The Transcriptional Activity of Sox9 in Chondrocytes Is Regulated by RhoA Signaling and Actin...

MOLECULAR AND CELLULAR BIOLOGY, Aug. 2009, p. 4262–4273 Vol. 29, No. 150270-7306/09/$08.00�0 doi:10.1128/MCB.01779-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The Transcriptional Activity of Sox9 in Chondrocytes Is Regulated byRhoA Signaling and Actin Polymerization�

Deepak Kumar and Andrew B. Lassar*Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Building C, Room 303,

240 Longwood Avenue, Boston, Massachusetts 02115

Received 20 November 2008/Returned for modification 9 January 2009/Accepted 16 May 2009

In this study, we demonstrate that dedifferentiation of round primary chondrocytes into a fibroblastmorphology correlates with a profound induction of RhoA protein and stress fibers. Culture of dedifferentiatedchondrocytes in alginate gel induces a precipitous loss of RhoA protein and a loss of stress fibers concomitantwith the reexpression of the chondrocyte differentiation program. We have found that chondrogenesis in limbbud micromass cultures similarly entails a loss of RhoA protein and that expression of dominant negativeRhoA in such cultures can markedly enhance chondrogenesis. Consistent with these results, expression of theRho antagonist C3 transferase can restore chondrocyte gene expression in dedifferentiated chondrocytes grownon plastic. Transfection of cells with agents that block actin polymerization enhance the ability of eitherexogenous Sox9 or a Gal4 DBD-Sox9 fusion protein to activate gene expression. Interestingly, the enhancementof Sox9 function by actin depolymerization requires both protein kinase A (PKA) activity and a PKA phos-phorylation site in Sox9 (S181) that is known to enhance Sox9 transcriptional activity. Lastly, we demonstratethat RhoA-mediated modulation of actin polymerization regulates the ability of Sox9 to both activate chon-drocyte-specific markers and maintain its own expression in chondrocytes via a positive feedback loop.

Vertebrate long bones are formed through a process ofendochondral ossification (8, 11). During this process, boneformation begins with the establishment of mesenchymal con-densations, which serve as a template for the adult skeletalelements. Chondrocytes then differentiate within the aggre-gated mesenchyme, generating distinct cartilage primordia thatbegin longitudinal growth. A very important system to studythe events that control the initiation of chondrocyte differen-tiation is the limb bud micromass culture system. Originallydeveloped by Solursh and colleagues, this culture system em-ploys mesenchymal cells isolated from either chick or mouseembryo limb buds, which undergo chondrogenesis when cul-tured under conditions of extremely high cell density, termedmicromass culture (1, 22). Recently, it was demonstrated thatbone morphogenic protein (BMP) signaling is necessary forthe initial compaction of limb bud mesenchymal cells intocellular condensations (2). After compaction, the limb budcells that undergo chondrogenesis assume a round cell shapeand coalesce to form a cartilage nodule (1, 2). For many years,it has been appreciated that environmental factors that altereither the cell shape or the actin cytoskeleton can modulate theability of prechondrogenic cells to undergo chondrogenesis. Itwas initially noted that in vitro differentiation of limb budmesenchymal cells into chondrocytes required that these cellsbe plated at a very high cell density (1, 22), presumably topromote cell-cell interactions. Interestingly, however, chondro-genesis could be induced in low-density cultures of limb budmesenchymal cells when these cells were plated in either sus-

pension culture (15, 31) or collagen gels (30). Because cultureof prechondrogenic cells in either suspension culture or colla-gen gels induced cell rounding, Solursh and colleagues specu-lated that a round cell shape might somehow promote chon-drogenesis (41). Indeed, transient treatment of subconfluentlimb bud mesenchyme cells with the actin binding drug cy-tochalasin D induced immediate cell rounding and subsequentchondrogenesis in these cultures (41). Consistent with thesefindings, more recent work has established that culture of“dedifferentiated” primary chondrocytes in either agarose (3)or alginate (4, 25) can induce the redifferentiation of suchcultures and reexpression of the chondrocyte phenotype.

Polymerization of actin to generate stress fibers is regulatedby the GTPase RhoA (reviewed in reference 5). When boundto GTP, RhoA interacts with and induces the activity of mDia,a member of the formin family, which directly binds to actinand stimulates its polymerization (16, 39). In addition, GTP-bound RhoA activates RhoA kinase (ROCK), which conse-quently activates LIM kinase, which phosphorylates the actindepolymerizing protein cofilin and thereby stabilizes actin fil-aments within the cell (reviewed in reference 5). Studies fromthe Beier lab have established that overexpression of RhoAcan block both Sox9 expression and chondrogenic differentia-tion of the ATDC5 chondrocyte cell line (36). In addition, thisgroup has demonstrated that inhibition of ROCK signaling orpharmacological disruption of the actin cytoskeleton can pro-mote both Sox9 expression and chondrogenic differentiation insome but not all cellular contexts (35, 36).

In the present study, we demonstrate that RhoA signalingand modulation of actin polymerization not only regulatesSox9 expression (35, 36) but in addition directly controls thetranscriptional activity of Sox9 protein. We demonstrate thatchondrogenesis entails a dramatic loss of RhoA protein levelsand that consequent actin depolymerization increases the tran-

* Corresponding author. Mailing address: Department of BiologicalChemistry and Molecular Pharmacology, Harvard Medical School,Bldg C, Room 303, 240 Longwood Ave., Boston, MA 02115. Phone:(617) 432-3831. Fax: (617) 738-0516. E-mail: [email protected].

� Published ahead of print on 26 May 2009.

4262

on Novem

ber 28, 2015 by guesthttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

scriptional activity of Sox9 protein to both induce its ownexpression and activate the expression of other downstreamtargets. Interestingly, enhancement of Sox9 function by actindepolymerization requires both protein kinase A (PKA) activ-ity and a PKA phosphorylation site in Sox9 (S181), suggestingthat actin depolymerization and PKA work synergistically toincrease Sox9 transcriptional activity in chondrocytes. To-gether our findings indicate that chondrogenesis entails a dra-matic loss of RhoA protein and consequent depolymerizationof actin, resulting in a PKA-dependent enhancement of Sox9transcriptional activity to activate both its own expression andother downstream targets.

MATERIALS AND METHODS

Reagents and antibodies. H89 and Y27632 were purchased from Calbiochem.Anti-Flag as well as antitubulin, anti-Sox9-p181, and anti-glyceraldehyde-3-phos-phate dehydrogenase (GAPDH) antibodies were purchased from Sigma, Abcam,and Chemicon, respectively.

Isolation and culture of primary chondrocytes. The caudal third of day 14chicken embryo sterna was harvested and incubated in Hanks’ balanced saltsolution (Gibco) supplemented with 0.6 mg/ml collagenase (Sigma) and 0.04%trypsin (Gibco) for 3 h at 37°C. The single-cell suspension was harvested andplated (as a primary culture) for 5 to 7 days in primary culture medium (Dul-becco’s modified Eagle medium [DMEM; Gibco] supplemented with 10%NuSerum [BD Biosciences], 50 U/ml penicillin, and 50 �g/ml streptomycin[Gibco]) to remove any fibroblast contamination. After primary culture, thefloating and loosely attached cells were harvested and used as primary chondro-cytes. To dedifferentiate cells, the primary chondrocytes were cultured in sec-ondary culture medium (DMEM supplemented with 10% NuSerum, 50 U/mlpenicillin, 50 �g/ml streptomycin, 8 �g/ml hyaluronidase [Sigma], and 5 ng/mlbasic fibroblast growth factor [Sigma]) for four passages. To induce redifferen-tiation of the dedifferentiated cells, the dedifferentiated cells were suspended ina 1.2% alginate solution (1.2% alginate, 150 mM sodium chloride, 1 mM calciumchloride, and 20 mM HEPES) at a density of 106 cells/ml and poured as dropsinto 50 mM of calcium chloride solution using a 22-gauge needle. After 10 minof incubation at room temperature, the beads were washed with DMEM andtransferred to differentiation medium (DMEM-F12 [Gibco] supplemented with10% fetal bovine serum [HyClone], 50 U/ml penicillin, and 50 �g/ml streptomy-cin) for various time periods. To harvest cells from alginate, the beads weredissociated in dissociation buffer (55 mM sodium citrate and 150 mM sodiumchloride) with gentle rocking at 4°C followed by centrifugation at 1,500 rpm for5 min.

Micromass culture. Limb bud mesenchymal cells isolated from Hamburger-Hamilton stage 22 to 24 chicken embryos were used for micromass culture.Briefly, limb bud mesenchymal cells suspended at a density of 2 � 107 cells/mlwere plated as a 10-�l spot in a tissue culture dish. Following incubation at 37°Cfor 2 h, differentiation medium was added and cells were incubated for 4 days.For avian retroviral infection, the cells were incubated with virus for 2 h on iceprior to plating as micromass cultures.

Alcian blue staining. For Alcian blue staining, micromass cultures were fixedwith 4% paraformaldehyde for 15 min, rinsed with 0.1 N hydrochloric acid for 15min, and then stained with 1% Alcian blue 8GX for 2 h. After staining, the cellswere washed overnight with 0.1 N hydrochloric acid. To measure the amount ofdye taken up by the micromass cultures, the cultures were gently shaken with 4M guanidine hydrochloride, pH 5.8, for 2 h. Following extraction, Alcian bluelevels were assayed by measuring the absorbance at 600 nm.

RT-PCR. For semiquantitative reverse transcriptase PCR (RT-PCR), RNAwas harvested from samples by using the Qiagen RNeasy minikit following themanufacturer’s instructions. RT reactions and PCR analysis were carried out aspreviously described (17, 42). Briefly, for cDNA synthesis, 1 �g of RNA was usedin a 30-�l reaction mixture using Moloney murine leukemia virus RT (Invitro-gen) as per the manufacturer’s instructions. For PCR analysis, GAPDH was usedas a control for the amount of cDNA present in each amplification reactionmixture. We normalized all PCR analyses to an arbitrary level of GAPDH ineach experiment by phosphorimager quantitation (Bio-Rad). In addition, mostPCRs were performed in the linear range and therefore are semiquantitativeassessments of gene expression. One microliter of cDNA was used in a 25-�lPCR amplification reaction mixture containing 10 mM Tris-HCl, pH 8.5, 50 mMKCl, 1.5 mM MgCl2, 0.1% Triton X-100, 200 �M of each deoxynucleoside

triphosphate, 0.5 �Ci [�-32P]dCTP (specific activity, 3,000 Ci/mmol), 1 �M of theappropriate primers, and 1 U of Taq polymerase (GeneChoice). After an initialdenaturation step of 95°C for 4 min, the reaction mixtures were cycled between95°C (30 s); either 60°C (30 s for GAPDH and aggrecan), 55°C (30 s forendogenous Sox9, viral human Flag-Sox9, and collagen II), or 50°C (30 s for Sox5and Sox6); and 72°C (1 min) in an MJ Research thermocycler. The reactionproducts for GAPDH, collagen II, and aggrecan were amplified for 18 cycles.The products of endogenous Sox9, viral Flag-Sox9, and RhoA were amplified for23 cycles, while the products of Sox5 and Sox6 were amplified for 25 cycles. Theprimers used for PCR analysis were as follows: GAPDH-F (AGTCATCCCTGAGCTGAATG), GAPDH-R (ACCATCAAGTCCACAACACG), endogenousSox9-F (CTCCCCCAACGCCATCTTCA), endogenous Sox9-R (AGCTGCTGATGCCGTAGGTA), viral Flag-tagged human Sox9-F (GGATCTGACTACAAAGACGAT), viral Flag-tagged human Sox9-R (CTGAGCTCGGCGTTGTGCAAG), Sox5-F (GCCACCTGATTAGGGTCCAA), Sox5-R (TTCTGATGCAGGCTGATGTC), Sox6-F (GCAGCTGATGGAGAGGAAAC), Sox6-R (CATCTTGTTGGATGGTCGTG), RhoA-F (CCCAACGTGCCTATCATCTT),RhoA-R (GCAGCTCTAGTGGCCATTTC), Collagen II-F (AAAGATGTTGTAGGACCCCG), Collagen II-R (GCAAAGTTTCCACCAAGTCC), Aggre-can-F (CCTGCCTGACCTCTTTGC), and Aggrecan-R (TGGGGAGGAGGGCAACAT).

Immunofluorescence staining. Micromass cultures or caudal sternal chondro-cytes were washed twice with phosphate-buffered saline (PBS) and fixed with 4%paraformaldehyde for 15 min. Cells were permeabilized with ice-cold 0.1%Triton X-100–PBS for 15 min and then washed three times with PBS. Afterblocking with 5% bovine serum albumin in PBS for 30 min, the cells wereincubated with either Alexa Fluor 546 phalloidin (diluted 1:200; Invitrogen) orthe primary antibodies mouse anti-RhoA immunoglobulin G1 (IgG1; diluted1:250; Cytoskeleton) and mouse anti-collagen II IgG2a (diluted 1:250; Develop-mental Studies Hybridoma Bank, Iowa City, IA) in blocking buffer (5% bovineserum albumin in PBS) for 1 h. Cells were washed with wash buffer (0.1% Tween20-PBS) three times and incubated with the secondary antibodies anti-mouseIgG1 conjugated to Alexa Fluor 594 (Invitrogen) and anti-mouse IgG2a conju-gated to Alexa Fluor 488 (Invitrogen) for 1 h. After three washes, the sampleswere stained with 4�,6-diamidino-2-phenylindole (DAPI) for 5 min and thencovered with a coverslip using mounting medium (Vector Laboratories). Imageswere obtained using either a Zeiss microscope with an oil immersion objective ora confocal microscope (Nikon A1/C1) with a Plan Apochromat VC �20 objec-tive. Fluorescence intensities were measured using MetaMorph software.

Rho assay and Western blotting. The amount of active RhoA was measured byusing a RhoA assay kit (Cytoskeleton) as per the manufacturer’s instructions.Briefly, the cells were washed twice in PBS and lysed, and the solution wasclarified by centrifugation at 8,000 rpm for 5 min. The supernatant was thenincubated with rhotekin-Rho binding domain beads for 1 h with gentle rockingat 4°C. The beads were then washed once with 10 volumes of lysis buffer andthrice with 10 volumes of washing buffer. The beads were resuspended in 10 �lof Laemmli buffer. The samples were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and Western blotting. For Western blotting,cells were lysed in radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 1 mM phenylmethyl-sulfonyl fluoride, 1 mM sodium orthovanadate, 1 mM NaF) supplemented withprotease inhibitor cocktail (Roche). The cell lysates were clarified of cellulardebris by centrifugation (10,000 � g) for 10 min at 4°C and were then subjectedto SDS-polyacrylamide gel electrophoresis and transferred onto nitrocellulosemembranes (Millipore). After being blocked with 5% nonfat milk in PBS con-taining 0.05% Tween 20, the membranes were probed with the indicated primaryantibodies. After three washes, the membranes were incubated with horseradishperoxidase-conjugated secondary antibodies (Jackson Laboratories). The inter-actions were detected using enhanced chemiluminescence (Pierce).

Plasmids and reporter assay. The following plasmids, 4x48p89-collagen II-luciferase, pcDNA3-Sox9, pcDNA3-Sox5, and pcDNA3-Sox6, were generouslysupplied by Benoit de Crombrugghe. The expression plasmids for wild-type(WT) actin and actin with a mutation (R62D) were generously supplied byRichard Treisman. The expression plasmids for constitutively activated mDia(mDia-CA) and a dominant negative version of mDia (mDia-DN) were gener-ously supplied by Shuh Narumiya. The expression plasmid for RhoA-N14 wasgenerously supplied by Xi He. The pGal4DBD-Sox9 was made by insertinghuman Sox9 (hSox9) cDNA in frame with the Gal4 DNA binding domain (DBD)at the BamHI and NotI sites in the pCMV-Gal4DBD vector (a kind gift from H.Sasaki). For reporter assays, cells were transfected in triplicate with plasmidDNA using FuGENE 6 (Roche) as per the manufacturer’s instructions. Forty-eight hours after transfection, the cells were harvested; firefly and Renilla lucif-

VOL. 29, 2009 ACTIN POLYMERIZATION REGULATES Sox9 ACTIVITY 4263

on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

erase expression levels were measured using the dual-luciferase assay kit (Pro-mega) as per the manufacturer’s instructions.

Expression and purification of Tat-myc-C3 transferase protein. Tat-myc-C3transferase protein was bacterially expressed and purified as follows. Briefly,competent Escherichia coli BL21(DE3) pLysS cells were transformed withpGEXKG Tat-myc-C3 plasmid (generously provided to us by Chris Marshall,Cancer Research Center, United Kingdom). A single colony was picked andincubated at 37°C in 50 ml of LB broth supplemented with 20 �g/ml chloram-phenicol and 100 �g/ml ampicillin. The overnight culture was diluted 1:10 in LBbroth supplemented with 100 �g/ml ampicillin and grown to a 0.6 to 1.0 opticaldensity at 600 nm before inducing with 100 �M isopropyl-�-D-thiogalacto-pyranoside (IPTG) for 3 h at 37°C. Cells were pelleted by centrifugation andresuspended in 10 ml of Tris-buffered saline (TBS) lysis buffer (137 mM NaCl, 5mM KCl, 25 mM Tris-HCl, pH 7.4, 1 mM dithiothreitol, and 1 mM phenylmeth-ylsulfonyl fluoride). The cells were then disrupted by three 1-min rounds ofsonication at 20% intensity using a Branson Sonifier, followed by removal ofdebris by centrifugation (10,000 � g) for 20 min at 4°C. Clarified supernatantswere incubated with a 0.5 ml glutathione-Sepharose (Sigma) bead slurry for 2 hat 4°C to bind the glutathione S-transferase (GST) fusion protein. Beads werewashed six times with 50 ml of TBS lysis buffer, followed by two washes with 50ml of thrombin cleavage buffer (1 mM magnesium chloride, 1 mM calciumchloride, 1 mM dithiothreitol in TBS). The beads were resuspended in 0.5 ml ofthrombin cleavage buffer, and Tat-myc-C3 was released from the GST moiety byincubation with 25 U of bovine thrombin (Sigma) overnight at 4°C. The super-natant was collected, beads were washed twice with 0.5-ml thrombin cleavagebuffer, and the collected supernatants were incubated with 30 �l of TBS-washedp-aminobenzamide beads (Sigma) for 1 h to remove thrombin before snapfreezing aliquots and storing them at �80°C.

RESULTS

Loss of chondrocyte differentiation correlates with in-creased RhoA signaling. To determine whether RhoA signal-ing is regulated during chondrocyte differentiation, we em-ployed primary caudal sternal chondrocytes (isolated fromday-14 chicken embryos), which display an immature chondro-cyte phenotype and appear as very refractile round cells intissue culture (data not shown). Upon repeated passage, thesecells lose their round cell shape and assume a fibroblast mor-phology (diagrammed in Fig. 1A). We found that both carti-lage structural genes (i.e., collagen II and aggrecan) and chon-drocyte transcriptional regulators (i.e., Sox9, Sox5, and Sox6)were robustly expressed in the caudal sternal chondrocytesafter their initial plating (P0) (Fig. 1B, lane 1) and that expres-sion of all of these chondrocyte markers was lost during con-tinued passage of these cells (P1 to P4) (Fig. 1B, lanes 2 to 5).We assayed RhoA levels in these cultures by using Westernblotting and assayed RhoA activity by using a rhotekin-GSTpull-down assay (27). Rhotekin is a RhoA effector, which canbind only to the GTP-bound form of RhoA (i.e., “activated”RhoA) (26), and therefore rhotekin-GST can be employed toisolate active RhoA, which is subsequently detected by West-ern blotting using a RhoA antibody. Interestingly, we foundthat freshly isolated caudal sternal chondrocytes contained rel-atively low levels of total RhoA and only trace levels of active(GTP-bound) RhoA (Fig. 1C, lane 1). In striking contrast, wefound that passage of these cells on plastic led to a significantincrease in the levels of both total RhoA protein and activeGTP-bound RhoA (Fig. 1C, compare lane 1 with lanes 2 to 3).Thus, there appears to be an inverse correlation between thelevels of active RhoA protein in a cell and the expression ofboth chondrogenic transcription factors and differentiationmarkers. Interestingly, the dramatic increase in the total levelsof RhoA protein in dedifferentiated cells compared to their

chondrogenic progenitors (Fig. 1C) was not accompanied byany alteration in RhoA transcript levels (Fig. 1B).

Culture of dedifferentiated chondrocytes in alginate gel in-duces chondrogenic gene expression and dramatically lowersthe levels of total and active RhoA protein. We investigatedwhether restoration of the chondrogenic phenotype by cultureof dedifferentiated cells in an alginate gel would concomitantlyaffect RhoA protein levels and/or activity. Caudal sternal chon-drocytes were passaged four times (P4; during which time theylost expression of chondrocyte-specific markers) and culturedfor either 2 or 4 days in alginate beads (Fig. 1D). Culture of thededifferentiated cells (P4) in alginate for 2 or 4 days led to adramatic increase in chondrocyte-specific gene expression(Fig. 1D, compare lane 2 with lanes 3 and 4), which was nearlyequal to that in freshly plated (P0) chondrocytes (Fig. 1D, lane1). Interestingly, reexpression of chondrocyte differentiationmarkers in the cells cultured in alginate correlated with aprofound decrease in the levels of both total and active (i.e.,GTP-bound) RhoA (Fig. 1C, compare lanes 3 and 4) in theabsence of altering RhoA transcript levels (Fig. 1D). Thesefindings indicate that culturing dedifferentiated chondroctyesin alginate gel both restores high levels of chondrocyte geneexpression and simultaneously promotes a precipitous loss ofRhoA protein.

Chondrogenic gene expression is inversely correlated withRhoA protein accumulation and the appearance of stress fi-bers. Our results indicate that there is an inverse correlationbetween chondrocyte differentiation and the level of activated(GTP-bound) RhoA. As activation of RhoA is known to con-trol the polymerization of actin into stress fibers (5), we com-pared the state of the actin cytoskeleton in both primary chon-drocytes and in dedifferentiated chondrocytes cultured eitheron plastic or in alginate gel. To visualize the polymerizationstate of actin in both primary chondrocytes and their dediffer-entiated progeny, we employed phalloidin, which binds to poly-meric actin (38). We observed that while P0 chondrocytesdisplay low levels of diffusely staining cytoplasmic actin (Fig.2A), dedifferentiated P5 cells show very prominent stress fibers(Fig. 2B). Culture of these dedifferentiated cells in alginateculture not only reinduces chondrogenic gene expression (Fig.1D) but also restores the actin cytoskeleton to a chondrocyte-like appearance, marked by the absence of detectable stressfibers (Fig. 2C).

We examined whether expression of collagen II was alsoinversely correlated with accumulation of RhoA protein inmicromass cultures of limb bud mesenchymal cells isolatedfrom HH stage 22 to 24 chicken embryos. We found that theexpression of collagen II was specifically confined to areas ofthe micromass culture displaying the lowest levels of RhoAprotein (Fig. 3A to D). We quantitated the RhoA/DAPI stain-ing ratio in differing regions of the micromass culture andfound that regions of the culture lacking collagen II displayeda 56% greater RhoA/DAPI staining ratio than regions of theculture expressing collagen II (Fig. 3E). These findings suggestthat chondrogenic differentiation in limb bud mesenchymalcells similarly entails a loss of RhoA protein. Thus, in bothdedifferentiated chondrocytes cultured either on plastic or inalginate gel and in limb bud micromass cultures, chondrocyte-specific gene expression inversely correlates with the accumu-lation of both RhoA protein and stress fibers.

4264 KUMAR AND LASSAR MOL. CELL. BIOL.

on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

RhoA activity represses chondrogenesis in micromass cul-tures of chicken limb bud mesenchymal cells. Because RhoAprotein was highest in areas of the micromass culture thatfailed to express collagen II (Fig. 3A to E), we examinedwhether inhibition of RhoA signaling in such cultures wouldaugment chondrogenesis. We infected limb bud mesenchymalcells with an avian retrovirus encoding either a dominant neg-ative form of RhoA (RhoA-DN, encoded by RhoA mutantRhoA-N19) (10) or green fluorescent protein (GFP) as a con-trol. The infected cells were then plated under micromass

conditions for 4 days. We evaluated both proteoglycan expres-sion by using Alcian blue staining (Fig. 3F and G) and theexpression of chondrocyte marker genes by semiquantitativeRT-PCR (Fig. 3H). Expression of RhoA-DN significantly in-creased both the extent of Alcian blue staining in these cul-tures and the expression of chondrogenic marker genes (Fig.3F to H). Thus, repressing RhoA signaling with a dominantnegative form of RhoA enhances chondrogenesis in limb budmicromass cultures, indicating that RhoA signaling limits theamount of chondrocyte differentiation in such cultures.

FIG. 1. Reactivation of the chondrocyte differentiation program in alginate culture correlates with a loss of both RhoA expression and activity.(A) Protocol to isolate caudal sternal chondrocytes, derive dedifferentiated chondrocytes from these cultures, and restore differentiation of theselatter cells in alginate culture conditions. Caudal sternal chondrocytes were isolated from day 14 chicken embryos and either harvested after 5 daysin culture following their initial plating (P0) or repeatedly passaged (P1 to P4) in medium containing hyaluronidase (8 �g/ml). P4 dedifferentiatedcells were subsequently plated in alginate beads for 2 or 4 days to restore chondrocyte gene expression. (B) Dedifferentiation of primary sternalchondrocytes after continued passage in tissue culture. Caudal sternal chondrocytes were isolated from day 14 chicken embryos and eitherharvested after 5 days in culture following their initial plating (P0) or repeatedly passaged (P1 to P4) in medium containing hyaluronidase (8�g/ml). Gene expression was assayed by RT-PCR analysis. (C) RhoA levels and activity increase during chondrocyte dedifferentiation, whereasculture of dedifferentiated chondrocytes in alginate dramatically lowers the levels of both total and active RhoA. Total RhoA levels were assayedby Western blot analysis, and GTP-bound “activated” RhoA protein levels were assayed by rhotekin binding followed by Western blot analysis inextracts derived from P0 chondrocytes or passaged (P1) cells, P4 cells cultured on plastic, or in P4 cells cultured for 4 days in alginate (lanes 1 to4, respectively). We have obtained similar results in four independent experiments. (D) Culture of dedifferentiated chondrocytes in alginatedramatically results in reexpression of chondrogenic differentiation markers. Caudal sternal chondrocytes were isolated from day 14 chickenembryos and either harvested following their initial plating (P0; lane 1) or passaged four times (P4; lane 2). P4 cells were subsequently culturedin alginate beads for either 2 or 4 days (P4; lanes 3 and 4). Gene expression was assayed by RT-PCR analysis.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

Inhibition of Rho signaling by the pan-Rho antagonist, C3transferase, can restore chondrocyte gene expression in dedif-ferentiated chondrocytes grown on plastic. Because dediffer-entiated chondrocytes grown on plastic show high levels ofactivated RhoA and extensive stress fibers (Fig. 1 and 2), weevaluated whether administration of the botulinum ADP-ribo-syltransferase (C3 transferase) that inhibits RhoA activity (23,29) would increase the expression of chondrocyte-specificgenes in otherwise dedifferentiated chondrocytes grown on aplastic substrate. C3 transferase blocks Rho signaling by cata-lyzing ADP ribosylation of all Rho family members at aminoacid Asn-41 (29). We found that culturing dedifferentiatedchondrocytes on plastic in the presence of a fusion proteinencoding C3 transferase fused to the leader sequence of thehuman immunodeficiency virus Tat protein (that promotes thetransport of exogenous proteins into the cell) (28) significantlyinduced the expression of collagen II and aggrecan and in-creased the expression of endogenous Sox9, Sox5, and Sox6(Fig. 3I). Induction of chondrocyte-specific gene expression byadministration of C3 transferase to dedifferentiated chondro-cytes suggests that Rho family signaling represses chondrogen-esis in such cells and is consistent with prior findings thatinhibition of the RhoA-activated kinase, ROCK, can promotechondrogenesis in some cellular contexts (35).

Alginate culture regulates the ability of exogenous Sox9 toinduce chondrocyte-specific gene expression in a PKA-depen-dent manner. We noticed that culture conditions that inducethe loss of RhoA protein in dedifferentiated chondrocytes(such as alginate culture) or agents that inhibit RhoA signaling(such as dominant negative RhoA or the pan-Rho antagonistC3 transferase) robustly induce the expression of both chon-drocyte-specific differentiation markers (e.g., collagen II and

aggrecan) and the chondrocyte transcriptional regulators Sox9,Sox5, and Sox6. Thus, it seems possible that the loss of RhoAprotein or activity promotes chondrogenesis by inducing theexpression of these key chondrocyte transcriptional regulators.However, as many cell-type-specific transcriptional regulatorsmaintain their own expression via positive feedback loops (e.g.,MyoD) (33), it is possible that increased expression of thechondrogenic Sox transcription factors induced by the loss ofRhoA protein/activity reflects an increase in the transcriptionalactivity of Sox9. To clarify whether alginate culture conditionsinduce the differentiation of dedifferentiated chondrocytes bysolely enhancing the expression of Sox9 or, in addition, bypromoting the transcriptional activity of this transcription fac-tor, we infected dedifferentiated chondrocytes (passage 5) witha retrovirus encoding Flag-tagged hSox9 (RCAS-Flag-hSox9).We observed that forced expression of exogenous Flag-taggedhSox9 in dedifferentiated chondrocytes cultured on plastic in-creased expression of both endogenous chicken Sox9 and ag-grecan and induced trace levels of collagen II (Fig. 4A, com-pare lanes 2 and 8). Interestingly however, the culture of suchRCAS-Flag-hSox9-infected cells in alginate gel further in-creased the expression of all of these chondrocyte markerswhile not affecting the expression of virus-encoded hSox9 (Fig.4A, compare lanes 8 and 9). Expression of exogenous RCAS-encoded Flag-tagged hSox9 and endogenous chicken Sox9were distinguished by employing human and chicken Sox9primers, respectively, in RT-PCR analysis. These findings in-dicate that alginate culture and the associated loss of RhoAsignaling (Fig. 1) both increase the expression of endogenousSox9 and enhance the activity of exogenous Sox9 to activatedownstream targets.

In addition to BMP signaling and a round cell shape, an-other factor that seems to play an important role in chondro-cyte differentiation is PKA. Treatment of micromass culturesof limb bud mesenchymal cells with the cyclic AMP analogue,dibutyryl cyclic AMP, enhances chondrocyte differentiation insuch cultures (12, 32). In addition, PKA activity has been foundto rise during chondrogenic differentiation of limb bud micro-mass cultures (12), and pharmacological inhibition of PKAwith the PKA antagonist H89 efficiently blocks chondrogenicdifferentiation of limb bud micromass cultures (12, 40). Similarto its effect on limb bud cultures, H89 also blocks the inductionof endogenous Sox9 and other chondrocyte differentiationmarkers in dedifferentiated chondrocytes cultured in alginategel (Fig. 4A, lanes 4 to 6). In striking contrast, forced expres-sion of RCAS-Flag-hSox9 can boost the expression of bothendogenous Sox9 and aggrecan in dedifferentiated chondro-cytes cultured in alginate gel in the presence of H89 (Fig. 4A,compare lanes 10 to 12). Induction of both endogenous Sox9and aggrecan by RCAS-Flag-hSox9 occurred in the presenceof H89 despite the inhibition of a PKA-dependent activatingphosphorylation of Sox9-S181 (9) (Fig. 4B). These findingssuggest that a kinase whose activity is blocked by H89 (perhapsPKA) is necessary to promote the expression of endogenousSox9 in dedifferentiated chondrocytes cultured in alginate geland that forced expression of RCAS-Flag-hSox9 can activatethe expression of endogenous Sox9 even in the presence of thiskinase inhibitor.

Most importantly, the induction of both endogenous Sox9and other chondrocyte markers (i.e., aggrecan and collagen II)

FIG. 2. Chondrocyte-specific gene expression inversely correlateswith the appearance of polymerized actin in the form of stress fibers inthe cell. Shown are phalloidin staining images of the following cells:caudal sternal chondrocytes isolated from day 14 chicken embryosafter 5 days in culture following their initial plating (P0) (A), dedif-ferentiated progeny of these cells that had been passaged five times(P5) in medium containing hyaluronidase (B), or P5 cells that had beencultured for 4 days in alginate beads and were found to reexpresschondrocyte-specific differentiation markers (C).


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

by RCAS-Flag-hSox9 was considerably augmented by cultureof the dedifferentiated cells in alginate (Fig. 4A, compare lanes8 and 9). Interestingly however, the ability of alginate cultureto enhance the transcriptional activity of exogenous Sox9 wasblocked by administration of H89 (Fig. 4A, compare lanes 9and 12). These findings indicate that alginate culture condi-tions, which entail a loss of RhoA protein (Fig. 1), increase thetranscriptional activity of exogenous Sox9 in a PKA-dependentfashion.

Constitutively active RhoA or mDia can repress the abilityof cotransfected chondrogenic Sox factors to activate expres-sion of a collagen II reporter. Our results indicate that cultur-ing dedifferentiated chondrocytes in alginate gel, with conse-quent loss of RhoA protein, promotes chondrocyte geneexpression by modulating the transcriptional activity of Sox9.To investigate whether RhoA (or its downstream effectors)could similarly modulate the activity of exogenous, transfectedSox9, we evaluated whether activated RhoA or mDia wouldaffect the ability of exogenous Sox9, Sox5, and Sox6 to activate

expression of a collagen II-luciferase reporter (4x48p89-Col.II-Luc) (14). Cotransfection of cytomegalovirus-driven Sox9,Sox5, and Sox6 robustly induced expression of the 4x48p89-Col.II-Luc reporter in caudal sternal chondrocytes (Fig. 5A,compare lanes 1 to 2). Addition of an expression vehicle en-coding constitutively activated RhoA (RhoA-CA) dramaticallyblocked the abilities of cotransfected Sox9, Sox5, and Sox6 toinduce the expression of this reporter in a dose-dependentmanner (Fig. 5A, compare lanes 2 with 3 to 5). Thus, activationof RhoA signaling can block the ability of cotransfected chon-drogenic Sox transcription factors to activate expression of acollagen II reporter construct.

While active RhoA has many possible effector molecules,one of its principal activities within the cell is to control thepolymerization of actin into stress fibers (5). To determinewhether activated RhoA blocks Sox9 transcriptional activity byincreasing the levels of polymerized actin within the cell, weemployed a constitutively active mutant form of mDia1(mDia1-CA), encoded by mDia�N3 (34), which constitutively

FIG. 3. RhoA signaling represses chondrocyte differentiation in both of the limb bud micromass cultures or in dedifferentiated chondrocytesmaintained on plastic. (A to E) Chicken limb bud mesenchymal cells grown in high-density micromass culture were immunostained withanti-collagen II, anti-RhoA, or DAPI as indicated. In panel E, the RhoA/DAPI staining ratio in regions of the micromass culture that either lackor express collagen II is displayed. (F to H) Chicken limb bud mesenchymal cells were infected with either RCAS-GFP (as a control) orRCAS-RhoA-DN (encoding dominant negative RhoA) and plated in high-density micromass culture and stained with Alcian blue (displayed inpanel F and quantitated in panel G) or RNA was harvested and gene expression was analyzed by quantitative RT-PCR (H). (I) Administrationof the pan-Rho antagonist C3 transferase can promote the redifferentiation of dedifferentiated chondrocytes. Dedifferentiated chondrocytes (P4)were cultured on plastic in either the absence or presence of a Tat-C3 transferase fusion protein for the indicated number of days. Gene expressionwas assayed by RT-PCR analysis.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

promotes actin polymerization even in the absence of RhoAsignaling (18). We found that transfection of an expressionvehicle encoding mDia1-CA efficiently blocked the ability ofcotransfected Sox9 to activate expression of a collagen II-luciferase reporter in a dose-dependent manner (Fig. 5B, com-pare lane 2 with lanes 3 to 5). Because expression of a consti-tutively active form of mDia1 blocks Sox9 transcriptionalactivity, as does expression of a constitutively active form ofRhoA, it seems most likely that RhoA signaling blocks chon-drogenesis by in part activating the ability of mDia1 to pro-mote actin polymerization.

Culturing dedifferentiated chondrocytes in alginate beadsaugments the ability of Sox9 to activate gene expression; ac-tivated RhoA blocks this effect. Because alginate culture con-ditions promote chondrocyte-specific gene expression whilepromoting the disassembly of stress fibers within the cell (Fig.1 and 2), we were curious to know if forced expression ofactivated RhoA (which promotes the formation of stress fi-bers) (5) would reverse the prochondrogenic effects of alginateculture. To investigate this possibility, we monitored the ex-pression of a transfected collagen II-luciferase reporter in de-differentiated (P5) chondrocytes that had been cultured eitheron plastic or in alginate gel. As observed for expression ofendogenous chondrocyte-specific genes, expression of the col-

lagen II-luciferase reporter was significantly boosted in P5-dedifferentiated chondrocytes when cultured in alginate gel(Fig. 5C, compare lanes 1 and 2). In addition, we found thatthe ability of Sox9 to induce expression of the collagen II-luciferase reporter was significantly increased in cells culturedin alginate (Fig. 5C, compare lanes 3 and 4). To evaluate ifRhoA signaling could negate the effects of alginate culture

FIG. 4. The ability of Sox9 to activate both its own expression andthat of other chondrocyte markers is boosted by culture of dediffer-entiated cells in alginate gel. (A) Freshly isolated caudal sternal chon-drocytes (P0) or dedifferentiated chondrocytes (P5) that have beeninfected with either RCAS-GFP or RCAS-Flag-hSox9 were culturedeither on plastic or in alginate gel as indicated. In some cases, thecultures were exposed to increasing levels of the PKA antagonist H89,as indicated. Gene expression was analyzed by RT-PCR. (B) RCAS-Flag-hSox9 maintains the expression of endogenous chicken Sox9 inthe presence of levels of H89 that block phosphorylation of Sox9 S181.Dedifferentiated chondrocytes (P5) infected with RCAS-Flag-hSox9were cultured in alginate gel and treated with increasing levels of thePKA antagonist H89. Western blot analysis is displayed for Flag-tagged hSox9, Sox9 phospho-S181, and GAPDH.

FIG. 5. Activated RhoA or activated mDia can block the abilitiesof cotransfected Sox9, Sox5, and Sox6 to activate a collagen II reporterand block the prochondrogenic effects of alginate culture. (A) Caudalsternal chondrocytes were cotransfected with a 4x48p89Col.II-fireflyluciferase reporter together with expression vectors encoding Sox9,Sox5, Sox6, and RhoA-CA (constitutively activated RhoA) as indi-cated. In addition, cells were transfected with a simian virus 40 (SV40)-Renilla luciferase construct. The cells were harvested 48 h after trans-fection followed by lysis of the cells and luciferase assay.4x48p89Col.II-firefly luciferase activity was normalized to the expres-sion of the cotransfected SV40-Renilla luciferase reporter. (B) Forcedexpression of a constitutively active form of mDia1 can block theability of Sox9 to activate a chondrocyte-specific reporter. Caudalsternal chondrocytes were transfected with the 4x48p89Col.II-lucifer-ase reporter and an expression vector encoding Sox9 plus increasingamounts of an expression vector encoding the constitutively activeform of mDia (mDia1-CA), which constitutively promotes actin poly-merization even in the absence of RhoA signaling (18). In addition,cells were transfected with an SV40-Renilla luciferase construct. Thecells were harvested 48 h after transfection followed by lysis of the cellsand luciferase assay. 4x48p89Col.II-firefly luciferase activity was nor-malized to the expression of the cotransfected SV40-Renilla luciferasereporter. (C) Dedifferentiated caudal sternal chondrocytes (which hadbeen passaged five times in plastic) were cotransfected with the4x48p89Col.II-luciferase reporter, an SV40-Renilla luciferase reporter,and expression vectors for Sox9 and constitutively active RhoA-CA asindicated. After transfection, cells were cultured either on plastic or inalginate beads for 72 h. 4x48p89Col.II-firefly luciferase activity wasnormalized to the expression of the cotransfected SV40-Renilla lucif-erase reporter.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

conditions, we cotransfected the cells with an expression vehi-cle encoding activated RhoA (RhoA-CA). While the ability ofSox9 to induce expression of the collagen II reporter wasaugmented in cells cultured in alginate relative to cells culturedon plastic, cotransfection of constitutively active RhoA blockedthis effect (Fig. 5C, compare lanes 3 and 4 with lanes 9 and 10).Thus, constitutively activated RhoA can reverse the ability ofalginate culture conditions to promote chondrocyte-specificgene expression.

Blockade of actin polymerization enhances the ability ofSox9 to activate chondrocyte-specific gene expression. Becauseour findings suggest that active (GTP-bound) RhoA blocks theactivity of exogenous Sox9 by promoting actin polymerization,we investigated whether expression of agents that block eitherRhoA activity or actin polymerization would conversely en-hance the transcriptional activity of Sox9. We found that cul-ture of dedifferentiated chondrocytes in medium containingthe Tat-C3 transferase fusion protein did in fact augment theability of exogenous Sox9 to activate a collagen II-luciferasereporter (Fig. 6A), indicating that Rho signaling inhibits theactivity of Sox9 in dedifferentiated chondrocytes. To explorewhether inhibition of actin polymerization would similarly en-hance the transcriptional activity of Sox9, we cotransfectedSox9 with either a dominant negative version of mDia (mDia-DN) (34) or a mutant form of actin [actin (R62D)] (24), bothof which reduce actin polymerization. We found that cotrans-fection of either mDia-DN (Fig. 6B) or actin (R62D) (Fig. 6C)boosted Sox9 induction of a collagen II-luciferase reporter.Thus, agents that block either RhoA function or actin poly-merization boost the ability of exogenous Sox9 to induce chon-drocyte gene expression.

C3 transferase or alginate culture boosts the transcriptionalactivity of a Gal4-Sox9 fusion protein. Because the collagenII-luciferase reporter (4x48p89-Col.II-Luc) (14) contains bind-ing sites for Sox5, Sox6, and Sox9 (13), augmented expressionof this reporter by agents that block either RhoA function oractin polymerization could reflect the enhancement of eitherthe expression or activity of any of these Sox transcriptionfactors. To evaluate if agents that block actin polymerizationdirectly affect the transcriptional activity of Sox9, we employeda chimeric protein consisting of the DBD of Gal4 fused to Sox9(Gal4DBD-Sox9). Cotransfection of dedifferentiated chondro-cytes with an expression vehicle encoding C3 transferase sig-nificantly augmented the ability of Gal4DBD-Sox9 to activatethe expression of either the 4x48p89-Col.II-luciferase reporter(Fig. 7A) or the pG5-luciferase reporter (Fig. 7B), whose ex-pression is driven by reiterated Gal4 binding sites. In addition,cotransfection of dedifferentiated chondrocytes with actin(R62D), which blocks actin polymerization, but not with WTactin, significantly augmented the induction of the pG5-lucif-erase reporter by Gal4DBD-Sox9 (Fig. 7C). Because culture ofdedifferentiated chondrocytes in alginate gel represses RhoAactivity and induces a precipitous loss of stress fibers (Fig. 1and 2), we examined whether these culture conditions wouldaugment the transcriptional activity of Gal4DBD-Sox9. In-deed, we found that induction of the pG5-luciferase reporterby Gal4DBD-Sox9 was increased approximately threefold byculturing the cells in alginate gel versus on plastic (Fig. 7D).In contrast, induction of the pG5-luciferase reporter byGal4DBD-VP16 (which contains the herpes simplex virus

VP16 activation domain) was equivalent in cells cultured inalginate gel versus those on plastic (Fig. 7D). Together, thesefindings indicate that agents that decrease either RhoA func-tion (C3 transferase) or expression (alginate gel culture con-ditions) or that block actin polymerization [actin (R62D)] allinduce the transcriptional activity of a Gal4-Sox9 fusion pro-tein, and by implication induce the transcriptional activity ofSox9.

Sox9 S181 is required for actin depolymerization to boostSox9 function. While culture of dedifferentiated chondrocytesin alginate gel boosted the ability of exogenous Sox9 to inducechondrocyte gene expression, we noted that treatment of suchcultures with the PKA antagonist H89 blocked the ability ofalginate gel to enhance exogenous Sox9 function (Fig. 4). Thisfinding suggests that enhancement of Sox9 activity by actindepolymerization requires PKA activity. To directly explore

FIG. 6. Blockade of actin polymerization with either Tat-C3 trans-ferase, dominant negative mDia, or overexpression of an actin mutantthat blocks actin polymerization and augments the ability of Sox9 toactivate chondrocyte-specific gene expression. (A) Dedifferentiatedchondrocytes (P4) were cotransfected with the 4x48p89Col.II-fireflyluciferase reporter, a simian virus 40 (SV40)-Renilla luciferase re-porter, plus a cytomegalovirus-driven Sox9 expression vehicle as indi-cated. The cells were cultured in either the absence or presence ofTat-C3 transferase, as indicated, harvested after either 4 or 6 days inculture, and assayed for relative luciferase units (RLU). (B) Caudalsternal chondrocytes were cotransfected with the 4x48p89Col.II-fireflyluciferase reporter and an SV40-Renilla luciferase reporter togetherwith expression vectors encoding Sox9 and a mDia-DN (34) as indi-cated. 4x48p89Col.II-firefly luciferase activity was normalized to theexpression of the cotransfected SV40-Renilla luciferase reporter.(C) Dedifferentiated chondrocytes (P4) were cotransfected with the4x48p89Col.II-luciferase reporter, an SV40-Renilla luciferase reporter,and an expression vector encoding Sox9 and increasing amounts ofexpression vectors encoding either a mutant form of actin [actin(R62D)] that reduces actin polymerization (24) or WT actin as indi-cated. 4x48p89Col.II-firefly luciferase activity was normalized to theexpression of the cotransfected SV40-Renilla luciferase reporter.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

FIG. 7. C3 transferase or alginate culture boosts the transcriptional activity of a Gal4-Sox9 fusion protein. (A and B) Dedifferentiatedchondrocytes were cotransfected with either the 4x48p89Col.II-firefly (FF) luciferase reporter (A) or the pGalX5-firefly luciferase reporter(pG5-FF) (B) plus the simian virus 40 (SV40)-Renilla luciferase reporter and expression vehicles encoding a Gal4DBD-Sox9 fusion protein or C3transferase, as indicated. In this and subsequent parts of this figure, the 4x48p89Col.II-FF or pG5-FF luciferase activity was normalized to theexpression of the cotransfected SV40-Renilla luciferase reporter. (C) Dedifferentiated chondrocytes were cotransfected with the pGalX5-fireflyluciferase reporter (pG5-FF) plus the SV40-Renilla luciferase reporter and expression vehicles encoding a Gal4DBD-Sox9 fusion protein, actin(R62D) or WT actin as indicated. Cells were processed as for panels A and B. (D) Dedifferentiated chondrocytes were cotransfected with thepGalX5-firefly luciferase reporter (pG5-FF) plus the SV40-Renilla luciferase reporter and expression vehicles encoding either Gal4DBD orGal4DBD-Sox9 fusion protein or Gal4DBD-VP16, as indicated. After transfection, cells were cultured either on plastic or in alginate beads for72 h. pGalX5-firefly luciferase activity was normalized to the expression of the cotransfected SV40-Renilla luciferase reporter. (E to G)Dedifferentiated chondrocytes were cotransfected with the 4x48p89Col.II-luciferase reporter, an SV40-Renilla luciferase reporter, and an expres-sion vector encoding WT Sox9, Sox9 (S181A), or Sox9 (S64, 181A) and either treated with the ROCK antagonist, Y27632, or cotransfected withan expression vector encoding mDia-DN or actin (R62D) as indicated. The 4x48p89Col.II-FF luciferase activities were normalized to theexpression of the cotransfected SV40-Renilla luciferase reporter. (G) Expression levels of WT Sox9, Sox9 (S181A), or Sox9 (S64, 181A) and actin(R62D) were assessed by Western blotting. GAPDH levels are displayed as a loading control for Western blotting.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

whether PKA-mediated phosphorylation of Sox9 is necessaryfor actin depolymerization to augment Sox9 function, we in-vestigated whether administration of the ROCK inhibitor,Y27632, or cotransfection of either mDia-DN or actin (R62D)could enhance the activity of mutant forms of Sox9-containingmutant PKA phosphorylation sites (S181A or S64,181A) (9).WT Sox9, Sox9-S181A, and Sox9-S64,181A each induce com-parable levels of expression of a cotransfected collagen II-luciferase reporter in dedifferentiated chondrocytes (Fig. 7E,lanes 2, 4, and 6). Administration of the ROCK inhibitor,Y27632, plus cotransfection of mDia-DN work synergisticallyto depolymerize actin (5) and increased the induction of thecollagen II-luciferase reporter by Sox9-WT by over 300% (Fig.7E, lanes 2 to 5). In contrast, the combination of both thesereagents failed to affect induction of this reporter by Sox9-S181A (Fig. 7E, lanes 6 to 9). Similarly, cotransfection of actin(R62D), which also blocks actin polymerization, increased theability of WT Sox9 to induce expression of the collagen II-luciferase reporter yet failed to affect induction of this reporterby either Sox9-S181A or Sox9-S64,181A (Fig. 7F). Impor-tantly, each of these forms of Sox9 was equivalently expressedin either the absence or presence of actin (R62D) (Fig. 7G).These findings suggest that phosphorylation of Sox9-S181 isnecessary for actin depolymerization to enhance Sox9 function.

DISCUSSION

RhoA signaling and actin polymerization negatively regu-late the transcriptional activity of Sox9 during chondrogene-sis. Our findings indicate that culture of dedifferentiated chon-drocytes in alginate gel results in a precipitous loss of RhoAprotein and a corresponding loss of actin polymerization intostress fibers. Culturing dedifferentiated chondrocytes in algi-nate gel is sufficient to completely restore expression of boththe chondrogenic Sox transcription factors and chondrocytedifferentiation markers such as aggrecan and collagen II tolevels found in nonpassaged chondrocytes. In contrast, whileforced expression of exogenous retrovirus-encoded Sox9 indedifferentiated chondrocytes maintained on plastic can in-duce expression of readily detectable levels of endogenousSox9 and aggrecan (and trace levels of collagen II), activationof all these markers by exogenous Sox9 is significantly aug-mented by culturing cells in alginate gel. In addition, we havefound that alginate gel culture conditions enhance the tran-scriptional activity of either WT Sox9 or a Gal4 DBD-Sox9fusion protein (Gal4DBD-Sox9), indicating that the transcrip-tional activity of Sox9 is modulated by cell shape. The ability ofalginate gel culture to enhance Sox9 transcriptional activitywas abrogated by cotransfection of a constitutively activatedform of RhoA. Thus, the loss of RhoA activity is necessary foralginate gel culture to augment Sox9 transcriptional activity.Conversely, agents that block actin polymerization, such asdominant negative mDia or a mutant form of actin (R62D),both increase the transcriptional activity of either exogenousWT Sox9 or a Gal4-Sox9 fusion protein. Together, these find-ings indicate that culture of dedifferentiated chondrocytes inalginate gel enhances both the expression and transcriptionalactivity of Sox9 and that the loss of RhoA activity and conse-quent depolymerization of actin filaments enhance the tran-scriptional activity of Sox9.

PKA-dependent phosphorylation of Sox9 is apparently re-quired for actin depolymerization to enhance Sox9 transcrip-tional activity. We have observed that the PKA antagonist H89blocks the ability of alginate culture to enhance Sox9 functionand that mutation of a PKA phosphorylation site in Sox9(S181) blocks the ability of agents that induced actin depoly-merization to boost Sox9 activity while not affecting the basalactivity of Sox9 in dedifferentiated chondrocytes. Togetherthese findings suggest that PKA-mediated phosphorylation ofSox9-S181 is necessary for actin depolymerization to enhanceSox9 function. Future analysis will determine whether actindepolymerization augments Sox9 function either by regulatingthe extent of Sox9 S181 phosphorylation or by regulating theassociation of Sox9 phospho-S181 with transcriptional coacti-vators.

Sox9 activates its own expression in chondrocytes. Exoge-nous retrovirus-encoded Sox9 induced the expression of en-dogenous Sox9 in dedifferentiated chondrocytes, indicatingthat Sox9 has the capacity to activate its own synthesis indedifferentiated chondrocytes. We observed that while admin-istration of the PKA antagonist H89 could efficiently block theexpression of endogenous Sox9 in dedifferentiated cells cul-tured in alginate gel, the expression of retrovirus-encoded Sox9could maintain the expression of endogenous Sox9 in suchH89-treated cells. These findings suggest that Sox9 proteinmay act to maintain expression of its own locus in differenti-ated chondrocytes and that signals/culture conditions that in-hibit RhoA activity enhance the transcriptional activity of Sox9and may therefore act to establish this positive autoregulatoryloop (summarized in Fig. 8).

Chondrogenesis downregulates the amount and activity ofRhoA protein but not RhoA RNA. The induction of Sox9 ex-pression in dedifferentiated chondrocytes cultured in alginatecorrelates with a loss of RhoA protein but not RhoA RNA. Itis possible that the uncoupling of RhoA RNA from RhoAprotein levels in either chondrocytes or dedifferentiated chon-drocytes that are cultured in alginate gel reflects either a dif-ferential stability of RhoA protein in cells cultured in alginateor a differential translation of RhoA RNA in such cells. Ineither case, the culture of cells in alginate gel induces a pre-cipitous loss of both total and active (GTP-bound) RhoA pro-tein and induces a consequent loss of polymerized actin local-ized to stress fibers. Consistent with these findings, weobserved that the expression of collagen II in limb bud micro-mass cultures was specifically confined to areas of the micro-mass culture displaying the lowest levels of RhoA protein,suggesting that chondrogenic differentiation in limb bud mes-enchymal cells similarly entails a loss of RhoA protein. Themodulation of RhoA protein levels and activity by cell shapechange is no doubt relevant to the differentiation status ofchondrocytes, as we have observed that treatment of eitherdedifferentiated chondrocytes with the pan-Rho antagonist,Tat-C3 transferase, or expression of dominant negative RhoAin chick limb bud micromass cultures induces a robust increasein chondrocyte differentiation. How is RhoA signaling con-trolled during chondrogenesis? Cellular condensation withinthe prechondrogenic regions correlates with a dramatic in-crease in the expression of N-cadherin, whose expression sub-sequently diminishes in the chondrogenic core (20, 21). Block-ing N-cadherin function with either antibodies (20, 21) or


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

dominant negative N-cadherin constructs (6, 7) has been foundto block both cellular condensation and subsequent chondro-genesis of limb bud mesenchyme in vitro and in vivo. Interest-ingly, N-cadherin expression in condensing chondrocytes isitself dependent upon Rac1 signaling (37), another GTP bind-ing protein that controls actin dynamics. Because cadherinfunction is apparently necessary for chondrogenesis to initiate,it may be relevant in this regard that cadherin engagementhas been demonstrated to activate a RhoA GAP and thusdiminish levels of active RhoA in the cell (19). Future stud-ies will be necessary to address whether cadherin engage-ment during the condensation stage of chondrogenesis actssimilarly to depress RhoA activity and thereby enhance Sox9transcriptional activity.

ACKNOWLEDGMENTS

This work was supported by an NIH grant to A.B.L. (AR048524).D.K. was supported by a postdoctoral fellowship from the ArthritisFoundation.

We thank Benoit de Crombrugghe, Xi He, Chris Marshall, ShuhNarumiya, H. Sasaki, and Richard Treisman for generously providingus with plasmids.

REFERENCES

1. Ahrens, P. B., M. Solursh, and R. S. Reiter. 1977. Stage-related capacity forlimb chondrogenesis in cell culture. Dev. Biol. 60:69–82.

2. Barna, M., and L. Niswander. 2007. Visualization of cartilage formation:insight into cellular properties of skeletal progenitors and chondrodysplasiasyndromes. Dev. Cell 12:931–941.

3. Benya, P. D., and J. D. Shaffer. 1982. Dedifferentiated chondrocytes reex-press the differentiated collagen phenotype when cultured in agarose gels.Cell 30:215–224.

4. Bonaventure, J., N. Kadhom, L. Cohen-Solal, K. H. Ng, J. Bourguignon, C.Lasselin, and P. Freisinger. 1994. Reexpression of cartilage-specific genes bydedifferentiated human articular chondrocytes cultured in alginate beads.Exp. Cell Res. 212:97–104.

5. Burridge, K., and K. Wennerberg. 2004. Rho and Rac take center stage. Cell116:167–179.

6. DeLise, A. M., and R. S. Tuan. 2002. Alterations in the spatiotemporalexpression pattern and function of N-cadherin inhibit cellular condensationand chondrogenesis of limb mesenchymal cells in vitro. J. Cell. Biochem.87:342–359.

7. Delise, A. M., and R. S. Tuan. 2002. Analysis of N-cadherin function in limbmesenchymal chondrogenesis in vitro. Dev. Dyn. 225:195–204.

8. Erlebacher, A., E. H. Filvaroff, S. E. Gitelman, and R. Derynck. 1995.Toward a molecular understanding of skeletal development. Cell 80:371–378.

9. Huang, W., X. Zhou, V. Lefebvre, and B. de Crombrugghe. 2000. Phosphor-ylation of SOX9 by cyclic AMP-dependent protein kinase A enhancesSOX9’s ability to transactivate a Col2a1 chondrocyte-specific enhancer. Mol.Cell. Biol. 20:4149–4158.

10. Khosravi-Far, R., P. A. Solski, G. J. Clark, M. S. Kinch, and C. J. Der. 1995.Activation of Rac1, RhoA, and mitogen-activated protein kinases is requiredfor Ras transformation. Mol. Cell. Biol. 15:6443–6453.

11. Kronenberg, H. M. 2003. Developmental regulation of the growth plate.Nature 423:332–336.

12. Lee, Y. S., and C. M. Chuong. 1997. Activation of protein kinase A is apivotal step involved in both BMP-2- and cyclic AMP-induced chondrogen-esis. J. Cell Physiol. 170:153–165.

13. Lefebvre, V., W. Huang, V. R. Harley, P. N. Goodfellow, and B. de Crom-brugghe. 1997. SOX9 is a potent activator of the chondrocyte-specific en-hancer of the pro�1(II) collagen gene. Mol. Cell. Biol. 17:2336–2346.

14. Lefebvre, V., G. Zhou, K. Mukhopadhyay, C. N. Smith, Z. Zhang, H. Eber-spaecher, X. Zhou, S. Sinha, S. N. Maity, and B. de Crombrugghe. 1996. An18-base-pair sequence in the mouse pro�1(II) collagen gene is sufficient forexpression in cartilage and binds nuclear proteins that are selectively ex-pressed in chondrocytes. Mol. Cell. Biol. 16:4512–4523.

15. Levitt, D., and A. Dorfman. 1972. The irreversible inhibition of differentia-tion of limb-bud mesenchyme by bromodeoxyuridine. Proc. Natl. Acad. Sci.USA 69:1253–1257.

16. Li, F., and H. N. Higgs. 2003. The mouse formin mDia1 is a potent actinnucleation factor regulated by autoinhibition. Curr. Biol. 13:1335–1340.

17. Munsterberg, A. E., J. Kitajewski, D. A. Bumcrot, A. P. McMahon, and A. B.Lassar. 1995. Combinatorial signaling by Sonic hedgehog and Wnt familymembers induces myogenic bHLH gene expression in the somite. GenesDev. 9:2911–2922.

18. Nakano, K., K. Takaishi, A. Kodama, A. Mammoto, H. Shiozaki, M.Monden, and Y. Takai. 1999. Distinct actions and cooperative roles ofROCK and mDia in Rho small G protein-induced reorganization of theactin cytoskeleton in Madin-Darby canine kidney cells. Mol. Biol. Cell 10:2481–2491.

19. Noren, N. K., C. M. Niessen, B. M. Gumbiner, and K. Burridge. 2001.Cadherin engagement regulates Rho family GTPases. J. Biol. Chem. 276:33305–33308.

20. Oberlender, S. A., and R. S. Tuan. 1994. Expression and functional involve-ment of N-cadherin in embryonic limb chondrogenesis. Development 120:177–187.

21. Oberlender, S. A., and R. S. Tuan. 1994. Spatiotemporal profile of N-cadherin expression in the developing limb mesenchyme. Cell Adhes. Com-mun. 2:521–537.

22. Osdoby, P., and A. I. Caplan. 1979. Osteogenesis in cultures of limb mes-enchymal cells. Dev. Biol. 73:84–102.

23. Paterson, H. F., A. J. Self, M. D. Garrett, I. Just, K. Aktories, and A. Hall.1990. Microinjection of recombinant p21rho induces rapid changes in cellmorphology. J. Cell Biol. 111:1001–1007.

24. Posern, G., A. Sotiropoulos, and R. Treisman. 2002. Mutant actins demon-strate a role for unpolymerized actin in control of transcription by serumresponse factor. Mol. Biol. Cell 13:4167–4178.

25. Reginato, A. M., R. V. Iozzo, and S. A. Jimenez. 1994. Formation of nodularstructures resembling mature articular cartilage in long-term primary cul-tures of human fetal epiphyseal chondrocytes on a hydrogel substrate. Ar-thritis Rheum. 37:1338–1349.

26. Reid, T., T. Furuyashiki, T. Ishizaki, G. Watanabe, N. Watanabe, K. Fuji-sawa, N. Morii, P. Madaule, and S. Narumiya. 1996. Rhotekin, a newputative target for Rho bearing homology to a serine/threonine kinase, PKN,and rhophilin in the rho-binding domain. J. Biol. Chem. 271:13556–13560.

27. Ren, X. D., W. B. Kiosses, and M. A. Schwartz. 1999. Regulation of the smallGTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J.18:578–585.

28. Sahai, E., and M. F. Olson. 2006. Purification of TAT-C3 exoenzyme. Meth-ods Enzymol. 406:128–140.

29. Sekine, A., M. Fujiwara, and S. Narumiya. 1989. Asparagine residue in therho gene product is the modification site for botulinum ADP-ribosyltrans-ferase. J. Biol. Chem. 264:8602–8605.

FIG. 8. Model for how RhoA signaling controls chondrogenesis.Our findings indicate that culture of dedifferentiated chondrocytes inalginate gel induces a precipitous loss of RhoA protein, thus resultingin a loss of polymerized actin in the cell. Enhancement of Sox9 func-tion by actin depolymerization requires both PKA activity and a PKAphosphorylation site in Sox9 (S181) that is known to enhance Sox9transcriptional activity (9). It is possible that actin depolymerizationaugments Sox9 function by either regulating the extent of Sox9 S181phosphorylation by PKA or regulating the association of Sox9 phos-pho-S181 with transcriptional coactivators. Because Sox9 has the ca-pacity to induce its own expression, RhoA signaling may in additionblock a Sox9 autoregulatory loop and thereby inhibit Sox9 gene ex-pression.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

30. Solursh, M., T. F. Linsenmayer, and K. L. Jensen. 1982. Chondrogenesisfrom single limb mesenchyme cells. Dev. Biol. 94:259–264.

31. Solursh, M., and R. S. Reiter. 1975. Determination of limb bud chondrocytesduring a transient block of the cell cycle. Cell Differ. 4:131–137.

32. Solursh, M., R. S. Reiter, P. B. Ahrens, and B. M. Vertel. 1981. Stage- andposition-related changes in chondrogenic response of chick embryonic wingmesenchyme to treatment with dibutyryl cyclic AMP. Dev. Biol. 83:9–19.

33. Thayer, M. J., S. J. Tapscott, R. L. Davis, W. E. Wright, A. B. Lassar, and H.Weintraub. 1989. Positive autoregulation of the myogenic determinationgene MyoD1. Cell 58:241–248.

34. Tsuji, T., T. Ishizaki, M. Okamoto, C. Higashida, K. Kimura, T. Furu-yashiki, Y. Arakawa, R. B. Birge, T. Nakamoto, H. Hirai, and S. Narumiya.2002. ROCK and mDia1 antagonize in Rho-dependent Rac activation inSwiss 3T3 fibroblasts. J. Cell Biol. 157:819–830.

35. Woods, A., and F. Beier. 2006. RhoA/ROCK signaling regulates chondro-genesis in a context-dependent manner. J. Biol. Chem. 281:13134–13140.

36. Woods, A., G. Wang, and F. Beier. 2005. RhoA/ROCK signaling regulatesSox9 expression and actin organization during chondrogenesis. J. Biol.Chem. 280:11626–11634.

37. Woods, A., G. Wang, H. Dupuis, Z. Shao, and F. Beier. 2007. Rac1 signalingstimulates N-cadherin expression, mesenchymal condensation, and chondro-genesis. J. Biol. Chem. 282:23500–23508.

38. Wulf, E., A. Deboben, F. A. Bautz, H. Faulstich, and T. Wieland. 1979.Fluorescent phallotoxin, a tool for the visualization of cellular actin. Proc.Natl. Acad. Sci. USA 76:4498–4502.

39. Xu, Y., J. B. Moseley, I. Sagot, F. Poy, D. Pellman, B. L. Goode, and M. J.Eck. 2004. Crystal structures of a formin homology-2 domain reveal a teth-ered dimer architecture. Cell 116:711–723.

40. Yoon, Y. M., C. D. Oh, S. S. Kang, and J. S. Chun. 2000. Protein kinase Aregulates chondrogenesis of mesenchymal cells at the post-precartilage con-densation stage via protein kinase C-alpha signaling. J. Bone Miner Res.15:2197–2205.

41. Zanetti, N. C., and M. Solursh. 1984. Induction of chondrogenesis in limbmesenchymal cultures by disruption of the actin cytoskeleton. J. Cell Biol.99:115–123.

42. Zeng, L., H. Kempf, L. C. Murtaugh, M. E. Sato, and A. B. Lassar. 2002. Shhestablishes an Nkx3.2/Sox9 autoregulatory loop that is maintained by BMPsignals to induce somitic chondrogenesis. Genes Dev. 16:1990–2005.


on Novem


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

The Transcriptional Activity of Sox9 in Chondrocytes Is Regulated by RhoA Signaling and Actin...

Documents

Transcript of The Transcriptional Activity of Sox9 in Chondrocytes Is Regulated by RhoA Signaling and Actin...