Gene 527 (2013) 376–383

Contents lists available at SciVerse ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Short Communication

Structural characterization and expression analysis of a beta-thymosinhomologue (Tβ) in disk abalone, Haliotis discus discus

Saranya Revathy Kasthuri a, H.K.A. Premachandra a, Navaneethaiyer Umasuthan a,Ilson Whang a, Jehee Lee a,b,⁎a Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Special Self-Governing Province 690-756, Republic of Koreab Marine and Environmental Institute, Jeju National University, Jeju Special Self-Governing Province 690-814, Republic of Korea

Abbreviations: Tβ, beta thymosin; ORF, open readingDNA; PCR, polymerase chain reaction; UTR, untranslatedpoly I:C, polyinosinic:polycytidylic acid; BAC, bacterial armuscular; qRT-PCR, quantitative real-time RT-PCR; PAMP,pattern; STAT, signal transducer and activator of transcrtranscription factor-1; C/EBPα, CCAAT-enhancer bindingprotein-1; HSF, heat shock factor; IRF-2, interferon regulateloid leukemia-1a; Lyf-1, lymphoid transcription factor-1brain-2; Egr-1, early growth response 1; ROR-α, RAR-reinterleukin-3; CFU, colony forming units.⁎ Corresponding author at: Marine Molecular Geneti

Life Sciences, College of Ocean Science, Jeju NationalAra-Dong, Jeju, 690-756, Republic of Korea. Tel.: +8756 3493.

E-mail address: jehee@jejunu.ac.kr (J. Lee).

0378-1119/$ – see front matter © 2013 Elsevier B.V. Alhttp://dx.doi.org/10.1016/j.gene.2013.04.079

a b s t r a c t

a r t i c l e i n f o

Article history:Accepted 23 April 2013Available online 13 May 2013

Keywords:Haliotis discus discusBeta thymosinLPSPoly I:CVibrio parahemolyticusGenomic characterization

Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobialpeptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved inprocesses such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis.Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our iden-tification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA pos-sessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The aminoacid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actinbinding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with mollus-kan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3exon–2 intron structure similar to the other homologues. In silico promoter analysis also revealed significanttranscription factor binding sites, providing evidence for the expression of this gene under different cellularconditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presencein all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge withlipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemo-cytes, affirming an immune-related role in invertebrates.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

The thymosins, named after their tissue of origin (thymus), aresmall polypeptides with molecular mass ranging from 1 to 15 kDa.They are classified into three groups based on their isoelectric point:the α-thymosins have pH b5; β-thymosins have pH between 5 and7; and the γ-thymosins have pH >7 (Hannappel and Huff, 2003).The β-thymosins are acidic peptides with a molecular mass of 5 kDa(Huff et al., 2001) and share high homology among members.

frame; cDNA, complementaryregion; LPS, lipopolysaccharide;tificial chromosome; i.m., intra-pathogen-associatedmoleculaription; Oct-1, octamer-bindingprotein alpha; AP-1, activator

ory factor-2; AML-1a, acutemy-; HSF, heat shock factor; Brn-2,lated orphan receptor A; IL-3,

cs Lab, Department of MarineUniversity, 66 Jejudaehakno,2 64 754 3472; fax: +82 64

l rights reserved.

β-Thymosins play significant roles in various physiological processes,including macrophage inhibition (Weller et al., 1988), T lymphocytedifferentiation (Low et al., 1981), stimulation of hormone releasing-factor secretion (Rebar et al., 1981), attachment and spreading of endo-thelial cells (Grant et al., 1995; Malinda et al., 1997), and cerebellumdevelopment (Gomez-Marquez and Anadon, 2002). Apart from thesefunctions, all β-thymosins are known to sequester actin (Nachmias,1993).

β-Thymosin homologues have been identified and characterizedfrom evolutionarily diverse organisms, ranging from mammals toechinoderms (Erickson-Viitanen and Horecker, 1984; Kannan et al.,2007; Low et al., 1981; Ruggieri et al., 1983; Safer and Chowrashi,1997; Stoeva et al., 1997; Yamamoto et al., 1992). Within the phylumMollusca, β-thymosins have been reported from the marine gastro-pods Haliotis diversicolor supertexta (abalone) (Wu and Wu, 2009)and Aplysia californica (California sea slug) (Romanova et al., 2006).Since the abalone does not possess an adaptive immune system, wewere intrigued by our discovery of a thymosin homologue in theabalone transcriptome. We investigated its molecular properties andas a preliminary step, we analyzed its transcript expression postimmune challenges. Here, we report the identification, and genomicand expression characterization of an invertebrate β-thymosin ho-mologue, HdTβ.

377S.R. Kasthuri et al. / Gene 527 (2013) 376–383

2. Materials and methods

2.1. Abalone rearing, tissue isolation, cDNA synthesis, cDNA libraryconstruction, and HdTβ identification

Animal acquisition, rearing, tissue isolation, cDNA synthesis, andcDNA library construction were performed as previously described (DeZoysa et al., 2008; Munasinghe et al., 2006; Nikapitiya et al., 2009). AcDNA sequence homologous to the earlier identified β-thymosins wasidentified using BLAST and was designated as HdTβ.

2.2. Abalone BAC library construction and HdTβ clone isolation

Disk abalones (H. discus discus) were obtained from the Dongjin ab-alone farm (Jeju, Republic of Korea) and gill tissues isolated fromhealthy abalones were used to construct a BAC library (Lucigen Corp.,USA). Briefly, genomic DNA was extracted from the gill and randomlysheared. The blunt ends of large inserts (>100 kb) were ligated to ob-tain anunbiased, full coverage library. Around92,160 clones, possessingan average insert size of 110 kb, were arrayed in 240 of 384-well micro-titer plates. BAC clones inoculated into the 384-deep well plates weregrown individually. Aliquots of the grown cultures were pooled withother clones from the same plate, the same row, or the same columnfor DNA preparation. They were further combined to form super pools(n = 20). Each super pool has a corresponding96-well plate containingits plate-pools, row-pools, and column-pools (P–R–C pools). The superpools were screened (with HdTβ-specific primers) during the firstround of PCR and plates, rows and columns were screened during thesecond round of PCR to determine the exact well containing the HdTβclone. The identified clone was isolated from the corresponding welland confirmed by colony PCR with HdTβ-specific primers. After confir-mation, the clone was subjected to GS-FLX titanium sequencing(Macrogen, Republic of Korea).

2.3. Bioinformatic analysis

The BLASTx program was used to identify a nucleotide sequencehomologous to β-thymosin. Conserved motifs were determinedusing Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan) andthe signal peptide was predicted using the SignalP Server (http://www.cbs.dtu.dk/services/SignalP/). Pairwise and multiple sequencealignments of HdTβ were generated using ClustalW2 (Thompson etal., 1994). Phylogenetic evolutionary analysis of HdTβ was performedwith the full-length amino acid sequences from GenBank andreconstructed using the maximum likelihood method in MEGA5(Tamura et al., 2011) with bootstrapping values taken from 5000 rep-licates. The amino acid identity percentages were calculated by theMatGAT program, using default parameters (Campanella et al., 2003).

2.4. Genomic and promoter sequence analysis

The gene and promoter region were identified from the abalone ge-nomic library using the BAC clone. The exon–intron structure wasdetermined by aligning mRNA to the genomic sequence of HdTβobtained from the BAC library using the Spidey program (http://www.ncbi.nlm.nih.gov/spidey/) (Wheelan et al., 2001). The exon–intronsizes of other β-thymosin homologues were deduced from the se-quence information available in GenBank and aligned using Spidey.The transcription initiation site was predicted using the NNPP version2.2 of the promoter predictor available in the Berkeley DrosophilaGenome Project (http://www.fruitfly.org/seq_tools/promoter.html). Theputative transcription factor binding sites were predicted usingTFSEARCH (Heinemeyer et al., 1998).

2.5. Tissue sampling and challenge experiments

Disk abalones (average body weight: ~50 g; average width: 8 cm;average height: 5 cm) were adapted to laboratory conditions (250 Ltanks filled with aerated seawater at 18 ± 1 °C) for one week priorto experimentation. To determine the normal tissue distributionpattern of HdTβ expression, gill, mantle, male gonad, female gonad,brain, hepatopancreas, adductor muscle, and digestive tract tissueswere harvested from unchallenged, active abalones (determined bythe general appearance and foot movement). Hemocytes were col-lected by centrifugation of the hemolymph (3000 ×g, 10 min, 4 °C).All the collected tissue samples were snap-frozen in liquid nitrogenand stored at −80 °C until use.

In order to understand the immunological relevance ofβ-thymosin, disk abaloneswere challengedwith LPS, poly I:C andVibrioparahemolyticus. For LPS challenge, purified LPS from Escherichia coli(055:B5; Sigma-Aldrich, USA) was dissolved in saline and administeredvia intramuscular (i.m.) injection at the rate of 500 μg/100 μL/abalone(~50 g). For poly I:C challenge, animals were intramuscularly injectedwith a 100 μL suspension of poly I:C in saline (500 μg per abalone)(5 mg/mL; Sigma-Aldrich). V. parahemolyticus were cultured in marinebroth for 16–20 h at 25 °C, while shaking at 200 rpm. The bacterialcells were harvested by centrifugation (7000 ×g, 5 min, 4 °C) andresuspended in saline (1 × 105 CFU/mL). Each abalone was injectedwith 100 μL of the suspension to achieve delivery of 1 × 104 CFU peranimal.

For all of the above challenges, four abalones were used at eachtime point and saline-injected animals were used as controls. Gills(which are the site of first contact with environmental pathogens)and hemocytes (which encapsulate invading pathogens) from thecontrol, saline-injected and immune-challenged animals were col-lected at post-injection (p.i.) time points of 3, 6, 12, 24, 48, 72 and120 h.

2.6. RNA isolation, cDNA synthesis, and transcriptional analysis

The mRNA isolation and cDNA synthesis from tissues in Section 2.5were performed as previously described (Revathy et al., 2012). The tis-sue distribution profiling was carried out by quantitative real-timeRT-PCR (qRT-PCR) with the tissue-specific cDNAs and HdTβ-specificprimers (sense: 5′-TGTGATTCAGTTCCCTGTCGCTGA-3′; antisense:5′-TGTCAGGTTTGTCACCCATGTTGG-3′). Expression of abalone ribo-somal protein L5 gene (accession no. EF103427)was detected as the in-variant control by using the gene-specific primers (sense: 5′-TCACCAACAAGGACATCATTTGTC-3′; antisense: 5′-CAGGAGGAGTCCAGTGCAGTATG-3′). The differential expression patterns of HdTβ following im-mune challenges were assessed by qRT-PCR of gill and hemocytesamples from unchallenged, saline-injected and immune-challengedabalones.

All qRT-PCR reactions were performed as described earlier on aThermal Cycler Dice™ Real Time System (Takara, Japan) (Revathy etal., 2012). The baselinewas set automatically by the accompanying soft-ware. The relative expression of HdTβ was determined by the Livakmethod,with the abalone ribosomal protein L5 gene as the endogenouscontrol gene. In gills and hemocytes, the relative fold-change in HdTβexpression after immune challenges was obtained by comparisonwith the saline-injected controls (at corresponding time points). Fortissue distribution profiling, the relative expression level calculated ineach tissue was compared with the respective expression level in thefemale gonad.

All data are presented in terms of relative mRNA expressed asmean ± standard deviation (SD). All experiments were performedin triplicate. Statistical analysis was performed using a two-tailedStudent's t-test. P-values of less than 0.05 were considered to indicatestatistical significance, with P-values less than 0.01 indicating ex-treme significance.

Table 1Identity and similarity percentages of HdTβwith other β-thymosin homologues, as de-termined by pairwise alignment analysis using the MatGAT program. The accessionnumbers of the corresponding homologues were obtained from GenBank.

S. no Organism Identity(%)

Similarity(%)

Genename

Accession no.

1 Haliotis discus discus 100 100 Tβ JX2359722 Haliotis diversicolor

supertexta79.5 88.6 Tβ ABW04622

3 Sycon raphanus 77.3 86.4 Tβ AAG089644 Aplysia californica 68.1 79.5 Tβ AAM224075 Paracentrotuslividus 75 81.8 Tβ CAD291446 Danio rerio 66.7 84.4 Tβ NP_9911447 Oncorhynchus mykiss 72.7 86.4 Tβ NP_0011178228 Bos taurus 72.7 79.5 Tβ4 DAA125499 Macropodus opercularis 75 79.5 Tβ AAL4785410 Xenopus (Silurana)

tropicalis77.3 84.1 Tβ4 NP_001037883

11 Paralichthys olivaceus 68.2 75 Tβ ACB9764712 Scophthalmus maximus 65.9 75 Tβ ABD6171713 Salmo salar 62.2 82.2 Tβ ACI6975614 Xenopus laevis 72.7 79.5 Tβ4 NP_00108432115 Mus musculus 72.7 79.5 Tβ4 NP_06725316 Homo sapiens 72.7 79.5 Tβ4 NP_06693217 Rattus norvegicus 72.7 79.5 Tβ4 NP_11239818 Lymnaea stagnalis 68.2 75 Tβ4 ABB85285

378 S.R. Kasthuri et al. / Gene 527 (2013) 376–383

3. Results

3.1. HdTβ identification and sequence and structure characterization

A554 bp cDNA contigwas identified to be homologous to previouslyidentified β-thymosins. The open reading frame (ORF) and encodedprotein sequence was obtained by subjecting the cDNA sequence toDNAssist. The 132 bp ORF encoded for a protein of 44 amino acids hada molecular mass of 4977 Da and an isoelectric point of 4.9. The nucleo-tide sequencewas submitted to GenBank and assigned the accession no.JX235972. The 3′-UTR harbored a polyadenylation signal (AATAAA) at1212 bp downstream from the transcription initiation site (TIS). A high-ly conserved actin-binding motif (18LKKTET23) which is responsible forthe initial interaction with G-actin was found. Glutamyl donors, whichcontribute to transglutaminase reactions, were found at positions Q24,Q37, and Q42. Multiple sequence alignment showed a high conservationamong the β-thymosin homologues and isoforms (Fig. 1). The identityand similarity percentages determined with the MatGAT programindicated that the highest identity (84%) and similarity (89%) werewith β12 thymosin homologues from the teleost Lateolabrax japonicasand another mollusk H. diversicolor supertexta, respectively (Table 1). Aphylogenetic tree constructed with β-thymosin homologues using themaximum likelihood method resulted in a distinctive tree structure,which suggested the evolution of β-thymosin homologues from aninvertebrate Lymnaea stagnalis. HdTβ was located closest to theβ-thymosin from the mollusk H. diversicolor supertexta (Fig. 2).

3.2. Genomic and promoter sequence characterization of HdTβ

HdTβ genome possessed 3 exons intervened by 2 introns (Fig. 3).The number of exons was found to be highly conserved in all theβ-thymosins, except for mouse and chicken homologues. The coding

Haliotis discus discus -MGD...KPDISEVATFDKGKLHaliotis diversicolor texta ----...---V-A--T---S--Sycon raphanus ----...---V----S---T--Paracentrotus lividus --A-...---V----S---S--Sus scrofa --S-...--EMA-IEK--ES--Gallus gallus --S-...---MA-IEK---S--Pongo abelii --S-...---MA-IEK---S--Bos taurus --S-...---MA-IEK---S--Rattus norvegicus --S-...---MA-IEK---S--Homo sapiens --S-...---MA-IEK---S--Chinchilla lanigera --S-...---MA-IEK---S--Mus musculus --S-...---MA-IEK---S--Capra hircus --S-...---MA-IEK---S--Macropus eugenii --S-...---MG-IQK-N-S--Xenopus laevis --S-...---MA-IEK---KA-Danio rerio --A-...--NMT-ITS---T--Salmo salar --S-...--NMR-ISS---T--Macaca mulatta --A-...---MG-I-S---A--Equus caballus --A-...---MG-I-S---A--Rattus norvegicus --A-...---MG-I-S---A--Homo sapiens --A-...---MG-I-S---A--Mus musculus --A-...---MG-I-S---A--Heterocephalus glaber --A-...---MG-I-S---A--Bos taurus --A-...---LG-INS---A--Sus scrofa --A-...---MG-INS---A--Oncorhynchus mykiss --S-...--NLE---S---T--Scophthalmus maximus --S-...-NDM---TN---S--Lymnaea stagnalis --S-...---L---SK---N--Paralichthys olivaceus --S-...-------TN--RT--Gillichthys mirabilis --S-...---VK--ES---TT-Scophthalmus maximus --S-...---V-A-KD--QS--Cyprinus carpio --S-...N-VKE--QK---RC-Aplysia californica --S-KHD-------TK---S--Anoplopoma fimbria --S-..A---V---SS-G-S--

.* : : *.. *

Fig. 1. Multiple sequence alignment of HdTβ with other homologues, accomplished by Clusaccession no. JX235972) is underlined. The actin-binding motif is underlined and the glutamfrom GenBank and the accession numbers are denoted in brackets. Residues identicalsemi-conserved residues are indicated by “:” and “.”, respectively.

exon sizes of HdTβ were similar to the other analyzed genomic struc-tures. The first exon encodes the 5′-UTR in its entirety. The startcodon begins at the 19th bp of the second exon, followed by 100 bpof the translated sequence. Hence, the second exon encodes for 33amino acids. The third exon possesses 35 bp of the translatedsequence, which codes for the next 11 amino acids, a stop codon(TGA), and the 3′-UTR. All exon–intron junctions conform to the5′-donor and 3′-acceptor consensus (GT-AG). A eukaryotic signal for

KKTETQEKNPLPSKETIEQEKAEQTK-- 44 (JX235972) --TDTEI-----T-----------G--- 43 (ABW04622) -----A------T--------RAS---- 42 (AAG08964) --A------T--T--------TA----- 41 (CAD29144) ---------------------QAGES— 44 (NP_001135463)---------------------QAGESK- 45 (AAQ55552) ---------------------QAGES— 44 (NP_001126333)---------------------QAGES— 44 (NP_001106702)---------------------QAGES— 44 (NP_112398) ---------------------QAGES— 44 (NP_066932) ---------------------QAGES— 44 (AAR26539) ---------------------QAGES-- 44 (NP_067253) ---------------------QAGES— 44 (ADU52989) ---------------------QAGES— 44 (AAQ16584) ---------------------QSTES— 44 (NP_001084321)R-----------T-------RQGESTP- 45 (NP_99114) -----RV-----T-------RKRESSH- 45 (ACI69756) ---------T--T--------RSEIS— 44 (NP_001180371)---------T--T--------RSEIS— 44 (AAM34215) ---------T--T--------RSEIS— 44 (AAA42248) ---------T--T--------RSEIS— 44 (AAH16731) ---------T--T--------RSEIS— 44 (NP_079560)---------T--T--------RSEIS— 44 (EHB11964) ---------T--T--------QAK---- 42 (DAA24569) ---------T--T--------QAK---- 42 (NP_001090951)------------T--------QASS--- 43 (NP_001117822)----------------------AE-S— 44 (ABD61716) --V--T------T----AQE-EA----- 41 (ABB85285) -----D---T--T--V--QE-SG----- 41 (ACB97647) --TT-N---T--T--V--QE-SGGSD— 44 (AAG13356) -----A---T--T------E-SG----- 41 (ABD61717) --TN-A---T--T--DI-EE-KAGDGAK 46 (AAS10353) -----H------T--TID-E-QG----- 44 (AAM22407) ------------PPSPALPCFQPLLLDV 47 (ACQ57889) :*. * **.** .

talW. The amino acid sequence derived from the HdTβ nucleotide sequence (GenBankyl donors “Q” are shaded in light gray. The HdTβ homologue sequences were obtainedto those in HdTβ are denoted by “–” and indicated by “*”. Highly conserved and

Fig. 2. Phylogenetic analysis of HdTβ with other β-thymosin homologous sequences.The tree was constructed by the maximum likelihood method in MEGA5 using thefull-length amino acid sequences. The β-thymosin homologous sequences wereobtained from GenBank, and the corresponding accession numbers are: Branchiostomabelcheri (AAK72482), Homo sapiens (NP_068832), Mus musculus (NP_001074436),Danio rerio (NP_001124169), Salmo salar (ACI70059), Bos taurus (NP_777048),Macropodus opercularis (AAL47854), Gallus gallus (NP_001001315), Xenopus tropicalis(NP_001037883), Strongylocentrotus purpuratus (NP_999791), Sycon raphanus(AAGO8963), Haliotis diversicolor supertexta (ABW04622), and Lymnaea stagnalis(ABB85285). Numbers above the line indicate percent bootstrap confidence valuesderived from 5000 replications.

379S.R. Kasthuri et al. / Gene 527 (2013) 376–383

termination of transcription (CA) was found 13 bp downstream ofthe polyadenylation signal surrounded by the GT-rich region, whichis a characteristic feature for the transcription termination.

A 1338 bp 5′-flanking region was obtained from the BAC clone, andfound to contain a putative TIS and a classical TATA box (at 25 bp up-stream of the TIS) (Fig. 4). TFSEARCH analysis of the proximal promoterregion (at 250 bp upstream of the TIS) predicted several pathogen-associated molecular pattern (PAMP)-activated transcription factorbinding sites, including activator protein-4 (AP-4), GATA-1 and -2,signal transducer and activator of transcription (STAT), HNF-3b, CCAAT-enhancer binding protein alpha (C/EBPα), octamer-binding transcriptionfactor-1 (Oct-1), HSF2, and activator protein-1 (AP-1). In silico analysis ofthe 5′-flanking region revealed the presence of other cis-regulatoryelement binding sites, such as SP1, C/EBPβ, and IRF-2, which may play avital role in the regulation of HdTβ expression and function. In addition,other transcription factor binding sites, such as AML-1a, Lyf-1, HSF-2,Ik-2, Brn-2, Egr-1 and ROR-α, were predicted.

3.3. Tissue distribution analysis of HdTβ

Tissue distribution analysis revealed constitutive expression ofHdTβ in all the tissues examined (Fig. 5). Hemocytes and mantleshowed the highest levels of expression (approximately equal ex-pression), with adductor muscle showing the next highest level ofexpression.

3.4. Transcriptional responsiveness of HdTβ to immune challenges(bacterial endotoxin LPS, viral stimulant poly I:C and intact bacteria(V. parahemolyticus))

In this study, LPS challenge stimulated HdTβ expression from 12 hp.i. to 120 h p.i. in both gills and hemocytes. Gills revealed the highestexpression level at 120 h p.i. (5.6-fold) while the highest level of ex-pression in hemocytes was observed at 72 h p.i. (3-fold) (Fig. 6A).Poly I:C injection led to elevated expression of HdTβ in gills atall-time points examined, similar to the LPS challenge with themaximum level of induction at 3 h p.i. (3-fold). But, in hemocytes,the most significantly enhanced expression occurred in the latephase (48 h p.i. — 2.5-fold) (Fig. 6B). V. parahemolyticus is a curved,rod-shaped, facultative aerobic, Gram-negative bacterium known tocause withering syndrome in abalone. In contrast to the LPS chal-lenge, V. parahemolyticus challenge did not enhance HdTβ expression

in gills whereas in hemocytes an elevation in expression was deter-mined from mid to late phase of the experiment with the highestexpression level at 24 h p.i (2.7-fold) (Fig. 6C).

4. Discussion

β-Thymosins are pleiotropic proteins involved in various physio-logical functions in vertebrates, including immune-related processes(Hannappel, 2007; Sun and Yin, 2007). A highly conserved actin bind-ing motif (18LKKTET23) was present in HdTβ similar to that of thevertebrate homologues. Although β-thymosin has been implicatedin many extracellular processes, its secretion outside the cells withouta signal peptide remains as an unsolved enigma (Hannappel and Huff,2003). A β-thymosin homologue was released into the extracellular en-vironment upon macrophage death induced by such immunostimulantsas LPS and poly I:C (Kannan et al., 2010); hence, it was theorized to play arole in repair processes. Multiple sequence alignment of HdTβ revealedhigh conservation with other homologues (Fig. 1). Phylogenetic analysisin the current study also indicated the distinctive nature of the HdTβ se-quence, as it clustered with other mollusk homologues, maintaining itsdistinct identity and being located close to theβ12 thymosin homologuesfrom trout and perch liver (Fig. 2). Highly conserved primary structure,higher identity with vertebrate homologues and distinct position in thephylogenetic tree affirm the unique characteristics of HdTβ, and suggestfunctions similar to that of its vertebrate counterparts.

The genome analysis of HdTβ revealed a 3 exon–2 intron structure.The Tβ4 and Tβ10 homologues share a genomic structure similar toHdTβ, making this structure a common characteristic of the β-thymosinfamily (Fig. 3). Although vertebrate homologues of Tβ11 and Tβ12 havebeen identified in trout (Salmo gairdneri) (Yialouris et al., 1992), their ge-nomic structural characterization had not been performed. The inverte-brate homologues were not discriminated into any particular family ofproteins (Romanova et al., 2006; Safer and Chowrashi, 1997; Wu andWu, 2009). The high degree of conservation between various vertebratesand invertebrates in terms of exon/intron arrangement suggests that astructural feature might have been critical for the preservation of theseβ-thymosin genes during evolution.

Promoter region analysis is a useful approach for beginning toelucidate the mechanisms of transcriptional activation of a gene andto annotate putative transcriptional regulatory elements. Promotercharacterization also gives an understanding of the strategies thatcan be employed to control the gene expression under particular con-ditions. HdTβ possessed various transcription factor binding sites inthe 5′ region similar to that of mouse β-thymosin, including SP1,AP-1, and Oct-1 (Fig. 4) (Li et al., 1996). The presence of an AP-1 tran-scription factor binding site would be consistent with the transcrip-tional activation of HdTβ in response to phorbol through an elementresponsible for iron-dependent translational regulation of esters,and subsequent T cell activation (Otero et al., 1993). Τhe mouseβ-thymosin possesses a TATA box-like motif (CATAAA) (Hsiao andSu, 2005) and the human β-thymosin homologue does not possessany TATA or CCAAT boxes (Yang et al., 2005). HdTβ possessed a clas-sical TATA box (TATAAA) upstream of the TIS. The presence of Egr-1and an Elk1 cis-regulatory element suggests that HdTβ may be acti-vated by stress-inducing agents, during healing and wound repair, re-spectively (Braddock, 2001; Li et al., 2000). AP-1 is a significanttranscription factor playing a vital role in the activation of macro-phages (Munoz et al., 1996; Wang et al., 1994). The presence of atranscription factor binding site for HSF-2 suggests that HdTβ expres-sion may be regulated during stress, and the presence of sites forAML-1a and Lyf-1 suggests that its expression may be regulated dur-ing IL-3 activation and lymphocyte development and differentiation,respectively (Lo et al., 1991; Uchida et al., 1997). The existence offew other transcription factors essential for the differentiation ofmacrophages and their activation through AML1 and GATA-2 alsosuggest an immunological role (Valledor et al., 1998; Zhang et al.,

1181

425

419

395

400

407

414

281

276

279

271

100 35

100 35

259

Homo sapiens Tβ10

Mus musculus Tβ10

100 28Bos taurus Tβ10

100 35Rattus norvegicus Tβ10

100 38

Danio rerio Tβ

100 28

280Sus scrofa Tβ10

100 35Homo sapiens Tβ4

100 35Mus musculus Tβ4

100 35Rattus norwegicus Tβ4

100 35Bos taurus Tβ4

100 35Gallus gallus Tβ4

100 35Sus scrofa Tβ4

100 35Pan troglodytes Tβ4

80

284

15

252

219

27053

277

15

252

63

313

13

252

55

1055

11

178

63

277

15

258

62

277

16

416

113 16

1055

47408

16

1002 397

41

1033

14

407

132

1086

1557

69 17

516 414

392

2213

100 35142

481

18

259Haliotis discus discus Tβ

Fig. 3. Genomic structure comparison of HdTβ with that of other β-thymosin homologues. The exon–intron structures were deduced using Spidey from NCBI for Danio rerioTβ10 (mRNA: NP_991144; Ch, 21: NC_007132.5 (25782916..25785531)), Mus musculus Tβ10 (mRNA: NP_001177256; Ch, 6: NC_000072.5 (72907341..72908742)), Homo sapiensTβ10 (mRNA: NP_066926; Ch, 2: NC_000002.11 (85132763..85133799)), Bos taurus Tβ10 (mRNA: NP_777048; Ch, 11: AC_000168.1 (49933204..49934214)), Rattus norvegicus Tβ10(mRNA: NP_067084; Ch, 4: NC_005103.2 (106286030..106287089)), Sus scrofa Tβ10 (mRNA: NP_001090951; Ch, 3: NC_010445.3 (62820778..62821794)), Homo sapiens Tβ4(mRNA: NP_066932; Ch, X: NC_000023.10 (12993226..12995346)), Mus musculus Tβ4 (mRNA: NP_067253; Ch, X: NC_000086.6 (163645026..163647150)), Rattus norvegicusTβ4 (mRNA: NP_067084; Ch, X: AC_000089.1), Bos taurus Tβ4 (mRNA: NP_001002885; Ch, X: AC_000187.1 (140973702..140975750)), Gallus gallus Tβ4 (mRNA:NP_001001315; Ch, 1: NC_006088.3 (122807428..122807976)), Sus scrofa Tβ4 (mRNA: NP_001135463; Ch, X: NC_010461.2 (8601589..8603690)), Pan troglodytes Tβ4 (mRNA:XP_520932; Ch, X: NC_006491.3 (12899705..12902060)). The translated/coding regions are denoted by dark shaded boxes and the introns are denoted by lines. Exon sizes areindicated above the exon boxes, and intron lengths are shown below the intron lines. Untranslated regions at the 5′- and 3′-ends are denoted by dotted boxes.

380 S.R. Kasthuri et al. / Gene 527 (2013) 376–383

1996). The presence of β-thymosin and the transcriptional regulatoryelement in abalone will provide an opportunity for dissecting themolecular mechanisms in invertebrates. The combined or individualactivation of these immunologically relevant transcription factorsbased on different cellular stress/pathogenic signals determines thetight regulation and activation of β-thymosin in disk abalone.

HdTβ revealed the highest level of expression in hemocytes andmantle (Fig. 5), suggesting an immune-related role in disk abalone.Hemocytes are major defense cells in mollusks playing a vital rolein chemotaxis, antigen recognition, phagocytosis, delivering of anti-microbial factors to the place of infection, exclusion of foreign in-vaders by oxidative burst and also by agglutination (Bugge et al.,2007; Donaghy et al., 2010). Mantle as an exoskeleton is the firstline of defense, which also show the highest lysozomal and anti-bacterial activity in mollusks (Chikalovets et al., 2010; Haug et al.,2004; Venier et al., 2011). Similarly in H. diversicolor supertexta, thehigher expression of β-thymosin was observed in hemocytes (Wuand Wu, 2009).

In our study, an appreciable level of expression of HdTβ wasobserved in the brain, similar to that of mammalian homologues(Gomez-Marquez and Anadon, 2002). A functional role of thymosinsin neuronal development has been demonstrated in mollusks, fish andmammals (Choe et al., 2005; Colby et al., 2005; Roth et al., 1999). Thy-mosins were once believed to be thymic-specific hormones, but werethen later detected in other tissues. Tβ4 shows ubiquitous expressionin rat. The role that thymosin plays in the developmental stages oforgans such as the thymus, spleen, lung, kidney, adrenal gland,heart, and liver has been studied (Goodall et al., 1983; Lin andMorrison-Bogorad, 1990). In our current study, appreciable levels ofexpression were detected in the adductor muscle, the tissue thatdepends to a great extent on actin for its contraction and locomotionfunctions. In contrast, relatively low levels of expression were observedin the digestive tract and gills, similar to that of the gastropod abalonehomologue (Wu and Wu, 2009).

Post immune challenges, HdTβ showed elevated expression in thegill and hemocytes (Figs. 6A, B, C). β-Thymosin was first discovered as

ACGTGAGCGCGAGGCAGTGCAGGGGGTACGCTGTAGGTCGTTAATCCGTGTCTCGGGTGCAAATACAGGCGTCTACGGCGA -1115 C-myc Sp1 TCTATGTTGCAAAGCACTTCAATATTTACCTCCGGCTAATGTGAAATGAAAACTGAGGGACCTTGATTAACCCACGTGGTC -1034

Elk1 ISRE ROR alpha C-myc TCGCATGTTGGACAGTGTTCGGGACAAAATATTGGTTTATGCCGGGACTATTTACAGAGAGGACAGACGAGGGGAACAGTT -953

Ik-2 GTAATAAATAAGTTGTGATCATTGGCGACACAACATATGCCTACGTATTATACGCGGATTCCATGGCCCAGTCAAGCCTTC -872

AML-1a Egr-1 TCTTTACCCAAAAAATATCGGACTTTACTTGTTTTCCTGCAGAGCGATGACCGAAACAGAGGGTGCGTCCCAGCACTCCAT -791 IRF-2 HNF-3b GCGTCGTTTCAGCTACACAGGAGAATGTGTCTATAGACTGTAATTGTAGGCAGGATCTCGGTGCAAACTCTCAAACAGCTG -710

AP-4 AGAAACCCGTCTACGGCTCTACAAATTATTTATAAGTCCACTTACGCTCCTTAAACATGGCTTGGGCAATCTCCCCATACA -629

C/EBPTACTTCCCTAGATGATGAGGATGGTTATGTAGGCTAATGGTATGTAATACTAAGATTGCTCATAAGTGATCATAGTGAATA -548

ATCAGAATGGAAATGATAACATTGAACATTATTATGAAAATATTAGAATTCCCAAGAATATTAATTTCCCGAGTCACCGGC -467AP-1

ATTGAAAATAATAACAAACACGATATGATGTCCCGCCCAAAAGATCATCCAAATGCACATACCATGTAACGCTATTATTCC -386 Brn-2 Lyf-1

CATATCATATCATCCTCGCTGTACTCCCCACCCAGGAATAATCCCTTCTCTGCCTCCCCAGATGTTTTTCTAGTAAGAAAT -305 GATA-2 STAT-x

GGGGCATGTGGCCGGCTGTTACTCTGACGGACGATTCTTTAAATCACTGTCTGGATTCTTTGCATTCCATTCATTCATTTT -224 AP-4 GATA-1 HNF-3b C/EBP

GCTGAAGCAGCCATGACCTTTTTGAAAATTACCATGGCAACTCGCACTTTTAAATTTCACATTTTTAGAAAATACGAACAC -143 Oct-1 HSF2

ATTTACTTCCTCAGCACATGACTCAAACAGTGTATAAACTGTACAATGATATCAGACTGGAATGACAGTTTTACTTTTGGG 018 AP-1 TATA

CCCCATGTGCTATGCTGTGCTTCCTTGACACATCGCCGATGAATCATGCGTGAAGACAAAATAGATCCCACATGTTTCTGGA 100 AAAAAGGCGTGGCCTCTTCAGAAACACTATACGTACTATGTTATAACGGCATTAACGTGAAATCTATTCCATCCGTACTTAT 182 TTTGTATATGAGCCGTGTTGTCGACTCGTATGCTTCACTACGTTTATAACAATCCGCGGGAAGTGAGAAGTCCGCGCTCATT 264 TGTATTCCTGCGCTGTGATTCAGTTCCCTGTCGCTGACGGCTTCAGACTAGTACAGCTCAAGCAGACGGCCAACGCAGACGA 346 CACTTTTCTCATTCTCCTGGTAAGTATACAACTCTACGATAAATCTGAAATGATAAACCTTAAATTTAACTGTTATTACATC 428 TAGCATTAATCCTAACCCAAATTCTTCACAATTATGCTATTAAAATTTTAATATCACGAGTTCTGGGCGAGACGTCTCCTAT 510 CAATGTTTGATCGAATCCAGTACCTAAATCTACTGTTTGTTCAGATGAATGCACAGTGCATATTCGGCAGCCGAGGAAATAC 592 ACCATGTCATATTTGCTTAACACAATGAGGAATATTTCTAGTAATGTGAAATTCAAACACATCGACTGGAGCCCCGTTGTGG 674 CATCCTTTGTGGCTGGTAGACGCCGTTATCGATCTCCGGCTGCCTGCTGGGGGAGGGGGAAGCAGGGAGGGGATGTTTGATG 756 TCTGGAACAAAGACCCTCCCTGTCTGGAGAGAGACGCAGTCTGTCTGTCAACGGCAGGACCTCACTTGTGTTTTTAACTTTT 838 TGTTACAGATTCCCTTATAGTCCAACATGGGT 870

*

Fig. 4. Analysis of the HdTβ gene 5′-flanking region. The transcription factor binding sites are in bold, colored, and denoted with the corresponding name below. The TATA box(TATAAA) is boxed. The transcription initiation site is denoted by “ ”. The start codon is marked in red and denoted by “*”. The first intron is denoted by the consensus splice se-quence GT at the 5′-end and the AG at the 3′-end and both are shaded in light gray.

381S.R. Kasthuri et al. / Gene 527 (2013) 376–383

a fragment of ubiquitin, which is the ATP-dependent proteolysis factoressential to the proteasome involved in the MHC class antigen presen-tation pathways (Schlesinger et al., 1975). Later, Tβ4 was determinedto participate in lymphocyte differentiation (Low et al., 1981),to inhibit macrophage migration (Weller et al., 1988), and to exert

0

5

10

15

20

25

30

35

GF Dt Hp Gl Br GM Mu Ml Hm

Tissues

HdT

mR

NA

exp

ress

ion

Tissue distribution of HdT β

β

Fig. 5. Tissue distribution of HdTβ. HdTβ tissue-specific expression in adductor muscle(Mu), gill (Gl), brain (Br), hemocytes (Hm), hepatopancreas (Hp), digestive tract (Dt),female gonad (GF), male gonad (GM), and mantle (Ml) collected from unchallengedabalone was analyzed using qRT-PCR. Relative mRNA expression was calculatedusing the Livak method, with abalone ribosomal protein L5 gene as the invariant con-trol. In order to determine tissue-specific expression, the relative mRNA level was com-pared with expression in the female gonad. Data are presented as mean values (n = 3)with error bars representing standard deviation (SD).

hormonal effects on the hypothalamus and pituitary gland (Rebar etal., 1981). Oxidation of methionine at position 6 of Tβ4 was shownto result in the formation of Tβ4 sulfoxide,which inhibits the inflamma-tory response (Young et al., 1999) and is a significant event in thepathogen-induced suppression of host cells during infection. Tβ4 pos-sesses chemoattractant activity, exerted by stimulation of the direction-al migration of endothelial cells to a wounded area and promotesangiogenic processes (Malinda et al., 1997). Although different thymo-sin isoforms have been reported, themost abundant and best studied isTβ4 (Goldstein et al., 2005). Evidence of the presence of β-thymosin(Kannan et al., 2007) and its ability to repress NF-κB activity in humancorneal epithelium (Sosne et al., 2007) reaffirm the immunologicalrole of β-thymosin.

The Tβ12 isoform shares high identity with Tβ11. Tβ11 is a Tβ4analog in the bony fish species, oscar and rainbow trout (Yialouriset al., 1992). Furthermore, the identification of a distinct Tβ12 peptidefrom perch liver (Low et al., 1992; Yialouris et al., 1992) suggests thatthis isoform may have undergone evolutionary modification to sus-tain itself in all forms of life. V. parahemolyticus induced HdTβ mRNAup-regulation in hemocytes which seems to be a tissue specificevent since no transcriptional modulation was observed in the gills.Similarly, up-regulation of β-thymosin was observed in hemocytesof other abalones after bacterial challenge (Wang et al., 2008), furthersuggesting a role in immune defense against pathogenic infection.HdTβ showed higher identity with the other Tβ4 homologues, as wellas up-regulation of expression upon challengewith the PAMP-like stim-ulants, LPS and poly I:C, and live Gram-negative bacteria, which suggest

Fig. 6. HdTβ expression analysis after immune challenge. HdTβ expression was analyzedin post-LPS (A), poly I:C (B), and V. parahemolyticus (C) challenged gills and hemocytesusing qRT-PCR. Relative mRNA expression was calculated by the 2−ΔΔCt method relativeto saline-injected controls and normalized with the same abalone ribosomal protein L5gene as the reference. Data are presented as mean values (n = 3) with error barsrepresenting SD. *P b 0.05, **P b 0.01.

382 S.R. Kasthuri et al. / Gene 527 (2013) 376–383

that it may possess a similar function in abalone. The initial induction ofHdTβ expressionmay be attributed to a function in macrophages, whilethe late phase induction may reflect functions in healing, tissue repair,and angiogenesis, all of which contribute to the defense mechanism.

β-Thymosins in zebrafish have significant roles in a broad range ofphysiological processes, including actin sequestering, neurite devel-opment, T lymphocyte differentiation, angiogenesis, wound healing,tissue repair, and formation of the axonal tract (Roth et al., 1999).However, involvement of various β-thymosin homologues in immu-nological processes, such as NF-κB repression resulting in a potentialanti-inflammatory pathway and other functions together suggeststhat the evolutionary subsistence of this small acidic peptide mayhave been particularly flexible in regard to function.

Herein, we have reported the molecular and genomic characteri-zation and transcriptional profiling of an invertebrate β-thymosin ho-mologue from the disk abalone H. discus discus. Furthermore, we havediscussed the possible immunological role of this novel peptide in theinvertebrate system, which provides direction for future studies ofthe functional roles of this peptide in other invertebrates.

Conflict of interest statement

There is no conflict of statement for this manuscript.

Acknowledgment

This research was supported by funding from the Marine and Ex-treme Genome Research Center Program of the Ministry of Land, Trans-portation and Maritime Affairs, Republic of Korea and from the MKE(Ministry of Knowledge Economy), Korea, under the ITRC (InformationTechnology Research Center) support program supervised by the NIPA(National IT Industry Promotion Agency) (NIPA-2013-H0301-13-2009).

References

Braddock, M., 2001. The transcription factor Egr-1: a potential drug in wound healingand tissue repair. Ann. Med. 33, 313–318.

Bugge, D.M., Hegaret, H., Wikfors, G.H., Allam, B., 2007. Oxidative burst in hard clam(Mercenaria mercenaria) haemocytes. Fish Shellfish Immunol. 23, 188–196.

Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates sim-ilarity/identity matrices using protein or DNA sequences. BMC Bioinforma. 4, 29.

Chikalovets, I., Chernikov, O., Shekhova, E., Molchanova, V., Lukyanov, P., 2010. Changesin the level of lectins in the mantle of the mussel Mytilus trossulus in response toanthropogenic contaminants. Russ. J. Mar. Biol. 36, 70–74.

Choe, J., Sun, W., Yoon, S.Y., Rhyu, I.J., Kim, E.H., Kim, H., 2005. Effect of thymosin beta15on the branching of developing neurons. Biochem. Biophys. Res. Commun. 331,43–49.

Colby, G.P., Sung, Y.J., Ambron, R.T., 2005. mRNAs encoding the Aplysia homologues offasciclin-I and beta-thymosin are expressed only in the second phase of nerveinjury and are differentially segregated in axons regenerating in vitro and invivo. J. Neurosci. Res. 82, 484–498.

De Zoysa, M., Pushpamali, W.A., Whang, I., Kim, S.J., Lee, J., 2008. Mitochondrialthioredoxin-2 from disk abalone (Haliotis discus discus): molecular characteriza-tion, tissue expression and DNA protection activity of its recombinant protein.Comp. Biochem. Physiol. B Biochem. Mol. Biol. 149, 630–639.

Donaghy, L., Hong, H.-K., Lambert, C., Park, H.-S., Shim, W.J., Choi, K.-S., 2010. First char-acterisation of the populations and immune-related activities of hemocytes fromtwo edible gastropod species, the disk abalone, Haliotis discus discus and thespiny top shell, Turbo cornutus. Fish Shellfish Immunol. 28, 87–97.

Erickson-Viitanen, S., Horecker, B.L., 1984. Thymosin beta 11: a peptide from trout liverhomologous to thymosin beta 4. Arch. Biochem. Biophys. 233, 815–820.

Goldstein, A.L., Hannappel, E., Kleinman, H.K., 2005. Thymosin beta4: actin-sequesteringprotein moonlights to repair injured tissues. Trends Mol. Med. 11, 421–429.

Gomez-Marquez, J., Anadon, R., 2002. The beta-thymosins, small actin-bindingpeptides widely expressed in the developing and adult cerebellum. Cerebellum 1,95–102.

Goodall, G.J., Hempstead, J.L., Morgan, J.I., 1983. Production and characterization ofantibodies to thymosin beta 4. J. Immunol. 131, 821–825.

Grant, D.S., et al., 1995. Matrigel induces thymosin beta 4 gene in differentiating endo-thelial cells. J. Cell Sci. 108 (Pt 12), 3685–3694.

Hannappel, E., 2007. Beta-thymosins. Ann. N. Y. Acad. Sci. 1112, 21–37.Hannappel, E., Huff, T., 2003. The thymosins. Prothymosin alpha, parathymosin, and

beta-thymosins: structure and function. Vitam. Horm. 66, 257–296.Haug, T., Stensvåg, K., Olsen, Ø.M., Sandsdalen, E., Styrvold, O.B., 2004. Antibacterial

activities in various tissues of the horse mussel, Modiolus modiolus. J. Invertebr.Pathol. 85, 112–119.

Heinemeyer, T., et al., 1998. Databases on transcriptional regulation: TRANSFAC, TRRDand COMPEL. Nucleic Acids Res. 26, 362–367.

Hsiao, H.L., Su, Y., 2005. Identification of the positive and negative cis-elements in-volved in modulating the constitutive expression of mouse thymosin beta4 gene.Mol. Cell. Biochem. 272, 75–84.

Huff, T., Muller, C.S., Otto, A.M., Netzker, R., Hannappel, E., 2001. Beta-thymosins, smallacidic peptides with multiple functions. Int. J. Biochem. Cell Biol. 33, 205–220.

Kannan, L., Rath, N.C., Liyanage, R., Lay Jr., J.O., 2007. Identification and characterizationof thymosin beta-4 in chicken macrophages using whole cell MALDI-TOF. Ann. N.Y. Acad. Sci. 1112, 425–434.

Kannan, L., Rath, N.C., Liyanage, R., Lay Jr., J.O., 2010. Effect of toll-like receptor activa-tion on thymosin beta-4 production by chicken macrophages. Mol. Cell. Biochem.344, 55–63.

Li, X., Zimmerman, A., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Yin, H.L., 1996. Themouse thymosin beta 4 gene: structure, promoter identification, and chromosomelocalization. Genomics 32, 388–394.

383S.R. Kasthuri et al. / Gene 527 (2013) 376–383

Li, Q.J., Vaingankar, S., Sladek, F.M., Martins-Green, M., 2000. Novel nuclear target forthrombin: activation of the Elk1 transcription factor leads to chemokine geneexpression. Blood 96, 3696–3706.

Lin, S.C., Morrison-Bogorad, M., 1990. Developmental expression of mRNAs encodingthymosins beta 4 and beta 10 in rat brain and other tissues. J. Mol. Neurosci. 2,35–44.

Lo, K., Landau, N.R., Smale, S.T., 1991. LyF-1, a transcriptional regulator that interactswith a novel class of promoters for lymphocyte-specific genes. Mol. Cell. Biol. 11,5229–5243.

Low, T.L., Hu, S.K., Goldstein, A.L., 1981. Complete amino acid sequence of bovinethymosin beta 4: a thymic hormone that induces terminal deoxynucleotidyltransferase activity in thymocyte populations. Proc. Natl. Acad. Sci. U. S. A. 78,1162–1166.

Low, T.L., Liu, D.T., Jou, J.H., 1992. Primary structure of thymosin beta 12, a newmemberof the beta-thymosin family isolated from perch liver. Arch. Biochem. Biophys. 293,32–39.

Malinda, K.M., Goldstein, A.L., Kleinman, H.K., 1997. Thymosin beta 4 stimulates direc-tional migration of human umbilical vein endothelial cells. FASEB J. 11, 474–481.

Munasinghe, H., Kang, H.S., Lee, J., 2006. Analysis of digestive gland expressed sequencetag library from the disk abalone, Haliotis discus discus. J. World Aquac. Soc. 37,96–106.

Munoz, C., et al., 1996. Pyrrolidine dithiocarbamate inhibits the production ofinterleukin-6, interleukin-8, and granulocyte-macrophage colony-stimulating fac-tor by human endothelial cells in response to inflammatory mediators: modulationof NF-kappa B and AP-1 transcription factors activity. Blood 88, 3482–3490.

Nachmias, V.T., 1993. Small actin-binding proteins: the beta-thymosin family. Curr.Opin. Cell Biol. 5, 56–62.

Nikapitiya, C., et al., 2009. Molecular cloning, characterization and expression analysisof peroxiredoxin 6 from disk abalone Haliotis discus discus and the antioxidantactivity of its recombinant protein. Fish Shellfish Immunol. 27, 239–249.

Otero, A., Bustelo, X.R., Pichel, J.G., Freire, M., Gomez-Marquez, J., 1993. Transcriptlevels of thymosin beta 4, an actin-sequestering peptide, in cell proliferation.Biochim. Biophys. Acta 1176, 59–63.

Rebar, R.W., Miyake, A., Low, T.L., Goldstein, A.L., 1981. Thymosin stimulates secretionof luteinizing hormone-releasing factor. Science 214, 669–671.

Revathy, K.S., et al., 2012. A novel acute phase reactant, serum amyloid A-like 1, fromOplegnathus fasciatus: genomic and molecular characterization and transcriptionalexpression analysis. Dev. Comp. Immunol. 37 (2), 294–305.

Romanova, E.V., et al., 2006. Identification and characterization of homologues ofvertebrate beta-thymosin in the marine mollusk Aplysia californica. J. MassSpectrom. 41, 1030–1040.

Roth, L.W., Bormann, P., Bonnet, A., Reinhard, E., 1999. Beta-thymosin is required foraxonal tract formation in developing zebrafish brain. Development 126, 1365–1374.

Ruggieri, S., Erickson-Viitanen, S., Horecker, B.L., 1983. Thymosin beta arg10, a majorvariant of thymosin beta 10 in rabbit tissues. Arch. Biochem. Biophys. 226, 388–392.

Safer, D., Chowrashi, P.K., 1997. Beta-thymosins from marine invertebrates: primarystructure and interaction with actin. Cell Motil. Cytoskeleton 38, 163–171.

Schlesinger, D.H., Goldstein, G., Niall, H.D., 1975. The complete amino acid sequence ofubiquitin, an adenylate cyclase stimulating polypeptide probably universal inliving cells. Biochemistry 14, 2214–2218.

Sosne, G., Qiu, P., Christopherson, P.L., Wheater, M.K., 2007. Thymosin beta 4 suppres-sion of corneal NFkappaB: a potential anti-inflammatory pathway. Exp. Eye Res. 84,663–669.

Stoeva, S., Horger, S., Voelter, W., 1997. A novel beta-thymosin from the sea urchin:extending the phylogenetic distribution of beta-thymosins frommammals to echi-noderms. J. Pept. Sci. 3, 282–290.

Sun, H.Q., Yin, H.L., 2007. The beta-thymosin enigma. Ann. N. Y. Acad. Sci. 1112, 45–55.Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: mo-

lecular evolutionary genetics analysis using maximum likelihood, evolutionarydistance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity ofprogressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Uchida, H., Zhang, J., Nimer, S.D., 1997. AML1A and AML1B can transactivate the humanIL-3 promoter. J. Immunol. 158, 2251–2258.

Valledor, A.F., Borras, F.E., Cullell-Young, M., Celada, A., 1998. Transcription factors thatregulate monocyte/macrophage differentiation. J. Leukoc. Biol. 63, 405–417.

Venier, P., et al., 2011. Insights into the innate immunity of the Mediterranean musselMytilus galloprovincialis. BMC Genomics 12, 69.

Wang, C.Y., Bassuk, A.G., Boise, L.H., Thompson, C.B., Bravo, R., Leiden, J.M., 1994. Acti-vation of the granulocyte-macrophage colony-stimulating factor promoter in Tcells requires cooperative binding of Elf-1 and AP-1 transcription factors. Mol.Cell. Biol. 14, 1153–1159.

Wang, K.-J., Ren, H.-L., Xu, D.-D., Cai, L., Yang, M., 2008. Identification of the up-regulatedexpression genes in hemocytes of variously colored abalone (Haliotis diversicolorReeve, 1846) challenged with bacteria. Dev. Comp. Immunol. 32, 1326–1347.

Weller, F.E., Mutchnick, M.G., Goldstein, A.L., Naylor, P.H., 1988. Enzyme immunoassaymeasurement of thymosin beta 4 in human serum. J. Biol. Response Mod. 7, 91–96.

Wheelan, S.J., Church, D.M., Ostell, J.M., 2001. Spidey: a tool for mRNA-to-genomicalignments. Genome Res. 11, 1952–1957.

Wu, L., Wu, X., 2009. Molecular cloning and expression analysis of a beta-thymosinhomologue from a gastropod abalone, Haliotis diversicolor supertexta. Fish ShellfishImmunol. 27, 379–382.

Yamamoto, M., et al., 1992. Expression of thymosin beta 4 gene during Xenopus laevisembryogenesis. Biochem. Biophys. Res. Commun. 184, 93–99.

Yang, S.P., Lee, H.J., Su, Y., 2005. Molecular cloning and structural characterization ofthe functional human thymosin beta4 gene. Mol. Cell. Biochem. 272, 97–105.

Yialouris, P.P., et al., 1992. The complete sequences of trout (Salmo gairdneri) thymosinbeta 11 and its homologue thymosin beta 12. Biochem. J. 283 (Pt 2), 385–389.

Young, J.D., et al., 1999. Thymosin beta 4 sulfoxide is an anti-inflammatory agent gen-erated by monocytes in the presence of glucocorticoids. Nat. Med. 5, 1424–1427.

Zhang, D.E., et al., 1996. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBFalpha2) synergistically activate the macrophage colony-stimulating factor receptorpromoter. Mol. Cell. Biol. 16, 1231–1240.