Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/aogs.12640 This article is protected by copyright. All rights reserved.

Received Date : 15-Jul-2014 Accepted Date : 29-Mar-2015 Article type : Main Research Article The obesity related FTO gene variant associates with the risk of recurrent

miscarriage

Running title: FTO gene variant in recurrent miscarriage

Prabha H Andraweera1,2, Gustaaf A Dekker1,3, Rohan W Jayasekara2, Vajira HW

Dissanayake2 & Claire T Roberts1

1School of Paediatrics and Reproductive Health, Robinson Research Institute, University of

Adelaide, Adelaide, Australia 2Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka 3Women’s and Children’s Division, Lyell McEwin Hospital, Elizabeth Vale, South Australia,

Australia

Correspondence

Prabha Andraweera

School of Paediatrics and Reproductive Health, Robinson Research Institute, University of

Adelaide, Adelaide, Australia

Email: prabha.andraweera@adelaide.edu.au

Conflicts of interest

All authors declare no conflicts of interest

Abstract

Objective: To investigate the association of the fat mass and obesity associated gene (FTO)

rs9939609 single nucleotide polymorphism (SNP) with recurrent miscarriage (RM). Design:

Candidate gene association study. Setting: Human Genetics Unit, Colombo, Sri Lanka.

Population: 202 Sinhalese women with two or more first trimester miscarriages and no living

children (cases) and 202 age and ethnicity matched women with no history of miscarriage

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

and having two or more living children (controls). Methods: Peripheral blood was collected

from the participants and DNA was extracted. Genotyping was performed at the Australian

genome Research Facility using the Sequenom MassARRAY system. Genotype and allele

frequencies of cases were compared with controls using chi-squared testing. Main outcome

measures: The prevalence of the SNP in cases and controls. Results: The mean age of the

women in the RM group was 31.9 ± 0.4 years and that of the control group was 32.3 ± 0.3

years. Of the women in the RM group, 140 (69.3%) had experienced ≥3 first trimester

miscarriages. The prevalence of the AA genotype [p = 0.0002, OR (95% CI) = 3.8 (1.8-8.0)]

and A allele [p = 0.002, OR (95% CI) = 1.6 (1.2-2.2)] of the FTO rs9939609 SNP were

increased in women in the RM group compared to the control group. Conclusion: The obesity

related FTO rs9939609 SNP associates with RM. This finding warrants further investigation

with controlling for important factors such as body mass index, diabetes and cardiovascular

disease status. The SNP may be useful in predicting the risk of recurrent miscarriage.

Key words

recurrent miscarriage, FTO rs9939609, polymorphism

Abbreviations

RM, recurrent miscarriage;

FTO, Fat Mass and Obesity;

SNP, single nucleotide polymorphism

OR, odds ratio

BMI, body mass index

Key message

The FTO rs9939609 SNP which is well known for the associations with obesity and vascular

and metabolic phenotypes, is associated with increased risk of recurrent miscarriage. The

SNP may be useful in predicting the risk of recurrent miscarriage.

Introduction

Spontaneous miscarriage is involuntary pregnancy loss before the 20th week of gestation and

affects approximately 15% of normal couples. Of these, 1-5% experience recurrent

miscarriage (RM). At present the definition of RM is debated with the American definition

being the loss of two or more consecutive pregnancies, while the European definition is the

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

loss of three or more consecutive pregnancies (1, 2). A genetic contribution to RM is

suggested by studies that have shown that the prevalence of RM among first degree relatives

is two- to seven-fold higher compared to the general population and that the prevalence of

miscarriage among siblings of those experiencing RM is approximately double that of the

general population (3, 4).

Women who experience RM are at increased risk of later life vascular and metabolic

disorders including coronary artery disease and diabetes mellitus and parents of women who

experience RM are also at a higher risk of developing coronary artery disease (5-7). These

findings suggest that these families may have shared genetic, epigenetic and environmental

risk factors that predispose them to RM and later life vascular disease. Among the many

mechanistic pathways that have been proposed to contribute to the above findings, one

plausible mechanism is the presence of phenotypic variants that predispose to metabolic

syndrome, including obesity, higher fasting insulin, glucose and triglycerides and lower high

density lipoproteins (8).

A few years ago, genome wide association studies identified a strong association between a

common single nucleotide polymorphism (SNP rs9939609) in the fat mass and obesity

associated gene (FTO) on chromosome 16q12.2 and the risk of obesity. Since then the FTO

rs9939609 SNP has been investigated in relation to many metabolic diseases and molecular

pathways and is one of the most extensively investigated SNPs. There is strong and

consistent evidence that has been replicated by many groups on the association of this SNP

with adverse metabolic traits, diabetes mellitus and coronary artery disease (9). However, this

polymorphism has not been studied in RM. The aim of our study was to investigate the

association of the FTO rs9939609 SNP with RM in Sinhalese women in Sri Lanka.

Material and methods

This study was conducted on 404 DNA samples that comprise a biobank of samples extracted

from peripheral blood of 404 women recruited to the “Recurrent Miscarriage Study” which

was conducted with the aim of identifying genetic variants that are associated with RM. We

have investigated a total of 100 SNPs in different molecular pathways that are implicated in

the pathogenesis of RM and some of the findings have previously been published (10, 11).

The FTO rs9939609 SNP was the only obesity-related polymorphism that was investigated in

this cohort and the findings are discussed in this manuscript.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

The participants were consecutively recruited at two tertiary care maternity hospitals and at

the Human Genetics Unit of the Faculty of Medicine, University of Colombo, Sri Lanka

between January 2006 and December 2008. The study population consisted of 202 women in

the RM group and 202 women in the control group. The eligibility criteria to be recruited into

the RM group included women who had experienced at least two consecutive first trimester

pregnancy losses and having no living children. All eligible women and their partners

underwent karyotyping. If a chromosome abnormality was detected in the woman or her

partner, the woman was not eligible to participate in the study. Only Sinhalese women were

eligible to participate. Women of mixed ethnicity and those who had pregnancies fathered by

non Sinhalese men were not recruited to ensure ethnic homogeneity. All women in the RM

group had been assessed by an obstetrician and had undergone routine testing to identify a

cause for RM including endocrine disorders, structural abnormalities of the reproductive

tract, thrombophilias and antiphospholipid antibody syndrome. Those with an identifiable

cause for RM were not eligible to participate in the study. The control group consisted of 202

ethnicity and age matched women who had two or more living children and who did not have

a past history of miscarriage. The women in the control group were recruited at postnatal

wards of the same maternity hospitals as the women in the RM group.

The study was approved by the Ethics Review Committee of the Faculty of Medicine,

University of Colombo, Sri Lanka (EC/05/003, 10/02/2005) and the Human Ethics

Committee of the University of Adelaide, Australia (H147-2008, 13/11/2008). All women

provided written informed consent.

Peripheral blood samples were collected from the women and DNA was extracted using

QiaAmp blood midi DNA extraction kits (Qiagen, Limberg, Netherlands). Genotyping was

performed at the Australian Genome Research Facility (Brisbane, Australia) using the

Sequenom MassARRAY system (Sequenom Inc, San Diego, California). The primer

sequences were ACGTTGGATGTGTCTGAATTATTATTCTAG (1st PCR primer),

ACGTTGGATGTAGAGTAACAGAGACTATCC (2nd PCR primer) and

GGTACTTGCGACTGCTGTGAATTT (extend primer). As a quality control measure 300

independent samples which were genotyped in house for the same SNPs using real time-PCR

and high resolution melting (HRM) analysis were genotyped using the Sequenom

MassARRAY system at the Australian Genome Research Facility. The concordance rate of

the RT-PCR results and MassARRAY results was 100%.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

The chi-squared test was used to test the genotypes for Hardy-Weinberg Equilibrium and to

compare categorical variables. All data analyses were performed using PASW version 17.02

(SPSS, Chicago, IL, USA). The genotype and allele frequencies of cases were compared with

controls using chi-squared analyses. Results were reported as number and percent [n (%)] or

mean ± standard deviation where appropriate. To account for multiple testing, the Bonferroni

correction was applied. Significant associations were defined at a two-tailed p value

<0.05/100 = 0.0005. The prevalence of the SNP in the general population was determined by

genotyping 85 randomly selected Sinhalese men and women. On the basis of prevalence of a

polymorphism in 20% in the general population, a ratio of one control subject to one case,

200 women with RM and 200 control women have 80% power to detect an odds ratio (OR)

of 2.0 (β = 80%, α = 0.05).

Results

The mean age of the women in the RM group was 31.9 ± 0.4 years and the mean age of the

control group was 32.3 ± 0.3 years. Of the 202 women in the recurrent pregnancy loss group,

140 (69.3%) had experienced 3 or more first trimester pregnancy losses and 114 (56.4%) had

experienced only first trimester pregnancy losses. The details of pregnancy loss are shown in

Table 1. All cases and controls were non-smokers. The FTO rs9939609 SNP was in Hardy-

Weinberg Equilibrium in both cases and controls. Genotype data of 7 (3.5%) women in the

RM group and 9 (4.5%) women in the control group were not available due to genotyping

failure. The prevalence of the AA genotype [p = 0.0002, OR (95% CI) = 3.8 (1.8 - 8.0)] and

A allele [p = 0.002, OR (95% CI) = 1.6 (1.2-2.2)] of the FTO rs9939609 SNP were increased

in women in the RM group compared to the control group (Table 2). The association of the

AA genotype of the FTO rs9939609 SNP with RM was significant after Bonferroni

correction. As a post-hoc analysis, we sub-categorized the women in the RM group into those

who have had three or more first trimester miscarriages and those who have had two first

trimester miscarriages and compared the prevalence of the genotypes with the control group.

We observed similar results in the two groups (Table 3).

Discussion

This is the first study to investigate the prevalence of the FTO rs9939609 SNP in women who

experience RM. Our findings demonstrate a significant increase in the prevalence of the

variant allele of the SNP in women who experience RM.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

There is increasing evidence linking RM with later life coronary artery disease and diabetes

mellitus (5, 6, 12). A recent systematic review and meta-analysis demonstrated that women

with a history of miscarriage are at a 45% higher risk and those with a history of RM at a

two-fold risk of developing coronary artery disease (8). Women with a history of RM are also

shown to be at two times higher risk of developing diabetes mellitus in later life (6). These

associations can be explained by two plausible theories. One theory is that RM and later life

vascular and metabolic disorders share the same etiology and the second theory is that

pathological processes initiated due to the pregnancy loss may predispose a woman to future

vascular and metabolic disorders.

Interestingly, Smith and colleagues recently reported that the prevalence of coronary artery

disease is also higher among parents of women with RM. The risk was shown to be 25% for

parents of women experiencing two miscarriages and 56% for parents of women

experiencing three or more miscarriages (7). These findings suggest that these families may

have shared genetic, epigenetic and environmental risk factors that predispose them to RM

and later life coronary artery disease, supporting the theory of shared genetic etiology among

these disorders.

The FTO rs9939609 SNP is an ideal candidate polymorphism in this setting. This SNP

gained much research interest when in 2007, three well-powered genome wide association

studies identified it as a strong contributor to both childhood and adult obesity (13-16). Since

then, it has been one of the most extensively studied polymorphisms with consistent evidence

of its association with many metabolic and vascular phenotypes.

The molecular mechanism of FTO action in metabolism is yet to be determined but the FTO

protein is highly expressed in the central nervous system and is considered to be implicated in

energy balance and regulation of appetite (17). The variant allele (A allele) of the SNP has

been shown to have a robust and consistent association with elevated body mass index

(BMI), central fat distribution and obesity (18). It has also been shown to be associated with

higher fasting insulin, glucose, triglycerides and lower high density lipoprotein cholesterol

(19). A strong and consistent association between the variant allele and the risk of type 2

diabetes mellitus and coronary artery disease has also been reported (9, 20, 21). Until

recently, the association between the SNP and these clinical phenotypes was thought to be

mediated via its association with elevated BMI and obesity. However, recent evidence

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

demonstrates an independent association of the SNP with disease risk. Two recent meta-

analyses on the association of the FTO rs9939609 SNP with type 2 diabetes among 24 987

and 95 551 patients demonstrated a significant association independent of BMI (22, 23).

Another recent systematic review and meta-analysis of 19 153 patients with coronary artery

disease also reported that the association between the SNP and coronary artery disease risk is

independent of BMI and other conventional coronary artery disease risk factors (23).

In our study, we found that homozygosity for the variant allele of this SNP was associated

with a 3.8-fold risk of RM in Sinhalese women providing further evidence for potential

shared genetic factors between RM, coronary artery disease and diabetes mellitus. When the

miscarriage cohort was sub-categorized into those with three or more and two first trimester

miscarriages, we found a marginal increase in the odds ratio in the group with three or more

miscarriages. However, the subgroups do not have sufficient power to test for significant

differences between the two groups.

We could not investigate the interaction between the polymorphism and the woman's BMI,

cardiovascular status and the presence of diabetes mellitus since we did not have information

on these variables. We consider this a limitation of our study. However, the presence of

strong evidence from meta-analyses demonstrating the potential role of this polymorphism

independent of BMI, warrants further investigation of this polymorphism in other groups of

women with RM for whom more clinical and environmental data are available.

In addition, most consistent associations between this polymorphism and clinical variables

were initially shown in studies of Europeans with less consistent evidence shown among

Asians. Recently, a few groups have found strong associations between this polymorphism

and disease risk in Asian populations demonstrating a potential risk independent of ethnicity

(22, 23). Our findings add further evidence to the association of the FTO rs9939609 SNP

with disease risk among South Asians.

Conclusion

Our study suggests that the FTO rs9939609 SNP can be a risk factor for recurrent

miscarriage. This finding warrants further investigation with controlling for important factors

such as BMI, diabetes and cardiovascular disease status.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

Funding

This study was funded by the National Health and Medical Research Council Australia

(NHMRC) Project Grant ID519225 awarded to CTR and GAD. CTR is supported by a

NHMRC Senior Research Fellowship APP1020749. PHA is supported by a NHMRC Peter

Doherty Postdoctoral Fellowship (GNT1090778). The recruitment, characterisation and

establishment of the RM sample collection in Sri Lanka was funded by a grant from the

National Science Foundation (NSF), Sri Lanka awarded to VHWD and RWJ (Grant No:

SIDA/BT/2005/04). The study sponsors had no role in study design, data analyses, and

interpretation or writing this report.

REFERENCES

1. Practice Committee of American Society for Reproductive Medicine. Definitions of

infertility and recurrent pregnancy loss: a committee opinion. Fertil Steril. 201;99:63.

2. Jauniaux E, Farquharson RG, Christiansen OB, Exalto N. Evidence-based guidelines

for the investigation and medical treatment of recurrent miscarriage. Hum Reprod.

2006;21:2216-22.

3. Christiansen OB. A fresh look at the causes and treatments of recurrent miscarriage,

especially its immunological aspects. Hum Reprod Update. 1996;2:271-93.

4. Kolte AM, Nielsen HS, Moltke I, Degn B, Pedersen B, Sunde L, et al. A genome-

wide scan in affected sibling pairs with idiopathic recurrent miscarriage suggests genetic

linkage. Mol Hum Reprod. 2011;17:379-85.

5. Ranthe MF, Andersen EA, Wohlfahrt J, Bundgaard H, Melbye M, Boyd HA.

Pregnancy loss and later risk of atherosclerotic disease. Circulation. 2013;127:1775-82.

6. Kharazmi E, Lukanova A, Teucher B, Gross ML, Kaaks R. Does pregnancy or

pregnancy loss increase later maternal risk of diabetes? Eur J Epidemiol. 2012;27:357-66.

7. Smith GC, Wood AM, Pell JP, Hattie J. Recurrent miscarriage is associated with a

family history of ischaemic heart disease: a retrospective cohort study. BJOG. 2011;118:557-

63.

8. Oliver-Williams CT, Heydon EE, Smith GC, Wood AM. Miscarriage and future

maternal cardiovascular disease: a systematic review and meta-analysis. Heart.

2013;99:1636-44.

9. Liu C, Mou S, Pan C. The FTO Gene rs9939609 Polymorphism Predicts Risk of

Cardiovascular Disease: A Systematic Review and Meta-Analysis. PloS one.

2013;8(8):e71901.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

10. Andraweera PH, Dekker GA, Thompson SD, Nowak RC, Jayasekara RW,

Dissanayake VH, et al. Polymorphisms in the fibrinolytic pathway genes and the risk of

recurrent spontaneous abortion. Reprod Biomed Online. 2014;29(6):745-51.

11. Dissanayake VH, Sirisena ND, Weerasekera LY, Gammulla CG, Seneviratne HR,

Jayasekara RW. Candidate gene study of genetic thrombophilic polymorphisms in pre-

eclampsia and recurrent pregnancy loss in Sinhalese women. J Obstet Gynaecol Res.

2012;38(9):1168-76.

12. Kharazmi E, Dossus L, Rohrmann S, Kaaks R. Pregnancy loss and risk of

cardiovascular disease: a prospective population-based cohort study (EPIC-Heidelberg).

Heart. 2011;97(1):49-54.

13. Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, et al.

A common variant in the FTO gene is associated with body mass index and predisposes to

childhood and adult obesity. Science (New York, NY). 2007;316(5826):889-94.

14. Dina C, Meyre D, Gallina S, Durand E, Korner A, Jacobson P, et al. Variation in FTO

contributes to childhood obesity and severe adult obesity. Nat Genet. 2007;39(6):724-6.

15. Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, et al. Genome-wide

association scan shows genetic variants in the FTO gene are associated with obesity-related

traits. PLoS Genet. 2007;3(7):e115.

16. Magi R, Manning S, Yousseif A, Pucci A, Santini F, Karra E, et al. Contribution of 32

GWAS-Identified Common Variants to Severe Obesity in European Adults Referred for

Bariatric Surgery. PloS one. 2013;8(8):e70735.

17. Willer CJ, Speliotes EK, Loos RJ, Li S, Lindgren CM, Heid IM, et al. Six new loci

associated with body mass index highlight a neuronal influence on body weight regulation.

Nat Genet. 2009;41(1):25-34.

18. Lauria F, Siani A, Bammann K, Foraita R, Huybrechts I, Iacoviello L, et al.

Prospective analysis of the association of a common variant of FTO (rs9939609) with

adiposity in children: results of the IDEFICS study. PloS one. 2012;7(11):e48876.

19. Freathy RM, Timpson NJ, Lawlor DA, Pouta A, Ben-Shlomo Y, Ruokonen A, et al.

Common variation in the FTO gene alters diabetes-related metabolic traits to the extent

expected given its effect on BMI. Diabetes. 2008;57(5):1419-26.

20. Binh TQ, Phuong PT, Nhung BT, Thoang DD, Lien HT, Thanh DV. Association of

the common FTO-rs9939609 polymorphism with type 2 diabetes, independent of obesity-

related traits in a Vietnamese population. Gene. 2013;513(1):31-5.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

21. Rees SD, Islam M, Hydrie MZ, Chaudhary B, Bellary S, Hashmi S, et al. An FTO

variant is associated with Type 2 diabetes in South Asian populations after accounting for

body mass index and waist circumference. Diabet Med. 2011;28(6):673-80.

22. Vasan SK, Karpe F, Gu HF, Brismar K, Fall CH, Ingelsson E, et al. FTO genetic

variants and risk of obesity and type 2 diabetes: A meta-analysis of 28,394 Indians. Obesity

(Silver Spring). 2014;22(3):964-70.

23. Li H, Kilpelainen TO, Liu C, Zhu J, Liu Y, Hu C, et al. Association of genetic

variation in FTO with risk of obesity and type 2 diabetes with data from 96,551 East and

South Asians. Diabetologia. 2012;55(4):981-95.

Table 1. Characteristics of the study population.

Characteristic Controls RM

(n=202) (n=202)

Age (years) 32.3 ± 0.33 31.9 ± 0.41

Pregnancy loss n (%)

T1 only 0 114 (56.4)

T1 and T2 0 75 (37.1)

T1 and T3 0 09 (4.5)

T1, T2 and T3 0 4 (2.0)

≥ 3 T1 losses 0 140 (69.3)

RM, recurrent miscarriage; T1, first trimester; T2, second trimester; T3, third trimester.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

Table 2. Genotype and allele frequency distribution of FTO rs9939609 SNP in Sinhalese

women with recurrent miscarriage and controls.

FTO rs9939609 Controls RM p value OR (95% CI)

n (%) n (%)

Genotype

TT 94 (48.7) 78 (40.2) ref 1.0 (ref)

TA 88 (45.6) 81 (41.8) 0.6 1.1 (0.7-1.7)

AA 11 (5.7) 35 (18.0) 0.0002 3.8 (1.8-8.0)

Allele

T 276 (71.5) 237 (61.1) ref 1.0 (ref)

A 110 (28.5) 151 (38.9) 0.002 1.6 (1.2-2.2)

RM, recurrent miscarriage; p values and OR (95% CI) in bold are significant after Bonferroni

correction.

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

Table 3. Genotype and allele frequency distribution of FTO rs9939609 SNP in RM sub

groups and controls.

FTO rs9939609 Controls RM P value OR (95% CI)

n (%) n (%)

3 or more T1 miscarriages

Genotype

TT 94 (48.7) 54(40.6) ref 1.0 (ref)

TA 88 (45.6) 54(40.6) 0.8 1.1 (0.7 - 1.7)

AA 11 (5.7) 25(18.8) 0.0003 3.9 (1.8 - 8.7)

Allele

T 276 (71.5) 163 (60.8) ref 1.0 (ref)

A 110 (28.5) 105 (39.2) 0.005 1.6 (1.2 - 2.2)

2 T1 miscarriages

Genotype

TT 94 (48.7) 24 (39.3) ref 1.0 (ref)

TA 88 (45.6) 27 (44.3) 0.6 1.2 (0.6 - 2.2)

AA 11 (5.7) 10 (16.4) 0.007 3.6 (1.4 - 9.4)

Allele

T 276 (71.5) 75 (61.5) ref 1.0 (ref)

A 110 (28.5) 47 (38.5) 0.04 1.1 (1.0 - 2.4)

RM, recurrent miscarriage; T1, first trimester; p values and OR (95% CI) in bold are

significant after Bonferroni correction.