The Human Werner Syndrome Protein Stimulates Repair of Oxidative DNA Base Damage by the DNA...

The Human Werner Syndrome Protein Stimulates Repair ofOxidative DNA Base Damage by the DNA Glycosylase NEIL1*□S

Received for publication, April 20, 2007, and in revised form, June 12, 2007 Published, JBC Papers in Press, July 3, 2007, DOI 10.1074/jbc.M703343200

Aditi Das‡, Istvan Boldogh§, Jae Wan Lee¶, Jeanine A. Harrigan¶, Muralidhar L. Hegde‡, Jason Piotrowski¶,Nadja de Souza Pinto¶, William Ramos¶, Marc M. Greenberg�, Tapas K. Hazra‡, Sankar Mitra‡, and Vilhelm A. Bohr¶1

From the ‡Department of Biochemistry and Molecular Biology and §Department of Microbiology and Immunology, University ofTexas Medical Branch, Galveston, Texas 77555, the ¶Laboratory of Molecular Gerontology, NIA, National Institutes of Health,Baltimore, Maryland 21224, and the �Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21224

The mammalian DNA glycosylase, NEIL1, specific for repairof oxidatively damagedbases in the genomevia the base excisionrepair pathway, is activated by reactive oxygen species and pre-vents toxicity due to radiation. We show here that the Wernersyndrome protein (WRN), amember of the RecQ family of DNAhelicases, associates with NEIL1 in the early damage-sensingstep of base excision repair. WRN stimulates NEIL1 in excisionof oxidative lesions from bubble DNA substrates. The binaryinteraction between NEIL1 and WRN (KD � 60 nM) involvesC-terminal residues 288–349 of NEIL1 and the RecQ C-termi-nal (RQC) region of WRN, and is independent of the helicaseactivity WRN. Exposure to oxidative stress enhances the NEIL-WRN association concomitant with their strong nuclear co-lo-calization. WRN-depleted cells accumulate some prototypicaloxidizedbases (e.g.8-oxoguanine, FapyG, andFapyA) indicatinga physiological function of WRN in oxidative damage repair inmammalian genomes. Interestingly, WRN deficiency does nothave an additive effect on in vivodamage accumulation inNEIL1knockdown cells suggesting that WRN participates in the samerepair pathway as NEIL1.

Oxidative damage to the mammalian genome represents themost pervasive genotoxic insult and includes a plethora of dam-aged bases, apurinic/apyrimidinic (AP)2 sites and DNA strandbreaks (1, 2). Such damage has been etiologically linked to a

variety of pathological states, including sporadic cancers andaging (3, 4). Most oxidized bases in DNA are repaired via thebase excision repair (BER) pathway (5–7). Mammalian BERconsists of two sub-pathways: short-patch (SP-BER) and long-patch (LP-BER) (8). Both pathways are initiatedwith excision ofthe damaged base by aDNAglycosylase, followed by cleavage ofthe DNA backbone by AP endonuclease (APE1) or by theintrinsic AP lyase activity in the case of oxidized base-specificglycosylases (6). The strand cleavage by the APE1 generates3�-OH and 5�-deoxyribose phosphate termini, whereas the APlyases produce 3�-blocking phosphoribose or phosphatetogether with 5�-phosphate termini. In the subsequent step inSP-BER, DNA polymerase � (pol �) with intrinsic 5�-deoxyri-bose phosphate lyase activity carries out both 5�-end cleaningand DNA repair synthesis with incorporation of a single nucle-otide at the site of the base damage (9, 10). In case of LP-BER,�2–6 nucleotides are incorporated by pol � or pol �/�, and thedisplaced 5�-flap is cleaved by flap endonuclease 1 (FEN1) priorto strand ligation (11, 12).We and others have discovered a new family of human DNA

glycosylases consisting of NEIL1 and NEIL2 (13–17) that aredistinct in many ways from the previously identified oxidizedbase-specific glycosylases, 8-oxoguanine DNA glycosylase(OGG1) and endonuclease III homologue 1 (NTH1). A distinct,APE1-independent BER sub-pathway is responsible for NEIL1-initiated single nucleotide SP-BER (18) and involves a DNArepair complex comprising NEIL1, pol �, DNA ligase III � (ligIII �), polynucleotide kinase, and x-ray repair cross-comple-menting 1 protein. Interestingly, NEILs stand apart fromOGG1 and NTH1 in their ability to excise base lesions frombubble and single-stranded DNA (19), which might be tran-siently generated during DNA replication or transcription.The emerging concept of cellular interactomes prompted us

to search for significant protein partners of NEIL1 to furthercharacterize its in vivo role. Earlier, we demonstrated stableinteractions between NEIL1 and downstream BER proteins pol� and lig III � (18). In this study, we have identified stableassociation between NEIL1 and the Werner syndrome protein(WRN), a member of the RecQ family of DNA helicases. Inaddition to a 3�- to 5�-helicase activity, WRN also possesses a3�- to 5�-exonuclease activity (20). WRN is mutated in thehuman autosomal recessive disease Werner syndrome (WS)

* This work was supported by NCI, National Institutes of Health (NIH) Grants 5RO1 CA81063 (to S. M.), 1PO1 AG 021803 (to I. B. and S. M.), R01 CA102271(to T. H.), RO1 CA-074954 (to M. M. G.), and PO1 CA 092584 (to S. M.); byNIEHS, NIH Center Grant ES06676; and by funds from the NIA, NIH intramu-ral program. The costs of publication of this article were defrayed in part bythe payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Figs. S1 and S2.

1 To whom correspondence should be addressed: Laboratory of MolecularGerontology, NIA, NIH, 5600 Nathan Shock Dr., Baltimore, MD 21224. Tel.:410-558-8162; Fax: 410-558-8157; E-mail: [email protected].

2 The abbreviations used are: AP, abasic; APE, AP endonuclease; BER, baseexcision repair; SP-BER, short-patch BER; LP-BER, long-patch BER; GO, glu-cose oxidase; ROS, reactive oxygen species; Nei, endonuclease VIII; NEIL,Nei-like; NTH1, endonuclease III homolog 1; OGG1, 8-oxoguanine-DNAglycosylase 1; pol �, DNA polymerase �; Lig III �, DNA ligase III �; FEN1, flapendonuclease 1; WRN, Werner; WS, Werner syndrome; Hlc, helicase; RQC,RecQ conserved; Fpg, formamidopyrimidine-DNA glycosylase; 5-OHU,5-hydroxyuracil; FapyG, 2,6-diamino-4-hydroxy-5-formamidopyrimidine;FapyA, 4,6-diamino-5-formamidopyrimidine; PBS, phosphate-bufferedsaline; TBS, Tris-buffered saline; WT, wild type; KD, knockdown; B11, 11-

nucleotide bubble; B12, 12-nucleotide bubble; IP, immunoprecipitation;aa, amino acid(s); 8-oxo-G, 8-oxoguanine; 8-oxo-dG, 8-oxodeoxyguanine.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 36, pp. 26591–26602, September 7, 2007Printed in the U.S.A.

SEPTEMBER 7, 2007 • VOLUME 282 • NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 26591

at University of T

exas Medical B

ranch on August 9, 2009

ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org/cgi/content/full/M703343200/DC1Supplemental Material can be found at:

http://www.jbc.org

http://www.jbc.org/cgi/content/full/M703343200/DC1

with a number of phenotypes, including premature aging,genome instability, and cancer predisposition (21, 22). WRNhas been implicated in various DNA metabolic pathways,including replication, recombination, and repair (23, 24). A rolefor WRN in the repair of oxidative DNA damage is supportedby its association with BER proteins as observed earlier, includ-ing APE1, pol �, FEN1, and poly(ADP-ribose) polymerase 1(25–29). In addition, WS cells display elevated sensitivity togenotoxic agents, includingmethyl methansulfonate (34), 4-ni-troquinoline-1-oxide (30, 31), and ionizing radiation (32, 33).Here, we provide evidence for a novel physical and functional

interaction between WRN and NEIL1, whereby WRN stimu-lates the glycosylase activity of NEIL1. Oxidative stressenhances this association, and depletion ofWRN leads to accu-mulation of oxidatively induced base lesions in cells. Takentogether, our observations strongly suggest that WRN plays asignificant role in oxidative DNA damage repair via an impor-tant association with NEIL1.

EXPERIMENTAL PROCEDURES

Cell Cultures and Knockdown Assays—The human colorec-tal carcinoma line HCT116 (expressing wild-type p53), a gen-erous gift of Dr. B. Vogelstein (The Johns Hopkins University),was cultured in McCoy’s 5A modified medium supplementedwith 10% fetal bovine serum, 2 mM L-glutamine, penicillin (100units/ml), and streptomycin (100 �g/ml; Invitrogen). At 70%confluence, the cells were transfected and/or treated with glu-cose oxidase (GO, Roche Applied Science) at 100 ng/ml for 1 h,followed bywashingwith and incubation in freshmedium. Thistreatment did not affect cell viability, as judged by the rate ofcell growth. The osteosarcoma cell line U-2 OS was cultured inDulbecco’s modified Eagle’s medium containing 10% fetalbovine serum, glutamine, penicillin, and streptomycin.U-2OS cells stably expressing a short hairpin RNA (Ambion)

that is not homologous to any known human gene (WT) or aWRN short hairpin RNA (KD) were generated as describedpreviously (34). Cells were cultured in Dulbecco’s modifiedEagle’s medium containing 10% fetal bovine serum, glutamine,penicillin, streptomycin, and hygromycin B (0.2 mg/ml,Invitrogen).For down-regulation of NEIL1, initially an ON-Target Plus

SMART pool set of four (LU-008327-00-0005, Human NEIL1,NM_024608) siRNAs was purchased from Dharmacon andused according to the manufacturer’s protocol. This was fol-lowed by using each of the individual siRNAs (N1 to N4) tooptimize NEIL1 depletion whereby the N3 (J-008327-06)siRNA resulted in maximum effect. Subsequently N3 was opti-mized at a dose of 80 nM to produce both single and double KDof NEIL1. Total RNA was isolated using an RNeasy mini kit(Qiagen) to monitor the level of NEIL1 expression by real-timequantitative reverse transcription-PCR (Molecular Genomicscore facility, University of Texas Medical Branch, Galveston).Proteins—Full-length NEIL1 and the C-terminal deletion

fragments of NEIL1 (NEIL1�40 andNEIL1�101) were purifiedas described previously (14, 18). To examine the domain struc-ture of NEIL1, we carried out limited proteolytic digestion ofNEIL1 with endoproteinase Asp-N (Roche Applied Science).Two major non-overlapping domains consisting of N-terminal

(residues 1–311) and C-terminal (residues 312–389) fragmentswere identified by N-terminal sequencing and mass spectro-scopic analysis in the Protein Chemistry core facility (Univer-sity of Texas Medical Branch, Galveston). The 78-amino acidC-terminal fragment of NEIL1 was purified as a GST-taggedpolypeptide, from which the GST was cleaved by thrombin.WRNwild-type or mutant fragments were cloned into Gate-

way pDEST15 (Invitrogen) or pGEX-KGvectors and expressedand purified in Escherichia coli. Recombinant glutathioneS-transferase (GST)-tagged proteins were purified as describedpreviously (35). K-WRN (K577M) was expressed and purifiedusing the Bac-N-Blue transfection kit (Invitrogen). High titerstocks were made, and the protein was expressed in Sf9 cells.The cells were lysed by freeze-thawing, and the protein waspurified on a nickel-agarose column as described previously.Co-immunoprecipitation—HCT116 cells were transfected

separately with 1 �g of empty FLAG vector and FLAG-taggedexpression constructs for NEIL1 (constructed in pCMV-C-FLAG, Sigma) and OGG1 (constructed in C-terminal pCMV-N-FLAG, Sigma) (36). 48 h post-transfection, cells werewashedwith phosphate-buffered saline (PBS) and lysed with cold lysisbuffer containing 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1 mMEDTA, 1% Triton X-100, phosphatase inhibitors (Sigma), and aprotease inhibitor mixture (Roche Applied Science). The cellextracts (2 mg/ml) were immunoprecipitated with anti-FLAGM2 antibody (Sigma), washed thoroughly with cold TBS (50mM Tris-Cl, pH 7.5, 150 mM NaCl), and assayed for the pres-ence ofWRN in the complex by immunoblotting with antibodyspecific for the C terminus ofWRN (Bethyl Laboratories). Oxi-dative stress on cells was imposed by GO treatment asdescribed previously (36, 37), and co-immunoprecipitationanalyses were carried out with mock and GO-treated cells.GST-pulldown Assays—GST-pulldown assays were per-

formed as described previously (26, 38). Briefly, glutathione-Sepharose beads (50 �l, 50% v/v), alone or bound to 1 ml ofGST-taggedWRN polypeptides, were incubated for 2 h at 4 °Cwith 100 �g of HCT116 nuclear extract prepared as describedpreviously (39) or purified recombinant NEIL1 (0.1 �g) in 250�l of buffer (50 mMHEPES, pH 7.5, 100mMKCl, 10% glycerol).The bound proteins were separated by SDS-PAGE, trans-ferred to a nitrocellulose membrane, and probed with anti-NEIL1 antibody (Alpha Diagnostics, San Antonio, TX) andanti-GST antibody (GE Amersham Biosciences) forWesternanalysis.FarWestern Analysis—The proteins were separated by SDS-

PAGE (10%), transferred to a nitrocellulose membrane, treatedwith 6 M guanidine-HCl, and then renatured with successivedilutions of guanidine-HCl in PBS, 1 mM dithiothreitol (40).After blocking with 5% nonfat dry milk in blocking buffer (PBS,0.5% Tween 20), the membranes were incubated with the indi-cated protein in the blocking buffer for 3 h at 4 °C before immu-noblot analysis with corresponding antibodies.Intrinsic Fluorescence Studies—The binding of WRN and

NEIL1 was monitored by the decrease in intrinsic fluorescenceof WRN HlcRQC tryptophan residues (�ex � 295 nm, �em �300–450 nm) upon titrationwithNEIL1 peptide78. All bindingexperiments were performed in buffer A (20 mM Tris, 1 mMEDTA, 2 mM MgCl2, and 150 mM KCl, pH 7.5) at 25 °C for an

Functional Interaction between NEIL1 and WRN

26592 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 36 • SEPTEMBER 7, 2007

at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

incubation time of 5 min. The fluorescence was measured in aLS50 spectrofluorometer (PerkinElmer Life Sciences) in a QScell of light path 1 cm. HlcRQC (0.25 �M) was titrated withincreasing concentrations (0 to 0.25 �M) of NEIL1 peptide78.Spectra were corrected for buffer scattering and sampledilution. The intensity of Raman scattering was recorded(NEIL1p78 contains no tryptophan residues) for the titration byadding NEIL1 peptide78 to the HlcRQC solution, where addi-tion of NEIL1p78 to buffer in a similar manner was served asblank. Each fluorescence spectrum represents an average of fiverecordings. The RecQC-NEIL1 interaction was analyzed byiterative fitting of the experimental data to the ligand bindingequation: y � Bmax�x/KD � x (41, 42). KD was calculated fromSigmaPlot analysis, whereby we plotted �F(F0 � F) versus con-centration of the ligand (NEIL1 peptide78) according to theequation, �F � �Fmax�[NEIL1p78]/(KD � [NEIL1p78]). �F or(F0 � F) represents the change in HlcRQC tryptophan fluores-cence intensity at 345 nm when HlcRQC was titrated, withNEIL1p78; F0 and �Fmax are the fluorescence values when[NEIL1p78] � 0 and at saturation, respectively, [NEIL1p78]being the concentration of the ligand.WRN Helicase and Exonuclease Assays—Helicase reactions

were performed as previously described (29). Briefly, oligonu-cleotides Bub19T (Integrated DNA Technologies, Inc.) or Mix3 (Midland Certified Reagent Co.) were 5�-end-labeled with[�-32P]ATP and T4 polynucleotide kinase (New England

Biolabs) and annealed to their res-pective complementary strands,Bub19B (Integrated DNA Technol-ogies, Inc.) or Mix 4 (Midland Cer-tified Reagent Co.). Sequences ofthe oligonucleotides are shown inTable 1. Reactions (20 �l) were per-formed in helicase reaction buffer(40 mM Tris-HCl, pH 8, 4 mMMgCl2, 5 mM dithiothreitol, and 0.1mg/ml BSA) and contained ATP (2mM), DNA substrate (1 nM), WRN,and NEIL1 as indicated. Sampleswere incubated for 15 min at 37 °Cand terminated by the addition ofstop dye (50 mM EDTA, 40% glyc-erol, 0.9% SDS, 0.05% bromphenolblue, and 0.05% xylene cyanol).Products were run on a 12% nativepolyacrylamide gel and visualizedusing a PhosphorImager (Amer-sham Biosciences).Exonuclease reactions were per-

formed essentially as described pre-viously (29). Briefly, oligonucleotideBub19T was 5�-end-labeled andannealed to Bub19B. Reactions (10�l) were performed in helicase reac-tion buffer (see above), DNA sub-strate (1 nM), WRN, and NEIL1 asindicated. Samples were incubatedfor 15min at 37 °C, and the reaction

was terminated by the addition of formamide stop dye (80%formamide, 0.5� TBE, 0.1% bromphenol blue, and 0.1% xylenecyanol). The products were heat-denatured at 90 °C for 5 min,separated on a 14% denaturing polyacrylamide gel, and ana-lyzed as before.DNA Strand Incision Assay for NEIL1—NEIL1 substrates

used were 51-mer oligonucleotides (purchased from MidlandCo.) with the damaged base (5-OHU or 8-oxo-G) at residue 26(indicated by X, Table 1) and 36-mer oligonucleotides, withFapyG at residue 13 (indicated by Y, Table 1). Oligonucleotidescontaining FapyG were prepared as previously described (43).The damage-containing oligonucleotides, named B11US andB12US, were labeled with [�-32P]ATP and polynucleotidekinase before annealing to the complementary oligonucleo-tides, B11DS and B12 US (Invitrogen), respectively, containinga C opposite the lesion. DNA strand cleavage at the site of thelesion due to the intrinsic AP-lyase activity of NEIL1 after baseexcision was assayed by incubation of 32P-labeled X or Y con-taining substrates with NEIL1 (20 fmol) alone or together withWRN (20–80 fmol) or its fragments as indicated in a buffercontaining (40mMTris, pH8, 4mMMgCl2, 5mMdithiothreitol,0.1 �g/�l BSA) at 37 °C for 15 min. After stopping the reactionwith 70% formamide/30 mM NaOH, the products were ana-lyzed by denaturing gel electrophoresis. ATP as indicated wasused at a final concentration of 2 mM. The radioactivity wasanalyzed as before.

FIGURE 1. Identification of WRN as NEIL1-associated protein in vivo and in vitro: mapping of the inter-acting domain of WRN. A, extracts of HCT116 cells expressing either FLAG vector (lane 1), FLAG-NEIL1 (lane 2),or FLAG-OGG1 (lane 3) were immunoprecipitated with FLAG antibody (lanes 4 – 6). The upper part of themembrane was blotted with anti-WRN antibody, and the lower part was probed with anti-FLAG antibody toconfirm presence of NEIL1 and OGG1, respectively. B, GST pulldown assays with recombinant WRN fragmentsand HCT116 nuclear extracts (NE). The pulldown assay products of GST-WRN1072–1432 (lane 1), GST-WRN949 –1432(lane 2), GST-WRN949 –1092 (lane 3), GST-WRN239 – 499 (lane 4), or only GST (lane 5) were probed with anti-NEIL1antibody and compared with the level of NEIL1 in the input (lane 6). C, GST pulldown assays with recombinantNEIL1 and WRN polypeptides, 239 – 499 (lane 1), 1–120 (lane 2), 949 –1092 (lane 3), 949 –1432 (lane 4), 1072–1432 (lane 5), and only GST (lane 6). The bound proteins were separated by SDS-PAGE and probed with anti-NEIL1 and anti-GST antibody.



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

For enzyme kinetics studies, the oligonucleotides (3.2–125nM) were incubated with NEIL1 or NEIL1 plus WRN for 4 minat 37 °C. The linear reaction rate, Km, and kcat were calculatedby linear regression analysis using SigmaPlot.Quantitation of 8-oxo-G, FapyG, and FapyA—8-Oxo-G was

measured as its nucleoside 8-oxo-dG in cellular DNA by liquidchromatography/mass spectrometry with isotope dilutiontechnique using 8-oxo-dG-15N5 as an internal standard asdescribed previously (44). FapyG and FapyA were measured bygas chromatography/mass spectrometry as described previ-ously (45). Statistical significance was determined by paired ttest and analysis of variance.Immunostaining and Confocal Imaging—5 � 104 cells per

dish were grown to 50% confluency on glass coverslips (25mm)in 5% CO2 and at 37 °C. After treatment with and without GO,the cells were washed with PBS, dried, and fixed in acetone-methanol 1:1 (v/v). After exposure to heterologous pre-im-mune serum (0.1 �g in PBS containing 0.05% Tween 20 and0.5% BSA; PBS-T) for 30 min, the cells were incubated withprimary antibody (rabbit polyclonal anti-NEIL1 or mouse

monoclonal anti-WRN), and counterstained with fluorescein-conjugated secondary antibody (Santa Cruz Biotechnology,Santa Cruz, CA) for 60 min at 37 °C and washed in PBS-T. Thecell nuclei were stained for 15 min with 4,6-diamidino-2-phen-ylindole dihydrochloride, 10 ng/ml, and mounted in anti-fademedium (Dako Inc., Carpinteria, CA) on microscope slides.Confocal microscopy was performed on a Zeiss LSM510META system with the 488 nm line of the argon laser for exci-tation of fluorescein isothiocyanate and helium-neon 543 nmline excitation of rhodamine, combined with appropriate dich-roic mirrors, and emission band filters to discriminate betweengreen and red fluorescence. Images were captured at a magni-fication of �60. Co-localization was visualized by superimpo-sition of green and red images using MetaMorph software ver-sion 4.6r9 (Universal Imaging Corp.). The co-localizationcoefficient shows extent of superimposition in the green chan-nel with respect to the red channel. Briefly, the regions of inter-est were drawn to include the structures after the individualchannels were thresholded. Scatter plots were generated, andcoefficients of co-localization were calculated (46, 47).

FIGURE 2. Fine mapping of interaction between NEIL1 and WRN. A, after SDS-PAGE and duplicate Coomassie staining, immobilized OGG1 (lanes 1 and 1�),NEIL1 (lanes 4 and 4�) and its deletion constructs, NEIL1C�40 (lanes 3 and 3�), NEIL1C�101 (lanes 2 and 2�), and also BSA (lanes 5 and 5�) were probed forinteraction with WRN protein and anti-WRN antibody by far Western analysis. B, proteolytic cleavage of NEIL1 (20 �g) with endoproteinase AspN (enzyme/substrate ratio � 1:500). 10-�l aliquots were removed at specified times and loaded onto 15% SDS-PAGE, arrows representing the different domains. Aschematic map of the endoproteinase cleavage of NEIL1 is represented. In C: Left panel, far Western analysis of WRN domains, HlcRQC (lanes 2 and 2�) and Hlc(lanes 3 and 3�) with the NEIL1 ligand of 78 aa and anti-NEIL1 antibody. Full-length NEIL1 (lanes 1 and 1�) was loaded in the gel as positive control forimmunoblotting. Right panel, schematic of WRN (full-length and other fragments (65) used in the far Western).



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

RESULTS

Identification of WRN as a NEIL1 Interacting Protein—NEIL1 has previously been shown to stably interact with severalBER proteins (18). To further elucidate the cellular role playedby this enzyme in oxidized base repair we decided to identifyother possible NEIL1 interacting partners by co-immunopre-cipitation analysis. For this HCT116 cells were transfected withNEIL1-FLAG, OGG1-FLAG, or empty FLAG expression plas-mids, and whole cell extracts were immunoprecipitated withanti-FLAGantibody beads (Sigma).WRNcould be identified asan interacting protein in the NEIL1-FLAG IP but not in thevector IP or OGG1 IP (Fig. 1A) when probed with anti-WRNantibody. Equal amounts of lysates used for pulldown assays areshown as input. The absence of WRN in an OGG1 IP providedan appropriate negative control, as well as evidence for thespecificity of the WRN/NEIL1 association. These results indi-cate the existence of WRN in a complex with NEIL1 in vivo.Direct Association between NEIL1 and WRN: Mapping of

WRN Interacting Domain—To test for physical interactionbetween NEIL1 and WRN, we performed affinity pulldownexperiments with various recombinant WRN fragmentsexpressed as GST-fusion polypeptides and nuclear extractsfromHCT116 cells. As shown in Fig. 1B, NEIL1 co-precipitatedwith GST-WRN949–1092 (lane 3), GST-WRN949–1432 (lane 2),and to a smaller extent with GST-WRN1072–1432 (lane 1) bycomparison with the input (lane 6). Purified GST (lane 5) orGST-WRN239–499 (lane 4) did not co-precipitateNEIL1. Therewas some cross-reactivity of the anti-NEIL1 antibody to bacte-rial proteins migrating at lower molecular weight. To rule outthe possibility that other proteins in the extracts mediated theinteraction between WRN and NEIL1, a GST-pulldown assaywas also performed with recombinant NEIL1 protein. Asbefore, we observed that the N-terminal recombinant GST-WRN fragments failed to pull down recombinant NEIL1,

whereas C-terminal fragments werebound to NEIL1 to varying degrees(Fig. 1C), providing strong supportfor a direct interaction betweenNEIL1 and WRN. Thus the RQCregion (WRN883–1075 by sequencehomology), which overlaps withmost of the GST-WRN fragment,949–1092,wasmapped as theWRNinteracting domain that binds toNEIL1.Mapping of the Interacting Region

of NEIL1 with WRN—We nextmapped the NEIL1 interactingdomain for WRN by far Westernanalysis using purified full-lengthand deletion constructs of NEIL1.NEIL1 has a common domain nearthe C terminus for interaction withBERproteins, pol� and lig III� (18).The interaction domain of NEIL1spanning residues 288 to 349 couldbe mapped using the C termi-nally truncated NEIL1 polypeptides

(C�40 and C�101) lacking the C-terminal aa residues 40 and101, respectively. We observed stable interaction ofWRNwithC�40, C�101, and full-length NEIL1 (Fig. 2A). OGG1, anotheroxidized base-specific DNA glycosylase, did not directly inter-act with WRN, and thus served as a negative control.Limited proteolytic digestion indicated the presence of two

major domains inNEIL1; theN-terminal domain spanning res-idues 1–311 and the C-terminal domain with residues 312–389(Fig. 2B). The C-terminal NEIL1 fragment comprising the 78 aawas then used as a probe, and it revealed binding to full-lengthas well as to the HlcRQC domain of WRN but not to the Hlcdomain of WRN (Fig. 2C). Taken together, these results con-firm our previous studies and indicate that WRN interacts viaits RQC domain with NEIL1.Stability of theWRN Interaction withNEIL1—The binding of

NEIL1 toWRN was analyzed from dose-dependent quenchingof intrinsic tryptophan fluorescence of the HlcRQC domain ofWRN by the NEIL1 probe of 78 aa, which lacks Trp or Tyr. Theemissionmaximum forWRNHlcRQCwas observed at 345 nmwith excitation at 295 nm (Fig. 3A). As expected, the 78-aapeptide has negligible fluorescence (Fig. 3A). Non-linearregression analysis using a ligand-receptor binding formula(“Experimental Procedures”) showed an apparent KD of 60 nM(Fig. 3B) for the binding of WRN interacting domain to NEIL1polypeptide, indicating a very high affinity. A comparable KDwas observed for the binding of full-length WRN to the NEIL1polypeptide (data not shown).Inhibition of WRN Activity by NEIL—The stable interaction

between NEIL1 and WRN raised the possibility of their abilityto modulate each other’s activity. We observed that NEIL1inhibited WRN helicase activity in a concentration-dependentmanner, with both bubble and forked duplex DNA substrates(Fig. 4A). The helicase activity of WRN was inhibited �40% by2-fold and nearly 80–90% by 10-fold molar excess of NEIL1

FIGURE 3. Determination of binding constant between NEIL1 and WRN. A, quenching of intrinsic trypto-phan fluorescence of HlcRQC domain of WRN by NEIL1. Examples (x to x�) of uncorrected emission spectra ofHlcRQC (0.25 �M in buffer A, pH 7.5 at 25 °C) alone and after incubation with increasing concentrations ofNEIL1p78 (0 – 0.25 �M). The lowest spectrum (y) is that of the 78-aa NEIL1 ligand alone in buffer. Inset, theRQC-NEIL1 interaction was analyzed by iterative fitting of the above experimental data (fluorescence intensityof HlcRQC plotted against NEIL1.p78 concentration) to the ligand binding equation (details under “Experimen-tal Procedures”). B, the binding isotherm was subsequently calculated using SigmaPlot by plotting the changein HlcRQC fluorescence intensity, �F or (F0 � F) versus concentration of the ligand, [NEIL1p78] according to theequation mentioned under “Experimental Procedures.”



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

(Fig. 4A, compare lanes 3 to 6 and 12to 16). NEIL1 also inhibited WRNexonuclease activity on a bubblesubstrate (Fig. 4B). A 2-fold molarexcess of NEIL1 inhibited WRNexonuclease activity �50% (Fig. 4B,compare lanes 2 to 6), which is sim-ilar to proteins previously shown toinhibit WRN catalytic activities,such as poly(ADP-ribose) polymer-ase 1 (29).Stimulation of NEIL1 Incision by

WRN and Its Effect on the KineticParameter—Initially, we tested theeffect ofWRNonNEIL1 glycosylaseactivity using DNA substrates con-taining 5-OHU as the oxidized base(shown in Table 1). A limitingamount of NEIL1 (20 fmol) wasused (2–5% product in the control)in the presence of increasing con-centrations of WRN. With the5-OHU-bubble substrate, NEIL1activity was reproducibly stimu-lated �2-fold with equimolar WRNconcentrations (Fig. 5A, lane 3).NEIL1 activity was enhanced a fur-ther 3- to 5-fold, with 2- to 3-foldmolar excess ofWRN (Fig. 5A, lanes4 and 5), after which a plateau wasreached. As expected, WRN has noglycosylase activity as indicated bythe lack of cleavage of substrate inthe absence of NEIL1.To further probe the mechanism

of NEIL1 stimulation by WRN, wemeasured kinetic parameters of theNEIL1 reaction in the presence ofWRN. The reaction rate (nanomo-lar/s) reached a plateau at 62.5 nMsubstrate concentration (data notshown). The incision reaction fol-lowed Michaelis-Menten kineticsfrom which the Km and kcat valueswere calculated (Table 2). Thekinetic parameter Km for NEIL1cleavage reaction was reduced

FIGURE 4. Inhibition of WRN helicase and exonuclease activities by NEIL1. A, reactions containing WRN (0.5nM) as indicated, in the absence or presence of NEIL1, were incubated with a bubble (Bubble 19, 1 nM, lanes 1–10)or forked (Mix 3/4, 1 nM, lanes 11–20) DNA substrate for 15 min at 37 °C. The concentrations of NEIL1 were 0.25nM (lanes 4 and 14), 0.5 nM (lanes 5 and 15), 1 nM (lanes 6 and 16), 2.5 nM (lanes 7 and 17), 5 nM (lanes 8 and18), and 12.5 nM (lanes 2, 9, 13, and 19). Lanes 1 and 11, substrate only. Lanes 10 and 20, heat-denaturedsubstrate. Reaction products were run on a 12% native gel and visualized using a PhosphorImager. %U,percentage of single-stranded product displaced. B, reactions containing WRN (1 nM) as indicated, in theabsence or presence of NEIL1, were incubated with a bubble substrate (Bubble 19, 1 nM) for 15 min at 37 °C.The concentrations of NEIL1 were 0.5 nM (lane 4), 1 nM (lane 5), 2 nM (lane 6), 5 nM (lane 7), 10 nM (lane 8), and25 nM (lanes 3 and 9). Lane 1, substrate only. Products were heat-denatured for 5 min at 95 °C, run on a 14%denaturing polyacrylamide gel, and visualized using a PhosphorImager. %D, percentage of substratedigested.

TABLE 1Oligonucleotides used in this study

Oligonucleotide Sequence (5�3 3�)a

B11(X) US GCTTAGCTTGGAATCGTATCATGTAXACTCGTGTGCCGTGTAGACCGTGCCB11(X) DS GGCACGGTCTACACGGCACAAACAGCCCACGGATACGATTCCAAGCTAAGCB12 (Y) US TGGCGTTCAACGTGCAGTYTCAGCACGTCCCATGGTB12 (Y) DS ACCATGGGACGTCACCCACACCACCGTTGAACGCCABub19T GCTTAGCTTGGAATCGTATCATGTAGACTCGTGTGCCGTGTAGACCGTGCCBub19B GGCACGGTCTACACGGACACAACACCCCACCACCCCGATTCCAAGCTAAGCMix3 TTTTTTTTTTTTTTTGAGTGTGGTGTACATGCACTACMix4 GTAGTGCATGTACACCACACTCTTTTTTTTTTTTTTT

a X � 5-OHU or 8-oxo-G; Y � FapyG; bold indicates non-complementary regions.



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

2-fold in the presence of WRN with the 5-OHU.B11 substrate,along with �6-fold increase in kcat. These results indicate thatWRN stimulates NEIL1 activity both by enhancing its affinityfor the damage-containing substrate (supplemental Fig. S1) andincreasing the Vmax or reaction rate. We confirmed that WRNstimulation ofNEIL1 is independent of the lesion type bymeas-uring NEIL1 activity with bubble substrates containing8-oxo-G and FapyG. Although less efficient than 5-OHU cleav-age (14), NEIL1 incision of the 8-oxo-G oligonucleotide, wasalso stimulated significantly by WRN (Fig. 5B, lanes 7 and 8).In addition FapyG was efficiently cleaved by NEIL1, and thecleavage activity was enhanced by the presence of WRN (Fig.5B, lanes 3 and 4). In our present studies we focused on theactivity of NEIL1 on FapyG, 5-OHU, and 8-oxo-G lesions pres-

ent in oligonucleotide substrates, because the sensitivity of theglycosylase assay with irradiated natural DNA containing lowlevels of multiple lesions is much less than with specific lesion-containing oligonucleotides (14).NEIL1 Stimulation Is Independent of WRN Helicase Acti-

vity—WRN stimulation of NEIL1 activity was ATP-independent,suggesting that the helicase activity is dispensable forNEIL1 stim-ulation. Our observation that the helicase-deficient WRN-K577M mutant (48, 49) stimulated NEIL1 supported thispossibility (supplemental Fig. S2). Furthermore, the recom-binant helicase domain (Hlc) by itself did not affect NEIL1activity (Fig. 5C, lanes 7 and 8), whereas recombinantHlcRQC stimulated NEIL1 3-fold (Fig. 5C, lanes 5 and 6).Furthermore, the GST-RQC domain alone was capable ofenhancing NEIL1 activity (Fig. 5C, lanes 3 and 4). Takentogether, these observations indicate that the RQC domainof WRN is necessary and sufficient for NEIL1 stimulation.Measurement of Oxidative Damage in NEIL1 and WRN

Knockdown Cells—Reactive oxygen species (ROS) generated asby-products of cellular respiration produce numerous base

FIGURE 5. Stimulation of glycosylase activity of NEIL1 by WRN. A, 10 pmol of substrate DNA (51-mer 5-OHU�B11) was incubated at 37 °C for 10 min eitherwith WRN (80 fmol, lane 1) or NEIL1 (20 fmol, lane 2) alone or with NEIL1 (20 fmol) with increasing amount of WRN (20, 40, 60, and 80 fmol; lanes 3– 6). B, inseparate assays, 36-mer FapyG�B12 (lanes 1– 4) and 51-mer 8-oxo-G�B11 (lanes 5– 8) were incubated with WRN alone, NEIL1 alone, or NEIL1 with 40 and 60 fmolof WRN, respectively. In all cases, graphical representation of the above results is depicted, showing averages of three experiments. C, 5-OHU�B11 wasincubated with NEIL1 alone (lane 2) or NEIL1 with 40 and 60 fmol each of Hlc (lanes 7 and 8), HlcRQC (lanes 5 and 6), and GST-RQC (lanes 3 and 4). In all cases,graphical representation of the above results is depicted, showing averages of three experiments (*, p � 0.01; **, p � 0.001).

TABLE 2Kinetic parameters

Reaction Km kcatnM �10�2/min

NEIL1 only 13.2 1.4 9.3 0.3NEIL1 plus WRN 6.8 0.8 57.5 1.6



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

modifications, including 8-oxo-G,5-OHU, thymine glycol, 2,6-dia-mino-4-hydroxy-5-formamidopyri-midine (FapyG), and 4,6-diamino-5-formamidopyrimidine (FapyA)(44). To probe the in vivo role ofWRN, we investigated the effect ofits down-regulation on the levelof oxidatively modified bases in thecell genome.We quantitated severalprototypical oxidized bases, namely8-oxo-G, FapyG, and FapyA, the lat-ter being well characterized sub-strates of NEIL1, in WT and WRNknockdown (KD) cells by using liq-uid chromatography/mass spec-trometry and gas chromatography/mass spectrometry analyses, respec-tively. We observed �50% higherlevels of 8-oxo-G in WRN KD cellscompared with WT cells (Fig. 6B,upper left panel) and also someincrease in FapyG levels (Fig. 6B,upper right panel). We went on toprobe the oxidative repair pathwayin which WRN seems to play animportant role. For this we knockeddown NEIL1 inWT as well asWRNKD cells using siRNA (Dharmacon)as described under “Experimen-tal Procedures,” whereby 80% ofNEIL1 expression was down-regu-lated (Fig. 6A). As expected, FapyGlevel was found to be significantlyelevated in NEIL1 single KD cells(Fig. 6B, bottom panel). Interest-ingly, a double knockdown of WRNwith NEIL1 did not reveal any addi-tional damage accrual (Fig. 6B, bot-tom panel) suggesting that WRNlies in the same repair pathway asNEIL1. A somewhat similar resultwas obtained when FapyA wasmeasured in NEIL1 and WRN KDcells (Fig. 6C). No difference in ROSproduction was observed as a resultof down-regulation of NEIL1 orWRN (data not shown). This con-firms that the difference in thelesion level did not result fromincreased ROS production in theknockdown cells.WRN Association with NEIL1 Is

Enhanced in Vivo by OxidativeStress—We next investigated wheth-er oxidative stress affects the in vivoassociation of WRN with NEIL1.HCT116 cells stably expressing



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

NEIL1-FLAGweremock treatedor treatedwitha subtoxicdoseofGO (100 ng/�l), which results in �2.5-fold increase in the ROSlevel (37). Co-immunoprecipitation analyses revealed greaterpull down ofWRNbyNEIL1-FLAG as a result of GO treatment(Fig. 7A). Microscopic analysis of intracellular distribution ofNEIL1 and WRN in mock and oxidatively stressed cells wasthen performed. WRN was previously shown to localize pri-marily in the nucleoli of human cells (50) and to relocalize in thenucleoplasm in response to genotoxic agents. In the case ofNEIL1, exposure of cells to ROS results in its accumulation inthe nucleus. Our results showed that in mock treated HCT116cells, NEIL1 was distributed both in cytoplasm and nuclei,whereas WRN was localized to the nucleolus, with a modestlevel of co-localization with NEIL1, the co-localization coeffi-cient being 0.11 0.9 from three independent experiments(data not shown). In oxidatively stressed cells, NEIL1 andWRNwere both accumulated in the nucleoplasm, as speckles/foci;superimposition of NEIL1 and WRN images showed a muchstronger co-localization (co-localization coefficient � 0.89 0.6)

(Fig. 7B). These results provide signif-icant support for the early recruit-ment ofWRN along with NEIL1 par-ticularly in response to oxidativestress-induced DNA damage.

DISCUSSION

Oxidative DNA base damage istypically repaired via the BER path-way. We had shown earlier thatthe mammalian DNA glycosylase,NEIL1, an ortholog of E. coli Nei/Fpg (14–16, 51) preferably excisesoxidative damage from single-stranded and bubble DNA sub-strates (19). Its substrates includea wide range of oxidatively dam-aged bases, including 5-OHU, thy-mine glycol, 8-oxo-G, FapyG, andFapyA (14, 51). Significant down-regulation of NEIL1 resulted inincreased sensitization of mouseembryonic fibroblasts to ionizingradiation (52), in comparison toOGG1- and NTH1-null cells (17,53). We also found up-regulationof hNEIL1 by oxidative stress (37),which underscored its role in pro-tecting cells from the genotoxiceffects of ROS. A recent reportindicates that NEIL1 null(Neil1�/�) mice accumulate mito-chondrial DNA damage and

develop dyslipidemia, obesity, diabetes, and fatty liver dis-ease (54). The pathogenesis of this metabolic syndromecould be partly attributed to ROS exposure (54, 55). Thesedata strongly suggest that NEIL1 is not simply a backup gly-cosylase for OGG1 and NTH1 but has a unique and signifi-cant function in vivo.In this report, we have documented physical and functional

interaction betweenNEIL1 andWRN, this being the first reportof the association of WRN with a DNA glycosylase of the BERpathway. The lack of association between WRN and OGG1,another glycosylase, underscores the specificity of WRN andNEIL1 binary interaction. We have shown here that the C-ter-minal RQC domain ofWRN, themajor DNA and protein bind-ing domain (56), is sufficient to mediate the interaction withNEIL1 and to stimulate oxidative base incision by NEIL1 in anATP-independent manner. Kinetic analyses of the NEIL1cleavage reaction for damage-containing substrates furtherdemonstrate that WRN increases the catalytic specificity of

FIGURE 6. Accumulation of oxidative damage in NEIL1- and WRN-depleted cells. In A: Upper panel, quantitative reverse transcription-PCR for detection ofNEIL1 down-regulation with ON-target SMARTpool siRNA (N pool), four individual ON-target siRNAs (N1–N4) as well as a scrambled siRNA (control) fromDharmacon. Lower panel, dose optimization of the individual siRNA N3 (40 and 80 nM) to down-regulate NEIL1 in WT U2-OS cells and WRN KD U2-OS cells.B, measurement of 8-oxo-G from WRN KD cells and FapyG lesions in genomic DNA from WRN knockdown (KD), NEIL1 KD as well as double KD cells. The valuespresented are mean S.D. The p values were calculated relative to values in WT cells; *, p � 0.01; #, p � 0.05. C, measurement of FapyA in genomic DNA fromWRN knockdown (KD), NEIL1 KD, as well as double KD cells. The values presented are mean S.D. *, p � 0.01; #, p � 0.05.

FIGURE 7. Enhanced association of WRN with NEIL1 following oxidative stress. A, FLAG-NEIL1 IP from cellextracts with or without GO treatment were tested for the presence of WRN. As before, the upper part of theblot was probed with WRN antibody and the lower half with anti-FLAG antibody to confirm the presence ofNEIL1. B, immunolocalization of NEIL1 and WRN in the presence and absence of oxidative stress. Upper leftpanel, nuclear accumulation of NEIL1 in GO-treated cells compared with mock treated cells. Upper right panel,WRN localized to nucleoli in non-stressed cells and to the nucleoplasm in stressed (GO-treated) cells. Lowerpanel, co-localization of NEIL1 with WRN in single cell nuclei of stressed cells. Details of con-focal imagingdepicted under “Experimental Procedures.”



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

NEIL1 by affecting the reaction rate at subsaturatingDNA con-centrations. Biochemical studies of ours and others haverevealed that the RQC domain of WRN mediates functionalinteractions with several members of the recombination andrepair pathways, including other BER proteins like pol �, FEN1,and PARP-1 (57). In the case of NEIL1, the interaction modulelies just downstreamof its zinc-less DNAbindingmotif harbor-ing the conservedArg-277 (58).WRNbinds toNEIL1with veryhigh affinity (KD � 60 nM) at nearly equimolar stoichiometry.

We have previously shown NEIL1 to be present at �30,000molecules/cell (59), whereas others have reported the concen-trations ofWRN to be an average of 60,000molecules/cell (60).Thus, the number of WRNmolecules/cell is �2-fold than thatof NEIL1, supporting that the activation of NEIL1 by WRNobserved in our studies is likely to be physiologically significant.Probing for the cellular roles of NEIL1 andWRN in response

to oxidative damage repair provided some interesting insights.WRN deficiency alone showed some increase in genomic Fapylevels (Fig. 6, B and C), which might be accounted for by a lackof stimulation of Fapy removal by the preferred glycosylaseNEIL1 or by dysfunction of a parallel repair pathway involvingWRN. The level of Fapys was elevated as predicted in NEIL1-depleted cells (Fig. 6, B and C). The lack of additive effect ofdepleting both WRN and NEIL1 could be explained by themodel that WRN is part of the NEIL1 repair complex. Deple-tion of WRN in cells also result in some accrual of the lesion8-oxo-G (Fig. 6B). OGG1 is the preferred glycosylase for8-oxo-G, although this lesion is also excised by NEIL1 to somedegree (18, 19). This excision activity is enhanced in presence ofWRN. Our previous work showed that NEIL1 influencesOGG1 turnover and improves the latter’s activity on8-oxo-G removal (18, 59). In the absence of any direct

collaboration between OGG1 andWRN, reduced levels of WRN inthe cell indirectly imply a lack ofstimulation of more efficient8-oxo-G removal by NEIL1.Finally, the cooperation between

NEIL1 andWRNduringDNAdam-age response signaling gained sup-port from our observation that oxi-dative stress enhanced the physicalassociation of these two proteins(Fig. 7A). One likely mechanism isenhanced affinity due to their cova-lent modifications (e.g. phosphoryl-ation, acetylation, monoubiquityla-tion, etc). Previous reports indicatethat WRN plays a role in the cellu-lar response to DNA damage, andits activity is possibly modulatedby DNA damage-induced acetyla-tion ofWRN and/or its interactingpartners (61). A similar oxidativechallenge of cells resulted ingreater spatial overlap or co-local-ization of NEIL1 and WRN as evi-denced from their foci formation

in the stressed cell nuclei (Fig. 7B).We had previously suggested a model wherebyWRN acts on

a late BER intermediate, formed after the action ofAPE1 (25). Inthe present modified model (Fig. 8), we propose recruitment ofWRN at a very early stage of damage recognition. The first stepof BER involves a lesion-specific component, NEIL1, a bifunc-tional DNA glycosylase/AP lyase that recognizes the oxidizedbase and recruits several repair-linked proteins includingWRN. WRN remains bound to NEIL1 at the damaged site andincreases damage removal byNEIL1.NEIL1 itself remains asso-ciated with the damaged DNA after it has performed its APlyase activity and might play a role in preventing unwantedunwinding byWRNat the nick. BecauseNEIL1 is involved in anAPE1-independent sub-pathway (18), polynucleotide kinasewould be the next downstream protein, which we could detectin the NEIL�WRN immunocomplex.3 Subsequently, pol � andlig III � come into play and at this stage the helicase activity ofWRN might be recruited to unwind the single-strand breaksand stimulate strand displacement DNA synthesis of pol� (27),completing repair by the short-patch (SP-BER) pathway. WRNalso may play a critical role by interacting with and stimulatingFEN1 activity in long-patch or LP-BER (26). Thus our model(Fig. 8) briefly illustrates involvement of WRN in the early aswell as late steps of BER via several parallel pathways that uti-lizes a hand-off mechanism for sequential recruitment of mul-tiple repair factors.While this reportwasbeingprepared therewasaparallel observationofNEIL1 interactionwith the9-1-1 complex(66). It will be interesting in the future to probe themechanism bywhichNEIL1orWRNswitches theirpartners in response to signalfrom oxidative/genotoxic stress within the cell.

3 Das, A., and Bohr, V. A., unpublished observation.

FIGURE 8. A model of the proposed role of WRN in BER. Model depicts early recruitment of WRN in thedamage-sensing step in association with NEIL1 BER complex. In addition, involvement of WRN is shown inparallel SP-BER pathways in association with APE1 and in LP-BER involving FEN1. Details are given under“Discussion.”



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

The distinct feature of NEIL1 compared with other glyco-sylases in utilizing bubble and forked substrates (19) implicatesNEIL1 in the repair of DNA in actively transcribed regions ofthe genome. Thus, the role of the WRN�NEIL1 complex in therepair of oxidative damage may be associated with particularregions of the genome such as open chromatin regions. It istempting to speculate as to the role of WRN in BER especiallyunder certain metabolic conditions (such as during replicationor transcription), and this specificity can account for the lack ofprominent general BER defects at the global level (globalgenome repair) in WS cell extracts.4Previous reports show abnormal sensitivity to the ROS-pro-

ducing agent, hydrogen peroxide, in WS cells and in WRN-knockdown MRC-5 normal fibroblasts using the Comet assay(62). Recently, it was shown that growth in physiological (3%)oxygen or in the presence of an antioxidant prevented the for-mation of the DNA damage foci in WRN-depleted cells,whereas acute oxidative stress led to inefficient repair of thelesions (63). These results strongly suggest that DNA lesionsarising due to ROS or other oxidative damage cannot be fullyrepaired by WRN-independent mechanisms. Again, redoxabnormalities in WS cells and WS patients suggest that a defi-ciency in WRNmay be a basis for the in vivo pro-oxidant state(64), which causes oxidative damage to biomolecules and mul-tiple oxidative stress-related alterations. This report is the firstdemonstration of a direct involvement ofWRN in the damage-sensing pathway that is initiated by the oxidative base specificenzyme, NEIL1. Earlier studies suggested that NEIL1 activa-tion by ROS is part of a coordinated cellular response to theadditional load of oxidative DNA damage both in the nucleusand mitochondria. How the functional association of NEIL1with WRN modulates this response in the context of globalgenome repair and also in aging pathologies warrants furtherinvestigation.

Acknowledgments—We thank Drs. Miral Dizdaroglu and PawelJaruga of the National Institute of Standards and Technology (Gaith-ersburg, MD) for the measurement of 8-oxo-dG by liquid chromatog-raphy/mass spectrometry and FapyG and FapyA by gas chromatog-raphy/mass spectrometry. We thank Dr. James C. Lee, and R. A.Maillard, Sealy Center for Structural Biology, University of TexasMedical Branch, Galveston for helping with the intrinsic fluorescencestudies. We thank Dr. Tadahide Izumi, Louisana State University,NewOrleans for binding isotherm calculations and other helpful sug-gestions.We acknowledgeDr. DavidWilson III andDr. Kishor Bhakatfor critically reviewing the manuscript.

REFERENCES1. Ames, B. N., Shigenaga, M. K., and Hagen, T. M. (1993) Proc. Natl. Acad.

Sci. U. S. A. 90, 7915–79222. Breen, A. P., and Murphy, J. A. (1995) Free Radic. Biol. Med. 18,

1033–10773. Gotz, M. E., Kunig, G., Riederer, P., and Youdim, M. B. (1994) Pharmacol.

Ther. 63, 37–1224. Lovell, M. A., Xie, C., and Markesbery, W. R. (2000) Brain Res. 855,

116–1235. Krokan, H. E., Nilsen, H., Skorpen, F., Otterlei, M., and Slupphaug, G.

(2000) FEBS Lett. 476, 73–776. Mitra, S., Hazra, T. K., Roy, R., Ikeda, S., Biswas, T., Lock, J., Boldogh, I.,

and Izumi, T. (1997)Mol. Cells 7, 305–3127. Wilson, S. H., and Kunkel, T. A. (2000) Nat. Struct. Biol. 7, 176–1788. Fortini, P., Pascucci, B., Parlanti, E., Sobol, R. W., Wilson, S. H., and

Dogliotti, E. (1998) Biochemistry 37, 3575–35809. Matsumoto, Y., and Kim, K. (1995) Science 269, 699–70210. Sobol, R. W., Prasad, R., Evenski, A., Baker, A., Yang, X. P., Horton, J. K.,

and Wilson, S. H. (2000) Nature 405, 807–81011. Liu, Y., Beard,W.A., Shock,D.D., Prasad, R., Hou, E.W., andWilson, S.H.

(2005) J. Biol. Chem. 280, 3665–367412. Sattler, U., Frit, P., Salles, B., and Calsou, P. (2003) EMBO Rep. 4, 363–36713. Bandaru, V., Sunkara, S., Wallace, S. S., and Bond, J. P. (2002)DNA Repair

(Amst.) 1, 517–52914. Hazra, T. K., Izumi, T., Boldogh, I., Imhoff, B., Kow, Y. W., Jaruga, P.,

Dizdaroglu, M., and Mitra, S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99,3523–3528

15. Hazra, T. K., Kow, Y. W., Hatahet, Z., Imhoff, B., Boldogh, I., Mokkapati,S. K., Mitra, S., and Izumi, T. (2002) J. Biol. Chem. 277, 30417–30420

16. Morland, I., Rolseth, V., Luna, L., Rognes, T., Bjoras, M., and Seeberg, E.(2002) Nucleic Acids Res. 30, 4926–4936

17. Takao, M., Kanno, S., Shiromoto, T., Hasegawa, R., Ide, H., Ikeda, S.,Sarker, A. H., Seki, S., Xing, J. Z., Le, X. C., Weinfeld, M., Kobayashi, K.,Miyazaki, J., Muijtjens, M., Hoeijmakers, J. H., van der Horst, G., andYasui, A. (2002) EMBO J. 21, 3486–3493

18. Wiederhold, L., Leppard, J. B., Kedar, P., Karimi-Busheri, F., Rasouli-Nia,A., Weinfeld, M., Tomkinson, A. E., Izumi, T., Prasad, R., Wilson, S. H.,Mitra, S., and Hazra, T. K. (2004)Mol. Cell 15, 209–220

19. Dou, H., Mitra, S., and Hazra, T. K. (2003) J. Biol. Chem. 278,49679–49684

20. Brosh, R. M., Jr., and Bohr, V. A. (2002) Exp. Gerontol. 37, 491–50621. Martin, G. M. (1997) Philos. Trans. R Soc. Lond. B Biol. Sci. 352,

1773–178022. Martin, G. M., Austad, S. N., and Johnson, T. E. (1996) Nat. Genet. 13,

25–3423. Opresko, P. L., Cheng, W. H., von Kobbe, C., Harrigan, J. A., and Bohr,

V. A. (2003) Carcinogenesis 24, 791–80224. Ozgenc, A., and Loeb, L. A. (2005)Mutat. Res. 577, 237–25125. Ahn, B., Harrigan, J. A., Indig, F. E., Wilson, D. M., 3rd, and Bohr, V. A.

(2004) J. Biol. Chem. 279, 53465–5347426. Brosh, R. M., Jr., von Kobbe, C., Sommers, J. A., Karmakar, P., Opresko,

P. L., Piotrowski, J., Dianova, I., Dianov, G. L., and Bohr, V. A. (2001)EMBO J. 20, 5791–5801

27. Harrigan, J. A., Opresko, P. L., von Kobbe, C., Kedar, P. S., Prasad, R.,Wilson, S. H., and Bohr, V. A. (2003) J. Biol. Chem. 278, 22686–22695

28. von Kobbe, C., Harrigan, J. A., May, A., Opresko, P. L., Dawut, L., Cheng,W. H., and Bohr, V. A. (2003)Mol. Cell. Biol. 23, 8601–8613

29. von Kobbe, C., Harrigan, J. A., Schreiber, V., Stiegler, P., Piotrowski, J.,Dawut, L., and Bohr, V. A. (2004) Nucleic Acids Res. 32, 4003–4014

30. Gebhart, E., Bauer, R., Raub, U., Schinzel, M., Ruprecht, K. W., and Jonas,J. B. (1988) Hum. Genet. 80, 135–139

31. Ogburn, C. E., Oshima, J., Poot, M., Chen, R., Hunt, K. E., Gollahon, K. A.,Rabinovitch, P. S., and Martin, G. M. (1997) Hum. Genet. 101, 121–125

32. Saintigny, Y., Makienko, K., Swanson, C., Emond, M. J., andMonnat, R. J.,Jr. (2002)Mol. Cell. Biol. 22, 6971–6978

33. Yannone, S. M., Roy, S., Chan, D. W., Murphy, M. B., Huang, S., Campisi,J., and Chen, D. J. (2001) J. Biol. Chem. 276, 38242–38248

34. Harrigan, J. A., Wilson, D. M., 3rd, Prasad, R., Opresko, P. L., Beck, G.,May, A., Wilson, S. H., and Bohr, V. A. (2006) Nucleic Acids Res. 34,745–754

35. von Kobbe, C., Thoma, N. H., Czyzewski, B. K., Pavletich, N. P., and Bohr,V. A. (2003) J. Biol. Chem. 278, 52997–53006

36. Bhakat, K. K., Mokkapati, S. K., Boldogh, I., Hazra, T. K., and Mitra, S.(2006)Mol. Cell. Biol. 26, 1654–1665

37. Das, A., Hazra, T. K., Boldogh, I., Mitra, S., and Bhakat, K. K. (2005) J. Biol.Chem. 280, 35272–35280

38. Leppard, J. B., Dong, Z., Mackey, Z. B., and Tomkinson, A. E. (2003)Mol.Cell. Biol. 23, 5919–59274 Dianov, G., and Bohr, V. A., unpublished observation.



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

39. Nada, S., Chang, P. K., and Dignam, J. D. (1993) J. Biol. Chem. 268,7660–7667

40. Jayaraman, L.,Moorthy, N. C.,Murthy, K. G.,Manley, J. L., Bustin,M., andPrives, C. (1998) Genes Dev. 12, 462–472

41. Dziewulska-Szwajkowska, D., Zmojdzian, M., Dobryszycki, P., Kochman,M., and Dzugaj, A. (2004) Comp. Biochem. Physiol. B Biochem. Mol. Biol.137, 115–129

42. Kumar, A., and Rao, M. (2006) Biochim. Biophys. Acta 1760, 1845–185643. Haraguchi, K., and Greenberg, M. M. (2001) J. Am. Chem. Soc. 123,

8636–863744. Hu, J., de Souza-Pinto, N. C., Haraguchi, K., Hogue, B. A., Jaruga, P.,

Greenberg, M. M., Dizdaroglu, M., and Bohr, V. A. (2005) J. Biol. Chem.280, 40544–40551

45. Jaruga, P., Speina, E., Gackowski, D., Tudek, B., and Olinski, R. (2000)Nucleic Acids Res. 28, E16

46. Boschman, G. A., Rens,W.,Manders, E.M., Slater, R.M., Versteeg, R., andAten, J. A. (1992) Genes Chromosomes Cancer 5, 375–384

47. Puri, N., Kruhlak, M. J., Whiteheart, S. W., and Roche, P. A. (2003) J. Im-munol. 171, 5345–5352

48. Gray, M. D., Shen, J. C., Kamath-Loeb, A. S., Blank, A., Sopher, B. L.,Martin, G. M., Oshima, J., and Loeb, L. A. (1997)Nat. Genet. 17, 100–103

49. Brosh, R. M., Jr., Orren, D. K., Nehlin, J. O., Ravn, P. H., Kenny, M. K.,Machwe, A., and Bohr, V. A. (1999) J. Biol. Chem. 274, 18341–18350

50. Gray, M. D., Wang, L., Youssoufian, H., Martin, G. M., and Oshima, J.(1998) Exp. Cell Res. 242, 487–494

51. Takao, M., Kanno, S., Kobayashi, K., Zhang, Q. M., Yonei, S., van derHorst, G. T., and Yasui, A. (2002) J. Biol. Chem. 277, 42205–42213

52. Rosenquist, T. A., Zaika, E., Fernandes, A. S., Zharkov, D. O., Miller, H.,and Grollman, A. P. (2003) DNA Repair (Amst.) 2, 581–591

53. Klungland, A., Rosewell, I., Hollenbach, S., Larsen, E., Daly, G., Epe, B.,

Seeberg, E., Lindahl, T., and Barnes, D. E. (1999) Proc. Natl. Acad. Sci.U. S. A. 96, 13300–13305

54. Vartanian, V., Lowell, B., Minko, I. G., Wood, T. G., Ceci, J. D., George, S.,Ballinger, S. W., Corless, C. L., McCullough, A. K., and Lloyd, R. S. (2006)Proc. Natl. Acad. Sci. U. S. A. 103, 1864–1869

55. Beckman, M. (2006) Sci. Aging Knowledge Environ. nf656. Hu, J. S., Feng, H., Zeng, W., Lin, G. X., and Xi, X. G. (2005) Proc. Natl.

Acad. Sci. U. S. A. 102, 18379–1838457. Lee, J.W., Harrigan, J., Opresko, P. L., and Bohr, V. A. (2005)Mech. Ageing

Dev. 126, 79–8658. Doublie, S., Bandaru, V., Bond, J. P., and Wallace, S. S. (2004) Proc. Natl.

Acad. Sci. U. S. A. 101, 10284–1028959. Mokkapati, S. K., Wiederhold, L., Hazra, T. K., and Mitra, S. (2004) Bio-

chemistry 43, 11596–1160460. Moser,M. J., Kamath-Loeb, A. S., Jacob, J. E., Bennett, S. E., Oshima, J., and

Monnat, R. J., Jr. (2000) Nucleic Acids Res. 28, 648–65461. Blander, G., Zalle, N., Daniely, Y., Taplick, J., Gray, M. D., and Oren, M.

(2002) J. Biol. Chem. 277, 50934–5094062. Von Kobbe, C., May, A., Grandori, C., and Bohr, V. A. (2004) FASEB J. 18,

1970–197263. Szekely, A. M., Bleichert, F., Numann, A., Van Komen, S., Manasanch, E.,

Ben Nasr, A., Canaan, A., andWeissman, S. M. (2005)Mol. Cell. Biol. 25,10492–10506

64. Pagano, G., Zatterale, A., Degan, P., d’Ischia ,M., Kelly, F. J., Pallardo, F. V.,and Kodama, S. (2005) Biogerontology 6, 233–243

65. Lee, J. W., Kusumoto, R., Doherty, K. M., Lin, G. X., Zeng, W., Cheng,W. H., von Kobbe, C., Brosh, R. M., Jr., Hu, J. S., and Bohr, V. A. (2005)J. Biol. Chem. 280, 39627–39636

66. Guan, X., Bai, H., Shi, G., Theriot, C. A., Hazra, T. K., Mitra, S., and Lu,A. L. (2007) Nucleic Acids. Res. 35, 2463–2472



at University of T

exas Medical B


ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org

The Human Werner Syndrome Protein Stimulates Repair of Oxidative DNA Base Damage by the DNA...

Documents

Transcript of The Human Werner Syndrome Protein Stimulates Repair of Oxidative DNA Base Damage by the DNA...