The Discovery of Vitamins - Karger Publishers

100

International Union of Nutritional Sciences (IUNS)

Federation of European Nutrition Societies (FENS)

IUNS

An Official Journal of

S. KargerMedical and Scientifi c PublishersBasel . Freiburg . Paris . London . New York . New Delhi . Bangkok . Beijing . Tokyo . Kuala Lumpur . Singapore . Sydney

Ann Nutr Metab61(3) 181–270 (2012) 61 | 3 | 12 print

ISSN 0250–6807onlinee-ISSN 1421–9697

www.karger.com/anm

ISBN 978–3–318–02288–9

The Discovery of Vitamins100th Anniversary Special Issue

EditorsR.D. Semba, Baltimore, Md.K. Kraemer, Basel

An up-to-date and comprehensive handbook

The easiest way to order : w w w.karger.com/wrund

Vitamin A plays a key role among the vitamins es-sential for healthy growth and development. Vitamin A defi ciency disorders (VADD) are therefore an im-portant part of general malnutrition that in the ma-jority of cases leads to failure to thrive and under-weight. Moreover, apart from adverse eff ects on health and survival in general, VADD can also lead to blindness, called xerophthalmia, and are also fre-quently accompanied by various infections. Last but not least, it has become evident that even mild de-grees of VAD (and all other forms of nutritional defi -ciencies) have important adverse implications for health and are thus much more widespread than previously assumed.This publication systematically covers detailed and up-to-date information on every relevant aspect of VADD, with particular emphasis on providing an out-line of their setting, nature, and signifi cance. In addi-tion to cutting-edge scientifi c information, the latest available data on the global occurrence of VAD from the World Health Organization is also included.

Contents

AcknowledgementsPrefaceForeword

• Foreground• Vitamin A in Nature• Methods of Analysis• Food Sources• Bioavailability of Carotenoids• Vitamin A in Health• Assessment of Vitamin A Status• Xerophthalmia• Mortality and Morbidity Especially in

Relation to Infections• Other Eff ects of VAD• Interaction of Vitamin A and

Other Micronutrients• Global Occurrence• Epidemiology• Retinoids and Carotenoids in

General Medicine• Control

Manual on Vitamin A Defi ciency Disorders (VADD)EditorsDonald S. McLarenKlaus Kraemer

World Review of Nutrition and Dietetics

Editor: B. Koletzko

Vol. 103

Manual on Vitamin A Deficiency Disorders (VADD)Editors

D.S. McLarenK. Kraemer

cLarenmer

ADD

Karger – Medical and Scientifi c PublishersCH–4009 Basel, [email protected], f: +41 61 306 12 34www.karger.com

Dear Librarian

I have reviewed this publication and would like to recommend it for our library.

Recommended by:

Department:

Date:

Signature:

Orders may be placed with any bookshop, subscription agency, directly with the publisher or through a Karger distributor.

Manual on Vitamin A Defi ciency Disorders (VADD)Editors: McLaren, D.S. (Worthing); Kraemer, K. (Basel)XII + 192 p., 76 fi g., 4 in color, 55 tab., hard cover, 2012CHF 196.– / EUR 163.– / USD 231.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02143–1e-ISBN 978–3–318–02144–8

World Review of Nutrition and Dietetics, Vol. 103Series Editor: Koletzko, B. (Munich)Listed in MEDLINE/PubMed

KI12649

Printed in Switzerland on acid-free and non-aging paper (ISO 9706) by Reinhardt Druck, Basel

Appears every 6 weeks: 2 volumes per year (8 issues)

Editor

B. Koletzko, Munich

Assistant Editor

B. Kessler, Munich

Associate Editors

P.S.W. Davies, Brisbane, Qld.L. de Groot, WageningenG. Desoye, GrazA. Gil, GranadaJ. Heinrich, NeuherbergR. Meier, LiestalS. Nagata, IzunokuniL. Poston, LondonM. Schulze, NuthetalM.B. Zimmermann, Zurich

Editorial Board

A. Astrup, CopenhagenA. Berg, FreiburgZ.A. Bhutta, KarachiS.C. Bischoff, StuttgartF. Branca, RomeR. Brigelius-Flohé, NuthetalP.C. Calder, SouthamptonS. Carlson, Kansas City, Kan.I. Cetin, MilanR.J. Deckelbaum, New York, N.Y.T. Decsi, Pécs

C.J. Field, EdmontonK. Godfrey, SouthamptonR. Hakkak, Little Rock, Ark.W.S. Harris, Sioux Falls, S. Dak.H. Hauner, MunichM. Hernández-Triana, HavanaH. Heseker, PaderbornE. Hypponen, LondonJ. Kopecky, PragueM. Krawinkel, GiessenM. Lamprecht, GrazW. Langhans, ZurichJ. Linseisen, HeidelbergO. Ljungqvist, ÖrebroJ.A. Martinez, PamplonaH.J. McArdle, AberdeenY. Naito, KyotoP.W. Nathanielsz, San Antonio, Tex.H. Oberritter, BonnR. Saffery, Parkville, Vic.W.H.M. Saris, MaastrichtL. Serra-Majem, Las Palmas de Gran

CanariaC. Sieber, NürnbergA.P. Simopoulos, Washington, D.C.P. Singer, Petah TikvaN.W. Solomons, Guatemala CityP. Stehle, BonnI. Thorsdottir, ReykjavikK. Tontisirin, Nakhon PathomR. Uauy, SantiagoS. Villalpando, Cuernavaca MorelosT. Yoshikawa, KyotoA. Zittermann, Bad Oeynhausen

Founded 1959 as ‘Nutritio et Dieta’ by E. Azerad, H. Kapp and J. Trémolières. Continued by A. Wretlind (1961–1969). Continued by N. Zöllner (1970–1990) as ‘Nutrition and Metabolism’ (1970–1980), since 1980 integrating ‘Annales de la Nutrition et de l’Alimentation’, continued as ‘Annals of Nutrition and Metabolism’. Continued by G. Wolfram (1991–1999), Continued by I. Elmadfa (2000–2010)

An Official Journal ofInternational Union of Nutritional Sciences (IUNS)Federation of European Nutrition Societies (FENS)European Neutraceutical Association (ENA)Deutsche Gesellschaft für Ernährung (DGE)

2012EB 20.2.12GL 23.4.12GI 20.2.12


IUNS


An Official Journal of

European Neutraceutical Association (ENA)

Deutsche Gesellschaft für Ernährung (DGE)

IUNS Editorial RepresentativeI. Elmadfa, Vienna

FENS Editorial RepresentativeD. Lairon, Marseilles

ENA Editorial RepresentativeM. Lamprecht, Graz

DGE Editorial ReresentativeH. Oberritter, Bonn

An excellent source of up-to-date information

The easiest way to order : w w w.karger.com/mspsc

In high-performance sport an optimal diet and nu-tritional interventions can make the diff erence be-tween victory and defeat. In recent years, sport nutri-tion research has increased. This publication provides scientifi cally-based information with regard to the bioeffi cacy of trendy sport supplements and dietary approaches off the mainstream. International experts in the specifi c fi elds inform and clarify under which circumstances the application of certain supple-ments and nutritional interventions would be ben-efi cial, either for the performance or health of the athletes. A broad spectrum of recent topics in sport nutrition is provided: selected sport supplements aside of mainstream, nutritional interventions and athlete‘s health, hydration and fl uid balance and cur-rent aspects in exercise and exercise recovery. Finally, the publication concludes with recent information about the risk of supplementation and inadvertent doping. The book will be of benefi t to sport physicians and scientists, nutritionists, coaches and athletes, as well as to the sport nutrition trade and related industries.

Contents

Preface: Lamprecht, M.

Selected Off -Mainstream Sport Supplements• Beta-Alanine Supplementation in High-Intensity Exercise: Harris, R.C.; Sale, C.

• Arginine and Citrulline Supplementation in Sports and Exercise: Ergogenic Nutrients?: Sureda, A.; Pons, A.

• Dietary Nitrate and O2 Consumption during Exercise: Jones, A.M.; Bailey, S.J.; Vanhatalo, A.

• GABA Supplementation and Growth Hormone Response: Powers, M.

Nutritional Interventions and Athlete’s Health • Exercise, Intestinal Barrier Dysfunction and Probiotic Supplementation: Lamprecht, M.; Frauwallner, A.

• Pleuran (β-Glucan from Pleurotus ostreatus): An Eff ective Nutritional Supplement against Upper Respiratory Tract Infections?: Majtan, J.

Bovine Colostrum and Immune Function after Exercise: Davison, G.

• Supplementation with Mixed Fruit and Vegetable Concentrates in Relation to Athlethe’s Health and Performance: Scientifi c Insight and Practical Relevance: Lamprecht, M.

• Cherry Juice Targets Antioxidant Potential and Pain Relief: Kuehl, K.S.

• Impact of Milk Consumption and Resistance Training on Body Composition of Female Athletes: Josse, A.R.; Phillips, S.M.

Hydration and Fluid Balance• Glycerol Use in Hyperhydration and Rehydration: Scientifi c Update: van Rosendal, S.P.; Coombes, J.S.

• Salt and Fluid Loading: Eff ects on Blood Volume and Exercise Performance: Mora-Rodriguez, R.; Hamouti, N.

• Milk Protein and the Restoration of Fluid Balance after Exercise: James, L.

Current Aspects of Recovery• Chocolate Milk: A Post-Exercise Recovery Beverage for Endurance Sports: Pritchett, K.; Pritchett, R.

• Role of Supplementary L-Carnitine in Exercise and Exercise Recovery: Huang, A.; Owen, K.

Supplementation and Inadvertent Doping• Supplements and Inadvertent Doping – How Big Is the Risk to Athletes?: Judkins, C.; Prock, P.

Acute Topics in Sport Nutrition EditorsManfred Lamprecht

Medicine and Sport Science

Editors: J. Borms, M. Hebbelinck, A.P. Hills, T. Noakes

Vol. 59

Acute Topics in Sport NutritionEditor

M. Lamprecht


Dear Librarian


Recommended by:

Department:

Date:

Signature:


Acute Topics in Sport Nutriton Editor: Lamprecht, M. (Graz)VIII + 156 p., 17 fi g., 6 tab., hard cover, 2012CHF 189.– / EUR 158.– / USD 222.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–8055–9992–4e-ISBN 978–3–8055–9993–1

Medicine and Sport Science, Vol. 59Series Editors: Borms, J.; Hebbelinck, M.(Brussels); Hills, A.P. (Brisbane, Qld.); Noakes, T. (Cape Town) Listed in MEDLINE/PubMed

KI12474

Identifying novel interdisciplinary approaches

Adult

Nutrition

Nestlé Nutrition Institute Workshop Series | Vol. 73

Obesity Treatmentand Prevention: New Directions

Adam Drewnowski Barbara J. Rolls

The easiest way to order : w w w.karger.com/nniws

Obesity continues to be a major problem for global public health, aff ecting not only adults, but increas-ingly also adolescents and even young children. Moreover, obesity and diabetes are no longer limited to wealthy societies: rates are also rising in low- and middle-income countries.Summarizing some of the key issues in obesity treat-ment and prevention, this publication promotes novel and interdisciplinary approaches and explores cutting-edge ideas that span child development, nutrition, behavioral sciences, economics, geography and public health.Contributions suggest a sequence of steps that may result in new ways to address obesity at the person-al as well as at the population level: First, a clear un-derstanding of who becomes obese, where, and for what reason is needed. Second, the likely contribu-tions to overeating by the brain, biology, economics and the environment need to be identifi ed. Then, based on the understanding of disease etiology and its distribution by geography and by social strata, targeted yet comprehensive strategies for obesity prevention and treatment for both individuals and groups need to be developed.

Contents

Preface

Foreword

Contributors

Obesity Treatment: Challenges and Opportunities• Brain Reorganization following Weight Loss:

Rosenbaum, M.; Leibel, R.L.• Physical Activity and Weight Loss: Jakicic, J.M.• Dietary Strategies for Weight Management: Rolls, B.J.• Targeting Adipose Tissue Infl ammation to Treat the Underlying Basis of the Metabolic Complications of Obesity: Goran, M.I.; Alderete, T.L.

• Summary Discussion on Obesity Treatment: Challenges and Opportunities

New Directions for Prevention• The Gut Microbiome and Obesity: Hullar, M.A.J.; Lampe, J.W.• Starting Early: Obesity Prevention during Infancy: Birch, L.L.;

Anzman-Frasca, S.; Paul, I.M.• The Economics of Food Choice Behavior: Why Poverty and Obesity Are Linked: Drewnowski, A.

• The Importance of the Food and Physical Activity Environments: Oppert, J.-M.; Charreire, H.

• The Importance of Systems Thinking to Address Obesity: Finegood, D.T.

• Summary Discussion on New Directions for Prevention• Concluding Remarks

Obesity Treatment and Prevention: New DirectionsEditorsAdam DrewnowskiBarbara J. Rolls


Dear Librarian


Recommended by:

Department:

Date:

Signature:


Obesity Treatment and Prevention: New DirectionsEditors: Drewnowski, Adam (Seattle, Wash.); Rolls, B.J. (University Park, Pa.)XVI + 150 p., 12 fi g., 8 tab., hard cover, 2012CHF 50.– / EUR 42.– / USD 59.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02115–8e-ISBN 978–3–318–02116–5

Nestlé Nutrition Institute Workshop Series, Vol. 73ISSN 1664–2147e-ISSN 1664–2155

KI12684

Fiel

ds

of In

tere

st: N

utri

tion

; Ob

stet

rics

; Ped

iatr

ics;

Clin

ical

Nut

riti

on,

Feta

l Med

icin

e, N

eona

tolo

gy

Nestlé Nutrition Institute Workshop Series, Vol. 70ISSN 1664–2147 / e-ISSN 1664–2155

Meeting Micronutrient Requirements for Health and Development70th Nestlé Nutrition Institute Workshop, Cebu, March 2011 Editors: Bhutta, Z.A. (Karachi); Hurrell, R.F. (Zurich); Rosenberg I.H. (Boston, Mass.)XVIII + 194 p., 24 fi g., 16 tab., hard cover, 2012CHF 50.– / EUR 42.– / USD 59.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02111–0 / e-ISBN 978–3–318–02112–7

PediatricN

utrition

Nestlé Nutrition Institute Workshop Series | Vol. 70

Meeting Micronutrient Requirements for Health and Development

Zulfiqar A. Bhutta Richard F. HurrellIrwin H. Rosenberg

KI 1

2658

Micronutrients and their signifi cance in pregnancy and early childhood

Meeting Micronutrient Requirements for Health and DevelopmentEditorsZulfi qar A. BhuttaRichard F. HurrellIrwin H. Rosenberg

Meeting macro- and micronutrient require-ments during pregnancy and early childhood is crucial for short- and long-term health and cognitive function. Meta-analyses confi rm that supplementation or fortifi cation of food with the ‘big four’ (vitamin A, iron, zinc, and iodine) is effi cacious to reduce the risk of infectious disease and improves growth and cognitive outcome. More recently, folate and vitamin B12 defi ciencies during pregnancy have been shown to be associated with poor neurodevel-opmental outcome and childhood obesity. The papers collected in the book at hand ad-dress the fact that maternal and fetal defi cien-cies can induce inadequate metabolic pro-gramming in the off spring, with increased risk for non-communicable diseases later in life. World-renowned experts in the fi elds of epide-miology and nutritional intervention met with those in genetics, epigenetics, and metabolic outcome to clarify the pathogenesis of micro-nutrient defi ciencies in pregnancy and child-hood, preventive methods and strategies, and opportunities for treatment.

w w w. k a r g e r. c o m/n n iws

Contents

Introduction to Micronutrient RequirementsGlobal Micronutrient Defi ciencies in Childhood

and Impact on Growth and Survival: Challeng-es and Opportunities: Imdad, A.; Bhutta, Z.A.

Micronutrients in the Treatment of Stunting and Moderate Malnutrition: Penny, M.E.

Discussion on Micronutrient Requirements: Solomons, N.W.

Zinc in Maternal and Child HealthZinc Requirements: Assessment and Population

Needs: Hambidge, K.M. et al.Role of Zinc in Child Health and Survival:

Black, R.E.; Fischer Walker, C.Discussion on Zinc in Maternal and Child Health:

Wasantwisut, E.

Multiple Micronutrient Defi ciencies in Pregnancy

Global Burden and Signifi cance of Multiple Micronutrient Defi ciencies in Pregnancy: Darnton-Hill, I.

Intervention Strategies to Address Multiple Micronutrient Defi ciencies in Pregnancy and Early Childhood: Imdad, A.; Bhutta, Z.A.

Summary on Micronutrient Requirements and Defi ciencies in Maternal and Child Nutrition: Bhutta, Z.

Vitamin A in Childhood: Evidence and Controversy

Vitamin A Supplementation, Infectious Disease and Child Mortality: A Summary of the Evidence: Thorne-Lyman, A.; Fawzi, W.W.

Issues and Controversies with Vitamin A in Childhood: Murguía Peniche, M.T.

Discussion on Vitamin A Supplementation in Childhood: Bhatia, J.

IronInfl uence of Infl ammatory Disorders and Infection

on Iron Absorption and Effi cacy of Iron-Fortifi ed Foods: Hurrell, R.F.

Safety of Iron Fortifi cation and Supplementation in Malaria-Endemic Areas: Brittenham, G.M.

Discussion on Iron: Lynch, S.Summary on Vitamin A and Iron: Hurrell, R.F.

IodineAre Weaning Infants at Risk of Iodine Defi ciency

Even in Countries with Established Iodized Salt Programs? Zimmermann, M.B.

Current Challenges in Meeting Global Iodine Requirements: Eastman, C.J.; Jooste, P.

Folate, Vitamin B12 and BrainFolate and Vitamin B12: Function and Importance

in Cognitive Development: Troen, A.M.Discussion on Folate and Vitamin B12 Importance

in Cognitive Development: Rosenberg, I.H.Pros and Cons of Increasing Folic Acid and Vitamin

B12 Intake by Fortifi cation: Allen, L.H.Discussion on Vitamin B12 and Folic Acid

Fortifi cation: Rosenberg, I.H.Summary on Iodine Folate and Vitamin B12:

Rosenberg, I.H.

Please send: copy/ies Postage and handling free with prepayment Payment:Please charge to my credit card� American Express � Diners � MasterCard � Visa

Card No.:

Exp. date:

CVV/CVC (3 digits in the signature fi eld on the back of Visa and MasterCard)

� Check enclosed � Please bill me


Fax: +41 61 306 12 34

S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland)E-Mail [email protected], www.karger.com

Name/Address:

Date:

Signature:

Or

de

r

Fo

rm

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

© 2012 S. Karger AG, Basel

The Journal Home Page is available at: www.karger.com/anm

General Information

ISSN Print Edition: 0250–6807ISSN Online Edition: 1421–9697

Journal Homepage: www.karger.com/anm

Publication Data: ‘Annals of Nutrition and Metabo-lism’ is published 8 times a year. Volumes 60 and 61, each with 4 issues, appear in 2012.

Copyright: © 2012 S. Karger AG, Basel (Switzerland). All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, with-out permission in writing from the publisher or, in the case of photocopying, direct payment of a specified fee to the Copyright Clearance Center.

Disclaimer: The statements, opinions and data con-tained in this publication are solely those of the indi-vidual authors and contributors and not of the publish-er and the editor(s). The appearance of advertisements in the journal is not a warranty, endorsement, or ap-proval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to per-sons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

Subscription Rates: Subscriptions run for a full calendar year. Prices are given per year.Personal subscription:

Print or Online Print+Online combinedCHF 971.– CHF 1067.–EUR 776.– EUR 852.–USD 943.00 USD 1037.00postage and handling (added to print and print+online)CHF 54.40 Europe, CHF 80.– OverseasEUR 41.60USD 75.20

Institutional subscription:Print or Online Print+Online combinedCHF 3236.– CHF 3560.– EUR 2588.– EUR 2848.–USD 3142.00 USD 3456.00postage and handling (added to print and print+online)CHF 68.– Europe, CHF 100.– OverseasEUR 52.–USD 94.00

Airmail surcharge: CHF 68.– / USD 64.00Discount subscription prices:

Please enquire about reduced rates for members of affiliated societies.

Back Volumes and Single Issues: Information on availability and prices of single print issues and print or electronic back volumes can be obtained from Cus-tomer Service at [email protected].

Bibliographic Indices: This journal is regularly listed in bibliographic services, including Current Contents® and PubMed/MEDLINE.

Photocopying: This journal has been registered with the Copyright Clearance Center (CCC), as indicated by the code appearing on the first page of each article. For readers in the US, this code signals consent for copying of articles for personal or internal use, or for the per-sonal or internal use of specific clients, provided that the stated fee is paid per copy directly to

Copyright Clearance Center Inc.222 Rosewood DriveDanvers, MA 01923 (USA)

A copy of the first page of the article must accompa-ny payment. Consent does not extend to copying for general distribution, for promotion, for creating new works, or for resale. In these cases, specific written per-mission must be obtained from the copyright owner,

S. Karger AG, P.O. BoxCH–4009 Basel (Switzerland).

Subscription Orders: Orders can be placed at agencies, bookstores, directly with the Publisher

S. Karger AGMedical and Scientific Publishers P.O. BoxCH–4009 BaselSwitzerland(for courier services only:Allschwilerstrasse 10CH–4055 Basel)t: +41 61 306 11 11f: +41 61 306 12 34e: [email protected]: www.karger.com

Change of Address: Both old and new address should be sent to the subscription source.

or further Karger offices or representatives:

GermanyS. Karger GmbHPostfach79095 FreiburgDeutschland(Hausadresse: Wilhelmstrasse 20A,79098 Freiburg)t: +49 761 45 20 70f: +49 761 45 20 714e: [email protected]: www.karger.de

JapanKarger Japan, Inc.Shiba Daimon Asahi Bldg. 2F1-2-23 Shiba DaimonMinato-kuTokyo 105-0012 Japant: +81 3 6435 6242f: +81 3 6435 6244e: [email protected]: www.karger.jp

USAS. Karger Publishers, Inc.26 West Avon RoadP.O. Box 529Unionville, CT 06085USAToll free: +1 800 828 5479t: +1 860 675 7834 f: +1 860 675 7302e: [email protected]

FranceLibrairie Médi-Sciences Sarl36, bd de Latour-Maubourg75007 ParisFrancet: +33 (0) 1 45 51 42 58f: +33 (0) 1 45 56 07 80e: [email protected]: www.medi-sciences.fr

Gulf Council Countries, Iran, Middle East, North Africa, TurkeyTrans Middle East International Distribution Co. Ltd. (KaSha)168 B, King Abdullah the 2nd StreetDaboog Building 2nd FloorDaboog AreaP.O. Box 2376Amman 11953Jordant: +962 6 515 3467f: +962 6 541 1336e: [email protected]: www.KaShaonline.com

South East Asia, China and TaiwanKarger Regional Office (Malaysia)CEO Suite Kuala Lumpur Quill 7, 27th FloorJalan Stesen Sentral 5KL SentralKuala Lumpur 50470Malaysiat: +60 3 2776 6803f: +60 3 2776 6999e: [email protected]; [email protected]

Karger China10th Floor, Twin Towers (East)B12 Jianguomenwai AvenueBeijing 100022Chinat: +86 10 5123 5033f: +86 10 5123 5122e: [email protected]; [email protected]: www.karger.cn

India, Bangladesh, Sri LankaMedscience IndiaPlot No. 17, Yusuf Sarai MarketB.L. Glass Building, 2nd FloorSri Aurobindo MargNew Delhi 110 016Indiat: +91 11 46029 633f: +91 11 46029 634c: +91 98 91052 128e: [email protected]

Nut

riti

on; O

pht

halm

olog

y; P

edia

tric

s, B

ioch

emis

try,

Pub

lic H

ealt

h,

His

tory

of M

edic

ine,

Soc

ial M

edic

ine

w w w. k a r g e r. c o m/ w ru n d

World Review of Nutrition and Dietetics, Vol. 104Series Editor: Koletzko, B. (Munich)ISSN 0084–2230 / e-ISSN 1662–3975

Semba, R.D. (Baltimore, Md.)The Vitamin A StoryLifting the Shadow of DeathXVI + 208 p., 41 fi g., 2 in color, 9 tab., hard cover, 2012CHF 88.– / EUR 73.– / USD 104.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02188–2e-ISBN 978–3–318–02189–9


Editor: B. Koletzko

Vol. 104

R.D. Semba

The Vitamin A StoryLifting the Shadow of Death

KI 1

2669

Intriguing reading for specialists and the interested public alike

Richard D. Semba

The Vitamin A StoryLifting the Shadow of Death

This book shows how vitamin A defi ciency – before the vitamin was known to scientists – aff ected mil-lions of people throughout history. It is a story of sailors and soldiers, penniless mothers, orphaned infants, and young children left susceptible to blindness and fatal infections. We also glimpse the fortunate ones who, with ample vitamin A-rich food, escaped this elusive stalker. Why were people going blind and dying? To unravel this puzzle, sci-entists around the world competed over the course of a century. Their persistent eff orts led to the iden-tifi cation of vitamin A and its essential role in health. As a primary focus of today’s international public health eff orts, vitamin A has saved hundreds of thousands of lives. But, we discover, they could save many more were it not for obstacles erected by political and ideological zealots who lack a his-torical perspective of the problem. Although exhaustively researched and document-ed, this book is written for intellectually curious lay readers as well as for specialists. Public health pro-fessionals, nutritionists, and historians of science and medicine have much to learn from this book about the cultural and scientifi c origins of their disciplines. Likewise, readers interested in military and cultural history will learn about the interaction of health, society, science, and politics. The author’s presentation of vitamin A defi ciency is likely to become a classic case study of health disparities in the past as well as the present.

Contents

PrefaceGlossary

Chapter 1Vitamin A Defi ciency in Nineteenth Century Naval Medicine

Chapter 2Paris in the Time of François Magendie

Chapter 3Deprivation Provides a Laboratory

Chapter 4Free but Not Equal

Chapter 5The Long, Rocky Road to Understanding Vitamins

Chapter 6Milk, Butter, and Early Steps in Human Trials

Chapter 7Rise of the ‘Anti-Infective Vitamin’

Chapter 8Vitamin A Defi ciency in Europe’s Former Colonies

Chapter 9Saving the Children: Rescue Missions against Strong Undertow

AppendixNight Blindness Among Black Troops and White Troops in the US Civil War


Card No.:

Exp. date:




Fax: +41 61 306 12 34


Name/Address:

Date:

Signature:

Or

de

r

Fo

rm

Basel • Freiburg • Paris • London • New York • New Delhi • Bangkok • Beijing • Tokyo • Kuala Lumpur • Singapore • Sydney

Contents

See the journal website for contents

http://content.karger.com/ProdukteDB/produkte.asp?ISSN=0250-6807&Volume=61&Issue=3



The Journal Home Page is available at: www.karger.com/anm_Guidelines

Aims and ScopeThe journal focuses on human nutrition and metabo-lism and related areas, including experimental stud-ies and basic science that can inform human nutrition science. We welcome manuscripts describing obser-vational and intervention studies as well as basic sci-ence reports on the topics of foods, diets and dietary supplements, nutrigenomics and genetics related to metabolism, on energy metabolism, macro- and mi-cronutrients including vitamins and minerals, biofunc-tional compounds, dietetics, obesity, clinical nutrition, social sciences and health economy as related to nutri-tion and metabolism and nutrition policy. Laboratory-based science may include descriptions of relevant ex-perimental models. In addition to Original Papers, the journal will publish Review Articles on topical subjects, Systematic Reviews, short Commentaries and View-point articles that may address current controversies, short Meeting Reports, Letters to the Editor, and An-nouncements/Society News. The journal will also pub-lish Supplements with proceedings from internation-ally relevant conferences on nutrition and metabolism.

SubmissionManuscripts written in English are considered and should be submitted online at

www.karger.com/anm

Authors may suggest up to four Referees who have expert knowledge on the subject. Suggested Refer-ees should not be from the same institution, not have published with the authors during the last 5 years, and should not be prejudiced.

Should you experience problems with your submission, please contact

Prof. Dr. B. KoletzkoDiv. Metabolic and Nutritional MedicineDr. von Hauner Children’s HospitalLudwig-Maximilians-University of MunichLindwurmstrasse 4D–80337 Munich (Germany)Tel. +49 89 5160 2826E-Mail [email protected]

ConditionsAll manuscripts are subject to editorial review. Manu-scripts are received with the explicit understanding that they are not under simultaneous consideration by any other publication. Submission of an article for publica-tion implies transfer of the copyright from the author to the publisher upon acceptance. Accepted papers be-come the permanent property of ‘Annals of Nutrition and Metabolism’ and may not be reproduced by any means, in whole or in part, without the written consent of the publisher. It is the author’s responsibility to ob-tain permission to reproduce illustrations, tables, etc. from other publications.

Types of ArticlesThe journal consists of the following sections:

Original Papers are full-length research papers which will be considered for the journal. Articles cover top-ics relevant to clinical studies. Basic and experimental work appear only if directly related to clinical issues (max. 2,500 words).

Review Articles/Systematic Reviews are comprehensive, state-of-the-art papers of important clinical problems. Reviews may be invited by the Editor or they may be unsolicited views (max. 5,000 words).Commentaries and Viewpoint of an editorial nature may be submitted to the journal. In these communica-tions, usual manuscript subdivisions do not apply, and a summary statement is not needed; however, a very brief reference list may be included (max. 500 words).

Meeting Reports are brief summaries of scientific meet-ings in the field of nutrition and metabolism. Authors should write a letter to the Editors inquiring about po-tential interest before submitting the paper. (max. 1,500 words).

Letters to the Editor are encouraged if they directly concern articles previously published in this journal or clinical subjects related to the matters discussed. The editor reserves the right to submit copies of such letters to the authors of the articles concerned prior to publication in order to permit them to respond in the same issue of the journal (max. 500 words).

Editorials are usually invited by the Editor (max. 1,000 words). Please send suggestions to the Editor.

Authors are referred to the uniform requirements for manuscripts submitted to biomedical journals (http://www.icmje.org/ethical_1author.html) for fur-ther guidance.

Conflicts of InterestAuthors are required to disclose any sponsorship or funding arrangements relating to their research and all authors should disclose any possible conflicts of inter-est. Conflict of interest statements will be published at the end of the article.

EthicsPublished research must comply with the guidelines for human studies and animal welfare regulations. Authors should state that subjects have given their informed consent and that the study protocol has been approved by the institute’s committee on human research. Fur-ther, they should also state that animal experiments conform to institutional standards.

Plagiarism PolicyPlagiarism is misrepresenting somebody else’s pub-lished intellectual work-product as your own (Note, this definition excludes ‘self-plagiarism’). In short, it is a misuse of source material. Whether intentional or unintentional, plagiarism is a serious violation of the Annals of Nutrition and Metabolism policy. Periodi-cally, manuscripts are screened for plagiarism and if your manuscript is found to be consistent with what the Editors define* as plagiarism prior to review of the manuscript then:

1) it will be rejected without review and the author(s) notified as such with a chance for rebuttal.

If a manuscript is found to contain evidence of plagia-rism after acceptance and/or publication then:

1) the author(s) will be notified, as in the previous situ-ation, and offered a chance for rebuttal.

If the rebuttal arguments are not found to be satisfac-tory, as judged by the Editors, the manuscript will be rejected and the author sanctioned from publishing ad-ditional papers in the Journal for a period to be deter-mined by the Editorial Board. The period of sanction imposed is dependent on the magnitude of plagiarism with a minimum sanction of one year.

If a manuscript already published in the Journal is found to exhibit evidence of plagiarism as defined by the Editors*, then we will request a retraction.*Definition of plagiarism – a 25% similarity in theResults or Discussion that exactly reproduces anotherpaper.

ArrangementTitle page: The first page of each paper should indi-cate the title, the authors’ names, the institute where the work was conducted, and a short title for use as running head.

Full address: The exact postal address of the corre-sponding author complete with postal code must be given at the bottom of the title page. Please also sup-ply phone and fax numbers, as well as e-mail address.

Key words: For indexing purposes, a list of 3–10 key words in English is essential.

Abstract: Each paper needs an abstract of up to 200 words. It should be structured as follows:Background/Aims: What is the major problem that

prompted the study?Methods: How was the study performed?Results: Most important findings?Conclusion: Most important conclusion?

Footnotes: Avoid footnotes.

Tables and illustrations: Tables are part of the text. Place them at the end of the text file. Illustration data must be stored as separate files. Do not integrate figures into the text. Electronically submitted b/w half-tone and color illustrations must have a final resolution of 300 dpi after scaling, line drawings one of 800–1,200 dpi.

Color illustrationsOnline edition: Color illustrations are reproduced free of charge. In the print version, the illustrations are re-produced in black and white. Please avoid referring to the colors in the text and figure legends. Print edition: Up to 6 color illustrations per page can be integrated within the text at CHF 800.– per page.

References: In the text, identify references by Arabic numerals [in square brackets]. Material submitted for publication but not yet accepted should be noted as ‘un-published data’ and not be included in the reference list. The list of references should include only those publi-cations which are cited in the text. Do not alphabet-ize; number references in the order in which they are first mentioned in the text. The surnames of the authors followed by initials should be given. There should be no punctuation other than a comma to separate the authors. Preferably, please cite all authors. Abbreviate journal names according to the Index Medicus system. Also see International Committee of Medical Journal Editors: Uniform requirements for manuscripts sub-mitted to biomedical journals (www.icmje.org).

Examples(a) Papers published in periodicals: Chatel J-M, Bernard H, Orson FM: Isolation and characterization of two complete Ara h 2 isoforms cDNA. Int Arch Allergy Immunol 2003;131:14–18.(b) Papers published only with DOI numbers:Theoharides TC, Boucher W, Spear K: Serum inter-leukin-6 reflects disease severity and osteoporosis in mastocytosis patients. Int Arch Allergy Immunol DOI: 10.1159/000063858.(c) Monographs: Matthews DE, Farewell VT: Using and Understanding Medical Statistics, ed 3, revised. Basel, Karger, 1996.

Guidelines for Authors



The Journal Home Page is available at: www.karger.com/anm_Guidelines

Guidelines for Authors

(d) Edited books: DuBois RN: Cyclooxygenase-2 and colorectal cancer; in Dannenberg AJ, Dubois RN (eds): COX-2. Prog Exp Tum Res. Basel, Karger, 2003, vol 37, pp 124–137.

Reference Management Software: Use of EndNote is rec-ommended for easy management and formatting of ci-tations and reference lists.

Digital Object Identifier (DOI)S. Karger Publishers supports DOIs as unique identi-fiers for articles. A DOI number will be printed on the title page of each article. DOIs can be useful in the fu-ture for identifying and citing articles published online without volume or issue information. More informa-tion can be found at www.doi.org.

Supplementary MaterialSupplementary material is restricted to additional data that are not necessary for the scientific integrity and conclusions of the paper. Please note that all supple-mentary files will undergo editorial review and should be submitted together with the original manuscript. The Editors reserve the right to limit the scope and length of the supplementary material. Supplementary material must meet production quality standards for Web publication without the need for any modifica-tion or editing. In general, supplementary files should not exceed 10 MB in size. All figures and tables should have titles and legends and all files should be supplied separately and named clearly. Acceptable files and for-

mats are: Word or PDF files, Excel spreadsheets (only if the data cannot be converted properly to a PDF file), and video files (.mov, .avi, .mpeg).

Author’s ChoiceTM Karger’s Author’s ChoiceTM service broadens the reach of your article and gives all users worldwide free and full access for reading, downloading and printing at www.karger.com. The option is available for a one-time fee of CHF 3000.–, which is a permissible cost in grant allocation. More information can be found at www.karger.com/authors_choice.

NIH-Funded Research The U.S. National Institutes of Health (NIH) mandates under the NIH Public Access Policy that final, peer-re-viewed manuscripts appear in its digital database with-in 12 months of the official publication date. As a ser-vice to authors, Karger submits the final version of your article on your behalf to PubMed Central. For those se-lecting our premium Author’s ChoiceTM service, we will send your article immediately upon publishing, accel-erating the accessibility of your work without the usual embargo. More details on NIH’s Public Access Policy is available at http://publicaccess.nih.gov/FAQ.htm#a1

Self-ArchivingKarger permits authors to archive their pre-prints (i.e. pre-refereeing) or post-prints (i.e. final draft post-ref-ereeing) on their personal or institution’s servers, pro-

vided the following conditions are met: Articles may not be used for commercial purposes, must be linked to the publisher’s version, and must acknowledge the publisher’s copyright. Authors selecting Karger’s Au-thor’s ChoiceTM feature, however, are also permitted to archive the final, published version of their article, which includes copyediting and design improvements as well as citation links.

Page ChargesThere are no page charges for papers of 3 or fewer printed pages (including tables, illustrations and ref-erences). Each additional complete or partial page is charged to the author at CHF 325.–. The allotted size of a paper is equal to approx. 10 manu script pages (in-cluding tables, illustrations and references).ProofsUnless indicated otherwise, proofs are sent to the first-named author and should be returned with the least possible delay. Alterations made in proofs, other than the correction of printer’s errors, are charged to the au-thor.

ReprintsOrder forms and a price list are sent with the proofs. Orders submitted after the issue is printed are subject to considerably higher prices.

ki124

82

A new vision to understanding medicine

Handbook of Clinical Gender Medicine

XVI + 522 p., 62 fi g., 4 in color, 63 tab., soft cover, 2012CHF 69.– / EUR 51.– / USD 69.00ISBN 978–3–8055–9929–0e-ISBN 978–3–8055–9930–6

Prices subject to changeEUR price for Germany, USD price for USA only

AGGTATCCAATGATAAGCATGATAAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCATCCAATGATAAGCATGATATTTATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAAATGATAAGCATCACGGT

AGCATGATAAGCTCACGGTATCCAATATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATCGAGCATCACGGTATCCAATGATAAGCATTGATAAGCGTG ATCCAATGATAAGCATCACGGTATCCCCAATGATAAGCATG

GGGTATCCAATGATAAGCATCACGGTATCCCAATGATAAGCATGATAAGCCACGGTATCCAATGAGATAAGCATCACGGGATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGAAGCATCACGGTATCCAATGATAAGCATGATAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAA

AAGCTCACGGTATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAATGATAAGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCACAATGATAAGCATCACGGTATCCAATGATAAGCATATGATAAGCCAATGATAAGCATCACGGTATCCAATGATAAGCATGGATAAGCTCAA CGGTATCCAATGATAAGCATCACGGGGTATC

AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATCAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGGTATCCAATGATAAGCATCACGGTATCCAATGAATATAA

AAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATAAGCATGATAAGCTCACGGTATCAGCATGATAATTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATCCAATGATAAGCATCACGGT

AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAAGCTCACGGTATCAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGA CATCACGGTATCCAATGATAA

GGAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCACATGATAAGTCACGGTATCCAATGATAAGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAAGCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATCCAATGATAAGCATCACGGTATC

CAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAATAAGCATGATAAGCTCACGGTATCCAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAAAGCATCACGGTATCCAATGATAA

AAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGAGCTCACGGTATCCAATGATAAGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAAGCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGGATAAGCATCACGGTATC

AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAGATAAGCTCACGGTATCAAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAA

AAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAAGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATAAGCATGATA AAGCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGGTATC

AGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTGTATCCAATGAGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCGCATGATAATTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGGT

AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATAA

AAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATTAAAGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGAG

CAATGATAAGCATCACGGTATCCAATGATAAGAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC

AAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAG

CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCCAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAA

GGAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAG

CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC

ATGATAAAATCCAGGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGAGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATA

TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACAGCATCACGGTATCCAATGATAAGCATGATAAGCGTATGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAATATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATGATA

TAATCCCAAATGATTAACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCGGTATCCAATGAATAAGCATGATAAA CTCACGGTA CTCCAATGATAAGCATCACGGTATCCAATGATAAGCATGCCAAATGA AAGCCATCACGGTAT CAATGATAAGCAATG

GCATGTGATAAGGATAAGGGTATCGGTATCTATCCCAATGCATCACGGTATCCGCATCACGGTATCC

CACGGTATCCAATGCAACGGTATCCCAATGACGGACGGTACGGTACGGTACGGACGGTACGGTCGCGCGACGGACCA TGAGAGAGATGATGATTGATGATGATGATATAAAAAAAAGAGAAAAAAAAAAAA

AGCCATTCACGGGTATATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGCATCACGGTATCCAAAGCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAAGCATAAGGCATCACGGGTATCCAATGATAAGCATGATAAGCTCAACGGTATCCAATGATAAGCATCACGGTAAAAAAACCCCCGGCCGGGGGGG CCACAAAAAAAAAAATATA

AGCATAG CACGGGTATCCAATGATAAGCATGATAAGAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATTGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAATGATAAGCATCACGGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA

TAAAGCAATGATACAATGATTAATGATAAGCTGATAAGCCATTGATAAAGATCCAATGATAAGATTCCAATGATATAAG

AGCATGATAAGCTCAGCCATGATAAGGCTCACGGAAGCATGATAGCATGATATCACGGTATCACGGTGTGTTGTTTATCCAATCCAATCCAATCCATCCAATCCAATCCATCCATCCACCATCCATCCAATCCACCACCAAA AAAAAAAAAACGGACGACGGACGACGGACGGACGACGGACGGACGGGGACGGACGACGACGA GCAGCACGCACAGCACACACACACAGCAGCATGTGTGTGATGATGATTGATGTGATGAGTGAGTG

Handbook of Clinical Gender MedicineEditors

Karin Schenck-GustafssonPaula R. DeColaDonald W. PfaffDavid S. Pisetsky

S. Karger AG, P.O. BoxCH–4009 Basel

(Switzerland) Fax. +41 61 306 12 34

E-Mail [email protected]

Editors: Karin Schenck-Gustafsson (Stockholm), Paula R. DeCola, Donald W. Pfaff (New York, N.Y.), David S.Pisetsky (Durham N.C.)

In well-referenced chapters, experts cogently and concisely explain how the incorporation of gender issues into research can aff ect the medical understanding and treatment of heart disease, osteopo-rosis, arthritis, pain as well as malaria among other conditions.

This intriguing and unique medical textbook provides readers with a valuable new perspective on how to incorporate gender issues into the diff erent branches of medicine.

More information and sample essays at:

www.karger.com/Gender_Medicine

Reaching beyond traditional nutrition support

The easiest way to order : w w w.karger.com/wrund

The care of ICU patients has seen many improve-ments over the years, both with regard to technical aspects and supportive measures. The fi rst part of this book analyzes nutritional support at various levels, ranging from the cell level to the whole-body aspect; drawing on recent prospective randomized studies, the authors propose a new approach for oral, enteral and/or parenteral nutrition. The second part under-lines the interference between nutrition and out-come to reach recovery, giving to this fi eld an in-creased importance for better short- and long-term management: The best glucose control, individual-ized nutritional support and the avoidance of harm-ful interferences is extensively discussed. The fi nal part deals with patients suff ering from multi-organ failure and the need for a better understanding of the interactions between disease and nutrition. Identifi -cation of the metabolic condition of the patient, existence or not of evidence-based medicine, expert opinion, treatment opportunities and the case man-ager recognizing threats are all integrated to reach the appropriate decision. This last part will help the reader to untangle the complexity of the ICU patient of the 21st century and to propose a personalized nutritional support process.

Contents

List of ContributorsPreface: Singer, P.

Requirements, Routes of Administration and Prescription• From Mitochondrial Disturbances to Energy Requirements: Singer, P.

• Protein Metabolism and Requirements: Biolo, G.• How to Choose the Route: Grecu, I.• How to Prescribe Nutritional Support Using Computers: Berger, M.M.

• Oral Feeding: Alvárez-Falcón, A.; Ruiz-Santana, S.• Enteral Nutrition: Anbar, R.• Parenteral Nutrition: Thibault, R.; Pichard, C.

How Can Nutrition Interfere with Outcome?• Can Nutrition Support Interfere with Recovery from Acute Critical Illness? Schulman, R.C.; Mechanick, J.I.

• Glucose Control: Preiser, J.-C.• Glutamine: Kim, M.; Wischmeyer, P.E.• Leucine and Citrulline: Two Major Regulators of Protein Turnover: Cynober, L.; de Bandt, J.-P.; Moinard, C.

Organ-Targeted Nutrition• The Surgical/Trauma Patient: Weimann, A.• Nutrition and Sepsis: Cohen, J.; Chin, W.D.N.• The Renal Failure Patient: Druml, W.• n–3 Fatty Acids and γ-Linolenic Acid Supplemen-tation in the Nutritional Support of Ventilated Patients with Acute Lung Injury or Acute Respira-tory Distress Syndrome: Lev, S.; Singer, P.

• Obesity: Frankenfi eld, D.C.• Nutritional Imbalances during Extracorporeal Life Support: Kagan, I.; Singer, P.

• Nutrition in Pancreatitis: McClave, S.A.• Which Nutritional Regimen for the Comorbid Complex Intensive Care Unit Patient? Singer, P.; Weinberger, H.; Tadmor, B.

• Nutrition Support for Wound Healing in the Intensive Care Unit Patient: Theilla, M.

Nutrition in Intensive Care: Beyond PhysiologyEditorPierre Singer105

144/63

31

ECG

mmHg

/min

mmHgET Fi02

RR

– – – %

24/min

Arrh.analys:Severe

99%(83)


Editor: B. Koletzko

Vol. 105

Nutrition in Intensive Care Medicine: Beyond PhysiologyEditor

P. Singer


Dear Librarian


Recommended by:

Department:

Date:

Signature:


Nutrition in Intensive Care: Beyond PhysiologyEditor: Singer P. (Petah Tikva)XII + 194 p., 18 fi g., 26 tab., hard cover, 2013CHF 196.– / EUR 163.– / USD 231.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02227–8e-ISBN 978–3–318–02228–5

World Review of Nutrition and Dietetics, Vol. 105Series Editor: Koletzko, B. (Munich)Listed in MEDLINE/PubMed

KI 12682

Nut

riti

on; P

edia

tric

s; N

eona

tolo

gy

w w w. k a r g e r. c o m/a n m

Quality and Safety in Infant NutritionEditors: Koletzko, B. (Munich); Shamir, R. (Tel Aviv)46 p., 3 fi g., 4 tab., soft cover, 2012CHF 29.– / EUR 24.– / USD 34.00Prices subject to changeEUR price for Germany, USD price for USA onlyISBN 978–3–318–02178–3e-ISBN 978–3–318–02179–0

Annals of Nutrition and MetabolismVol. 60, No. 3 (2012)Included in subscription

KI 1

2665

Quality and Safety in Infant NutritionEditorsB. KoletzkoR. Shamir

Jo

ur

na

l

Pu

bl

ic

at

io

n

Contents

Quality and Safety Aspects of Infant Nutrition: Koletzko, B.; Shamir, R.; Ashwell, M.; on behalf of the Early Nutrition Academy (ENA) and the European Society for Paediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN)

Thiamine-Defi cient Infant Formula: What Happened and What Have We Learned? Shamir, R.

Current Safety Standards in Infant Nutrition – A European Perspective: Hernell, O.

Safety Standards in Infant Nutrition: A United States Perspective: Bier, D.M.

Preclinical Assessment of Infant Formula: Lönnerdal, B.

Clinical Safety Assessment of Infant Nutrition: Fewtrell, M.S.

The Role of Systematic Data Reviews in Safety Assessment of Infant Nutrition: Szajewska, H.

Quality Control throughout the Production Process of Infant Food: Hamrin, P.; Hoeft, B.

Safety Aspects in Preparation and Handling of Infant Food: Turck, D.

Non-Breast Milk Feeding in Developing Countries: Challenge from Microbial and Chemical Contaminants: Weisstaub, G.; Uauy, R.



IUNS

An Offi cial Journal of

S. KargerMedical and Scientifi c PublishersBasel . Freiburg . Paris . London . New York . New Delhi . Bangkok . Beijing . Tokyo . Kuala Lumpur . Singapore . Sydney

Ann Nutr Metab60(3) 175–220 (2012) 60 | 3 | 12 print

ISSN 0250–6807onlinee-ISSN 1421–9697

www.karger.com/anm

ISBN 978–3–318–02178–3

Quality and Safety in Infant Nutrition

EditorsB. Koletzko, MunichR. Shamir, Tel Aviv


Card No.:

Exp. date:




Fax: +41 61 306 12 34


Name/Address:

Date:

Signature:

Or

de

r

Fo

rm

• J O UR NAL

An interdisciplinary journal on human and clinical nutrition

Annals of Nutrition and Metabolism is a leading international peer-reviewed journal for sharing information on human nutrition, metabolism and related fi elds, covering the broad and mul-tidisciplinary nature of science in nutrition and metabolism. The journal focuses on human nu-trition and metabolism and related areas, includ-ing experimental studies and basic science that can inform human nutrition science. We wel-come manuscripts describing observational and intervention studies as well as basic science re-ports on the topics of foods, diets and dietary supplements, nutrigenomics and genetics re-lated to metabolism, on energy metabolism, macro- and micronutrients including vitamins and minerals, biofunctional compounds, dietet-ics, obesity, clinical nutrition, social sciences and health economy as related to nutrition and me-tabolism and nutrition policy. Laboratory-based science may include descriptions of relevant ex-perimental models. In addition to Original Pa-pers, the journal will publish Review Articles on topical subjects, Systematic Reviews, short Com-mentaries and Viewpoint articles that may ad-dress current controversies, short Meeting Re-ports, Letters to the Editor, and Announcements/Society News. The journal will also publish Sup-plements with proceedings from internationally relevant conferences on nutrition and metabo-lism.

Selected contributions• Glycemic Responses of Patients with Type 2 Diabetes to Individual Carbohydrate-

Rich Foods and Mixed Meals: Robert, S.D.; Ismail, A.A.-S. (Kelantan)

• Vitamin D in Relation to Myocardial Structure and Function after Eight Years of Follow-Up: The Hoorn Study: van Ballegooijen, A.J.; Snijder, M.B.; Visser, M.; van den Hurk, K.; Kamp, O.; Dekker, J.M.; Nijpels, G. (Amsterdam); Stehouwer, C.D.A.; Henry, R.M.A. (Maastricht); Paulus, W.J.; Brouwer, I.A. (Amsterdam)

• Health Eff ects Related to Low Vitamin D Concentrations: Beyond Bone Metabolism: Moreno, L.A. (Zaragoza); Valtueña, J. (Madrid); Pérez-López, F. (Zaragoza); González-Gross, M. (Madrid/Bonn)

• Upregulation of Hepatic 11-Hydroxysteroid Dehydrogenase-1 Expression in Calcium-Defi cient Rats: Takaya, J.; Iharada, A.; Okihana, H.; Kaneko, K. (Moriguchi)

• Diet-Dependent Net Endogenous Acid Load of Vegan Diets in Relation to Food Groups and Bone Health-Related Nutrients: Results from the German Vegan Study: Ströhle, A. (Hannover); Waldmann, A. (Lübeck); Koschizke, J. (Hannover); Leitzmann, C. (Giessen); Hahn, A. (Hannover)

• Eff ect of Selenium Supplementation on Glutathione Peroxidase and Catalase Activities in Senescent Cultured Human Fibroblasts: Ghneim, H.K.; Al-Sheikh, Y.A. (Riyadh)

• Role of Nutritional Status in Predicting the Length of Stay in Cancer: A Systematic Review of the Epidemiological Literature: Gupta, D.; Vashi, P.G.; Lammersfeld, C.A.; Braun, D.P. (Zion, Ill.)

• Eff ects of Monounsaturated Fatty Acids on Cardiovascular Risk Factors: A Systematic Review and Meta-Analysis: Schwingshackl, L.; Strasser, B.; Hoffmann, G. (Hall in Tirol)

Annals of Nutrition and Metabolism2013: Volumes 62, 634 issues per volumeLanguage: EnglishISSN 0250–6807 (print)ISSN 1421–9697 (online)

Listed in bibliographic services, including Current Contents®, MEDLINE, Biological Abstracts, EMBASE/Excerpta Medica

KF13004

More information at

www.karger.com/anm• Pay-per-View and Subscriber Access

to Full Text• Full Table of Contents• Full Editorial Board• Free Abstracts and Selected Articles• Online Sample Issue• Submission/Guidelines for Authors• Subscription Details• Free Alert Service• Online Library Recommendation



IUNS


Editor

B. Koletzko, Munich

An Offi cial Journal of the



European Nutraceutical Association (ENA)

Deutsche Gesellschaft für Ernährung(DGE)

IUNS

Karger Publications in NutritionWorld Review of Nutrition and Dietetics

Editor: A.P. Simopoulos

Vol. 102

Healthy Agriculture,Healthy Nutrition,Healthy PeopleEditor A.P. Simopoulos


www.karger.com/wrund

Series EditorB. Koletzko, Munich

Vol. 102 Healthy Agriculture, Healthy Nutrition, Healthy People (ISBN 978–3–8055–9779–1)

Vol. 101 Personalized Nutrition. Translating Nutrigenetic/Nutrigenomic Research into Dietary Guidelines (ISBN 978–3–8055–9427–1)

Vol. 100 A Balanced Omega-6/Omega-3 Fatty Acid Ratio, Cholesterol and Coronary Heart Disease(ISBN 978–3–8055–9224–6)

Vol. 69 Sports Nutrition: More Than Just Calories – Triggers for Adaptation (ISBN 978–3–8055–9697–8)

Vol. 68 Early Nutrition: Impact on Short- and Long-Term Health (ISBN 978–3–8055–9745–6)

Vol. 67Milk and Milk Products in Human Nutrition (ISBN 978–3–8055–9586–5)

KI1

2631

Nestlé Nutrition Institute Workshop SeriesPediatric Program, Vol. 68

Earl y Nutrition: Impact on Short- and Long-Term Health

Hans van GoudoeverStefano GuandaliniRonald E. Kleinman

www.karger.com/nutrition

Nestlé Nutrition Institute Workshop Series

www.karger.com/nniws

Journal of Nutrigenetics and Nutrigenomics

www.karger.com/jnnCurrent IF: 1.304

EditorJ.X. Kang

Official Journal of the International Society of

Nutrigenetics/Nutrigenomics

ISNNwww. isnn.info

International Society of Nutrigenetics/Nutrigenomics (ISNN)

Offi cial Journal of the

Annals of Nutrition and Metabolism

www.karger.com/anmCurrent IF: 2.173

EditorB. Koletzko, Munich




Deutsche Gesellschaft für Ernährung (DGE)

IUNS

Offi cial Journal of the



EuropeanNeutraceutical Association (ENA)

The Discovery of Vitamins - Karger Publishers

Documents

Transcript of The Discovery of Vitamins - Karger Publishers