e.g., heat shock proteins, cel-lular DNA) is thought to have an important role in the reg-ulation of inflammation.7–11

Mesenchymal stem cells (MSCs) are multipotent adultstem cells capable of differentiation to mesenchymal-typecells (adipocytes, osteoblasts, and chondrocytes) and tomyocytes, neurons, endothelial cells, astrocytes, and epithe-lial cells.12–14 Adipose tissue is a potential source of MSCsreferred to as human adipose-derived mesenchymal stemcells (hASCs).15 hASCs can be isolated from liposuctioned fattissue and expanded over a long time in culture. In additionto their differentiation potential, hASCs share with otherMSCs the unique ability to suppress immune responses.Ex vivo expanded MSCs and ASCs have been reported toinhibit activation, proliferation, and function of immunecells, including T cells, B cells, natural killer cells, and

1Cellerix S.A, Tres Cantos, Spain2Fundacion Inbiomed, San Sebastian, Spain*Eleuterio Lombardo and Olga DelaRosa contributed equally to this manuscript

TISSUE ENGINEERING: Part AVolume 15, Number 00, 2009ª Mary Ann Liebert, Inc.DOI: 10.1089=ten.tea.2008.0340

1

antigen-presenting cells.16–18 There is evidence that thisability to modulate immune responses relies on cell contact–dependent mechanisms and soluble factors secreted byMSCs and ASCs in response to cytokines released by acti-vated immune cells. Soluble factors such as hepatocytegrowth factor, prostaglandin E2, transforming growth factor(TGF)-b1, indoleamine 2,3-dioxygenase (IDO), nitric oxide,and IL-10 have been implicated.19–26 Several reports haveshown that IFNg plays an active role in the immunosup-pression mediated by MSCs and ASCs through its inductionof prostaglandins and IDO release.21 An additional immu-nological feature of all MSCs, hASCs among them, is thatthey are considered to be poorly immunogenic because theyexpress low levels of human leukocyte antigen (HLA)-I butdo not express HLA-II, CD40, CD80, or CD86. This pheno-type is thought to lead to the activation of T cells mediatedvia HLA-I but concomitantly to anergy due to the absenceof co-stimulatory molecules.27 Recent studies have shownthat MSCs express active TLRs, which may modulatestem cell function.28–31

The two biological abilities (differentiation and immuno-suppression) make hASCs an interesting tool for cellular ther-apy and regeneration. MSCs are being used in several clinicaltrials, with a focus on their immunomodulatory capacities(http:==clinicaltrials.gov=search=term¼stemþcells?term¼stemþcells). We are currently conducting a phase III clinical trialusing hASCs to treat complex peri-anal fistula in patientswith and without Crohn’s disease after having successfullycompleted phase I and II trial with high efficacy rates.32,33

TLR activation has been implicated in the pathology of anumber of inflammatory diseases, including inflammatorybowel disease, because they can initiate or perpetuate thechronic inflammation due to the continued exposure to TLRligands in the gut.34,35 Therefore, the use of hASCs in celltherapy for the treatment of inflammatory diseases deservedfurther investigation regarding the potential effects of TLRsignaling on hASCs biology and the potential implications forimmunogenicity and immunosuppressive capacity, whichare of special relevance in terms of therapeutic potency.

Here we report that hASCs express virtually all TLRs, ex-cept TLR8 at the messenger RNA (mRNA) level. Activationwith specific ligands resulted in induction of the NF-kB-dependent genes manganese superoxide dismutase (MnSOD),cyclooxygenase (COX)-2, IL-6, and IL-8. TLR3 and TLR4 li-gands increased differentiation into osteoblasts, but no effectwas observed in proliferation, immunogenicity, or immuno-suppressive capabilities. These results have important impli-cations for the safety and efficacy of hASC-based cell therapies.

Materials and Methods

Isolation and expansion of cells

hASC isolation. Lipoaspirates obtained from human adi-pose tissue from healthy adult male and female donors werewashed twice with phosphate buffered saline (PBS) to re-move contaminating debris and red blood cells and digestedat 378C for 30 min with 0.075% collagenase (Type I, Invitro-gen, Carlsbad, CA) in PBS. The digested sample was washedwith 10% fetal bovine serum (FBS), treated with 160 mM ofammonium chloride to eliminate the remaining red bloodcells, suspended in culture medium (Dulbecco’s modi-fied Eagle medium *DMEM) containing 10% FBS) and fil-

tered through a 40-mm nylon mesh. Cells were seeded (2–3�104 cells=cm2) onto tissue culture flasks and expanded at378C and 5% carbon dioxide. The culture medium waschanged every 3 to 4 days. Cells were passed to a new cul-ture flask (1,000 cells=cm2) when cultures reached 90% ofconfluence. Cells were phenotypically characterized accord-ing to their capacity to differentiate into chondro-, osteo-,and adipogenic lineages. In addition, hASCs were verified bystaining with specific surface markers. hASCs were positivefor HLA-I, CD90, CD105, and CD59 and negative for HLA-II,CD40, CD80, CD86, CD34, CD14, CD18, and CD45. A poolof six different hASC samples from male and female donors(culture passage 4–6) were used in the study.

Human peripheral blood lymphocytes. The National Trans-fusion Centre of the Comunidad Autonoma of Madrid(CAM) kindly provided Buffy coats. Peripheral bloodmononuclear cells (PBL) were isolated using density centri-fugation gradient using Ficollplaque Plus (GE HealthcareBiosciences AB, Uppsala, Sweden). After isolation, cells werewashed and stored before use.

Immunomagnetic cell separation. Lymphocyte subpopula-tions were isolated using antibody-coated magnetic beads(Miltenyi Biotech, Madrid, Spain) against CD8 or CD4 surfacemolecules. After washing, CD8 fraction was collected using theAUTOMACS system (Miltenyi Biotech), and the depleted CD8negative fraction was stained for CD4 with the coated beads,following the manufacturer’s instructions. The CD4-positivefraction was then collected, and both fractions (CD4 and CD8)were stored separately until use. The medium for culture andproliferation assays was RPMI 1640 supplemented with 10%FBS, 2mM L-glutamine, 1% non-essential amino acids, 1%pyruvate, and 1% penicillin and streptomycin.

Reagents and antibodies

The following anti-human monoclonal antibodies (mAbs)were used for flow cytometry: antibodies against HLA-I,CD80, CD86, and HLA-II were purchased from BDBioscience (San Jose, CA). Anti-TLR4 was from Serotec(Raleigh, NC), and Anti-TLR2 was from eBioscience (SanDiego, CA). Antibodies and their respective isotypes (nega-tive controls) used for surface staining were all titrated underthe appropriate conditions. Anti-COX-2 and anti-IkB-a werefrom Santa Cruz Biotechnology; LPS (Salmonella typhimur-ium) was purchased from List Biological Laboratories;poly I:C, oligodeoxynucleotides (ODNs), and PGNs werefrom Invivogen (San Diego, CA) and IFNg was fromPeproTech (Rocky Hill, NJ); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), sulfanilic acid,naphthylenediamine, 5(6)- carboxyfluorescein diacetate N-succinimidyl ester (CFSE), dexamethasone, insulin, indometh-acin, isobutyl-methylxanthine, 1,25-dihydroxyvitamin D3,ascorbate-2-phosphate, b-glycerophosphate, oil-red-O, andalizarin red were from Sigma-Aldrich (St. Louis, MO); anddihydroethidium and chloromethyl-20,70-dichlorofluoresceindiacetate were from Invitrogen.

Cellular staining and flow cytometry

CFSE labelling. Ten to 20�106 cells were extensivelywashed to remove FBS, resuspended in 200mL of a 10-mM

2 LOMBARDO ET AL.

CFSE solution, and incubated under constant shaking at 378Cfor 10 min. The reaction was stopped by adding ice-cold RPMI10% FBS, after which the cells were washed twice with ice-coldPBS. Cells were then cultured overnight, and one aliquot wasused to set up and control the FL-1 voltage for CFSE.

Flow cytometry. A total of 106 hASCs were left untreated ortreated with IFNg (30 ng=mL), LPS (1mg=mL), PGN(10 mg=mL), poly I:C (1mg=mL) and maintained in culture for72 h. Cells were harvested and stained with the monoclonalantibodies, and appropriate isotopic controls were included.Intracellular antibody staining was achieved after fixationand permeabilization as indicated by the manufacturer(cytofix=cytoperm buffers, BD Biosciences). Flow cytometrywas performed using a Coulter XL flow cytometer equippedwith Expo32 software, 10�103 events were acquired for eachtube. The acquisition and analysis gates were chosen basedon the forward and side scatter properties of cells.

Cell proliferation assays

hASCs proliferation. At day 0, hASCs were seeded at2�104 cells per well in 24-well plates in 1 mL of DMEM 10%FBS overnight. Cells were then incubated under the indi-cated experimental conditions. At different time points, me-dium was removed, and 0.5 mL of MTT solution (0.5 mg=mLin RPMI 10% FBS) was added to each well. After 30 min at378C, cells were washed once with PBS, and 100 mL of di-methyl sulfoxide was added. Spectrophotometric measure-ment at 570 nm was performed using a 96-well plate reader(iEMS Reader, ThermoElectron Corp., Waltham, MA).

PBL proliferation assay. After overnight resting, CFSE-labelled cells were activated with the Pan T cell Activationkit (microbeads loaded with anti-CD3, anti-CD2, and anti-CD28, Miltenyi Biotech, Madrid, Spain) following the man-ufacturer’s instructions or left inactivated. Two days beforePBL activation, ASCs were plated in a 24-well plate (5–4�104 cells=well). Lymphocytes (106 cells=mL) were culturedwith or without hASCs and in the presence or absence of1 mg=mL of LPS, 1 mg=mL of poly I:C, or 10mg=mL of PGN.At day 5, PBLs were harvested, and cell proliferation wasdetermined according to loss of CFSE in the FL-1 channel. AFACScalibur cytometer (Becton Dickinson, San Diego, CA)was used to measure the cells. Data were analyzed usingCellQuest-pro software (Becton Dickinson) over gated lym-phocytes (based on forward scatter=side scatter properties).Percentage of proliferating lymphocytes was obtained bygating in the region (M1) of the FL-1 channel correspondingto the last 2 days of culture.

Reverse transcriptase polymerase chain reaction

Total RNA from 80% confluent hASCs was isolated, and1mg of the total RNA was reverse transcribed using Super-Script II (Invitrogen). Human TLRs were amplified using spe-cific primers (50to 30): TLR1 forward AAACGGTCTCATCCACGTTC, reverse CCAAGTGCTTGAGGTTCACA; TLR2forward GGCC AGCAAATTACCTGTGT, reverse TTCTCCACCCAGTAGGCATC; TLR3 forward AGCCTTCAACGACTGATGCT, reverse TTTCCAGAG CCGTGCTAAGT; TLR4forward CAAAATCCCCGACAACCTCC, reverse TGTAGAACCCGCAAGTCTGTGC; TLR5 forward CAGAAACCTGCC

CA ACCTTA, reverse TCCCAAATGAAGGATGAAGG;TLR6 forward TTCCAGAGCTGCCAGAAGAT, reverseCCAGGGCAGATCCAAGTAGA; TLR7 forward GGAAATTGCCCTCGTTGTTA, reverse CTGGGGAGA AAATGCAGAAA; TLR8 forward GTTTCCTCGTCTCGAGTTGC, re-verse TCAAAGGGGTTTCCGTGTAG; TLR9 forward CAGCAGCTCTG CAGTACGTC, reverse AAGGCCAGGTAATTGTCACG; TLR10 forward GGCCAGAAACTGTGGTCAAT,reverse AACTTCCTGGCAGCTCTGAA (958C for 20 s, 528Cfor 1 min, and 728C for 1 min, 35 cycles). The complementaryDNA of THP-1 cells was used as a positive control for TLRmRNA expression.

Western blot

Cell extracts were obtained using CelLytic M Cell lysisreagent (Sigma-Aldrich) containing protease inhibitors, andprotein concentration was determined using bicinchoninicacid protein assay (Pierce, Rockford, IL). Lysates were sepa-rated using sodium dodecyl sulfate polyacrylamide gel elec-trophoresis, transferred onto nitrocellulose membrane, andblotted with primary and secondary antibodies, and proteinswere visualized using enhanced chemoluminescence. Anti-MnSOD (SOD-110) was obtained from Stressgen (AnnHarbor, MI). Anti-b-actin was from Sigma-Aldrich.

Cytokine detection

hASCs were treated with TLR ligands, and supernatantswere collected at different time points. Cytokine secretion wastested using enzyme-linked immunosorbent assay (ELISA)following the manufacturer’s instructions (eBioscience).Measurements were obtained at 450 nm using a 96-well platereader (Bio-Rad, model 680, Hercules, CA). In addition, si-multaneous detection in conditioned supernatants of multiplesoluble cytokines was performed using the Cytometric BeadArray immunoassay (BD Biosciences, Becton Dickinson, SanDiego, CA). Data were acquired in a FACScalibur and ana-lyzed using Cellquest-Pro software.

IDO activity

IDO activity was measured by determining tryptophanand kynurenine concentrations in conditioned supernatants.Two hundred mL of supernatants was added to 50 mL oftrichloroacetic acid 2M and vortexed. After centrifugation for10 min at 13,000 rpm, 100 mL of supernatant was analyzedusing high-performance liquid chromatography (HPLC;Waters 717plus Autosampler, Milford, MA).

Nitric oxide detection

The generation of nitrite was measured using the Griess re-action. Briefly, after stimulation with the corresponding stimuli,the nitrite content in the supernatant was measured usingincubation with Griess reagent (sulfanilamide and N-1-napthylethylenediamine dihydrochloride). The nitrite concen-tration was determined spectrometrically at 540 nm (model 680,Bio-Rad) and calculated from a sodium nitrite standard curve.

hASC differentiation

Adipogenic differentiation was achieved after 3 weeks inadipogenic medium (DMEM 10% FBS), containing 1mM of

TOLL-LIKE RECEPTOR SIGNALING ON hASCS 3

dexamethasone, 10 mM of insulin, 200 mM of indomethacin,and 0.5 mM of isobutyl-methylxanthine. Adipocytes werestained with oil-red-O. Osteogenic differentiation wasachieved after 3 weeks in DMEM 10% FBS containing0.01 mM of 1,25-dihydroxyvitamin D3, 50mM of ascorbate-2-phosphate, and 10 mM of b-glycerophosphate. Osteoblastswere stained with alizarin red. Where indicated, LPS(1 mg=mL), poly I:C (1mg=mL), or PGN (10mg=mL) was ad-ded during differentiation.

Results

hASCs express TLRs

To determine whether hASCs express TLRs, we analyzedlevels of TLR mRNA according to reverse transcriptasepolymerase chain reaction (PCR) using specific primers forhuman TLR1 to TLR10. The PCR revealed that hASCs ex-press mRNA of all TLRs except TLR8, similar to THP-1 cells,a monocytic human cell line that was used as a positivecontrol (Fig. 1A). To confirm expression of TLRs in hASCs atthe protein level, TLR2 and TLR4 expression was studiedusing flow cytometry using specific antibodies. As expected,hASCs stained positively for TLR2, TLR4, and HLA-I, whichwas used as a control for staining (Fig. 1B). To furtherunderstand the regulation of TLR expression by proin-flammatory cytokines, hASCs were stimulated with IFNg,TNFa, LPS, or combinations of them, and TLR2 and TLR4expression was determined using flow cytometry 72 h afterstimulation. None of the stimuli employed showed any sig-nificant effect on TLR2 and TLR4 expression (data notshown). These results indicate that hASCs express detectablelevels of TLRs.

TLR ligands activate hASCs

TLR activation leads to the nuclear translocation of NF-kBand activation of a gene expression program that includesinduction of the anti-oxidant gene MnSOD, COX-2, IL-6, andIL-8.36–41 We therefore investigated the expression of func-tional TLRs by stimulating hASCs with different concentra-tions of PGN (TLR2 ligand), poly I:C (TLR3 ligand), LPS(TLR4 ligand), and ODN (TLR9 ligand). MnSOD and COX-2were detected using Western blot at, after 72 h poststimula-tion. As shown in Figure 2A, PGN induced MnSOD poorlyeven at the highest concentration, whereas LPS and poly I:Cinduced a strong expression of MnSOD even at the lowestconcentration. However, no induction was observed afterstimulation with ODN. COX-2 expression was stimulated bypoly I:C only at the highest concentration (Fig. 2A and datanot shown). To further demonstrate that TLRs are expressedand can be activated, IL-6, TNFa, and IFNg production wasdetermined using ELISA. Of the TLR ligands tested, PGN,LPS, and poly I:C induced IL-6 production, although theyfailed to induce TNFa and IFNg production. Again, ODNsfailed to induce any tested cytokine (Fig.2B and data notshown). Furthermore, simultaneous detection of soluble cy-tokines induced by TLR activation was determined usingcytometric bead arrays (Becton Dickinson) 72 h after stimu-lation with LPS, poly I:C, and PGN. Whereas unstimulatedhASCs showed expression of IL-6 and IL-8, activation byLPS, poly I:C, and PGN led to a significant increase in IL-6and IL-8 secretion (Fig. 2C). However, TLR activation did notinduce production of IL-1b, IL-2, IL-4, IL-5, IL-10, IL-12,IFNg, or TNFa. Finally, to confirm that stimulation of hASCsby LPS, poly I:C, and PGN leads to the activation of the NF-kB signalling cascade, degradation of IkB-a, which is re-quired for efficient nuclear translocation of NF-kB, was an-alyzed at different time points. As shown in Figure 2D,stimulation with LPS, poly I:C, or PGN led to a rapid deg-radation of IkB-a, demonstrating that NF-kB signalling cas-cade is turned on. Together, our results show that hASCsexpress functional TLR2, TLR3, and TLR4.

TLR and hASC differentiation

One of the main features of hASCs is their potential todifferentiate to adipocytes, osteoblasts, and chondrocyteswhen cultured in the appropriate media. To investigatewhether TLRs can modulate differentiation, hASCs weredifferentiated into adipocytes or osteoblasts in the presenceor absence of PGN, poly I:C, LPS, and ODNs. Whereas ad-ipocyte differentiation was not affected, poly I:C and LPSstimulation significantly increased osteoblast differentiation(Fig. 3A and data not shown). Levels of reactive oxygenspecies (ROS) seem to play a role during osteogenic differ-entiation.42,43 To determine whether increased ROS levelsmay play a role in the observed effects of LPS and poly I:Con hASC osteogenesis, staining with 70-dichlorofluoresceindiacetate and dihydroethidium were performed after 48 h ofstimulation. Neither LPS nor poly I:C showed any effect onROS levels of hASCs (data not shown).

TLR and hASC immunogenic phenotype

TLRs have been shown to modulate expression of co-stimulatory molecules in immune cells.3 To test whether TLR

FIG. 1. Toll-like receptor (TLR) expression by human adi-pose-derived stem cells (hASCs). (A) Total RNA was isolatedfrom hASCs and tetrahydropyran (THP)-1 cells. TLR ex-pression was determined according to reverse transcriptasepolymerase chain reaction (PCR) using specific primers forhuman TLR1 to TLR10 or in the absence of any primer as aPCR control (–). (B) Representative flow cytometry analysisof TLR2, TLR4, and human leukocyte antigen-I (black line)and corresponding isotype antibodies controls (grey line) inhASCs. Histograms from one representative experiment areshown (n¼ 3).

4 LOMBARDO ET AL.

activation might modify the immunogenic profile of hASCs,we analyzed the expression of HLA-I, HLA-II, CD80, andCD86 using flow cytometry 72 h after stimulation with IFNg,LPS, poly I:C, and PGN. As expected, IFNg up-regulated theexpression of HLA-I, induced expression of HLA-II, andfailed to induce the expression of CD80 and CD86. LPS, polyI:C, and PGN did not alter the expression of HLA-II, CD80,and CD86, whereas poly I:C was the only TLR ligand ca-pable of inducing HLA-I similarly to IFNg (Fig. 3B). Fur-thermore, costimulation of hASCs with IFNg in combinationwith LPS, poly I:C, or PGN did not alter the INFg-mediatedinduction of HLA-I and HLA-II (data not shown). Together,

these results indicate that TLR activation does not signifi-cantly affect the immunogenic properties of hASCs.

TLR effects on hASC proliferation

To determine the role of TLR ligands in hASC prolifera-tion, we compared the proliferation of hASCs in the absenceor presence of TLR ligands using the MTT proliferation as-say. As shown in Figure 3C, only LPS induced a moderateincrease in proliferation, although it was not statisticallysignificant ( p> 0.05). Similar results were obtained using cellcounting (data not shown). Together, these results indicate

FIG. 2. Human adipose-derived stem cells (hASCs) express functional Toll-like receptors (TLRs). (A) hASCs were leftunstimulated or were stimulated with increasing concentrations of lipopolysaccharide (LPS), poly-inosinic acid:cytidylic acid(Poly I:C), peptidoglycan (PGN) and ODN. After 72 hours of treatment, TLR-mediated induction of manganese superoxidedismutase and cyclooxygenase-2 was determined using Western blot. (B) Supernatants from the same experiments werecollected to determine interleukin (IL)-6 concentration. Unstimulated cells (lined bar) were compared with TLR2- (whitebars), TLR3- (light grey bars), TLR4- (dark grey bars), and TLR9-stimulated (black bars) cells at three different concentrations.Means and standard deviations of three different experiments are represented. (C) Simultaneous detection of 10 differentcytokines induced 72 h after activation with LPS (1 mg=mL), Poly I:C (1 mg=mL), or PGN (10 mg=mL) was carried out usingcytometric bead arrays. Cytokines were gated based on their FL3-FL4 position (upper left dot plot). FL2 intensity of theremaining plots indicates concentration of the gated cytokines. Gray line indicates baseline levels of IL-6 and IL-8 byunstimulated hASCs. Representative plots from one experiment are shown (n¼ 3). (D) hASC were left unstimulated or werestimulated with LPS (1 mg=mL), Poly I:C (1mg=mL), or PGN (10mg=mL). At the indicated time points, degradation of IkB-awas determined according to Western blot.

TOLL-LIKE RECEPTOR SIGNALING ON hASCS 5

that TLR ligands have no significant effect on hASCproliferation.

TLRs and induction of immune modulators

Adult mesenchymal stem cells, hASCs among them, havebeen shown to inhibit proliferation of PBLs upon mitogenicor allogeneic activation.13 This important role is mediated, atleast in part, through the induction of immune modulatorsupon activation. One of the molecules found to inhibit PBLproliferation is nitric oxide, which has been reported to beinduced by TLRs in monocytes and macrophages.44 Wetherefore wondered whether TLR triggering could result inthe release of nitric oxide by hASCs. To determine nitricoxide production, hASCs were left unstimulated or werestimulated with increasing concentrations of LPS, poly I:C,and PGN, and nitric oxide concentration was determined inconditioned supernatants 72 h after stimulation (Fig. 4A anddata not shown). Bone marrow–derived macrophages(BMDMs) stimulated with LPS were used as a positivecontrol for nitric oxide detection. None of the TLR ligandstested in our experimental conditions (not even at the highestconcentration of 10 mg=mL) induced the release of nitric ox-ide (Fig. 4A and data not shown).

IDO enzyme is essential in the tryptophan catabolism,leading to the conversion of tryptophan into kynurenine.IDO activity plays a key role in mediating suppression ofPBL proliferation.16 Different stimuli, most prominentlyIFNg, induce transcription of IDO. In this regard, it should benoted that TLRs have been shown to induce IDO expressionin dendritic cells and macrophages.45 Therefore, to determinewhether TLRs activation results in IDO expression and ac-tivity, we stimulated hASCs with increasing concentrationsof LPS, poly I:C, and PGN. Tryptophan and kynurenineconcentrations were determined using HPLC in supernatants72 h after stimulation. As expected, IFNg induced strong IDOactivity, whereas LPS and PGN failed to induce it. However,poly I:C was capable of inducing IDO expression and ac-tivity at the highest concentration (10mg=mL) only, althoughweaker than that observed with IFNg (Fig. 4B).

TLRs do not inhibit hASC immunosuppressive capacity

The immunosuppressive capacity of hASCs is a key factorin their therapeutic use and potential. Therefore, we testedthe role of TLRs in the immunosuppressive capacity ofhASCs. To do so, we analyzed proliferation of activatedCFSE-labeled PBLs in the absence or presence of increasingamounts of hASCs pre-cultured for 24 h with medium aloneor in the presence of LPS, poly I:C, or PGN (Fig. 5A). Asexpected, hASCs efficiently suppressed PBL proliferationwhen 2�104 or 4�104 cells were plated but not at lowerconcentrations (5�103 or 1�104 cells). No significant effect ofTLRs on hASC-mediated suppression was observed. More-over, neither a longer preincubation of hASCs with TLR li-gands for 72 h nor incubation with higher concentrations ofTLR ligands (10 mg=mL) altered their suppressive potential inour experimental conditions (data not shown). Furthermore,to exclude the possibility that TLR activation may have aneffect on hASC-mediated inhibition of proliferation of T cellsubsets, CFSE-labeled CD4þ or CD8þ T cells were stimu-lated and cultured in the absence or presence of 4�104

hASCs pre-cultured for 24 h with medium alone or in the

presence of LPS (1mg=mL), poly I:C (1mg=mL), or PGN(10 mg=mL). As shown in Figure 5B, no effect on hASC-mediated suppression was found. As a whole, these resultsindicate that activation through TLR2, TLR3, and TLR4 donot significantly interfere with the capacity of hASCs tomodulate immune responses in vitro.

Discussion

Because TLR signalling has been associated with the per-petuation of chronic inflammatory and autoimmune dis-eases,46–49 the importance of better understanding thepotential effect of TLR ligands on hASCs function is high-lighted because of the therapeutic use of hASCs in the set-tings of such diseases. We have successfully conducted aphase II clinical trial for treatment with autologous hASCs(Cx401) for complex perianal fistula that included patientssuffering from Crohn’s disease,32,33 and a phase III clinicaltrial is currently ongoing. Because of the nature of the gut,TLR ligands are highly present in the healthy gut and par-ticularly in the gut of patients suffering from Crohn’s dis-ease. Therefore, hASCs employed in the treatment of fistulaare probably exposed to TLR ligands, which may result inthe modulation of hASC activity and therapeutic potency,including their proliferation, immunogenicity,and immuno-suppression. While conducting our research, we found that afew studies have reported that MSCs express active TLRs.28–

31 However, they did not investigate the role of TLRs in theimmunosuppressive and immunogenic features of hASCs.

In the present study, we report that hASCs express mRNAfor TLR1, 2, 3, 4, 5, 6, 7, 9, and 10, similar to THP-1 cells, amonocytic cell line used as a control for TLR expression (Fig.1A). Only TLR8 mRNA was absent in our studies. Thesefindings are in agreement with the results recently reportedshowing high mRNA expression of TLR1 to 6 in adipose andbone marrow MSCs.27–30

We demonstrated that hASCs possess active and func-tional TLR2, TLR3, and TLR4, because activation withPGN (TLR2), poly I:C (TLR3), and LPS (TLR4) triggereddownstream signalling events, leading to IkB-a degra-dation and the induction of NF-kB–dependent genes andcytokines (MnSOD, COX-2, IL-6, and IL-8). MnSOD is a well-established TLR downstream gene with a key protective roleagainst oxidative stress in the mitochondria. LPS and poly I:Ctreatment of hASCs led to the induction of MnSOD, whereasPGN treatment triggered a moderate induction of the gene(Fig. 2A). In the settings of an inflammatory response, im-mune cells release vast amounts of reactive oxygen species,which results in the generation of an oxidative milieu. In thisregard, it has been reported that induction of MnSOD pro-tects cells from oxidative stress, leading to greater survival.50

Therefore, it is tempting to speculate that greater expressionof MnSOD by hASCs in response to TLR ligand exposurewould provide them with better engraftment or survival atinjured or inflamed sites, leading to better therapeutic effects.

Cytokine release upon TLR triggering has been deter-mined using ELISA and cytometric bead arrays (Fig. 2B, C).Under our experimental conditions, hASCs constitutivelyreleased significant amounts of IL-6 and IL-8. TLR2, TLR3,and TLR4 activation led to the strong up-regulation of IL-6and IL-8 secretion but failed to induce other known TLR-regulated cytokines such as IL-1b, IL-2, IL-4, IL-5, IL-10,

6 LOMBARDO ET AL.

FIG. 3. Toll-like receptor (TLR) ligation effects on human adipose-derived stem cells (hASC) phenotype. (A) hASCs werecultured for 3 weeks in osteogenic differentiation medium in the absence (control) or presence of lipopolysaccharide (LPS;1 mg=mL) or poly-inosinic acid:cytidylic acid (Poly I:C; 1 mg=mL), and osteogenic differentiation was analyzed using alizarinred staining, as indicated in Materials and Methods. Representative pictures from two independent experiments are depicted.(B) Expression by hASC of the indicated surface markers was determined using flow cytometry after 72 h of culture in theabsence (control) or presence of interferon gamma (IFNg; 30 ng=mL), LPS (1 mg=mL), Poly I:C (1 mg=mL), or peptidoglycan(PGN; 10mg=mL), as described in Materials and Methods. Overlay histograms from one representative experiment are shown(n¼ 3). Isotype monoclonal antibody (mAb) (…), specific mAb in control hASCs (–), and specific mAb in stimulated hASCs(—). (C) 2�104 hASCs were seeded in 24-well plates and cultured for 2 weeks in the absence (control) or presence of LPS(1 mg=mL), Poly I:C (1 mg=mL), or PGN (10mg=mL), and the effects on proliferation were analyzed according to 3-(4,5-(95%)dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as described in Materials and Methods. Data shown arerepresentative of three different experiments.

7

IL-12, TNFa, or IFNg that immune cells induce highly uponTLR ligation. The significance of a constitutive expression ofIL-6 and IL-8, which are considered pro-inflammatory cyto-kines, in the context of the immunosuppressive activity ofhASCs is unclear. It has been recently reported that MSCsinhibit the differentiation of dendritic cells, at least in part,through the release of IL-6.51 This observation links IL-6production to the immunosuppression mediated by MSCs.Hence, it is tempting to speculate that induction of IL-6secretion by TLR activation may enhance hASC-mediatedimpairment of dendritic cell differentiation and maturation.

To determine the effects of TLR activation on hASC phe-notype, we tested the ability of PGN, poly I:C, and LPS to

modulate hASC proliferation, differentiation, and immuno-genicity. We found no effect on adipogenic differentiationbut detected that poly I:C and LPS significantly increasedosteogenic differentiation in hASCs (Fig. 3A). The effect ofTLR activation on hASC and MSC differentiation remainscontroversial, with different authors recently reportingcontradictory results. Liotta et al.31 found no effect of TLRactivation on adipogenic, osteogenic, or chondrogenic dif-ferentiation of human bone marrow–derived MSCs. How-ever, Pevsner-Fischer et al.29 reported that TLR2 activationby Pam3Cys reduced mouse bone marrow–derived MSCdifferentiation into the three mesodermal lineages. Further-more, Hwa Cho et al.28 reported greater osteogenic differ-entiation of hASC by LPS and PGN activation and lessadipogenic differentiation when PGN was present. Differ-ences between bone marrow and adipose-derived mesen-chymal stem cells and between mouse and human cellsmight explain these discrepancies.

The potential use of allogeneic hASCs and MSCs relies onthe capacity of these cells to escape to the immune recognitionbecause they display low levels of HLA-I and no expressionof HLA-II and costimulatory molecules.52 In this study, forthe first time, we provide evidence that activation of hASCsthrough TLRs does not increase hASC immunogenic features,indicated by a lack of expression of several costimulatorymolecules. Furthermore, only poly I:C activation led togreater expression of HLA-I (Fig. 3B). These results may haverelevance in terms of allogeneic hASC-based cell therapy.

The mechanisms underlying the immunosuppression po-tential of hASCs are not fully understood but seem to requirethe release of soluble factors in response to immune cells.Soluble factors such as TGF-b1, IDO, nitric oxide, and IL-10have been shown to play a role.19–26 Our study shows thathASC activation by LPS, poly I:C, and PGN does not lead tothe production of IL-10 (Fig. 2C), TGF-b1 (data not shown),or nitric oxide (Fig. 4A). Moreover, IDO induction was re-stricted to poly I:C at the highest concentration (10 mg=mL),which yielded a more-moderate kynurenine production thanIFNg (Fig. 4B). Based on these results, we hypothesized thatTLR activation would not impair the suppressive effect ofhASCs on PBL proliferation. Proliferation assays with PBLsor CD4þ or CD8þ T cells cocultured with hASCs in thepresence of TLR ligands, in which no effect on hASC-medi-ated immunosuppression was observed further confirmedthis hypothesis (Fig. 5).

Our observations, although in agreement with thosereported by Pevsner-Fisher et al.,29 which showed thatTLR2 activation by Pam3Cys does not inhibit mouse MSC-mediated immunosuppression, are somewhat different fromthose by Liotta et al.31 showing that TLR3 and TLR4 liga-tion on human MSCs may regulate their suppressive activity.The fact that bone marrow MSCs and hASCs are different,although they share numerous similar properties, might ex-plain these differences. Differences in the experimental con-ditions during the assay may also play a role. In fact, Liottaand colleagues employed purified CD4þ T cells stimulatedwith allogeneic T cell–depleted PBLs and anti-CD3 mAb,whereas we used whole PBL samples or purified CD4þ andCD8þ fractions (in the absence of any additional allogeneicPBLs) stimulated with beads loaded with anti-CD3, anti-CD2, and anti-CD28 mAbs. Further investigations will beneeded to clarify the findings from different authors.

0

5

10

15

20

25

Co

nc

(µg

/ml)

c 0.1 µg/ml

LPS

TrpKyn

A

B

0

2

4

6

8

10

12

14N

O p

rod

uct

ion

(µM

)

Control LPS BMDM+LPS

IFNγ

IFNγ PGNPoly I:C

1010.11010.1101

PGNPolyI:C

FIG. 4. Toll-like receptor (TLR) effects on human adipose-derived stem cell (hASC)-mediated production of immuno-modulators. hASCs were left unstimulated (control) or werestimulated with increasing concentrations of interferongamma (IFNg), lipopolysaccharide (LPS), poly-inosinicacid:cytidylic acid (Poly I:C), and peptidoglycan (PGN).(A) Seventy-two h after stimulation, supernatants were col-lected and tested for nitric oxide release, as described inMaterials and Methods. Bone marrow–derived macrophages(BMDM) stimulated with LPS (100 ng=mL) were used as apositive control for nitric oxide detection. One experimentwith hASCs stimulated with 30 ng=mL of IFNg or 10mg=mLof the corresponding TLR ligands is shown. (B) Tryptophanand kynurenine concentrations were determined in condi-tioned supernatants after 72 h of stimulation with the indi-cated stimuli, as described in Materials and Methods. Meansand standard deviations of three experiments are represented.

8 LOMBARDO ET AL.

FIG. 5. Toll-like receptor (TLR) signaling does not impair the inhibitory effect of human adipose-derived stem cells (hASCs)on lymphocyte proliferation. (A) Peripheral blood lymphocytes (PBLs) were labeled with carboxyfluorescein diacetateN-succinimidyl ester (CFSE) and stimulated with anti-CD3=CD2=CD28 antibodies. PBLs were cultured in the absence (blackline) or presence of increasing numbers of hASCs pre-cultured for 24 h with medium alone (green line) or containinglipopolysaccharide (LPS) (1mg=mL, red line), poly-inosinic acid:cytidylic acid (Poly I:C; 1 mg=mL, orange line), or peptido-glycan (PGN); 10mg=mL, blue line). PBLs proliferation was determined according to flow cytometry after 5 days in culture, asdescribed in Materials and Methods. M1 region represents proliferating cells after day 4. One representative experiment ofthree is shown. (B) Highly purified CD4þ or CD8þ CFSE-labeled T cells were stimulated and cultured in the absence orpresence of 4�104 hASCs pre-cultured for 24 h with medium alone or containing LPS (1 mg=mL), Poly I:C (1mg=mL), or PGN(10 mg=mL). Results are expressed as the percentage of proliferating lymphocytes gated after day 4 of culture (M1 region).Means and standard deviations of three different experiments are shown.

TOLL-LIKE RECEPTOR SIGNALING ON hASCS 9

Finally, our demonstration that TLR2, TLR3, and TLR4ligation does not impair the potential of hASCs to suppressimmune responses or to escape the recipient immune sur-veillance has implications for the safety and efficacy of al-logeneic hASC-based cell therapies for inflammatorydiseases in which hASCs may eventually be exposed to TLRligands, such as inflammatory bowel disease (in particular,patients with complex perianal fistula).

Acknowledgments

The authors would like to thank Dr. Sonsoles Hortelano(Centro Nacional de Investigaciones Cardiovasculares, Ma-drid, Spain) for generously providing reagents for nitritedetection. We would also like to thank Eduardo Suarez forthe critical reading of the manuscript. This work was sup-ported by the Ministerio de Industria, Turismo y Comercio ofSpain, and by the Ramon y Cajal program from the Minis-terio de Educacion y Ciencia of Spain (to E.L.).

Disclosure Statement

Authors are employees of Cellerix. A potential conflict ofinterest may exist. Data are original and unbiased.

References

1. Akira, S., Uematsu, S., and Takeuchi, O. Pathogen recogni-tion and innate immunity. Cell 124, 783, 2006.

2. Ozinsky, A., Underhill, D.M., Fontenot, J.D., Hajjar, A.M.,Smith, K.D., Wilson, C.B., Schroeder, L., Aderem, A. Therepertoire for pattern recognition of pathogens by the innateimmune system is defined by cooperation between toll-likereceptors. Proc Natl Acad Sci U S A 97, 13766, 2000.

3. Pasare, C., and Medzhitov, R. Toll-like receptors: linking in-nate and adaptive immunity. Adv Exp Med Biol 560, 11, 2005.

4. Hoebe, K., Jiang, Z., Georgel, P., Tabeta, K., Janssen, E., Du,X., and Beutler, B. TLR signaling pathways: opportunitiesfor activation and blockade in pursuit of therapy. CurrPharm Des 12, 4123, 2006.

5. Hawai, T., and Akira, S. TLR signaling. Semin Immunol 19,

24, 2007.6. O’Neill, L.A., and Bowie, A.G. The family of five: TIR-

domain-containing adaptors in Toll-like receptor signalling.Nat Rev Immunol 7, 353, 2007.

7. Ohashi, K., Burkart, V., Flohe, S., and Kolb, H. Cutting edge:heat shock protein 60 is a putative endogenous ligand of thetoll-like receptor-4 complex. J Immunol 164, 558, 2000.

8. Asea, A., Kraeft, S.K., Kurt-Jones, E.A., Stevenson, M.A.,Chen, L.B., Finberg, R.W., Koo, G.C., and Calderwood, S.K.HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chap-erone and cytokine. Nat Med 6, 435, 2000.

9. Barrat, F.J., Meeker, T., Gregorio, J., Chan, J.H., Uematsu, S.,Akira, S., Chang, B., Duramad, O., and Coffman, R.L. Nu-cleic acids of mammalian origin can act as endogenous li-gands for Toll-like receptors and may promote systemiclupus erythematosus. J Exp Med 202, 1131, 2005.

10. Termeer, C., Benedix, F., Sleeman, J., Fieber, C., Voith, U.,Ahrens, T., Miyake, K., Freudenberg, M., Galanos, C., andSimon, J.C. Oligosaccharides of hyaluronan activate den-dritic cells via Toll-like receptor 4. J Exp Med 95, 99, 2002.

11. Beutler, B. Neo-ligands for innate immune receptors and theetiology of sterile inflammatory disease. Immunol Rev 220,

113, 2007.

12. Friedenstein, A.J., Gorskaja, J.F., and Kulagina, N.N. Fibro-blast precursors in normal and irradiated mouse hemato-poietic organs. Exp Hematol 4, 267,1976.

13. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K.,Douglas, R., Mosca, J.D, Moorman, M.A., Simonetti, D.W.,Craig, S., and Marshak, D.R. Multilineage potential of adulthuman mesenchymal stem cells. Science 284, 143, 1999.

14. Jiang, Y., Jahagirdar, B.N., Reinhardt, R.L., Schwartz, R.E.,Keene, C.D., Ortiz-Gonzalez, X.R., Reyes, M., Lenvik, T.,Lund, T., Blackstad, M., Du, J., Aldrich, S., Lisberg, A., Low,W.C., Largaespada, D.A., and Verfaillie, C.M. Pluripotencyof mesenchymal stem cells derived from adult marrow.Nature 418, 41, 2002.

15. Zuk, P.A., Zhu, M., Ashjian, P., De Ugarte, D.A., Huang, J.I.,Mizuno, H., Alfonso, Z.C., Fraser, J.K., Benhaim, P., andHedrick, M.H. Human adipose tissue is a source of multi-potent stem cells. Mol Biol Cell 13, 4279,2002.

16. Stagg, J. Immune regulation by mesenchymal stem cells: twosides to the coin. Tissue Antigens 69, 1, 2007.

17. Puissant, B., Barreau, C., Bourin, P., Clavel, C., Corre, J.,Bousquet, C., Taureau, C., Cousin, B., Abbal, M., Laharra-gue, P., Penicaud, L., Casteilla, L., and Blancher, A. Im-munomodulatory effect of human adipose tissue-derivedadult stem cells: comparison with bone marrow mesenchy-mal stem cells. Br J Haematol 129, 118, 2005.

18. Yanez, R., Lamana, M.L., Garcıa-Castro, J., Colmenero, I.,Ramırez, M., and Bueren, J.A. Adipose tissue-derived mes-enchymal stem cells have in vivo immunosuppressiveproperties applicable for the control of the graft-versus-hostdisease. Stem Cells 24, 2582, 2006.

19. Tse, W.T., Pendleton, J.D., Beyer, W.M., Egalka, M.C., andGuinan, E.C. Suppression of allogeneic T-cell proliferationby human marrow stromal cells: implications in transplan-tation. Transplantation 75, 389, 2003.

20. Djouad, F., Plence, P., Bony, C., Tropel, P., Apparailly, F.,Sany, J., Noel, D., and Jorgensen, C. Immunosuppressiveeffect of mesenchymal stem cells favors tumor growth inallogeneic animals. Blood 102, 3837, 2003.

21. Aggarwal, S., and Pittenger, M.F. Human mesenchymalstem cells modulate allogeneic immune cell responses. Blood105, 1815, 2005.

22. Beyth, S., Borovsky, Z., Mevorach, D., Liebergall, M., Gazit,Z., Aslan, H., Galun, E., and Rachmilewitz, J. Human mes-enchymal stem cells alter antigen-presenting cell maturationand induce T-cell unresponsiveness. Blood 105, 2214, 2005.

23. Sato, K., Ozaki, K., Oh, I., Meguro, A., Hatanaka, K., Nagai,T., Muroi, K., and Ozawa, K. Nitric oxide plays a critical rolein suppression of T-cell proliferation by mesenchymal stemcells. Blood 109, 228, 2007.

24. Krampera, M., Glennie, S., Dyson, J., Scott, D., Laylor, R.,Simpson, E., and Dazzi, F. Bone marrow mesenchymal stemcells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide. Blood 101, 3722, 2003.

25. Augello, A., Tasso, R., Negrini, S.M., Amateis, A., Indiveri, F.,Cancedda, R., and Pennesi, G. Bone marrow mesenchymalprogenitor cells inhibit lymphocyte proliferation by activationof the programmed death 1 pathway. Eur J Immunol 35, 1482,2005.

26. Cui, L., Yin, S., Liu, W., Li, N., Zhang, W., and Cao, Y.Expanded adipose-derived stem cells suppress mixed lym-phocyte reaction by secretion of prostaglandin E2. TissueEng 13,1185, 2007.

27. Chamberlain, G., Fox, J., Ashton, B., and Middleton, J.Concise review: mesenchymal stem cells: their phenotype,

10 LOMBARDO ET AL.

differentiation capacity, immunological features, and po-tential for homing. Stem Cells 25, 2739, 2007.

28. Hwa Cho, H., Bae, Y.C., and Jung, J.S. Role of toll-like re-ceptors on human adipose-derived stromal cells. Stem Cells24, 2744, 2006.

29. Pevsner-Fischer, M., Morad, V., Cohen-Sfady, M., Rousso-Noori, L., Zanin-Zhorov, A., Cohen, S., Cohen, I.R., andZipori, D. Toll-like receptors and their ligands control mes-enchymal stem cell functions. Blood 109, 1422, 2007.

30. Tomchuck, S.L., Zwezdaryk, K.J., Coffelt, S.B., Waterman,R.S., Danka, E.S., and Scandurro, A.B. Toll-like receptors onhuman mesenchymal stem cells drive their migration andimmunomodulating responses. Stem Cells 26, 99, 2008.

31. Liotta, F., Angeli, R., Cosmi, L., Filı, L., Manuelli, C., Frosali,F., Mazzinghi, B., Maggi, L., Pasini, A., Lisi, V., Santarlasci,V., Consoloni, L., Angelotti, M.L., Romagnani, P., Parronchi,P., Krampera, M., Maggi, E., Romagnani, S., and Annun-ziato, F. Toll-like receptors 3 and 4 are expressed by humanbone marrow-derived mesenchymal stem cells and can in-hibit their T-cell modulatory activity by impairing Notchsignaling. Stem Cells 26, 279, 2008.

32. Garcıa-Olmo, D., Garcıa-Arranz, M., Herreros, D., Pascual, I.,Peiro, C., and Rodrıguez-Montes, J.A. A phase I clinical trialof the treatment of Crohn’s fistula by adipose mesenchymalstem cell transplantation. Dis Colon Rectum 48, 1416, 2005.

33. Garcia-Olmo, D., Herreros, D., Pascual, I., Pascual, J. A., Del-Valle, E., Zorrilla, J., De-La-Quintana, P., Garcia-Arranz, M.,Beraza, A., Alemany, J., Fernandez, G., Portero, I., Buscher,D., and Pascual, M. Expanded Adipose-Derived Stem Cells(Cx401) for the Treatment of Complex Perianal Fistula; aRandomized, Controlled Clinical Trial. In press.

34. Yamamoto-Furusho, J.K., and Podolsky, D.K. Innate im-munity in inflammatory bowel disease. World J Gastro-enterol 13, 5577, 2007.

35. Ishihara, S., Rumi, M.A., Ortega-Cava, C.F., Kazumori, H.,Kadowaki, Y., Ishimura, N., and Kinoshita, Y. Therapeutictargeting of toll-like receptors in gastrointestinal inflamma-tion. Curr Pharm Des 12, 4215, 2006.

36. Tsan, M.F., Clark, R.N., Goyert, S.M., and White, J.E. In-duction of TNF-alpha and MnSOD by endotoxin: role ofmembrane CD14 and Toll-like receptor-4. Am J Physiol CellPhysiol 280, 1422, 2001.

37. Crofford, L.J., Tan, B., McCarthy, C.J., and Hla, T. Involve-ment of nuclear factor kappa B in the regulation of cy-clooxygenase-2 expression by interleukin-1 in rheumatoidsynoviocytes. Arthritis Rheum 40, 226, 1997.

38. Matsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Mat-sushima, K., Kishimoto, T., and Akira, S. Transcription fac-tors NF-IL6 and NF-kappa B synergistically activatetranscription of the inflammatory cytokines, interleukin 6and interleukin 8. Proc Natl Acad Sci U S A 90,10193, 1993.

39. Libermann, T,A., and Baltimore, D. Activation of interleu-kin-6 gene expression through the NF-kappa B transcriptionfactor. Mol Cell Biol 10, 2327, 1990.

40. Mukaida, N., Mahe, Y., and Matsushima, K. Cooperativeinteraction of nuclear factor-kappa B- and cis-regulatoryenhancer binding protein-like factor binding elements inactivating the interleukin-8 gene by pro-inflammatory cy-tokines. J Biol Chem 265, 21128, 1990.

41. Kunsch, C., and Rosen, C.A. NF-kappa B subunit-specificregulation of the interleukin-8 promoter. Mol Cell Biol 10,

6137, 1993.42. Fehrer, C., Brunauer, R., Laschober, G., Unterluggauer, H.,

Reitinger, S., Kloss, F., Gully, C., Gassner, R., and Lepper-

dinger, G. Reduced oxygen tension attenuates differentia-tion capacity of human mesenchymal stem cells andprolongs their lifespan. Aging Cell 6, 745, 2007.

43. Potier, E., Ferreira, E., Andriamanalijaona, R., Pujol, J.P.,Oudina, K., Logeart-Avramoglou, D., and Petite, H. Hy-poxia affects mesenchymal stromal cell osteogenic differen-tiation and angiogenic factor expression. Bone 40, 1078,2007.

44. Weinberg, J.B., Misukonis, M.A., Shami, P.J., Mason, S.N.,Sauls, D.L., Dittman, W.A., Wood, E.R., Smith, G.K.,McDonald, B., Bachus, K.E., et al. Human mononuclearphagocyte inducible nitric oxide synthase (iNOS): analysis ofiNOS mRNA, iNOS protein, biopterin, and nitric oxideproduction by blood monocytes and peritoneal macro-phages. Blood 86,1184, 1995.

45. Fujigaki, S., Saito, K., Sekikawa, K., Tone, S., Takikawa, O.,Fujii, H., Wada, H., Noma, A., and Seishima, M. Lipopoly-saccharide induction of indoleamine 2,3-dioxygenase ismediated dominantly by an IFN-gamma-independentmechanism. Eur J Immunol. 31, 2313, 2001.

46. Marshak-Rothstein, A., and Rifkin, I.R. Immunologicallyactive autoantigens: the role of toll-like receptors in the de-velopment of chronic inflammatory disease. Annu Rev Im-munol. 25, 419, 2007.

47. Kanai, T., Ilyama, R., Ishikura, T., Uraushihara, K., Totsuka,T., Yamazaki, M., Nakamuma, T., and Watanabe, M. Role ofthe innate immune system in the development of chroniccolitis. J Gastroenterol 37, 38, 2002.

48. Andreakos, E., Sacre, S., Foxwell, B.M., and Feldmann, M.The toll-like receptor-nuclear factor kappaB pathway inrheumatoid arthritis. Front Biosci 10, 2478, 2005.

49. Baccala, R., Hoebe, K., Kono, D.H., Beutler, B., and Theofi-lopoulos, A.N. TLR-dependent and TLR-independentpathways of type I interferon induction in systemic auto-immunity. Nat Med 13, 543, 2007.

50. Kops, G.J., Dansen, T.B., Polderman, P.E., Saarloos, I., Wirtz,K.W., Coffer, P.J., Huang, T.T., Bos, J.L., Medema, R.H., andBurgering, B.M. Forkhead transcription factor FOXO3aprotects quiescent cells from oxidative stress. Nature 419,

316, 2002.51. Djouad, F., Charbonnier, L.M., Bouffi, C., Louis-Plence, P.,

Bony, C., Apparailly, F., Cantos, C., Jorgensen, C., and Noel,D. Mesenchymal stem cells inhibit the differentiation ofdendritic cells through an interleukin-6-dependent mecha-nism. Stem Cells 25, 2025, 2007.

52. McIntosh, K., Zvonic, S., Garrett, S., Mitchell, J.B., Floyd,Z.E., Hammill, L., Kloster, A., Di Halvorsen, Y., Ting, J.P.,Storms, R.W., Goh, B., Kilroy, G., Wu, X., and Gimble, J.M.The immunogenicity of human adipose-derived cells: tem-poral changes in vitro. Stem Cells 24,1246, 2006.

Address reprint requests to:Eleuterio Lombardo, Ph.D.

Cellerix S.AParque Tecnologico de Madrid

C= Marconi 1,28760, Tres Cantos, Madrid

Spain

E-mail: elombardo@cellerix.com

Received: June 19, 2008Accepted: October 15, 2008

Online Publication Date: December 5, 2008

TOLL-LIKE RECEPTOR SIGNALING ON hASCS 11