The early stages of the immune response of the European abaloneHaliotis tuberculata to a Vibrio harveyi infectionMarion Cardinaud a,*, Nolwenn M. Dheilly b, Sylvain Huchette c, Dario Moraga a,Christine Paillard a,**a UMR 6539-LEMAR (Laboratoire des Sciences de l’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Université de BretagneOccidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280 Plouzané, Franceb School of Marine and Atmospheric Sciences, Stonybrook University, Stony Brook, NY 11794-5000 USAc France Haliotis, Kerazan, Lilia, 29880 Plouguerneau, France

A R T I C L E I N F O

Article history:Received 14 November 2014Revised 25 February 2015Accepted 26 February 2015Available online

Keywords:Abalone immune responseGene expressionPathogen quantificationFlow cytometryVibrio harveyi

A B S T R A C T

Vibrio harveyi is a marine bacterial pathogen responsible for episodic abalone mortalities in France, Japanand Australia. In the European abalone, V. harveyi invades the circulatory system in a few hours afterexposure and is lethal after 2 days of infection. In this study, we investigated the responses of Europeanabalone immune cells over the first 24 h of infection. Results revealed an initial induction of immunegene expression including Rel/NF-kB, Mpeg and Clathrin. It is rapidly followed by a significant immuno-suppression characterized by reduced cellular hemocyte parameters, immune response gene expressionsand enzymatic activities. Interestingly, Ferritin was overexpressed after 24 h of infection suggesting thatabalone attempt to counter V. harveyi infection using soluble effectors. Immune function alteration waspositively correlated with V. harveyi concentration. This study provides the evidence that V. harveyi hasa hemolytic activity and an immuno-suppressive effect in the European abalone.

© 2015 Elsevier Ltd. All rights reserved.

1. Introduction

Vibriosis is the most common disease caused by pathogenic bac-teria in halophilic environment and affects a large panel of organismssuch as humans, fishes and marine invertebrates. In humans, vib-riosis is usually associated with an exposure or absorption ofcontaminated water or with a zoonosis process, and the regularsymptoms are gastroenteritis, tissue lesions and septicemia (Austin,2010). In marine organisms, several pathogenic Vibrio species areresponsible for serious losses in natural populations or in aquacul-ture stocks. Vibrio pathogens have various virulence strategies inmarine invertebrates and may invade their hosts through differ-ent ways and at different stages of the life cycle. It has been notablydescribed that Vibrio parahaemolyticus and Vibrio harveyi target, re-spectively, the digestive tractus of the neritid gastropod Clithon

retropictus and the cultured juveniles of the shrimp Penaeus monodonor larvae of the lobster Jasus verreauxi (Diggles et al., 2000; Kumazawaand Mine, 2001; Leaño et al., 1998). Vibrio pathogens may also gen-erate epidermal ulcerations and hemocytic inflammation, causingthe necrosis of diverse tissues, as observed in cultured oysterCrassostrea gigas infected by Vibrio splendidus (Sugumar et al., 1998),in cultured cuttlefishes from the genus Sepia infected by Vibrioalginolyticus (Sangster and Smolowitz, 2003), in the wild octopusOctopus vulgaris infected by Vibrio lentus (Farto et al., 2003), and incultured post-larvae of the penaeid shrimp P. monodon infected byV. harveyi (Soonthornchai et al., 2010). Moreover, they may inducea repression effect on immune function via an alteration of cellu-lar capacities or molecular effector synthesis, as described in theManila clam Ruditapes philippinarum infected by Vibrio tapetis, andin the shrimp Litopenaeus vannamei following a V. alginolyticus in-jection (Allam and Ford, 2006; Allam et al., 2006; Brulle et al., 2012;Li et al., 2008). Interestingly, a significant immunosuppression, in-cluding the downexpression of antimicrobial synthesis, has also beenobserved in the coral Pocillopora damicornis infected by Vibriocoralliilyticus (Vidal-Dupiol et al., 2014) .

The European abalone hemolymph is constituted for a high ma-jority by a single differentiated cell population, assimilated tohyalinocyte-type cells, which present remarkable adhesion and ag-gregation capacities – 56% of the cells adhere within 15 min to thesubstratum, and assume immune function (Travers et al., 2008b).The remaining circulating cells are undifferentiated blast cells.

* Corresponding author. UMR 6539-LEMAR (Laboratoire des Sciences del’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Universitéde Bretagne Occidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280Plouzané, France. Tel.: + 33 6 71 13 80 77; fax: +33 2 98 49 86 45.

E-mail address: marion.cardinaud@gmail.com (M. Cardinaud).** Corresponding author. UMR 6539-LEMAR (Laboratoire des Sciences de

l’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Universitéde Bretagne Occidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280Plouzané, France. Tel.: + 33 2 98 45 86 50; fax: +33 2 98 49 86 45.

E-mail address: christine.paillard@univ-brest.fr (C. Paillard).

http://dx.doi.org/10.1016/j.dci.2015.02.0190145-305X/© 2015 Elsevier Ltd. All rights reserved.

Developmental and Comparative Immunology ■■ (2015) ■■–■■

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

journal homepage: www.elsevier.com/ locate /dc i

Hyalinocytes assume abalone immunity through the phagocytosisof foreign particles and the synthetization of a panel of soluble ef-fectors (Hooper et al., 2007; Travers et al., 2008b). Abalone immuneresponses are initiated by protein-mediated recognition of non-self molecules (Nikapitiya et al., 2008; Wang et al., 2008c) that leadsto the induction of two major signal transduction pathways, the NF-κB and MAP kinases, and stimulate the synthesis of immune effectors(Baud and Karin, 2001; De Zoysa et al., 2010a, 2010b; Jiang and Wu,2007). Foreign particles are then internalized and phagocytized byhemocytes (Bayne, 1990; Travers et al., 2008b). The elimination ofthe invader is accomplished by enzymatic digestion mediated byacid phosphatase activity and by the production of reactive oxygenspecies such as hydrogen peroxide – ROS (Tiscar and Mosca, 2004;Wang et al., 2004). The toxic effect of ROS production is limited by“ROS-scavengers” such as superoxide dismutase – SOD (Ekanayakeet al., 2006; Kim et al., 2007; Li et al., 2010). In addition, solubleeffectors present in the serum act as immune helpers such as theion holders and the phenoloxidase pathway that may limit patho-gen proliferation in abalone (Cheng et al., 2004; Travers et al., 2008c).

Over the past fifteen years, European abalone populations fromthe north coast of France and aquaculture farms have sufferedmassive summer mortalities leading to the loss of up to 80% ofabalone stock (Nicolas et al., 2002). These mortalities have been at-tributed to the bacterial pathogen V. harveyi in physiologicallydepressed animals when the seawater temperature reaches 17 °C(Cardinaud et al., 2014b; Travers et al., 2009a).

V. harveyi infection of the European abalone is characterized bythe rapidity of the infectious process. V. harveyi adhesion on gillsand penetration into abalone tissues takes place within the first 3hours of contact. Invasion and multiplication of V. harveyi in theabalone circulatory system is effective 24 h after exposure and mor-talities appear 2 days after the initial exposure (Cardinaud et al.,2014a; Travers et al., 2009a). It has been demonstrated in vitro that3 hours of contact between V. harveyi and abalone hemocytes leadto an inhibition of phagocytosis that could be triggered by an in-hibition of the p38 MAPK pathway (Travers et al., 2009b). However,the alteration of Haliotis tuberculata hemocytes function by V. harveyiremains to be demonstrated in vivo. In the present study, we ana-lyzed the response of European abalone hemocytes, at the cellularand molecular levels during the first 24 hours of V. harveyi infec-tion. Measurements of cellular immune parameters, immune-related gene expressions and analyses of enzymatic activitiesinvolved in general metabolism and immune function have pro-vided crucial information on the successive events leading to thesuccessful and rapid infection of abalone by V. harveyi.

2. Material and methods

2.1. Abalone and bacterial strain

Adult H. tuberculata (n = 100, 3 years old) were transported incontainers filled with macroalgae Palmaria palmata from the FranceHaliotis hatchery in Plouguerneau (temperature 14 °C, salinity 35),France (abalonebretagne.com/) to our laboratory at the EuropeanInstitute for Marine Studies in Brest, in April 2012. Abalones wereplaced in six 5 L-tanks in which the seawater was replaced dailywith seawater pumped from the Bay of Brest filtered at 1 μm (dis-solved oxygen concentration > 7.5 mg. L-1, salinity 35). The seawatertemperature was progressively increased by 1 °C per day until 19 °Cand animals were maintained at this temperature for a week beforeexperimental infections.

The strain ORM4 of V. harveyi, isolated from diseased abaloneH. tuberculata in Normandy, France, during an episode of massivemortalities in 1999 (Nicolas et al., 2002), was used in this study. Bac-teria were grown in lysogeny Broth (LB Broth, Sigma-Aldrich Co.,St. Louis, USA) supplemented with extra salt (20 g L-1, f.c.) in a

temperature controlled shaker, at 28 °C for 16 hours. Bacteria werewashed and re-suspended 3 times in filtered and sterile seawater(FSSW) before use. The bacterial concentration was then mea-sured by spectrophotometry at 490 nm according to the formulaCFU = 6.109 OD – 108, as previously described (Travers et al., 2008a).

The rest of the procedure was summed up in the Fig. 1.

2.2. Experimental infection 1

Thirty abalones were exposed for 24 hours to V. harveyi, strainORM4, at a final concentration of 105 CFU mL−1 as previously de-scribed (Travers et al., 2009a). A control group of 30 individuals werekept unexposed to bacteria. Dead abalone were counted and removeddaily until mortality rate stabilization (Fig. 1). The presence ofV. harveyi in moribund abalone hemolymph was confirmed by PCRusing the method developed by Conejero and Hedreyda (2003).

2.3. Experimental infection 2

2.3.1. SamplingForty abalones were separated in two sets of 3 tanks: the first

set contained animals exposed to the strain ORM4 at a final con-centration of 105 CFU mL−1, and the second set contained unexposedanimals. Five animals were randomly sampled from the 3 tanks ofeach set just before the infection (T0) and then after 3 h, 9 h and24 h of experimentation.

Approximately one mL of hemolymph was collected from theanterior sinus of each abalone with a 2.5 mL pre-cooled sterile

Adult abalone at 19°C

Exp. infection 1n=60

Experimental infection 2n=40

Hemolymph sampling of 5 individuals

after 0, 3, 9 and 24h

Mortality rate after 12 days

On each abalone

Cellular analysis

Gene expression

Enzymatic activities

Hemocyte densityHemocyte viability Phagocytosis index ROS production

GlsActinFerritinMpegClathrinRel/NF-κBMnk

GLSCCOPOAPSOD

V. harveyi quantification

Fig. 1. Simplified experimental design to determine the early effects of V harveyiexposure to the immune function of the European abalone. One hundred adult aba-lones were transferred from hatchery, maintained in the laboratory and acclimatedat 19 °C and were subjected to two different experimental infections. ROS: reactiveoxygen species, Gls: Glutamine synthase gene, Mpeg: Macrophage expressed protein,Rel/NF-κB: Rel/nuclear factor-kappa B, Mnk: MAP kinase-interacting kinase, GLS:Glutamine synthase enzyme, CCO: Cytochrome c oxidase, PO: Phenoloxidase, AP:Acid phosphatase, SOD: Superoxide dismutase.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

2 M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

syringe fitted on a 23-gauge needle containing one mL of ice-coldFSSW to avoid hemocyte aggregation as previously described inabalone (Cardinaud et al., 2014b; Dang et al., 2012; Travers et al.,2008c). Hemolymph was sampled within 30 sec following abaloneremoval from each tank to prevent sampling stress, and was kepton ice. The 2 mL of 1:2 diluted hemolymph was split into fourtubes : (i) 500 μL was further diluted with 500 μL of ice-cold FSSWand kept on ice until flow cytometry analysis, (ii) 500 μL was storedat −80 °C for V. harveyi quantification; (iii) 500 μL was centrifugedat 2500 g for 15 min and the hemocyte pellet was frozen in liquidnitrogen and stored at −80 °C for gene expression analysis; (iv) 500 μLwas stored at −80 °C for enzymatic assays.

2.3.2. Cellular analysis by flow cytometryMorphological analyses of hemocytes were performed using a

FACSCalibur flow cytometer (Becton Dickinson) equipped with a488-nm air-cooled laser. Prior to the measures of immune param-eters, the absence of different hemocyte sub-populations wasconfirmed by analyzing cell size – forward scattering (FSC) and com-plexity – side scattering (SSC) (Fig. S1). Hemocyte concentration,viability, phagocytosis index and ROS production were measuredas described previously (Travers et al., 2008c).

2.3.2.1. Hemocyte concentration and viability. Initially, hemo-lymph samples were filtered through an 80 μm nylon mesh toeliminate aggregates and debris before flow cytometry analyses.Then, 300 μL of diluted hemolymph was further diluted into 300 μLof anti-aggregant solution (AASH: 1.5% EDTA, 6.25 g L−1 NaCl, in FSSW,pH 7.4), and divided in three technical replicates. Each sample wasthen incubated for 30 min with both SYBR Green I fluorescent dye(Molecular Probes, 10−3 dilution of the commercial stock solution,in FSSW) and Propidium Iodide fluorescent dye (10 μg·mL−1, f.c., inFSSW). Hemocyte concentration was estimated by counting at least10,000 particles in 30 sec through the green fluorescence cytom-eter detector –FL1, and results were reported in cells per millimeterof hemolymph.

Dead cells incorporated Propidium Iodide and were visualizedthough the FL3 cytometer detector. Hemocyte viability was ob-tained by calculating the percentage of dead cells among 10,000hemocytes.

2.3.2.2. Phagocytosis index. Three hundred μL of diluted hemo-lymph were further diluted into 300 μL of FSSW and divided intothree technical replicates of 200 μL. Each replicate was depositedin a 24-well plate (Cellstar, Greiner Bio-one). Hemocytes wereallowed to adhere for 15 min at 18 °C. Then, 100 μL of fluorescentbeads (Fluoresbrite Yellow Green Microspheres, 2.00 μm,Polysciences, 1:200 in FSSW) was added to each sample with a ratioabout 30 beads per hemocyte. After 3 hours at 18 °C, superna-tants were removed and adherent cells were detached by adding200 μL of a trypsin solution (2.5 mg. mL-1 in AASH). Plates wereshaken for 10 min and the percentage of hemocytes that phagocytedthree or more beads – phagocytosis index – was counted on the flowcytometer through the cytometer detector FL1.

2.3.2.3. ROS production. Three hundred μL of diluted hemolymphwas further diluted into 300 μL of FSSW and divided into three tech-nical replicates of 200 μL. Each replicate was analyzed exactly 10 minafter addition of 2′, 7′-dichlorofluorescein diacetate (DCFH-DA,0.1 mM f.c. in FSSW) which is oxidized by H2O2 and other oxygenderivatives (Bass et al., 1983; Keller et al., 2004; Myhre et al., 2003).Results are given as the mean intra-hemocytic fluorescence levelof the dichlorofluorescein end product expressed in arbitrary units(U.A.).

2.3.3. V. harveyi quantificationV. harveyi quantification was performed using a 7500 Fast Real-

Time PCR System instrument and TaqMan® Universal Master Mix(Applied Biosystems, Life Technologies Corporation, Carlsbad, CA,USA) as described in Cardinaud et al. (2014a). Briefly, 500 μL of he-molymph was diluted in 500 μL of salted extract buffer (100 mMTris–HCl, 100 mM NaCl and 50 mM EDTA pH 8). Total DNA was ex-tracted using a phenol/chloroform/isoamyl alcohol method(Sambrook and Russell, 2001) and resuspended in 50 μL of DNase-free water. Concentration and quality of DNA were determined usinga Nanodrop ND-1000 spectrometer (Thermo Fisher scientific, USA).RT-qPCR measures were made using V. harveyi tox-R gene specificprimers: Forward CCA-CTG-CTG-AGA-CAA-AAG-CA, Reverse GTG-ATT-CTG-CAG-GGT-TGG-TT, and a Tox-R probe dually labeled with5′ reporter dye Texas Red and a downstream 3′ quencher dye BHQ-2: CAG-CCG-TCG-AAC-AAG-CAC-CG (Schikorski et al., 2013). Eachreaction was run in triplicate in a final volume of 20 μL containing4 μL of DNA sample, 1X of master mix, 300 nM of each primer and200 nM of probe. Reactions were initiated with activation of theThermo-Start DNA polymerase during 10 min at 95 °C followed by45 amplification cycles (denaturation at 95 °C for 15 s, annealingat 60 °C for 1 min). Tenfold serial dilution of V. harveyi in hemo-lymph of healthy unexposed abalone (108 CFU to 0) was used togenerate a standard curve. Bacteria count was confirmed by spec-trophotometry (for high bacteria concentrations, see above) andby plating and microscopic enumeration (for low bacteriaconcentrations).

2.3.4. Gene expression analysis2.3.4.1. Selection of gene candidates. Seven genes were chosen forgene expression analysis due to their implication in general me-tabolism – Glutamine Synthase (Gls), in cell movement – Actin, inimmune response – the subunit H of Ferritin, Clathrin, Macro-phage expressed gene (Mpeg), and in signal transduction – Rel/nuclear factor-kappa B (Rel/NF-κB) and MAP kinase-interactingkinase (Mnk) genes, and their putative involvement during abaloneinfection (Jiang and Wu, 2007; Travers et al., 2009b, 2010; Wanget al., 2008b). The gene encoding Elongation Factor 2 (Ef2) was se-lected as reference gene (Table 1) because of its stable expressionin all samples and time points. Primers for sequencing those geneswere available in the literature in H. tuberculata, except for Rel/NF-κB and Mnk genes (Table 1). For Rel/NF-κB gene, a cDNA consensussequence was created by the software Bioedit Sequence Align-ment Editor 7.1.3.0 (Hall, 1999) from the conserved regions of otherHaliotis species sequences (Fig. S2). Oligonucleotide primer se-quences were designed using Primer express 3.0 software (AppliedBiosystems, Foster City, CA) (Fig. S2). For Mnk gene, the primers de-signed in Haliotis midae were used in this study (van der Merweet al., 2011). None of the primers matched with the genome of thestrain ORM4 of V. harveyi (unpublished data, Paillard Christine), whichprevented cross-reactions. The size of the PCR products was con-firmed by electrophoresis on agarose gel. The RT-qPCR efficiency(E) was estimated by serial dilutions (from 1/25 to 1/400) of tworeference cDNA samples (one control and one exposed abalone),using the method described by Yuan et al. (2006): E = 10[−1/slope].

2.3.4.2. RNA isolation and cDNA synthesis. Total RNA was ex-tracted using TRIzol® Reagent (Invitrogen, Carlsbad, CA) accordingto the manufacturer’s instructions and resuspended in RNase-freewater. RNA was quantified by spectrophotometry with a NanodropND-1000 (Thermo Fisher Scientific, USA) and RNA quality was as-sessed by gel electrophoresis and by analysis on an AgilentBioanalyzer 2100 with RNA 6000 Nano Kit (Agilent Technologies).DNA contamination was prevented using a RTS-DNase kit (MO BIOLaboratories, Inc., Carlsbad, CA) on RNA samples, and checked byamplification of a non-reverse transcribed fraction (minus-RT).

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

3M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Reverse transcription was performed with 1 μg of cDNA usingrandom hexamer primers and a RevertAid™ kit (Fermentas Inter-national Inc., Burlington, Canada). A minimal difference betweenminus-RT and cDNA samples was fixed at ten amplification cyclesto accept a sample in gene expression analyses.

2.3.4.3. Real time q-PCR measurements. RT-qPCR measurements wereperformed as previously described (Travers et al., 2010). Each runincluded a negative control in which sterile water replaced cDNAsample, and a reference sample constituted by a pool of all thesamples – including both control and exposed samples. Results werefirst normalized to the reference gene using the method de-scribed by Pfaffl (2001) and determined by the equation:

Relative expression = EtargetΔCttarget (control-sample)/Eref

ΔCtref (control-sample),whereEtarget is the amplification efficiency of the target or gene of interest,Eref is the amplification efficiency of the reference gene and Ct is thecycle threshold.

Then, relative gene expression was indexed to the number ofviable hemocytes in the sample (see above hemocytes concentra-tion and viability) and reported to 106 cells.

2.3.5. Enzymatic assaysPrior to enzymatic activity assays by spectrophotometric methods,

hemolymph samples were centrifuged at 2500 g for 15 min. The su-pernatant was conserved and stored on ice until use. The total proteincontent of all samples was measured using the method of Lowryand collaborators, with the DC™ Protein Assay kit (Life Science, Bio-Rad, Marnes-la-Coquette, France) and serial dilution of bovine serumalbumin as standards (Lowry et al., 1951). Enzymatic activities werecalculated and normalized to the number of viable hemocytes andreported to 106 cells:

Units mg protein =

−( )× ×

Δ ΔA Sample min A Blank minTotal volume Conv

λ λ

eersion factor to minutesMillimolar extinction coefficient of

the ssubstrate at Volume of the sample

mg protein in the samplece

λ ×

× × 106 lllsnumber of viable cells

2.3.5.1. Glutamine synthase (GLS) activity. Glutamine synthase ac-tivity was measured at 19 °C, using the indirect method describedby Kingdon et al. (1968). Briefly, the consumption of β-NADH wasmonitored at 340 nm during the formation of lactate by the enzy-matic complex pyruvate kinase/L-lactic dehydrogenase. The finalconcentrations of the reagents were as follows: 34.1 mM imidaz-ole, 102 mM sodium glutamate, 8.5 mM adenosine 5′-triphosphate,1.1 mM phosphoenolpyruvate, 60 mM magnesium chloride, 18.9 mM

potassium chloride, 45 mM ammonium chloride, 0.25 mMb-nicotinamide adenine dinucleotide, 28 units of pyruvate kinaseand 40 units of L-lactic dehydrogenase. The absorbance at 340 nmwas read continuously for 30 min. The activity was given in GLS unitwhich corresponds to the conversion of 1.0 μmol of L-glutamate toL-glutamine.

2.3.5.2. Cytochrome c oxidase (CCO) activity. Cytochrome c oxidasewas measured at 19 °C, using the method described by Smith (1955)and adapted in marine mollusks by Sussarellu et al. (2013). The ox-idation of the reduced cytochrome c was monitored at 550 nm, usinga 600 μM reduced cytochrome c substrate in 50 mM phosphate buffer(50 mM NaH2PO4, 50 mM Na2HPO4, pH = 7.8). The absorbance at550 nm was read continuously for 15 min. The activity was givenin CCO unit which corresponds to the oxidation of 1.0 μmol ofreduced cytochrome c.

2.3.5.3. Phenoloxidase (PO) activity. Phenoloxidase activity was mea-sured at 19 °C, using the indirect method described by Ford andPaillard, in which the oxidation of phenol components is moni-tored at 490 nm (Ford and Paillard, 2007). Briefly, 100 μL of 2 mML-3,4-dihydroxyphenylalanine in 0.2 M Tris–HCl–1% SDS (v/v), pH 8,was added to 100 μL of total hemolymph and the absorbance at490 nm was read continuously for 30 min. The activity was givenin PO unit which corresponds to the oxidation of 1 μmol of L-DOPA.

2.3.5.4. Acid phosphatase (AP) activity. Acid phosphatase activity wasmeasured at 19 °C, using the method described by Bergmeyer et al.(1974). Briefly, the consumption of p-nitrophenyl phosphate wasmonitored at 410 nm using a 6.9 mM p-nitrophenyl phosphate sub-strate in 41 mM citric acid buffer after 15 min. The activity was givenin AP unit which hydrolyzes 1.0 μmol of p-nitrophenyl phosphate.

2.3.5.5. Superoxide dismutase activity. Superoxide dismutase activ-ity was measured at 19 °C, using the method described by McCordand Fridovich (1969). The inhibition of the rate of cytochrome c re-duction by superoxide anion generated from the xanthine oxidase/hypoxanthine reaction was observed at 550 nm. The finalconcentrations of the reagents were as follows: phosphate buffer(50 mM, pH 7.8), hypoxanthine (0.05 mM), xanthine oxidase(0.008 mU/mL), and cytochrome C (0.01 mM). The absorbance at490 nm was read continuously for 15 min. The activity is given inSOD unit which corresponds to a 50% inhibition of the xanthineoxidase reaction.

Table 1Primer sequences used in Real time qPCR analysis in this study.

Gene Primer sequences Biological function Literature source Efficiency

Elongation factor 2 F: ATGGAGTTTTGTGCGATGAGAAR: TCGGCGTGGAGAGTCACAT

Transduction – reference gene Travers et al., 2010 1.07

Glutamine synthase F: GCGACACCTGCCGAGAAGTR: AGTTATTGAAGAAGCCATCGAGAGA

General metabolism Travers et al., 2010 0.94

Ferritin F: CGTGACGACTGGGCATTACTCR: GGACCACATCACCAACCTGAA

Stress response – ferrous ion holder Travers et al., 2010 0.96

Clathrin F: CACTCGCTCGGTCAACTTCTTR: CTGGTAGTCCTCCTCCTCAATGA

Cell exchange – internalization Travers et al., 2010 0.98

Mpeg F: AGGTWGCTTCGCTRTGGTR: TCAYTCCTGCTGGYTGTTCT

Immunity – perforin Cardinaud et al., 2014b 1.01

Mnk F: AATGGAGGATAACCGCAAAGR: GAGATTCAGATGTCCGCACC

Signal transduction – MAPK pathway van der Merwe et al., 2011 1.03

Rel/Nf-κB F: TCGTCCGCAACCCTTCTR: GGGTGGTTCAGTGAGTGAGAGA

Signal transduction – transcription factor This study 0.87

Mpeg: macrophage expressed protein, Mnk: MAP kinase-interacting kinase, Rel/NF-κB: nuclear factor-kappa B.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

4 M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

2.4. Statistics

All statistical analyses were performed using JMP 10.0.0 soft-ware (SAS Institute Inc.).

2.4.1. Factorial analysesA discriminant analysis (DA) was performed on all the vari-

ables of the dataset in the function of sampling time to estimate apossible distinction of the hemocyte response along the exposureto V. harveyi.

Then, an estimation of Spearman’s rank correlation was donebetween all the measured parameters to remove variables statis-tically dependent on each other and positively correlated (Spearman,1904). A Principal component analysis (PCA) was performed withthese non-correlated variables. Components with the highest pro-portion of variance were used to draw a scatter plot organizingcontrol (T0 and unexposed) and exposed abalone samples along theprincipal components.

2.4.2. Variance analysesAccording to the results of normality and homoscedasticity anal-

yses, the effects of V. harveyi exposure and of the time of exposurewere estimated by 1/ analysis of variance (2-way ANOVA) for theimmune parameters, and 2/ by a non-parametric Wilcoxon test fortranscriptional and enzymatic measures. Then, pairwise compari-sons between control and exposed abalone were performed for eachtime point with Student’s t test for immune factors, and by aWilcoxon signed-rank test for transcriptional and enzymatic mea-sures (Wilcoxon, 1945).

3. Results

3.1. Mortality rate and quantification of V. harveyi in hemolymph

European abalone mortality following a 24 h exposure toV. harveyi was followed for 12 days (Fig. S3). The role of V. harveyiin the individual mortality was assessed by the detection of V. harveyiin abalone hemolymph. The first mortalities occurred 2 days afterexposure and the cumulated mortality rate reached 93% after 9 days.No mortality was observed in control abalone (T0 and unexposed).

Quantification of V. harveyi in European abalone hemolymph re-vealed a significant abundance of the pathogen after 9 h of exposure

Detection threshold

104

103

102

0

101

T3 T9T0 T24Exposure time

V.

iyevrahnoitartnecnoc

Log(

CFU

/mL)

Fig. 2. Fluctuations of V. harveyi concentration in European abalone hemolymph after0 h, 3 h, 9 h and 24 h of exposure – T0, T3, T9 and T24. The measures were made byquantitative PCR using the absolute method developed in Cardinaud et al. (Cardinaudet al., 2014a). The dotted line corresponds to the detection threshold of this method.

Table 2Effects of Vibrio harveyi exposure and time of exposure on data of cellular immuneparameters estimated by ANOVA tests, and gene expression and enzymatic activi-ty measures estimated by Wilcoxon tests. The values in bold are statistically significantat the level of 0.05.

Gene and variable tested P value

Immune parametersHemocyte density

V. harveyi exposure 0.0171Time 0.0073V. harveyi exposure × time 0.0048

ViabilityV. harveyi exposure 0.0820Time 0.0367V. harveyi exposure × time 0.0164

ROS productionV. harveyi exposure 0.0922Time 0.0007V. harveyi exposure × time 0.0007

Phagocytosis indexV. harveyi exposure 0.2220Time <0.001V. harveyi exposure × time <0.001

Gene expression dataGlutamine synthase

V. harveyi exposure 0.6839Time 0.5573V. harveyi exposure × time 0.7418

ActinV. harveyi exposure 0.1715Time 0.0043V. harveyi exposure × time 0.0061

ClathrinV. harveyi exposure 0.0005Time 0.1660V. harveyi exposure × time 0.0058

FerritinV. harveyi exposure 0.2466Time 0.0308V. harveyi exposure × time 0.0035

MpegV. harveyi exposure 0.9501Time 0.0161V. harveyi exposure × time 0.0237

Rel/NF-κBV. harveyi exposure 0.3237Time 0.3633V. harveyi exposure × time 0.0306

MnkV. harveyi exposure 0.2356Time 0.0270V. harveyi exposure × time 0.0574

Enzymatic activitiesGlutamine synthase

V. harveyi exposure 0.3461Time 0.0002V. harveyi exposure × time 0.0004

Cytochrome c oxidaseV. harveyi exposure 0.3428Time 0.0506V. harveyi exposure × time 0.0479

Acid phosphataseV. harveyi exposure 0.3356Time 0.0762V. harveyi exposure × time 0.1043

PhenoloxidaseV. harveyi exposure 0.5016Time 0.5598V. harveyi exposure × time 0.8952

Superoxide dismustaseV. harveyi exposure 0.5705Time 0.9493V. harveyi exposure × time 0.0653

Mpeg: macrophage expressed protein, Mnk: MAP kinase-interacting kinase, Rel/NF-κB: nuclear factor-kappa B.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

5M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

(Fig. 2). The concentration of V. harveyi in hemolymph significantlyincreased between 9 h and 24 h, from 1.18·102 ± 0.82·102 bacteria/mLto 1.32·103 ± 0.71·103 bacteria/mL.

3.2. Factorial analyses

In the present study, we measured numerous parameters pro-viding information on hemocyte ability to respond to infection at thecellular and molecular level. A discriminant analysis (DA) was usedto confirm internal consistency of different samples from the sametime point after infection (Fig. 3A). DA scatter plot revealed that 1/T0 and not infected abalone clustered together with high canonicalcomponent 1 and 2 values and 2/ abalone collected 3 h, 9 h and 24 hafter exposure to V. harveyi clustered apart from each other (LambdaWilk < 0.0001). After 3 h of infection, samples clustered slightly apartfrom control individuals with slightly lower component 2 values. Com-ponent 1 decreased significantly in abalone collected after 9 h ofexposure compared to noninfected individuals. Samples collected 24 h

from exposure clustered further apart with low component 1 and 2values.

Next, estimation of Spearman’s rank correlation showed that 5immune measures were not correlated with each other and mayexplain the integrality of dataset: hemocyte concentration, ROS pro-duction, Clathrin, Ferritin and Rel gene expressions (Table S1). APrincipal Component Analysis was performed using this subset ofdata (Fig. 3B). The two principal components of this PCA ex-plained 61.2% of total variance. PCA1 was characterized by lowFerritin values – (and hence low Actin, according to Spearman’s rankcorrelation), high ROS values and to a lesser extent by high hemo-cyte concentration (and hence high hemocyte viability andphagocytosis index, according to Spearman’s rank correlation). In-terestingly, PCA1 was inversely correlated with V. harveyiconcentration (Fig. 3C), which results in a direct correlation betweenV. harveyi concentration, Ferritin and Actin gene expressions andan inverse correlation with hemocyte cellular parameters. PCA 2 wascharacterized by high Clathrin and Rel/NF-κB expression (and hence

T0 and Unexposed

8 10 12 14 16 18DA component 1

-8

-6

-4

-2

0

2

DA

com

pone

nt 2

T3

T9

T24

A

-6

-4

-2

0

2

0 101 102 103 104

PCA

com

pone

nt 1

V. harveyi concentrationCFU/mL

y = 0.357 0.00205 x

R² = 0.76

C

-6

-4

-2

0

2

4

6

-6 -4 -2 0 2 4 6PCA component 1

(36,8 %)

ROS

Density

Clathrin

Rel

FerritincA

CP2tnenop

m o)

%4,42 (

B

Fig. 3. Factorial analyses of the global dataset obtained after the first hours of exposure of European abalone to V. harveyi. A: Discriminant analysis of global hemocyteresponse dataset, classed by time of exposure to V. harveyi. B: Principal component analysis of global hemocyte response dataset. An estimation of Spearman’s rank corre-lation was done between all the measured parameters to remove variable statistically correlated to other ones. C: Linear regression between PCA1 and V. harveyi concentration.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

6 M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

high Mpeg expression, according to Spearman’s rank correlation)and low hemocyte concentration values (and hence low hemocyteviability and phagocytosis index, according to Spearman’s rankcorrelation).

Wilcoxon tests were executed on all measured parameters inorder to determine if they were statistically influenced by the timeof exposure and/or by the exposure to V. harveyi (Table 2). Addi-tional statistical analyses were performed to identify the time pointat which a significant difference was measured when the results wereinfluenced by the joint factor of time and exposure. When the factorV. harveyi exposure alone was sufficient to explain the variance ob-served, complementary analyses were performed to characterize the

correlation between the measured factor and the concentration ofV. harveyi in the hemolymph of sampled abalone. The results ofparameters that were not significantly statistically different in re-sponse to exposure to V. harveyi were not further described.

3.3. Changes in immune parameters

All cellular immune parameters were influenced by the jointfactor time and exposure (Table 2). A significant reduction in he-mocyte viability and ROS production was observed from 9 h ofexposure, and hemocyte concentration and phagocytosis index weresignificantly reduced from 24 h of exposure to V. harveyi (Fig. 4).

*

400

300

200

100

0

100

90

80

70

0

60Hem

ocyt

evi

abili

ty%

60

50

40

30

20

120

90

60

30

0

sisotycogahPxedni

% RO

SA

.U.

T0 T3 T24T9Exposure timeExposure time

T0 T3 T24T9

etycome

Hytisned

x10

4ce

lls/m

Letyc o

meH

ytisnedx

104

cells

/mL

0

200

400

0 500 1000 1500 2000 2500 3000

V. harveyi concentration CFU/mL

100

125

150

5.102 103

R² = 0.99

Density = 328.56 28.22*Log(concentration)100

150

200

250

101 102

R² = 0.80

Density = 489.92 69.56*Log(concentration)

** *

**

T9 T24

UnexposedExposed

Fig. 4. Fluctuations of hemocyte cellular parameters in the European abalone after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24, and fluctuationof hemocyte density in the function of V. harveyi concentration. Hemocyte concentration, hemocyte viability, phagocytosis index, and ROS production were indicated duringthe earlier stages of vibriosis from 5 individuals per time. * indicates values that are significantly different for a two-sided student t-test with p < 0.05. Two regressions havebeen done between hemocyte concentration and V. harveyi concentration after 9 h and after 24 h of exposure to V. harveyi.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

7M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Interestingly, hemocyte concentration was also influenced by theexposure to V. harveyi (Table 2). Fig. 4 shows that the hemocyteconcentration was negatively correlated with the concentration ofV. harveyi, after 9 h and 24 h of exposure.

3.4. Gene expression analysis

Gls and Mnk were not significantly differentially expressed inpresence of V. harveyi while the expression of Rel/NF-kB, Clathrin,Mpeg, Actin and Ferritin was dependent on the joint factor ofV. harveyi exposure and time (Table 2). A significant increase inRel/NF-kB gene expression was observed after 3 h of exposure whichwas followed by a downregulation after 24 h of exposure (Fig. 5).Clathrin and Mpeg genes had the same expression profiles, and weresignificantly overexpressed after 9 h of exposure and downregulatedafter 24 h (Fig. 5). Actin and Ferritin genes showed different ex-pression profiles with a significant overexpression after 24 h ofexposure to V. harveyi (Fig. 5).

Interestingly, Clathrin gene expression was also dependent onV. harveyi concentration. Indeed, Clathrin gene expression initiallyincreased at low V. harveyi concentration and then decreased whenV. harveyi concentration reached about 200 CFU/mL (Fig. 6). As aresult, a positive correlation between Clathrin gene expression andV. harveyi concentration was observed after 9 h of exposure(R2 = 0.79), and was followed by a negative correlation after 24 hof exposure (R2 = 0.96) (Fig. 6).

3.5. Modulation of enzymatic activities

AP, PO and SOD activities were not impacted by the abalone ex-posure to V. harveyi, while GLS and CCO activities were significantlydependent on the joint factor time and exposure to V. harveyi(Table 2). Both enzyme activities were significantly reduced after24 h of exposure (Fig. 7).

4. Discussion

This study aimed at revealing hemocyte responses in Europeanabalone during the earlier stages of V. harveyi infection. Our resultsshow two successive stages: (i) an early immune response to in-fection based on molecular immune response pathway and (ii) aV. harveyi induced cellular immuno-suppression and an alterna-tive immune response with increase in Ferritin gene expression. Also,our results suggest a strong influence of V. harveyi concentrationin the bacteria pathogenicity.

Previous reports indicated that V. harveyi penetrates the gill–hypobranchial gland tissue after one hour of contact and can bedetected in the abalone circulatory system after 3 h of exposure(Cardinaud et al., 2014a). In this study, the V. harveyi quantificationrevealed detectable quantities of the pathogen in the hemolymph ofabalone after 9 h of exposure. The canonical discriminant analysis sug-gests that after only 3 h of exposure, V. harveyi has infected the abaloneand initiates a response. The over expression of Rel/NF-kB gene after3 h of exposure indicates that abalones are indeed responding to thepresence of V. harveyi even though the bacteria concentration wasbelow detection threshold. The family of Rel/NF-κB transcriptionfactors is particularly known for its involvement in immunity, in-flammation and apoptosis process (Hoffmann and Baltimore, 2006).After 9 h of exposure, an increase in expression of Clathrin and Mpeggene confirmed that an immune response has been initiated. More-over, a positive correlation between the Clathrin gene expression andV. harveyi concentration was observed after 9 h of exposure (Fig. 6).Clathrin is involved in bacterial internalization by phagocytic cells(Pauly and Drubin, 2007; Veiga and Cossart, 2006). An upregulationof Mpeg gene expression in response to pathogen contact has already

been observed in marine invertebrates such as the giant oyster C. gigas,the small abalone Haliotis diversicolor supertexta and in thesponge Suberites domuncula (He et al., 2011; Wang et al., 2008b; Wienset al., 2005). Abalone Mepg like-protein genes have been first

Mpeg

101

10-1

1

10-2

102

**

Exposure timeT0 T3 T24T9

Rel/NF-kB

103

101

10-1

1

10-2

102 *

*

103

101

10-1

1

102

Actin

**

*

Ferritin

104

101

10-1

1

102

103 **

evitaleR

enegsnoisserpxe

UnexposedExposed

Fig. 5. Expression profiles of Glutamine synthase (Gls), Ferritin, Rel/nuclear factor-kappa B (Rel/NF-κB) and Macrophage expressed protein (Mepg) genes after 0 h, 3 h,9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24, in European abalonehemocytes. The relative gene expression was calculated by Pfaffl’s method (Pfaffl,2001) using Elongation Factor 2 as reference gene and relative to expression of apool of all samples considered in this study. * and ** indicate values that are sig-nificantly different for a non-parametric Wilcoxon test with p < 0.05 and p < 0.01,respectively.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

8 M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

characterized in the pink abalone, Haliotis corrugata, and the redabalone, Haliotis rufescens, and have almost 50% similarity with themouse Mpeg1 gene (Mah et al., 2004). Abalone Mpeg also pos-sesses perforin typical structures as a “membrane attack complex/

perforin-homology domain” containing the cytolytic helix-turn-helix functional domain (Kemp and Coyne, 2011; Mah et al., 2004;Wang et al., 2008a). The precocious upregulation of Clathrin and Mpeggene expressions in European abalone hemocytes after 9 h of contactwith V. harveyi suggests the induction of both cellular and molecu-lar immune response processes during the earlier hours of exposure.

However, from 9 h of exposure, this study showed that V. harveyihas intensively reproduced and impacted hemocyte viability andROS measurements. It has previously been demonstrated that strainsof pathogenic V. harveyi produce a hemolytic factor called hemo-lysin. Hemolysin could be responsible for the reduced hemocyteviability of infected abalones. Regarding ROS production, Travers et al.suggested that V. harveyi regulates the p38 MAPK pathway to reducehemocyte phagocytosis and ROS production (Travers et al., 2009b).However, in the present study, Mnk was not differentially ex-pressed, which prevented us from confirming this hypothesis. Asignificant reduction in ROS production has been described duringother types of Vibrio infection in marine mollusks, notably in thegiant oyster C. gigas, and may correspond to a component of theirvirulence strategy (Lambert et al., 2003). Here, the reduction of ROSlevel after 9 h of exposure to V. harveyi, measured using the DCFH-DA probe, may also be linked with the reduction of hemocyteviability due to impairment in cell membrane integrity. Furtherstudies are so necessary to decipher the molecular mechanisms in-volved in the reduction of hemocyte phagocytosis and ROSproduction by V. harveyi.

After 24 hours of exposure, we observed an impairment of cel-lular immunity resulting from V. haryeyi reproduction and infection.All cellular parameters measured (hemocyte concentration and vi-ability, phagocytosis index and ROS production) were significantlylower than control individuals (Fig. 4). It further suggests thatV. harveyi alters immune functions via toxin production. The reducedhemocyte viability can also be explained by the observed reduc-tion in general metabolism. The activities of GLS and CCO weresignificantly reduced after 24 h of exposure (Fig. 7). A modulationof Glutamine metabolism via activation or inhibition of GLS syn-thesis or gene expression during infection process has beenpreviously reported in humans and marine invertebrates such asthe bivalvia Tegillarca granosa and Chlamys farreri (Karinch et al., 2001;

101

10-1

1

10-2

**

Exposure time

T0 T3 T24T9 0 500 1000 1500 2000 2500 3000 3500

101

10-1

1

10-2

V. harveyi concentrationCFU/mL

Log(Clathrin) = 3.03 + 0.025*Log(concentration)

101

1101 102

R² = 0.79

1/Log(Clathrin) = -0.90 + 0.0038*Log(concentration)

1

10-2

102 103

R² = 0.96

10-1

104

evitaleR

nirhtalC

noisserpxeT9 T24

UnexposedExposed

Fig. 6. Expression profile of Clathrin gene in the function of time of exposure to V. harveyi and of V. harveyi concentration, in European abalone hemocytes. A: Clathrin geneexpression after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24. * indicates values that are significantly different for a non-parametric Wilcoxon testwith p < 0.05. B: Correlation between Clathrin gene expression and V. harveyi concentration. Two regressions have been done after 9 h and after 24 h of exposure to V. harveyi.

0.0

2.0

4.0

6.0

8.0

10.0

Enzy

mat

icac

tiviti

esU

nit/m

g pr

otei

n

GLS

0.0

0.3

0.6

0.9

1.2

CCOT0 T3 T24T9

Exposure time

*

*

UnexposedExposed

Fig. 7. Enzymatic activities of Glutamine synthase (GLS) and Cytochrome c oxidase(CCO) after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9, T24 inEuropean abalone hemocytes. The measures were made by spectrophotometricmethods. * indicates values that are significantly different for a non-parametricWilcoxon test with p < 0.05.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

9M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Wilmore and Shabert, 1998). A down-regulation of GLS expressionhas also been observed in infected muscle of abalone after 6 daysof exposure (Travers et al., 2010). This reduced general metabo-lism may be a consequence of vibriosis or a response of the Europeanabalone to vibriosis. Indeed, it has been demonstrated that stressconditions may induce a metabolic depression which is correlatedwith lower survival capacity to infection and lower hemocyte func-tion, in invertebrates and notably in the European abalone (Arnoldet al., 2013; Cardinaud et al., 2014b). Moreover, a recent study aboutthe effect of a V. harveyi infection in two clam species shows thatthis pathogen leads to an alteration of energy metabolism andimmune stress (Liu et al., 2013).

Vibriosis has direct consequences on the European abalone cellu-lar immune capacities as illustrated by the observed variation inimmune-related gene expression. After 24 h of exposure, we ob-served a significant down-expression of Clathrin, Mpeg and Rel/NF-kB genes (Figs. 5 and 6). As discussed above, these genes are involvedin the initial stages of the European abalone response to V. harveyi in-fection: signal transduction, recognition and phagocytosis. The alterationof these pathways may result from the lower viability of hemocytes,or from a more direct effect of V. harveyi toxins on the immune func-tion as previously proposed by Travers et al. (2009b).

However, a significant increase in Actin and Ferritin gene ex-pressions was observed after 24 h of exposure. In addition to theinvolvement of actin cytoskeleton in many cellular mobile pro-cesses and phagocytosis, actin fibers are implicated in the controlof cell mitosis and cytokinesis, in the regulation of the cell signal-ing pathway and production of ROS, and constitute one of the maintargets of pathogen toxins (Aktories et al., 2011). An upregulationof Actin gene expression during the first hours of vibriosis in theEuropean abalone may counteract a hypothetical subversion of he-mocyte actin cytoskeleton by V. harveyi to enter and to multiply inthese host cells, as previously described in the giant oyster C. gigasinfected by V. splendidus and in the Manila clam R. philippinaruminfected by V. tapetis (Brulle et al., 2012; Duperthuy et al., 2011) ormay offset the decrease in hemocyte concentration and viability bystimulating the mitotic division of the remaining hemocytes. Fer-ritin is a globular protein that enables ferrous ion sequestration,preventing its toxic effects, and is involved in ROS production controlvia the Fenton reaction (Fenton and Jackson, 1899). Iron seques-tration may constitute a component of the immune response ininvertebrates, limiting its bioavailability for Vibrio proliferation (Becket al., 2002; Doherty, 2007; Stork et al., 2002; Wright et al., 1981).In shrimps, ferritin protects against V. harveyi infection (Maiti et al.,2010). In the European abalone, Ferritin was among the few genesupregulated in individuals that survived the infection by V. harveyi(Travers et al., 2010). Therefore, the late Actin and Ferritinoverexpression could represent an alternative response of the abaloneto V. harveyi infection to counter the impaired phagocytosis. Furtherstudies would be necessary to determine if there is a causal rela-tion between Ferritin gene expression, V. harveyi concentration andabalone survival (6% of individuals after 12 days in this study).

5. Conclusion

This study characterized the earlier stages of the Europeanabalone hemocyte responses to vibriosis infection at the cellular andmolecular levels. In the light of our results, we believe that the ef-fectiveness of V. harveyi invasion in H. tuberculata tissues is due toits rapid reproduction and capacity to reduce the concentration andimmune competencies of hemocytes before they can develop an ef-fective response. It would be interesting to follow hemocyteresponses and the production of virulence factors by V. harveyi duringthe first hours of contact to reveal if the parasite reduces cytotoxiceffectors production by H. tuberculata. An in vitro study would allowa tight control of the number of bacteria per hemocyte. The present

study of gene expression analysis was limited to the short numberof immune response genes that had previously been described inthe genus. We believe next generation sequencing technologies, thatcan now be employed on any non-model species (Dheilly et al.,2014), should be employed in order to provide an integrated andunbiased picture of the interaction at the molecular level throughthe combined study of H. tuberculata and V. harveyi transcriptomes.

Acknowledgements

This study was supported by the partners of the Pole MerBretagne: the region of Brittany, the consil of the Finistère andMorbilhan and the city community Brest Metropole Oceane, andthe Université de Bretagne Occidentale.

Appendix: Supplementary material

Supplementary data to this article can be found online atdoi:10.1016/j.dci.2015.02.019.

References

Aktories, K., Lang, A.E., Schwan, C., Mannherz, H.G., 2011. Actin as target formodification by bacterial protein toxins. FEBS J. 278, 4526–4543.

Allam, B., Ford, S.E., 2006. Effects of the pathogenic Vibrio tapetis on defence factorsof susceptible and non-susceptible bivalve species: I. Haemocyte changesfollowing in vitro challenge. Fish Shellfish Immunol. 20, 374–383.

Allam, B., Paillard, C., Auffret, M., Ford, S.E., 2006. Effects of the pathogenic Vibrio tapetison defence factors of susceptible and non-susceptible bivalve species: II. Cellularand biochemical changes following in vivo challenge. Fish Shellfish Immunol.20, 384–397.

Arnold, P.A., Johnson, K.N., White, C.R., 2013. Physiological and metabolicconsequences of viral infection in Drosophila melanogaster. J. Exp. Biol. 216,3350–3357.

Austin, B., 2010. Vibrios as causal agents of zoonoses. Vet. Microbiol. 140, 310–317.Bass, D.A., Parce, J.W., Dechatelet, L.R., Szejda, P., Seeds, M.C., Thomas, M., 1983. Flow

cytometric studies of oxidative product formation by neutrophils – a gradedresponse to membrane stimulation. J. Immunol. 130, 1910–1917.

Baud, V., Karin, M., 2001. Signal transduction by tumor necrosis factor and its relatives.Trends Cell Biol. 11, 372–377.

Bayne, C.J., 1990. Phagocytosis and no-self recognition in invertebrates. Bioscience40, 723–731.

Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution ofthe acute phase response: iron release by echinoderm (Asterias forbesi)coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp.Immunol. 26, 11–26.

Bergmeyer, H.U., Gawehn, K., Grassl, M., 1974. Enzymatic assay of acid phosphatase.In: Methods of Enzymatic Analysis. Academic Press, New York and London.

Brulle, F., Jeffroy, F., Madec, S., Nicolas, J.-L., Paillard, C., 2012. Transcriptomic analysisof Ruditapes philippinarum hemocytes reveals cytoskeleton disruption after invitro Vibrio tapetis challenge. Dev. Comp. Immunol. 38, 368–376.

Cardinaud, M., Barbou, A., Capitaine, C., Bidault, A., Dujon, A.M., Moraga, D., et al.,2014a. Vibrio harveyi adheres to and penetrates tissues of the European abaloneHaliotis tuberculata within the first hours of contact. Appl. Environ. Microbiol.80, 6328–6333.

Cardinaud, M., Offret, C., Huchette, S., Moraga, D., Paillard, C., 2014b. The impactsof handling and air exposure on immune parameters, gene expression, andsusceptibility to vibriosis of European abalone Haliotis tuberculata. Fish ShellfishImmunol. 36, 1–8.

Cheng, W., Hsiao, I.S., Chen, J.C., 2004. Effect of ammonia on the immune responseof Taiwan abalone Haliotis diversicolor supertexta and its susceptibility to Vibrioparahaemolyticus. Fish Shellfish Immunol. 17, 193–202.

Conejero, M.J.U., Hedreyda, C.T., 2003. Isolation of partial toxR gene of Vibrio harveyiand design of toxR-targeted PCR primers for species detection. J. Appl. Microbiol.95, 602–611.

Dang, V.T., Speck, P., Benkendorff, K., 2012. Influence of elevated temperatures onthe immune response of abalone, Haliotis rubra. Fish Shellfish Immunol. 32,732–740.

De Zoysa, M., Nikapitiya, C., Lee, Y., Lee, S., Oh, C., Whang, I., et al., 2010a. Firstmolluscan transcription factor activator protein-1 (Ap-1) member from diskabalone and its expression profiling against immune challenge and tissue injury.Fish Shellfish Immunol. 29, 1028–1036.

De Zoysa, M., Nikapitiya, C., Oh, C., Whang, I., Lee, J.S., Jung, S.J., et al., 2010b. Molecularevidence for the existence of lipopolysaccharide-induced TNF-alpha factor (LITAF)and Rel/NF-kB pathways in disk abalone (Haliotis discus discus). Fish ShellfishImmunol. 28, 754–763.

Dheilly, N.M., Adema, C., Raftos, D.A., Gourbal, B., Grunau, C., Du Pasquier, L., 2014.No more non-model species: the promise of next generation sequencing forcomparative immunology. Dev. Comp. Immunol. 45, 56–66.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

10 M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Diggles, B.K., Moss, G.A., Carson, J., Anderson, C.D., 2000. Luminous vibriosis in rocklobster Jasus verreauxi (Decapoda : Palinuridae) phyllosoma larvae associated withinfection by Vibrio harveyi. Dis. Aquat. Organ. 43, 127–137.

Doherty, C.P., 2007. Host-pathogen interactions: the role of iron. J. Nutr. 137,1341–1344.

Duperthuy, M., Schmitt, P., Garzón, E., Caro, A., Rosa, R.D., Le Roux, F., et al., 2011.Use of OmpU porins for attachment and invasion of Crassostrea gigas immunecells by the oyster pathogen Vibrio splendidus. Proc. Natl. Acad. Sci. U.S.A. 108,2993–2998.

Ekanayake, P.M., Kang, H.S., De Zyosa, M., Jee, Y., Lee, Y.H., Lee, J., 2006. Molecularcloning and characterization of Mn-superoxide dismutase from disk abalone(Haliotis discus discus). Comp. Biochem. Physiol. B Biochem Mol. Biol. 145,318–324.

Farto, R., Armada, S.P., Montes, M., Guisande, J.A., Pérez, M.J., Nieto, T.P., 2003. Vibriolentus associated with diseased wild octopus (Octopus vulgaris). J. Invertebr. Pathol.83, 149–156.

Fenton, H.J.H., Jackson, H.J., 1899. I. The oxidation of polyhydric alcohols in presenceof iron. J. Chem. Soc., Trans. 75, 1–11.

Ford, S.E., Paillard, C., 2007. Repeated sampling of individual bivalve mollusks I:intraindividual variability and consequences for haemolymph constituents ofthe Manila clam, Ruditapes philippinarum. Fish Shellfish Immunol. 23, 280–291.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

He, X.C., Zhang, Y., Yu, Z.N., 2011. An Mpeg (macrophage expressed gene) from thePacific oyster Crassostrea gigas: molecular characterization and gene expression.Fish Shellfish Immunol. 30, 870–876.

Hoffmann, A., Baltimore, D., 2006. Circuitry of nuclear factor κB signaling. Immunol.Rev. 210, 171–186.

Hooper, C., Day, R., Slocombe, R., Handlinger, J., Benkendorff, K., 2007. Stress andimmune responses in abalone: limitations in current knowledge and investigativemethods based on other models. Fish Shellfish Immunol. 22, 363–379.

Jiang, Y.S., Wu, X.Z., 2007. Characterization of a Rel\NF-kappa B homologue in agastropod abalone, Haliotis diversicolor supertexta. Dev. Comp. Immunol. 31,121–131.

Karinch, A.M., Pan, M., Lin, C.M., Strange, R., Souba, W.W., 2001. Glutamine metabolismin sepsis and infection. J. Nutr. 131, 2535S–2538S.

Keller, A., Mohamed, A., Drose, S., Brandt, U., Fleming, I., Brandes, R.P., 2004. Analysisof dichlorodihydrofluorescein and dihydrocalcein as probes for the detection ofintracellular reactive oxygen species. Free Radic. Res. 38, 1257–1267.

Kemp, I.K., Coyne, V.E., 2011. Identification and characterisation of the Mpeg1homologue in the South African abalone, Haliotis midae. Fish Shellfish Immunol.31, 754–764.

Kim, K.Y., Lee, S.Y., Cho, Y.S., Bang, I.C., Kim, K.H., Kim, D.S., et al., 2007. Molecularcharacterization and mRNA expression during metal exposure and thermal stressof copper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotisdiscus discus. Fish Shellfish Immunol. 23, 1043–1059.

Kingdon, H.S., Hubbard, J.S., Stadtman, E.R.B., 1968. Glutamine synthase activity assay.Biochemistry 7, 2136–2142.

Kumazawa, N.H., Mine, A., 2001. Migratory responses of hemocytes to Vibrioparahaemolyticus in the alimentary tract of an estuarine neritid gastropod, Clithonretropictus. J. Vet. Med. Sci. 63, 1257–1261.

Lambert, C., Soudant, P., Choquet, G., Paillard, C., 2003. Measurement of Crassostreagigas hemocyte oxidative metabolism by flow cytometry and the inhibitingcapacity of pathogenic vibrios. Fish Shellfish Immunol. 15, 225–240.

Leaño, E.M., Lavilla-Pitogo, C.R., Paner, M.G., 1998. Bacterial flora in thehepatopancreas of pond-reared Penaeus monodon juveniles with luminousvibriosis. Aquaculture 164, 367–374.

Li, C.-C., Yeh, S.-T., Chen, J.-C., 2008. The immune response of white shrimp Litopenaeusvannamei following Vibrio alginolyticus injection. Fish Shellfish Immunol. 25,853–860.

Li, H.F., Sun, X.F., Cai, Z.H., Cai, G.P., Xing, K.Z., 2010. Identification and analysis of aCu/Zn superoxide dismutase from Haliotis diversicolor supertexta with abalonejuvenile detached syndrome. J. Invertebr. Pathol. 103, 116–123.

Liu, X., Zhao, J., Wu, H., Wang, Q., 2013. Metabolomic analysis revealed the differentialresponses in two pedigrees of clam Ruditapes philippinarum towards Vibrio harveyichallenge. Fish Shellfish Immunol. 35, 1969–1975.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement withthe Folin phenol reagent. J. Biol. Chem. 193, 265–275.

Mah, S.A., Moy, G.W., Swanson, W.J., Vacquier, V.D., 2004. A perforin-like protein froma marine mollusk. Biochem. Biophys. Res. Comm. 316, 468–475.

Maiti, B., Khushiramani, R., Tyagi, A., Karunasagar, I., 2010. Recombinant ferritinprotein protects Penaeus monodon infected by pathogenic Vibrio harveyi. Dis.Aquat. Organ. 88, 99.

McCord, J.M., Fridovich, I., 1969. Superoxide dismutase. J. Biol. Chem. 244, 6049–6055.Myhre, O., Andersen, J.M., Aarnes, H., Fonnum, F., 2003. Evaluation of the probes

2′,7′-dichlorofluorescin diacetate, luminol, and lucigenin as indicators of reactivespecies formation. Biochem. Pharmacol. 65, 1575–1582.

Nicolas, J.L., Basuyaux, O., Mazurie, J., Thebault, A., 2002. Vibrio carchariae, a pathogenof the abalone Haliotis tuberculata. Dis. Aquat. Organ. 50, 35–43.

Nikapitiya, C., De Zoysa, M., Lee, J., 2008. Molecular characterization and geneexpression analysis of a pattern recognition protein from disk abalone, Haliotisdiscus discus. Fish Shellfish Immunol. 25, 638–647.

Pauly, B.S., Drubin, D.G., 2007. Clathrin: an amazing multifunctional dreamcoat? CellHost Microbe 2, 288–290.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Res. 29.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual. Cold SpringHarbor Laboratory Press. New York.

Sangster, C.R., Smolowitz, R.M., 2003. Description of Vibrio alginolyticus infection incultured Sepia officinalis, Sepia apama, and Sepia pharaonis. Biol. Bull. 205,233–234.

Schikorski, D., Renault, T., Paillard, C., Bidault-Toffin, A., Tourbiez, D., Saulnier, D.,2013. Development of Taqman real-time PCR assay targeting both the marinebacteria Vibrio harveyi, a pathogen of European abalone Haliotis tuberculata,and plasmidic DNA harbored by virulent strains. Aquaculture 392–395, 106–112.

Smith, L., 1955. Spectrophotometric assay of cytochrome c oxidase. Methods Biochem.Anal. 2, 427.

Soonthornchai, W., Rungrassamee, W., Karoonuthaisiri, N., Jarayabhand, P., Klinbunga,S., Söderhäll, K., et al., 2010. Expression of immune-related genes in the digestiveorgan of shrimp, Penaeus monodon, after an oral infection by Vibrio harveyi. Dev.Comp. Immunol. 34, 19–28.

Spearman, C., 1904. The proof and measurement of association between two things.Am. J. Psychol. 15, 72–101.

Stork, M., Di Lorenzo, M., Welch, T.J., Crosa, L.M., Crosa, J.H., 2002. Plasmid-mediatediron uptake and virulence in Vibrio anguillarum. Plasmid 48, 222–228.

Sugumar, G., Nakai, T., Hirata, Y., Matsubara, D., Muroga, K., 1998. Vibrio splendidusbiovar II as the causative agent of bacillary necrosis of Japanese oyster Crassostreagigas larvae. Dis. Aquat. Organ. 33, 111–118.

Sussarellu, R., Dudognon, T., Fabioux, C., Soudant, P., Moraga, D., Kraffe, E., 2013. Rapidmitochondrial adjustments in response to short-term hypoxia and re-oxygenationin the Pacific oyster, Crassostrea gigas. J. Exp. Biol. 216, 1561–1569.

Tiscar, P.G., Mosca, F., 2004. Defense mechanisms in farmed marine molluscs. Vet.Res. Commun. 28, 57–62.

Travers, M.A., Barbou, A., Le Goic, N., Huchette, S., Paillard, C., Koken, M., 2008a.Construction of a stable GFP-tagged Vibrio harveyi strain for bacterial dynamicsanalysis of abalone infection. FEMS Microbiol. Lett. 289, 34–40.

Travers, M.A., da Silva, P.M., Le Goic, N., Marie, D., Donval, A., Huchette, S., et al., 2008b.Morphologic, cytometric and functional characterisation of abalone (Haliotistuberculata) haemocytes. Fish Shellfish Immunol. 24, 400–411.

Travers, M.A., Le Goic, N., Huchette, S., Koken, M., Paillard, C., 2008c. Summer immunedepression associated with increased susceptibility of the European abalone,Haliotis tuberculata to Vibrio harveyi infection. Fish Shellfish Immunol. 25,800–808.

Travers, M.A., Basuyaux, O., Le Goic, N., Huchette, S., Nicolas, J.L., Koken, M., et al.,2009a. Influence of temperature and spawning effort on Haliotis tuberculatamortalities caused by Vibrio harveyi: an example of emerging vibriosis linkedto global warming. Glob. Change Biol. 15, 1365–1376.

Travers, M.A., Le Bouffant, R., Friedman, C.S., Buzin, F., Cougard, B., Huchette, S., et al.,2009b. Pathogenic Vibrio harveyi, in contrast to non-pathogenic strains, interveneswith the p38 MAPK pathway to avoid an abalone haemocyte immune response.J. Cell. Biochem. 106, 152–160.

Travers, M.A., Meistertzheim, A.L., Cardinaud, M., Friedman, C.S., Huchette, S., Moraga,D., et al., 2010. Gene expression patterns of abalone, Haliotis tuberculata, duringsuccessive infections by the pathogen Vibrio harveyi. J. Invertebr. Pathol. 105,289–297.

van der Merwe, M., Franchini, P., Roodt-Wilding, R., 2011. Differential growth-relatedgene expression in abalone (Haliotis midae). Mar. Biotechnol. 13, 1125–1139.

Veiga, E., Cossart, P., 2006. The role of clathrin-dependent endocytosis in bacterialinternalization. Trends Cell Biol. 16, 499–504.

Vidal-Dupiol, J., Dheilly, N.M., Rondon, R., Grunau, C., Cosseau, C., Smith, K.M., et al.,2014. Thermal stress triggers broad Pocillopora damicornis transcriptomicremodeling, while Vibrio coralliilyticus infection induces a more targetedimmuno-suppression response. PLoS ONE 9, e107672.

Wang, G.D., Zhang, K.F., Zhang, Z.P., Zou, Z.H., Jia, X.W., Wang, S.H., et al., 2008a.Molecular cloning and responsive expression of macrophage expressed genefrom small abalone Haliotis diversicolor supertexta. Fish Shellfish Immunol. 24,346–359.

Wang, K.J., Ren, H.L., Xu, D.D., Cai, L., Yang, M., 2008b. Identification of theup-regulated expression genes in hemocytes of variously colored abalone(Haliotis diversicolor Reeve, 1846) challenged with bacteria. Dev. Comp. Immunol.32, 1326–1347.

Wang, N., Whang, I., Lee, J., 2008c. A novel C-type lectin from abalone, Haliotis discusdiscus, agglutinates Vibrio alginolyticus. Dev. Comp. Immunol. 32, 1034–1040.

Wang, S.H., Wang, Y.L., Zhang, Z.X., Jack, R., Weng, Z.H., Zou, Z.H., et al., 2004. Responseof innate immune factors in abalone Haliotis diversicolor supertexta to pathogenicor nonpathogenic infection. J. Shellfish Res. 23, 1173–1177.

Wiens, M., Korzhev, M., Krasko, A., Thakur, N.L., Perovic-Ottstadt, S., Breter, H.J., et al.,2005. Innate immune defense of the sponge Suberites domuncula against bacteriainvolves a MyD88-dependent signaling pathway – induction of a perforin-likemolecule. J. Biol. Chem. 280, 27949–27959.

Wilcoxon, F., 1945. Individual comparisons by ranking methods. Biometr. Bull. 1,80–83.

Wilmore, D.W., Shabert, J.K., 1998. Role of glutamine in immunologic responses.Nutrition 14, 618–626.

Wright, A.C., Simpson, L.M., Oliver, J.D., 1981. Role of iron in the pathogenesis of Vibriovulnificus infections. Infect. Immun. 34, 503–507.

Yuan, J.S., Reed, A., Chen, F., Stewart, C.N., 2006. Statistical analysis of real-time PCRdata. BMC Bioinformatics 7.

ARTICLE IN PRESS

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the Eu-ropean abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

11M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■