The Evolutionarily Conserved Tetratrico Peptide Repeat Protein Pale Yellow Green7 Is Required for...

1

The evolutionary conserved TPR protein Pyg7 is required for

photosystem I accumulation in Arabidopsis thaliana

and co-purifies with the complex

Jana Stöckel, Stefan Bennewitz, Paul Hein and Ralf Oelmüller

Institut für Allgemeine Botanik und Pflanzenphys iologie, Friedrich-Schiller-

Universität Jena, Dornburger Str. 159, 07747 Jena, Germany

Running title: Pyg7 is required for photosystem I biogenesis

Key words: Arabidopsis thaliana, positional cloning, photosynthesis , photosystem I

assembly, TPR proteins

Correspondance: Ralf Oelmüller Institut für Allgemeine Botanik und Pflanzenphysiologie Friedrich-Schiller-Universität Jena Dornburger Str. 159 07747 Jena phone: 49-3641-949-231 fax: 49-3641-949-232 email: [email protected] word count: 6891

Plant Physiology Preview. Published on May 5, 2006, as DOI:10.1104/pp.106.078147

Copyright 2006 by the American Society of Plant Biologists

www.plantphysiol.org on September 17, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/

http://www.plantphysiol.org

2

Pyg7 -1 (pale yellow green) is a photosystem I-deficient Arabidopsis mutant.

Photosystem I subunits are synthesized in the mutant but do not assemble into a

stable complex. In contrast, light-harvesting antenna proteins of both photosystems

accumulate in the mutant. Deletion of Pyg7 results in severely reduced growth rates,

alterations in leaf coloration and plastid ultrastructure. Pyg7 was isolated by map-

based cloning and encodes a TPR protein with homolog y to Ycf37 from Synechocystis

(Wilde et al., 2001). The protein is localized in the chloroplast, associated with

thylakoid membranes and co-purifies with photosystem I. An independent pyg7 T-

DNA insertion line pyg7-2 exhibits the same phenotype. pyg7 gene expression is light-

regulated. Comparison of the roles of Ycf37 in cyanobacteria and Pyg7 in higher

plants suggests that the ancient protein has altered it function during the evolution.

While the cyanobacterial protein mediates more efficient photosystem I

accumulation, the higher pl ant protein is absolutely required for complex assembly or

maintenance.




3

Plants are of fundamental importance to maintain life on earth because they supply

oxygen and energy during photosynthesis. The basic processes of light capturing are

organised into two multiprotein complexes, the photosystems I and II. Both complexes are

present in pro- and eukaryotic organisms and composed of approximately the same

proteins and co-factors. Ult imately, light energy is converted into a proton gradient across

the photosynthetic membrane which gives rise to the synthesis of ATP, and drives an

electron flow through the thylakoid me mbrane. Among the two photosynthetic complexes,

photosystem I (PSI) is the most conserved mu ltiprotein complex in all photosynthetic

organisms (Pakrasi, 1995; Chitnis, 2001, Scheller et al., 2001). The molecular mechanism

of PSI biogenesis is still enigmatic, although possible scenarios have been proposed in

numerous reviews (Pakrasi, 1995; Schwabe and Kruip, 2000; Chitnis, 2001, Scheller et al.,

2001). In recent years several regulatory factors for PSI biosynthesis have been identified

which are conserved in pro- and eukaryotic organisms (Wilde et al., 1995; Bartsevich and

Pakrasi, 1997; Boudreau et al., 1997; Ruf et al., 1997; Mann et al., 2000; Naver et al.,

2001; Wilde et al., 2001; Shen et al., 2002a, 2002b; Lezhneva et al., 2004; Stöckel and

Oelmüller, 2004). This implies a strong conservation in the organisation, biogenesis,

structure and dynamics of pro- and eukaryotic PSI. The initial step in PSI biogenesis is the

formation of the reaction centre consisting of the heterodimer PsaA/B. The formation of

this complex is thought to depend on proper and in-time delivery of all associated co-

factors including iron, sulfur, heme, etc.

Although many structural and regulatory proteins for PSI are evolutionary conserved and

already present in cyanobacteria, a more detailed analyses uncovered that some of these

compounds also differ in function. For instance, while PsaC stabilizes the reaction centre

of eukaryotic PSI and is absolutely required for its function, the cyanobacterial complex is

also functional without PsaC (Takahashi et al., 1991; Yu et al., 1995). Differences between

pro- and eukaryotic PSI complexes become even more apparent, when the roles of

individual regulatory factors are considered. BtpA, for instance, a factor identified for

prokaryotes PSI biogenesis, is not present in eukaryotes (Bartsevich and Pakrasi, 1997).

Here we demonstrate that deletion of a homologous protein with regulat ory function can

have different consequences for PSI assembly in pro - and eukaryotes. Inactivation of Pyg7

in the higher plant Arabidopsis completely abolishes photoautotrophic growth. In contrast,

inactivation of ycf37, the homologous genes in Synechocystis, allows still photoautotrophic

growth of the cells , although they are severely impaired in photosynthetic activity and PSI

accumulation (Wilde et al., 2001). This implies that the interplay between the regulatory




4

factors and PSI complex formation has changed during evolution, presumably because the

role of the regulatory factor became more specialized or stringent.




5

RESULTS

The recessive pyg7-1 mutant was generated by ethylmethansulfonate mutagenesis.

When grown on soil, homozygous mutant seedlings are lethal. After germination they

developed pale yellow green (pyg) cotyledons, but no primary leaves. The mutant can only

be propagated heterotrophically. Even though grown on sucrose supplemented media

pyg7-1 plants reveal a significantly reduced growth rate and display yellowish leaf

pigmentation. Furthermore, the leaves are thinner and almost transparent compared to the

wild type (Fig. 1). Under UV light the pyg7-1 mutant exhibits an high-chlorophyll-

fluorescence phenotype. The Chl content of the mutant grown under high light conditions

(100 µmol m-2 s-1) was decreased by 95 (±1)% and under low light (5 µE m-2 s-1)

conditions by 91 (±1)%, indicating a minor light-dependent photosensitivity of the mutant.

Of the two pyg7 alleles (pyg7-1 and pyg7-2) available (cf. Fig. 1 and see below), pyg7-1

was used for detailed analyses.

Wild type and pyg7-1 plants grown under axenic conditions were analysed for P700

absorbance changes, 77K emission and Chl a fluorescence. The mutant pyg7-1 did not

show any detectable absorbance changes of P700 at 810 nm indicating that PSI is not

functional (data not shown). 77K fluorescence spectra were recorded to examine the

distribution of excitation energy in the mutant pyg7-1 and wild type. The emission band at

731.1 ± 0.5 nm in the wild type, characteristic for a functional PSI, was shifted to 727.8 ±

0.8 nm in the mutant (Fig. 2). This blue-shift indicates that the amount of the various Lhca

components relative to each other is changed. Western analyses revealed that the Lhca1, 2

and 4 proteins are only slightly reduced in the mutant while Lhca3 is reduced by more than

80% (cf. Fig. 5B). These data are consistent with the idea that the impairment in pyg7-1 is

likely to be caused by lesions in those PSI proteins that are directly involved in electron

transfer. The smaller blue shift in pyg7-1 compared to other PSI deficient mutants (Haldrup

et al., 2000; Lezhneva et al., 2004; Stöckel and Oelmüller, 2004) might be caused by the

severe reduction of Lhca3 antenna protein of PSI.

No significant shift in the emission bands at 682.4 ± 1.2 nm were observed indicating that

the residual amount of PSII is functional in the mutant.

No photochemical quenching (qP) could be measured in pyg7-1 (data not shown).

The Chl a fluorescence parameter Fv/Fm describes the maximum efficiency of PSII




6

photochemistry which correlates with the number of functional reaction centers (Öquist et

al., 1992). The reduced value of Fv/Fm in the mutant 0.33 ± 0.08 vs. 0.78 ± 0.03 in the

wild type might be caused by secondary effects since pyg7-1 does not show any detectable

absorbance changes of P700 at 810 nm. Because of the non functional PSI, the

photosynthetic electron transport is blocked and PSII remains the major target of excessive

light. This has also been reported for other PSI specific mutants as well as mutants

impaired in the Cytb6/f complex and the ATP synthase (Maiwald et al., 2003; Stöckel and

Oelmüller, 2004). In several cases, this results in the downregualtion of PSII (cf. Stöckel

and Oelmüller, 2004, Hein and Oelmüller, unpublished). Taken together, these data

indicate that the mutation primarily affects the electron transport through PSI.

Lack of PSI in pyg7-1 is accompanied by changes in the plastid ultrastructure (Fig.

3). In low light, only a few lamellae and no assimilatory starch can be detected in pyg7-1.

In high light, the membrane structure in the mutant plastids is less organized (data not

shown).

Northern analysis of pyg7 -1 plants using representative probes for nuclear and plastid

encoded PSI, PSII and Cytb6/f-complex subunits as well as rbcL revealed that the

expression and transcript accumulation are not affected in the mutant (Fig. 4). Immunoblot

analyses of thylakoid proteins uncovered that none of the PSI subunits PsaA, PsaC, PsaD,

PsaF, PsaL and PsaH were detectable in pyg7-1 (Fig. 5A). This was independent of the

light intensity in which the seedlings were grown (data not shown). The significant

decrease in the level of D1, the reaction center protein of PSII, in the mutant might be

caused by an enhanced destabilization due to increased photoinhibition in pyg7-1 plants in

higher light intensities. The subunits PsbS and PsbO of PSII, subunit IV and Cytb6 of the

Cytb6/f complex as well as AtpB of the ATP synthase accumulate in comparable amounts

in wild type and pyg7-1 (Fig. 5A).

In organello labeling experiments of wild type and pyg7-1 chloroplast proteins with 35S-methionine (Fig. 6) demonstrates that all major thylakoid proteins are synthesized in

the mutant. This indicates that accelerated degradation rather than a block in protein

synthesis is responsible for the absence of PSI reaction center polypeptides in pyg7-1.

Gelöscht: :

Gelöscht: The accumulation of plastoglobuli in high-light grown pyg7-1 suggests that the seedlings suffer from light stress (cf. Palatnik et al., 2003).




7

Although PsaA and PsbA are synthesized in the mutant (Fig. 6), PsaA (and other

PSI subunits) were never detectable in Western studies. In contrast PsbA accumulates in a

light intensity dependent manner. Thus, the decrease in the steady state PsbA protein level

under high light in pyg7-1 might be caused by photoinhibition. Since the Fv/Fm values

increases in the mutant during recovery after photodamage (data not shown), PsbA

synthesis appears to be normal in the mutant.

The gene pyg7 has been mapped on chromosome 1 using SSLP and CAPS markers

(cf. Material and Methods). Finally, CAPS markers CAT3, F19G10-VII and the SSLP

marker CIW12 (Lukowitz et al., 2000) were chosen for high resolution mapping of 1338 F2

individuals deriving from backcrosses to the ecotype Ler. The two markers CAT3 and

F19G10-VII enclose the mutant locus with 24 and 4 recombinations, respectively. The

appearance of the pyg7 phenotype was examined by segregation analysis of the following

progeny. The CAPS markers F19G10-VII and m235 could localize the mutation on the

Bac clone T22J18 with 4 and 7 recombination events, respectively. Database searches and

sequence analyses of amplified DNA regions from pyg7-1 uncovered that the mutation is

located in At1g22700. The gene contains 5 exons and 4 introns. The mutant sequence

contains a single G to A exchange at position 621 of the coding region which leads to a

conversion of a tryptophan to a stop codon of the resulting protein in the mutant pyg7-1.

RT-PCR analyses uncovered that the pyg7 mRNA level is low in etiolated material and

increases approximately 8-fold upon transfer of the seedlings to light (Fig. 7).

The open reading frame of pyg7 encodes a polypeptide of 296 amino acids with a

predicted molecular mass of 33.7 kDa. Analysis of the N-terminal sequence using the

prediction programs ChloroP (Emanuelsson et al., 1999) and TargetP (Nielsen et al., 1997;

Emanuelsson et al., 2000) revealed a putative plastid-directing transit sequence of 61

amino acids. Thus, the predicted mature protein possesses an estimated molecular weight

of 26.8 kDa.

Analysis of the primary sequence of Pyg7 revealed high homology to the

cyanobacterial Ycf37 from Synechocystis (Wilde et al., 2001) and contains three TPR

(tetratrico peptide repeat) motifs. An antiserum was raised against a Pyg7 peptide (cf.

Material and Methods). It detects a polypeptide with an apparent molecular weight of

approximately 27 kDa in the thylakoid membrane fraction of wild type leaf extracts. No




8

protein was detected in the mutant. Antisera against the reaction center protein PsaA of PSI

and the reaction center subunit PsbA of PSII were used as a control (Fig. 8A). The antisera

also detect a polypeptide of the expected molecular mass in protein extracts from wild-type

Synechocystis cells, which was not present in extracts from the mutant Ycf37 (data not

shown, cf. below). Immunoblot analyses of soluble and membrane fractions from Percoll-

purified chloroplasts revealed that Pyg7 is associated with the thylakoid membranes of

isolated chloroplasts (Fig 8B). The localisation of Pyg7 was further studied in a sucrose

gradient, in which the two photosystems were separated after solubilization with Triton X-

100 (cf. Material and Methods). Figure 9 demonstrates that the highest amount of Pyg7 is

found in the fractions which contain the PSI reaction center (represented by PsaA and

Lhca1). The very same distribution of Pyg7 in the sucrose gradient fractions was

confirmed by mass spectrometry.

To confirm that the mutated gene is responsible for the observed phenotype, we

analysed an independent knock-out line N807379 (cf. Material and Methods). Chl a

fluorescence induction data of pyg7-2 resembled that of pyg7-1. PCR and sequence

analyses with the homozygous knock-out plants confirmed the information available in the

Databases. No PSI activity, PsaA and Pyg7 proteins were detected in pyg7-2 (data not

shown, cf. Fig. 1).

Gelöscht: Interestingly, >80% coverage of the mature Pyg7 protein could be detected in the PSI fraction suggesting that the protein is present in relatively high amounts (data not shown).




9

DISCUSSION

Several regulatory proteins involved in PSI biogenesis of higher plants,

Chlamydomonas and Synechocystis have been isolated and characterised (Wilde et al.,

1995; Bartsevich and Pakrasi, 1997; Boudreau et al., 1997; Ruf et al., 1997; Mann et al.,

2000; Naver et al., 2001; Wilde et al., 2001; Shen et al., 2002a; 2002b; Lezhneva et al.,

2004; Stöckel and Oelmüller, 2004). Pyg7, a TPR protein, is a novel membrane-bound

regulator of PSI which represents the homolog of the cyanobacterial Ycf37 (Wilde et al.,

2001). Immunological studies with antisera raised against a conserved Pyg7 polypeptide

from Arabidopsis revealed that the TPR proteins Pyg7 and Ycf37 do not accumulate in the

higher plant and cyanobacterial mutants. Both organisms are impaired in PSI activity, but

differ substantially in that ycf37-deficient Synechocystis cells can grow

photoautotrophically and accumulate a functional PSI complex, while the higher plant

mutant is lethal and lacks PSI completely.

Chl a fluorescence measurements demonstrate that the ratio of variable to

maximum fluorescence (Fv/Fm) is considerably reduced in the mutant. The increase in QA

reduction further indicates that the electron flow downstream of PSII is blocked.

Determination of absorbance changes of P700 at 810 nm revealed that PSI in pyg7-1 is not

functional. Western analysis confirmed that essential subunits of the reaction center are

either absent or severely reduced in pyg7-1 (Fig. 5) and the corresponding knock-out line

pyg7-2. Furthermore, the blue-shift in the 77K fluorescence emission spectrum of the

mutant (Fig. 2) is in agreement with the notion that the transfer of excitation energy from

Lhca1/Lhca4 to the PSI reaction center P700 is impaired. A similar blue -shift was also

reported for plants lacking PsaF (Haldrup et al., 2000) and for hcf101, another PSI

deficient mutant (Lezhneva et al., 2004; Stöckel and Oelmüller, 2004). The fluorescence

data are consistent with the observation that the Lhca1, 2 and 4 proteins are still detectable

in the mutant although they cannot be associated with PSI. Interestingly, Lhca3 which is

located adjacent to PsaK (Jansson et al., 1996; Ben-Shem et al., 2003) is severely reduced

in the mutant. Finally, the loss of PSI in pyg7-1 has strong effects on the organisation of

the thylakoid membrane (Fig. 3). Stacking of the grana thylakoids is comparable to wild

type while stroma thylakoids are barely detectable. Like other photosynthetic mutants




10

pyg7-1 does not accumulate assimilatory starch (Fig. 3; Haldrup et al., 2000; Lezhneva et

al., 2004; Stöckel and Oelmüller, 2004; Amann et al., 2004).

Inactivation of pyg7 leads to PSI deficiency and to the inability of the mutant to

grow photoautotrophically. Since transcripts for representative plastid and nuclear encoded

subunits of PSI reaction center are present in wild type amounts in the mutant, it is unlikely

that Pyg7 plays a role in transcription and/or transcript accumulation (Fig. 4). Furthermore,

in organello labeling experiments of thylakoid proteins revealed that major subunits of PSI

reaction center are synthesized in pyg7-1 (Fig. 6). Because we could isolate only a limited

number of plastids from homozygote mutant seedlings, pulse-chase experiments gave no

reasonable results. However, we could demonstrate that the radiolabel disappears much

more rapidly from PsaA in the pyg7-1 plastids compare to wild-type plastids after transfer

of the isolated organelles to radioactive -free medium (data not shown). The prediction of a

plastid transit peptide suggests that Pyg7 is a chloroplast protein. This was confirmed by

cell fractionation and immunoblot analyses as well as mass spectrometrical analyses of

thylakoid subfraction (cf. Fig. 8). Pyg7 is a membrane-bound protein and associated with

PSI, further supporting the idea that the protein affects the stable accumulation of the PSI

complex rather than being involved in transcriptional or posttranscriptional processes (cf.

Figs. 4, 5 and 8). Western analyses and mass spectrometrical analyses demonstrate that

Pyg7 is present in substantial amounts in purified PSI fractions (cf. Fig. 9). Pyg7 might be

required for the assembly and/or stabilization of the complex. The protein can affect the

stability of the PSI core subunits, or the availability and/or binding of any of the co-factors

to these subunits, or the assembly of the subunits or of the cofactors into a functional PSI

complex. The presence of three TPR motifs in the C-terminal part of the protein suggests

that this region might be involved in protein/protein interactions with other PSI subunits.

The three TPR motifs are already present in the cyanobacterial ycf37 protein and they

exhibit the highest degree of sequence conservation to the eukaryotic protein. It remains to

be determined whether the cyanobacterial Ycf37 is also associated with PSI reaction

center. Ycf3, another regulator of PSI which interacts with PsaA and PsaD in

Chlamydomonas (Naver et al., 2001) contains also three TPR motifs. Boudreau et al.

(1997) have shown that ycf3 is only loosely associated with PSI. Thus, the role of the TRP

sequences for PSI association needs to be analysed in more details.

Gelöscht: s




11

Pyg7 is of ancient phylogenetic origin and its homolog Ycf37 from Synechocystis is

already required for proper PSI accumulation. However there is a remarkable difference in

the function of both proteins: cyanobacteria can still grow photoautotrophically in the

absence of Ycf37, also the reduced PSI/PSII ratio and the higher phycobilin/chlorophyll

ratio suggests a function of Ycf37 in PSI stability or assembly (Wilde et al., 2001).

Inactivation of the higher plant Pyg7 results in the complete loss of PSI. A similar

evolutionary shift in function has been observed for another protein pair involved in PSI

accumulation, Hcf101 from higher plants (Lezhneva et al., 2004; Stöckel and Oelmüller,

2004) and Slr0067 from Synechocystis (Stöckel, unpublished). This indicates that proteins

which have accessory functions in cyanobacteria develop to crucial regulators in higher

plant chloroplasts. The ycf37/pyg7 genes provide an interesting system to investigate this

hypothesis, since homologous genes are also present in the cyanelle of Cyanophora

paradoxa, the plastids of Cyanidium caldarium, Porphyra purpurea and Guilliardia theka.

In the green algae Chlamydomonas rheinhardtii and higher plants, the gene was transferred

to the nucleus.




12

MATERIAL AND METHODS

Growth conditions and plant material

Arabidopsis thaliana seedlings were grown in growth chambers under continuous

whit e light and a light intensity of 5 and 100 :mol m-2 s-1 at 22°C, respectively. For

physiological experiments seeds were sterilized with 33% (v/v) bleach and 0.08% N-

laurylsarcrosinate, washed four times with 1 ml of sterile distilled water and placed on

Petri dishes with solidified 1/2 strength MS media (Murashige and Skoog, 1962)

supplemented with 1.35% (w/v) sucrose. To ensure synchronised germination, the plates

were kept in darkness at 4°C for the first 48 h. Pyg7-1 is an EMS induced mutant. The T-

DNA insertion line N807379 named pyg7-2 was obtained from NASC stock center,

Nottingham, Great Britain (Sessions et al., 2002). Segregation and sequencing analyses

using the primer pairs (5’- TGTTACATAACCGGGTTGCAG-3’; 5’-

TGTTTCTGCTTGAGGTTTAGATTG-3’) confirmed that the pale yellow green

phenotype of the mutant is caused by a T-DNA insertion in exon 3 (363 nt downstream of

the ATG codon) of At1g22700.

PAM101/PDA-100- and P700 absorbance measurements

In vivo Chl a measurements were performed with 18-day-old Arabidopsis seedlings

using the pulse amplitude modulated fluorometer PAM101 equipped with a PAM-Data-

Acquisition System (PDA-100, Walz, Effeltrich, Germany). Prior to measurements the

fiber optic of the emitter/detector unit (101-ED) was positioned closely to the upper

surface of the plants, which were dark adapted for 7 min before the minimal fluorescence

Fo was recorded. A saturating white light pulse of 6000 µmol m-2 s-1 for 600 ms was used

to determine the maximal fluorescence Fm and the Fv/Fm ratio. After 1 min, actinic red

light (650 nm, 40 µmol m-2 s-1) emitted from a photodiode (102-L) was turned on and the

fluorescence parameter Fm’ of illuminated leaves was determined by the application of

saturating flashes every 30 s until a stable fluorescence level (Ft) was reached.

Subsequently the actinic light was switched off to determine the minimal fluorescence Fo’

in the light adapted state. The fluorescence quenching parameter qP (photochemical

quenching) was calculated as qP = (Fm’ - Ft)/(Fm’ – Fo). The quantum yield of PSII




13

(ΦPSII) was calculated as ΦPSII = (Fm’ – Ft)/Fm’ and the non-photochemical quenching

parameter as NPQ = (Fm – Fm’)/Fm’.

The light induced in vivo absorbance changes of P700 at 810 nm were measured using the

PAM101/PDA-100 fluorometer connected to a dual-wavelength emitter/detector unit (ED

P700DW). Saturating far-red light (730 nm, 15 Wm-2) emitted by a far-red diode (102-FR)

for 1 min was applied to oxidize P700. After 30 s of far-red light a strong white light pulse

of 6000 µmol m-2 s-1 was applied for 400 ms. The maximum signal difference (∆A810max)

between the reduced and the oxidized states of P700 was used to estimate the photochemical

capacity of PSI (Barth and Krause, 2002).

77K measurements

Fluorescence spectra at 77K were recorded using a FluoroMax-2 fluorometer (Jobin

Ivon, Longjumaeu, France). The excitation was set at 420 ± 10 nm and the spectra were

measured over 650–750 nm to reveal fluorescence emitted from PSII and PSI. Leaf tissue

of 18-day-old plant material was homogenized in 2 ml RB buffer (50 mM MES -NaOH pH

6.0, 10 mM MgCl2, 5 mM CaCl2, 25% glycerol) and immediately used for recording

spectra.

Photoinhibitory measurements

Mutant and wild type Arabidopsis seedlings were illuminated with a photon fluxes

density of 1800 µmol m–2 s–1 for 1.5 h before transfer to 20 µmol m–2 s–1 for subsequent

recovery. The photoinhibition was assayed by calculating the ratio of maximum to variable

fluorescence (Fv/Fm) as a measure of the maximal photochemical efficiency of PSII. The

room temperature chlorophyll fluorescence of 15 min dark adapted plants was performed

using the Fluorocam (Photon Systems Instruments, Brno, Czech Republic).

Antisera and immunoblot analyses

The Anti-Pyg7 antibodies were raised against the N-NKV ARP RRD ALK DRV K-

C peptide (Eurogentec, Belgium). For immunoblot analyses a dilution of 1:500 were used.

The PsbA, PsbS, Lhcb1, 2, 5 and 6 antibodies were obtained from Agrisera (Upsala,




14

Sweden). All other antibodies have been described previously (Stöckel and Oelmüller,

2004).

In organello radiolabeling of proteins

Translational active chloroplasts from 18-day-old mutant and wild type seedlings

were purified on a Percoll gradient and resuspended in reaction buffer (330 mM sorbitol,

50 mM Hepes-KOH pH 8.0, 10 mM d ithiothreitol and 100 µg/ml PMSF) according to van

Wijk et al., (1995). For labelling 107 chloroplasts were used. The chloroplasts were pre-

incubated in reaction buffer containing 5 µM aminoacid mixture without methionine and

10 µM Mg-ATP for 10 min under 50 µmol m-2 s-1 at 23°C prior adding of 5 µCi 35S-

methionine. The reaction was stopped by adding 20 volumes of ice cold lysis buffer (7 mM

magnesium acetate, 118 mM potassium acetate and 46 mM Hepes-KOH, pH 7.6) after 7.5

min. After centrifugation at 10,000 rpm (SS34, Sorvall) total membranes were washed

twice with lysis buffer and resuspended in HS-buffer (330 mM sorbitol, 50 mM Hepes-

KOH, pH 8.0). The radioactive incorporation of methionine was measured using a

scintilation counter (Beckmann, Palo Alto).

Isolation of chloroplasts, soluble plastid proteins, thylakoid membranes and

photosystem I

Chloroplasts for immunolocalisation analyses were isolated from 18-day-old plants.

The chloroplast enriched fraction was purified on a Percoll gradient. Intact chlo roplasts

were washed twice with isolation-medium (0.3 M sorbitol, 5 mM MgCl2, 5 mM EGTA, 5

mM Na2EDTA, 20 mM Hepes -KOH, pH 8.0 and 10 mM NaHCO3) and disrupted in

breaking-buffer (50 mM Hepes-KOH, pH 8.0, 10 mM MgCl2). The stromal and membrane

fractions were separated by centrifugation at 10,000 rpm (SS34, Sorvall) for 20 min. The

soluble proteins from the supernatant were precipitated with trichloroacetic acid and

resuspended in 100 mM Na2CO3, 10% (w/v) sucrose and 50 mM dithiothreitol. The

membrane proteins in the pellet were resuspended in breaking-buffer.

Separation of PSI and PSII occurred by sucrose-gradient centrifugation. A crude thylakoid

membrane preparation was obtained from isolated plastids. Plastids were resuspended in

10 mM Tris-HCl, pH 8.0, 5 mM KCl, 3 mM MgCl2, 2 mM MnCl2, and stirred on ice for 2

h. The chlorophyll concentration was adjusted to 1.05 mg/ml, and the photosynthetic




15

complexes were partially solublized at 4°C for 50 min in the presence of 400 mM

(NH4)2SO4, 30 mM octyl-ß-D-glucopyranoside and 0.45% sodium cholate. The

photosynthetic complexes were collected by high speed centrifugation (49,000 rpm, Ti45

rotor, Beckman, 2 h, 4°C) and the pellet was resuspended in 10 mM Tris HCl, pH 8.0, 3

mM MgCl2, 2 mM MnCl2, 2% Triton X-100. After adjustment of the chlorophyll

concentration to 1.5 mg/ml, the two photosystems were solubilized by stirring on ice for 50

min. The suspension was clarified by centrifugation (20,000 rpm, Sorvall, 20 min) and 500

:l aliquots loaded onto a linear sucrose gradient (10 ml, 5-28%, centrifugation: 26 h for

39,000 rpm, SW40 rotor, Beckman). The gradient was fractionated and aliquots of the

fractions used for mass spectrometry or sodium dodecyl-sulfate (SDS) -polyacrymamide

gel electrophoresis (Schägger and Jagow, 1987).

Positional cloning of pyg7-1

A segregating F2 progeny was generated by crosses of male pollen donor plants of

heterozygous lines of pyg7-1 in Columbia (Col) background with female recipient plants of

ecotype Landsberg (Ler), followed by selfing of the resulting F1 plants. To assign the

mutant locus to one of the Arabidopsis chromosomes 30 F2 plants homozygous for the

mutant pyg7 locus as well as a combination of simple sequence length polymorphisms

(SSLP): nga248, nga280, nga111, nga168, nga162, nga8, nga6, nga76, nga151 (Bell and

Ecker, 1994) and cleaved amplified polymorphic sequence (CAPS) markers: PhyB and AG

(www.arabidopsis.org) were used. For high resolution mapping genomic DNA from single

leaves of 1338 individual F2 plants was isolated. The SSLP marker: nga248, SO392 (Bell

and Ecker, 1994), CIW12 (Lukowitz et al., 2000), m235 and CAPS markers CAT3

(www.arabidopsis.org) as well as the newly developed marker F19G10-VII (5’-

AGTTGGTCCTCGAGCTCTCC -3’ and 5’-GCTGCTTAAGAATGCGCAGC-3’) were

used for fine mapping procedures.

RT-PCR and Northern blot analyses

RNA for greening experiments were isolated from 7-day-old etiolated seedlings, 7-

day-old etiolated seedlings illuminated for 4, 10, 24 or 72 h as well as green seedlings

illuminated for 7 days with continuous white light of 100 µmol m-2 s-1 using TRIZOL

Reagent (Invitrogen) according to the manufactures instructions. RT-PCR reactions were




16

performed with the RT-PCR kit (RevertAid™ First Strand cDNA Synthesis Kit,

Fermentas) using the following primer pairs 5’- AGGCTTCCACAGTTTTGGTTT -3’ and

5’- CCCAAACATCTGACTGCATTT -3’ for psaA, 5’-

CAAGACTCTCCTCACAGAAC-3’ and 5’-CTCTGAACCAAGAACCGTTG-3’ for

pyg7, 5’-GCTGATGTCTATGGTCCAAGTCTACC-3’ and 5’-

CAATTACCGCTGCTGTCAATGGCGC-3’ for hcf101. Actin-2 (5’-

GGTAACATTGTGCTCAGTGGTGG-3’, 5’- CTCGGCCTTGGAGATCCACATC-3’)

was used as a control (Robinson et al., 1999). For the reverse transcription reactions 1 µg

mRNA, 0.5 µg oligo dT primers as well as 2 units M-MULV reverse transcriptase were

used to synthesize cDNA. In the subsequent PCR reactions under standard conditions gene

specific primers for pyg7, hcf101 psaA and for actin -2 with 25 and 23 cycles of replication,

respectively, were used. The resulting PCR fragments were separated on 1 % agarose gels.

Genomic DNA and a PCR reaction without template served as a control.

For Northern analysis, total RNA from 18-day-old wild type and mutant plants was

isolated according to Heim et al. (1993). Northern blot analyses were performed as

previously described (Heim et al., 1993). The following primer pairs were used to produce

the appropriate probes: 5´-GATGGCGATGTCAAGTGG-3´ and 5´-

GCTTCATCTATATCCGCGTG-3´ for PetC, 5´-AATCTCCTCTGTATCCCC-3´ and 5´-

TTTCCTTGCCAACAGGTC-3´ for PetH, 5 -́AGGCTTCCACAGTTTTGGTTT-3´ and

5´-CCCAAACATCTGACTGCATTT-3´ for psaA, 5´-GGATGTACTCAATGTGTCCG-3´

and 5 -́AGCTAGACCCATACTTCGAG-3´ for psaC, 5´-ATGGCAACTCAAGCCG-3´

and 5´-CTCTTCCTGGATTCGCTTTC-3´ for PsaD, 5 -́ATTCATTGCTGCTCCTCC-3´

and 5´-GCCCGAATCTGTAACCTTC-3´ for psbA, 5´-CTGCTTCGAGCCTACTTCCTT-

3´ and 5´-GCAGTGTTCTTCACGTTCTCC-3´ for PsbO, 5´-

GCGTATGTAGCTTATCCC-3´ and 5 -́TCCCCCTGTTAAGTAGTC-3´ for rbcL as well

as 5´ -AACCCCGACTTATGGAAG-3´ and 5´-TAAGACCAGGAGCGTATC-3´ for the

18S rRNA gene. For hybridisation the probes were labelled with 32P CTP by random

priming.

Electron microscopy

Electron micrographs were performed as previously described (Kusnetsov et al.,

1994).




17

Mass spectrometry

Aliquots of the eluted protein fractions and excised protein bands from SDS gels

were used for mass spectrometry. Trypsin digestion of protein mixtures, in-gel trypsin

digestion of excised protein bands and elution of the peptides from the gel matrix was

performed according to Sherameti et al. (2004). Peptide analysis by coupling liquid

chromatography with electrospray ionization mass spectrometry (ESI-MS) and tandem

mass spectrometry (MS-MS) was described previously (Sherameti et al., 2004; Stauber et

al., 2003).

Protein identification

The measured MS-MS spectra were matched with the amino-acid sequences of

tryptic peptides from the A. thaliana database in FASTA format. Raw MS-MS data were

analysed by the Finnigan Sequest/Turbo Sequest software (revision 3.0; ThermoQuest, San

Jose, USA). The parameters for the analysis by the Sequest algorithm were set according to

Stauber et al. (2003). The similarity between the measured MS-MS spectrum and the

theoretical MS-MS spectrum, reported as the cross-correlation factor (Xcorr) was equal or

above 1.5, 2.5 and 3.5 for singly, doubly or triply charged precursor ions, respectively. In

order to identify corresponding loci, identified protein sequences were subjected to BLAST

search at NCBI (http://www.ncbi.nlm.nih.gov/) and FASTA searches by using the AGI

protein database at TAIR (http://www.arabidopsis.org/). Identification of conserved

domains and signal peptides was performed by using SMART (Ponting et al., 1999).




18

ACKNOWLEDGEMENTS

Work was supported by the Friedrich -Schiller-University, Jena. We like to thank

Dr. M. Hippler for PsaA and PsaD antibodies, Dr. R. B. Klösgen for PsbO antibodies, Dr.

W. Fischer for electron microscopy, and Dr. A. Wilde for the Synechocystis Ycf37 strain..

We thank H. Becker for skillful technical assistance. The SAIL insertion line N807379 was

obtained from the NASC stock center at Nottingham (England). The nucleot ide sequence

of pyg7 is identical to At1g22700 deposited in the EMBL database.




19

LITERATURE CITED

Amann K, Lezhneva L, Wanner G, Herrmann RG, Meurer J (2004)

ACCUMULATION OF PHOTOSYSTEM ONE1, a member of a novel gene family, is

required for accumulation of [4Fe-4S] cluster-containing chloroplast complexes and

antenna proteins. Plant Cell 16: 3084-3097

Barth C, Krause GH (2002) Study of tobacco transformants to assess the role of

chloroplastic NAD(P)H dehydrogenase in photoprotection of photosystems I and II. Planta

216: 273-279

Bartsevich VV, Pakrasi HB (1997) Molecular identification of a novel protein that

regulates biogenesis of photosystem I, a membrane protein complex. J Biol Chem 272:

6382-6387

Bell CJ, Ecker JR (1994) Assignment of 30 microsatellite loci to the linkage map of

Arabidopsis. Assignment Genomics 19: 137-144

Ben-Shem A, Frolow F, Nelson N (2003) Crystal structure of plant photosystem I. Nature

426: 630-635

Boudreau E, Takahashi Y, Lemieux C, Turmel M, Rochaix JD (1997) The chloroplast

ycf3 and ycf4 open reading frames of Chlamydomonas reinhardtii are required for the

accumulation of the photosystem I complex. EMBO J 16: 6095-6104

Chitnis PR (2001) Photosystem I: Function and Physiology. Annu Rev Plant Physiol Plant

Mol Biol 52: 593-626

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular

localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300:

1005-1016

Emanuelsson O, Nielsen H, von Heijne G (1999) ChloroP, a neural network-based

method for predicting chloroplast transit peptides and their cleavage sites. Prot Sci 8: 978-

984

Haldrup A, Simpson DJ, Scheller HV (2000) Down-regulation of the PSI-F subunit of

photosystem I (PSI) in Arabidopsis thaliana. The PSI-F subunit is essential for

photoautotrophic growth and contributes to antenna function. J Biol Chem 275: 31211-

31218.




20

Heim U, Weber H, Baumlein H, Wobus U (1993) A sucrose-synthase gene of Vicia faba

L.: expression pattern in developing seeds in relation to starch synthesis and metabolic

regulation. Planta 191: 394-401

Jansson S, Andersen B, Scheller HV (1996) Nearest-neighbor analysis of higher-plant

photosystem I holocomplex. Plant Physiol 112: 409-420

Kusnetsov VV, Oelmüller R, Sarwat MI, Porfirova SA, Cherepneva GN, Herrmann

RG, Kulaeva ON (1994) Cytokinins, abscisic acid and light affect accumulation of

chloroplast proteins in Lupinus luteus cotyledons without notable effect on steady-state

mRNA levels. Specific protein response to light/phytohormone interaction. Planta 194:

318-327

Lezhneva L, Amann K, Meurer J (2004) The universally conserved HCF101 protein is

involved in assembly of [4Fe-4S]-cluster-containing complexes in Arabidopsis thaliana

chloroplasts. Plant J 37:174-185

Lukowitz W, Gillmor CS, Scheible WR (2000) Positional cloning in Arabidopsis. Why it

feels good to have a genome initiative working for you. Plant Physiol 123: 795-805

Maiwald D, Dietzmann A, Jahns P, Pesares P, Joliot P, Joliot A, Levin JZ, Salamini

F, Leister D (2003) Knock-out of the genes coding for the Rieske protein and the ATP-

synthase delta-subunit of Arabidopsis. Effects on photosynthesis, thylakoid protein

composition, and nuclear chloroplast gene expression. Plant Physiol 133: 191-202

Mann NH, Novac N, Mullineaux CW, Newman J, Bailey S, Robinson C (2000)

Involvement of an FtsH homologue in the assembly of functional photosystem I in the

cyanobacterium Synechocystis sp. PCC 6803. FEBS Lett 479: 72-77

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with

tobacco tissue cultures. Physiol Plant 15: 473-497

Naver H, Boudreau E, Rochaix JD (2001) Functional studies of Ycf3: its role in

assembly of photosystem I and interactions with some of its subunits. Plant Cell 13: 1-17

Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic

and eukaryotic signal peptides and prediction of their cleavage sites. Prot Eng 10: 1-6

Öquist G, Chow WS, Anderson JM (1992) Photoinhibition of photosynthesis represents

a mechanism for the long-term regulation of photosystem II. Planta 186: 450-460

Pakrasi HB (1995) Genetic analysis of the form and function of photosystem I and

photosystem II. Annu Rev Genet 29: 755-776




21

Ponting CP, Schultz J, Milpetz F, Bork P (1999) SMART: identification and annotation

of domains from signalling and extracellular protein sequences. Nucleic Acids Res 27:

229-232

Robinson NJ, Procter CM, Connolly EL, Guerinot ML (1999) A ferric -chelate

reductase for iron uptake from soils. Nature 397: 694 - 697

Ruf S, Kössel H, Bock R (1997) Targeted inactivation of a tobacco intron-containing open

reading frame reveals a novel chloroplast-encoded photosystem I-related gene. J Cell Biol

139: 95-102

Schägger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel

electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal

Biochem 166: 368 - 379

Scheller HV, Jensen PE, Haldrup A, Lunde C, Knoetzel J (2001) Role of subunits in

eukaryotic Photosystem I. Biochim Biophys Acta 1507: 41-60

Schwabe TM, Kruip J (2000) Biogenesis and assembly of photosystem I. Indian J

Biochem Biophys 37: 351-359

Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P,

Bacwaden J, Ko C, Clarke JD, Cotton D, Bullis D, Snell J, Miguel T, Hutchison D,

Kimmerly B, Mitzel T, Katagiri F, Glazebrook J, Law M, Goff SA (2002) A high-

throughput Arabidopsis reverse genetics system. Plant Cell 14: 2985-2994

Shen G, Antonkine ML, van der Est A, Vassiliev IR, Brettel K, Bittl R, Zech SG,

Zhao J, Stehlik D, Bryant DA, Golbeck JH (2002b) Assembly of photosystem I. II.

Rubredoxin is required for the in vivo assembly of F(X) in Synechococcus sp. PCC 7002

as shown by optical and EPR spectroscopy. J Biol Chem 277: 20355-20366

Shen G, Zhao J, Reimer SK, Antonkine ML, Cai Q, Weiland SM, Golbeck JH,

Bryant DA (2002a) Assembly of photosystem I. I. Inactivation of the rubA gene encoding

a membrane-associated rubredoxin in the cyanobacterium Synechococcus sp. PCC 7002

causes a loss of photosystem I activity. J Biol Chem 277: 20343-20354

Sherameti I, Shahollari B, Landsberger M, Westermann M, Cherepneva G,

Kusnetsov V, Oelmüller R (2004) Cytokinin stimulates polyribosome loading of nuclear-

encoded mRNAs for the plastid ATP synthase in etioplasts of Lupinus luteus: the complex

accumulates in the inner-envelope membrane with the CF(1) moiety located towards the

stromal space. Plant J 38: 578-593

Gelöscht: Palatnik JF, Tognetti VB, Poli HO, Rodriguez RE, Blanco N, Gattuso M, Hajirezaei MR, Sonnewald U, Valle EM, Carrillo N (2003) Transgenic tobacco plants expressing antisense ferredoxin-NADP(H) reductase transcripts display increased susceptibility to photo-oxidative damage. Plant J 35: 332-341¶




22

Stauber EJ, Fink A, Markert C, Kruse O, Johanningmeier U, Hippler M (2003)

Proteomics of Chlamydomonas reinhardtii light-harvesting proteins. Eukaryotic Cell 2:

978-994

Stöckel J, Oelmüller R (2004) A novel protein for photosystem I biogenesis. J Biol Chem

279: 10243-10251

Takahashi Y, Goldschmidt-Clermont M, Soen SY, Franzen LG, Rochaix JD (1991)

Directed chloroplast transformation in Chlamydomonas reinhardtii: insertional inactivation

of the psaC gene encoding the iron sulfur protein destabilizes photosystem I. EMBO J 10:

2033-2040

van Wijk KJ, Bingsmark S, Aro EM, Andersson B (1995) In vitro synthesis and

assembly of photosystem II core proteins. The D1 protein can be incorporated into

photosystem II in isolated chloroplasts and thylakoids. J Biol Chem 270: 25685-25695

Wilde A, Härtel H, Hübschmann T, Hoffmann P, Shestakov SV, Börner T (1995)

Inactivation of a Synechocystis sp strain PCC 6803 gene with homology to conserved

chloroplast open reading frame 184 increases the photosystem II-to-photosystem I ratio.

Plant Cell 7: 649-658

Wilde A, Lünser K, Ossenbühl F, Nickelsen J, Börner T (2001) Characterization of the

cyanobacterial ycf37: mutation decreases the photosystem I content. Biochem J 357: 211-

216

Yu J, Smart LB, Jung YS, Golbeck J, McIntosh L (1995) Absence of PsaC subunit

allows assembly of photosystem I core but prevents the binding of PsaD and PsaE in

Synechocystis sp. PCC6803. Plant Mol Biol 29: 331-342




23

Figure legends

Figure 1: Wild type (WT), pyg7-1 and pyg7-2 phenotypes of 18-day old seedlings grown

under high light (100 µmol m-2 s-1; A) or low light (5 µmol m-2 s-1; B).

Figure 2: 77K fluorescence emission spectra for wild type (WT) and mutant pyg7-1 leaves

of Arabidopsis thaliana. Spectra for wild type leaves (solid line) and pyg7-1 leaves

(dashed line) were recorded using homogenized leaf material. Chlorophyll was excited at

420 ± 10 nm. Data were normalised to the PSII emission peak at 682 nm. The figure is

representative for spectra of at least five extracts from 18-day old wild type and pyg7-1

leaves of seedlings grown under low light (5 µmol m-2 s-1).

Figure 3: Electron micrographs of chloroplasts from wild type (WT) and pyg7-1 leaves.

Plants were grown under low light (5 µmol m-2 s-1).

Figure 4: Northern blot analysis for psaA/B, psaC, PsaD, PsaF and PsaL as representative

transcripts for PSI, psbA, PsbO for PSII, PetC (Rieske iron sulfur protein of the

cytochrome b6/f complex), PetH (ferredoxin-NADPH-oxidoreductase) and rbcL (large

subunit of ribulose-1,5-bisphosphate carboxylase) with total RNA from 18-day-old wild

type (WT) and pyg7-1 seedlings. Lanes were loaded with 15 µg (WT, pyg7-1), 7.5 µg

(WT/2) or 3.75 µg (WT/4) RNA per lane. Plants were grown under high light (100µmol m-

2 s-1).

Figure 5: Immunoblot analyses of thylakoid protein extracts from wild type (WT) and

pyg7-1 with antisera raised against the polypeptides indicated on the right side. 15 µg (WT,

pyg7), 7.5 µg (WT/2), 5 µg (WT/4) or 2.5 µg (WT/8) of total membrane protein was

loaded per lane. Plants were grown under high light (100µmol m-2 s-1).

Figure 6: Pattern of 35S-radiolabeled plastome-encoded membrane proteins from 18-day-

old wild type and pyg7-1 chloroplast proteins. Labeling occurred for 7.5 mins. 60000 cpm

for wild type (WT) and pyg7-1 proteins were loaded on a 15% SDS-polyacrymamide gel.

The positions of PsaA/B (subunits A and B of PSI) and PsbA (D1 protein of PSII reaction

center) are indicated. The proteins were identified by Western blot analyses. Plants were

grown under high light (100µmol m-2 s-1).




24

Figure 7: Light induced transcript accumulation of pyg7, hcf101 (14) and psaA from 12-

day-old etiolated (dark), or light-grown (light , 100µmol m-2 s-1) Arabidopsis seedlings or

etiolated seedlings which were illuminated for 4, 10, 24 or 72 h. Amplification of actin

cDNA was used as an internal control. Relative pyg7 mRNA levels, based on 3

independent experiments: Dark: 1.0±0.1; 4 h light: 4.7±0.2; 10 h light: 5.7±0.3; 24 h light:

5.8 ± 0.4; 72 h light: 8.1±0.5; continuous light: 8.0±0.3.

Figure 8: Immunoblot analyses of Pyg7 in comparison to Hcf101, PsbA and PsaA. (A)

Thylakoid membrane extracts from 18-day-old wild type and pyg7-1 seedlings grown in

high light (100µmol m-2 s-1) were analysed with antibodies against Pyg7, PsbA and PsaA,

the soluble protein fractions were tested with Hcf101 antibodies (Stöckel and Oelmüller,

2004). (B) Percoll-purified chloroplasts from 18-day-old wild type seedlings (Chl) were

separated into thylakoid (Thy) and stroma fractions (Str) and analysed with antibodies

against Pyg7, Hcf101, PsbA and PsaA, respectively. 20 µg protein was loaded per lane.

Figure 9: Sucrose density gradient centrifugation of 2% Triton X-100-solubilized PSII and

PSI complexes. Prior to loading on a 5-28% linear sucrose gradient the two sedimented

photosystems (cf. Material and Methods) were adjusted to 1.5 mg/ml chlorophyll and

solubilized by 2% Triton for 50 min. Sucrose gradients were centrifugated for 26 h at

39.000 rpm and fractionated from top to bottom into 15 equal fractions. Equal volumes of

each fraction was loaded on a SDS-polyacrylamide gel and investigated by immunoblot

analyses with antibodies against PsaA, Lhca1, Pyg7 and PsbA.




25

Figure 1




26

Figure 2




27

Figure 3

WT

pyg 7-1 0.15 µm

0. 4 µm




28

Figure 4




29

Figure 5




30

Figure 6




31

Figure 7




32

Figure 8




33

Figure 9




The Evolutionarily Conserved Tetratrico Peptide Repeat Protein Pale Yellow Green7 Is Required for...

Documents

Transcript of The Evolutionarily Conserved Tetratrico Peptide Repeat Protein Pale Yellow Green7 Is Required for...