The FASEB Journal • FJ Express Full-Length Article

The calcium sensing receptor is directly involved inboth osteoclast differentiation and apoptosis

R. Mentaverri,*,†,1 S. Yano,* N. Chattopadhyay,* L. Petit,† O. Kifor,*S. Kamel,† E. F. Terwilliger,‡ M. Brazier,† and E. M. Brown**Division of Endocrinology, Diabetes and Hypertension, Brigham and Women’s Hospital, HarvardMedical School, Boston, Massachusetts, USA; †Unite de Recherche sur les Mecanismes de laResorption Osseuse (Universite de Picardie) et INSERM ERI-12, Amiens, France; and ‡Departmentof Medicine, Beth Israel Deaconess Medical Center, Boston, Massachusetts, USA

ABSTRACT Intracellular transduction pathways thatare dependent on activation of the CaR by Cao

2� havebeen studied extensively in parathyroid and other celltypes, and include cytosolic calcium, phospholipases C,A2, and D, protein kinase C isoforms and the cAMP/protein kinase A system. In this study, using bonemarrow cells isolated from CaR�/� mice as well asDN-CaR-transfected RAW 264.7 cells, we provide evi-dence that expression of the CaR plays an importantrole in osteoclast differentiation. We also establish thatactivation of the CaR and resultant stimulation of PLCare involved in high Cao

2�-induced apoptosis of maturerabbit osteoclasts. Similar to RANKL, Cao

2� (20 mM)appeared to trigger rapid and significant nuclear trans-location of NF-�B in a CaR- and PLC-dependent man-ner. In summary, our data suggest that stimulation ofthe CaR may play a pivotal role in the control of bothosteoclast differentiation and apoptosis in the systemsstudied here through a signaling pathway involvingactivation of the CaR, phospholipase C, and NF-�B.—Mentaverri, R., Yano, S., Chattopadhyay, N., Petit, L.,Kifor, O., Kamel, S., Terwilliger, E. F., Brazier, M.,Brown, E. M. The calcium sensing receptor is directlyinvolved in both osteoclast differentiation and apopto-sis. FASEB J. 20, E1945–E1954 (2006)

Key Words: phospholipase C � NF-�B � caspases

Osteoclasts are giant multinucleated cells thatarise from the proliferation, differentiation, and fusionof mononuclear hematopoietic progenitors (GM-CFU)through a process that is regulated by both local andsystemic factors (1). Over the past decade, a tumornecrosis factor (TNF) family member called receptoractivator of NF-�B ligand (RANKL) and its receptor(RANK) have been shown to control osteoclast differ-entiation, activation, and survival (2–5). The actualexistence of osteoclasts appears to be dependent onRANK-RANKL signaling, since mice lacking either theRANK or the RANKL genes appear to be devoid ofosteoclasts (4, 6). RANKL, a protein expressed byosteoblasts and activated T-cells, acts directly on oste-oclast precursors and mature osteoclasts, respectively,

to stimulate their formation and activity. Signalingthrough RANK involves recruitment of cytosolic TNFreceptor-associated factors (TRAF) 2 and 6, which inturn activate activating protein (AP) �1 and NF-�B,respectively. Phosphorylation of I�B permits NF-�B totranslocate to the nucleus, where it regulates theexpression of a variety of genes involved in inflam-mation and immunity, cell proliferation, response tostress, and apoptosis. Osteoprotegerin (OPG), a sol-uble decoy receptor produced mainly by osteoblasts,binds RANKL, thereby preventing RANK-mediatedsignaling (7).

Precise regulation of the extracellular ionized cal-cium concentration (Cao

2�) is a high priority formulticellular organisms owing to the key roles thatcalcium plays in numerous cellular processes, such asmaintaining membrane potential and controlling hor-monal secretion, cellular proliferation, differentiation,and survival (8, 9). It is now well established thatincreasing Cao

2� to levels comparable to those result-ing from local bone resorption (10) inhibits osteoclastdifferentiation and osteoclastic bone resorption. Thusosteoclasts can “sense” increasing levels of Cao

2�, whichin turn trigger a rapid rise in the cytosolic calciumconcentration, disassembly of podosomes, and oste-oclast apoptosis (11–14). Several mechanisms havebeen invoked as mediators of Cao

2�-induced effects onthe osteoclast, including the putative roles of the ryan-odine receptor (15), a transient potential receptorchannel (16), and the calcium sensing receptor (CaR)as sensors of Cao

2� (17, 18). However, relatively little isknown about the precise cellular mechanisms underly-ing the effects of Cao

2� on osteoclast function.In this study we focused our attention on assessing

the role played by the CaR in two processes that areintimately involved in regulating osteoclastic activitiesand, in turn, the extent of bone resorption (i.e., osteo-clast differentiation and apoptosis). Using well-charac-

1 Correspondence: Unite de Recherche sur les Mecanismesde la Resorption Osseuse et INSERM, ERI-12, 1 rue desLouvels, 80037 Amiens, France. E-mail: romuald.mentaverri@sa.u-picardie.fr

doi: 10.1096/fj.06-6304fje

E19450892-6638/06/0020-1945 © FASEB

terized osteoclast models, namely murine bone marrowcells (19) or RAW 264.7 cells that are differentiated invitro to osteoclasts (20) as well as mature rabbit oste-oclasts (21), we demonstrate here that both matureosteoclasts and preosteoclasts express the CaR and thatlack of a functional CaR, or antagonizing endogenousCaR function though overexpression of a dominantnegative form of the CaR (DN-CaR), reduces both theformation of osteoclasts as well as Cao

2�-induced oste-oclast apoptosis.

MATERIALS AND METHODS

In vitro osteoclastogenesis

In vitro osteoclastogenesis was studied using a protocoladapted from the one described by T. Koga et al. (20). Briefly,after sacrifice, bone marrow cells were mechanically flushedfrom the medullary cavities of the long bones of CaR�/� orwild-type (WT) mice and cultured overnight in �-MEM(Sigma, St. Louis, MO, USA) with 10% fetal calf serum (FCS).Littermates were obtained from breeding of heterozygousmice (CaR�/�) with targeted disruptions of exon 5 of theCaR gene from the laboratory of Drs. John and ChristineSeidman (Harvard Medical School, Boston, MA, USA) (22).Nonadherent bone marrow cells were then seeded on 96-wellplates at a density of 30,000 cells/well and cultured for 5 or6 days in �-MEM with 10% FCS or in �-MEM with 10%FCS containing 50 ng/ml soluble recombinant murine(rm) RANKL (R&D Systems, Minneapolis, MN, USA) and 10ng/ml rmM-CSF (R&D Systems). Medium was replaced onthe third day. In each well, TRAP-positive cells were thencounted after staining with a leukocyte acid phosphatase kit(Sigma 387-A).

RAW 264.7 cell cultures were performed at a cell density of3000 cells per cm2, and cells were incubated for 5 days in 10�l of �-MEM containing 10% FCS and 50 ng/ml rmRANKL.Culture medium was replaced on the third day, and TRAP-positive multinucleated cells differentiated from the RAW264.7 cells, referred to hereafter as osteoclast-like cells(OCLs), were counted in each well at the end of the cultureperiod.

Osteoclast isolation and culture

Mature osteoclasts (OCs) were isolated from the long bonesof rabbits or mice according to the procedure described byFoged et al. (23), with slight modifications. Rabbit or mouselong bones were dissected and minced with scissors in �MEMsupplemented with 10% heat-inactivated FCS. Cells were thendissociated from bone fragments by vigorous vortexing andcollected by centrifugation (4 min, 500 rpm) before seedingonto 24-well plates or on 12 mm glass coverslips.

Purified osteoclasts, used hereafter to directly assess theeffect of calcium on apoptosis of mature osteoclasts, wereobtained by removing osteoblasts as well as stromal cells fromthe wells using a solution of 0.01% collagenase-dispase pre-pared with PBS. Purified osteoclasts were then incubated inmedium for 2 h. Next cells were cultured in �-MEM supple-mented with 1% FCS and containing various amounts of testsubstances or transfected with the DN-CaR and cultured in�-MEM supplemented with 1% FCS containing variousamounts of test substances. Cell purity was assessed usingtartrate-resistant acid phosphatase (TRAP) staining and wasclose to 99% in all cases.

To assess nuclear translocation of NF-�B, rabbit bone cellswere submitted to an additional step before being seededonto 12 mm glass coverslips. As first described by Collin-Osdoby et al. (24), the bone cell pellet was resuspended in 15ml of serum-free medium and carefully placed on top of a70–40% FCS gradient. The preparation was then left undis-turbed for 30 min to allow the larger multinucleated oste-oclasts to settle under unit gravity and penetrate the FCSlayers. Before being seeded onto glass coverslips, the bottom15 ml of the gradient, which contains predominantly matureosteoclasts, was harvested, centrifuged for 5 min at 700 rpm,and resuspended in �-MEM supplemented with 10% FCS.

Reverse transcription and quantitative real-time polymerasechain reaction (PCR)

Total RNA was prepared using TRIzol reagent (Life Technol-ogies, San Diego, CA, USA). For both types of PCR, 2 �g oftotal RNA was used to synthesize single-stranded cDNA (Om-niscript reverse transcription kit, Qiagen, Chatsworth, CA,USA).

As described (25), a “hot start” PCR protocol was used toassess CaR mRNA expression, and intron-spanning primerswere employed to prevent amplification of products arisingfrom genomic DNA. Primer sequences were 5� -TCTGTTCTCTTTAGGTCCTGAAACA-3� , sense; 5� -TCATTGATGAACAGTCTTTCTCCCT-3�, antisense. Bidirec-tional sequencing of the PCR fragments was performed usingthe same primer pairs by means of an automated sequencer(AB377; Applied Biosystems, Foster City, CA, USA) anddideoxy terminator Taq technology in the DNA SequenceFaculty of the University of Maine (Orono, ME, USA).

SYBR green chemistry was used to perform quantitativedeterminations of the mRNAs encoding for TRAP, the CaR,and a housekeeping protein, glyceraldehyde-3-phosphate de-hydrogenase (GAPDH). The design of sense and antisenseoligonucleotide primers was based on published cDNA se-quences using Primer Express (version 2.0.0, Applied Biosys-tems). Primer sequences are listed in Table 1. The cDNAswere amplified using an ABI PRISM 7000 sequence detectionsystem (PE Applied Biosystems, Foster City, CA, USA) follow-ing the manufacturer’s protocol. GAPDH was used to normal-ize differences in RNA isolation, RNA degradation, and theefficiency of the reverse transcription reaction. Sizes of the

TABLE 1. Primer pairs used for quantitative real-time PCR

Accession no. Gene name Primers

NM_013803 mCaR CGAGCACATCCCTTCAACCAT (920–941)TAGTCGTCGTCGGCTGCAATT (1156–1177)

NM_007388 mTRAP CACCCTGAGATTTGTGGCTGT (105–125)CGGTTC TGGCGATCTCTTTG (187–205)

NM_008084 mGAPDH CCCAGAACATCATCCCTGCATTCAGATCCACGACGGACACATT

E1946 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal

PCR products were verified on 2.0% agarose gels and bymelting curve analysis.

Immunocytochemistry

Cells were fixed with a 3.7% formaldehyde-PBS solution (5min) and successively stained with the leukocyte acid phos-phatase kit, Hoechst 33258 (0.2 mM), and an anti-CaRantibody (Ab) (see below). CaR expression in mouse orrabbit mature osteoclasts was investigated using a rabbitpolyclonal antiserum called 4637 or a mouse monoclonalantiserum called LRG (generous gifts from Drs. Karen Krap-cho and Edward Nemeth of NPS Pharmaceuticals (Salt LakeCity, UT, USA) and Drs. Allen Spiegel and Paul Goldsmith,NIDDK, NIH, respectively), which were raised against pep-tides corresponding to amino acids 345–359 and 374–391 ofthe N-terminal extracellular domain of the CaR, respectively(26, 27). All slides were finally mounted on coverslips usingVECTASHIELD® (Vecta Laboratories, Burlington, CA, USA)and examined using a confocal microscope (Zeiss LSM510).

Western blot analysis

Expression of the CaR in OCLs and mature rabbit OCs wasalso investigated using Western blot analysis. Samples weresubjected to SDS-containing 6.5% PAGE, and detection ofappropriately sized bands was performed using 4637 Abfollowing the protocol described by Kifor et al. (28). Immu-noblots were visualized using an enhanced chemilumines-cence (ECL) system (PerkinElmer Life Sciences, Norwalk,CT, USA).

Detection of osteoclast apoptosis

As described by Kameda et al. (29), after treatment withreagents cells were fixed with 3.7% formaldehyde for 10 minand stained with 0.2 mM Hoechst 33258 for 10 min. Cellswere examined under a fluorescence microscope (OlympusBH2) to determine morphological changes of the chromatin,as described previously (30). At least 100 TRAP-positivemultinucleated cells were scored in order to assess theincidence of apoptotic changes in the chromatin, and theextent of apoptosis of mature osteoclasts was expressed as thepercentage of apoptotic osteoclasts per total osteoclast num-ber. A phospholipase C (PLC) inhibitor (U73122), andinhibitors of IP3-dependent intracellular signaling [i.e., 2-ami-noethoxydiphenyl borate (2-APB) and SKF-96365] were pur-chased from Tocris Cookson Ltd. (Bristol, UK). Peptideinhibitors of the caspase cascade [i.e., benzyloxycarbonyl-Val-Ala-Asp (Ome)-fluoromethylketone (Z-VAD-FMK), benzyl-oxycarbonyl-Leu-Glu-His-Asp (Ome)-fluoromethylketone (Z-LEHD-FMK)] used to assess the role of caspases in Cao

2�-induced osteoclast apoptosis and an NF-�B inhibitor (Ro106–9920) were obtained from Calbiochem (San Diego, CA,USA).

NF-�B localization by immunofluorescence

Rabbit osteoclasts seeded onto glass coverslips were incubatedwith various test substances in osteoclast culture medium at37°C. Treatments were started at various times prior tofixation for 5 min with 3.7% formaldehyde, as presented insubsequent sections. Cells were washed twice with PBS andincubated for 10 min in 0.5% Triton-X 100-PBS solution.Osteoclasts were then incubated overnight at 4°C with amouse anti-p65 primary Ab (Santa Cruz Technology, SantaCruz, CA, USA; sc-8008), then for 1 h at room temperature

with an AlexaFluor-488-conjugated, goat anti-mouse IgG(H�L) secondary Ab. Coverslips were finally mounted onslides using VECTASHIELD® before examination using aconfocal microscope.

Gene delivery by recombinant adeno-associated virus

High-efficiency gene transfer into mature rabbit osteoclasts aswell as RAW 264.7 cells was accomplished using a recombi-nant adeno-associated virus (rAAV) -based method. A bovineCaR sequence with a naturally occurring dominant-negativemutation R186Q (DN-CaR) or the same vector encoding�-galactosidase cDNA (�-Gal) (as a control for nonspecificeffects of viral infection) was placed under the control of acytomegalovirus (CMV) immediate-early (CMV-IE) promoterelement and packaged in the same vector as describedpreviously (31). Before being exposed to the virus, RAW264.7 cells, as well as mature rabbit osteoclasts, were culturedovernight in �-MEM supplemented with 10% FCS. Cells werethen washed once with serum-free �-MEM, and �1000 viralparticles/cell were used to infect each well (as optimized bypilot studies). Cells were incubated for 90 min in serum-freemedium at 37°C in a cell culture incubator. Equal volumes of�-MEM containing 20% serum were added to the cells toachieve a final serum concentration of 10%. The cells werefinally cultured for 36 h before being used for the experi-ments described later. On each coverslip, at least 80% of theosteoclasts appeared to be �-Gal-positive, confirming the highefficiency of our rAAV-based approach (data not shown).

Statistical analysis

Results are expressed as the mean sem. The statisticaldifferences among groups were evaluated using the Kruskal-Wallis test. The Mann-Whitney U test was then used to identifydifferences between the groups when the Kruskal-Wallis testindicated a significant difference (P0.05).

RESULTS

Preosteoclasts as well as mature osteoclastsexpress CaR

To assess the role played by the CaR in the capacity ofosteoclasts to sense extracellular calcium, we first fo-cused our attention on whether osteoclast precursorsand mature osteoclasts express this receptor. Reversetranscription PCR (Fig. 1A) as well as quantitativereal-time PCR (Fig. 1B) showed that undifferentiatedRAW 264.7 cells (RAW) and RAW-differentiated oste-oclasts-like (OCLs) express CaR mRNA. It should benoted that OCLs express 15-fold more copies of CaRmRNA than osteoclast precursors (Fig. 1B). As de-scribed (32), differentiation of OCLs from RAW 264.7cells was documented by both TRAP staining andamplification of TRAP mRNA by real-time PCR (datanot shown).

Immunostaining (Fig. 1C, D) and immunoblotting(Fig. 1E) were then used to assess the presence orabsence of the CaR at the protein level. Both OCLs andmature rabbit osteoclasts appear to be positive for CaRimmunoreactivity. Confirming the specificity of thestaining, preabsorption of the primary antiserum with

E1947THE CaR AND OSTEOCLAST CALCIUM SENSING

the specific peptide against which it was raised dramat-ically reduced CaR immunoreactivity (data not shown).Expression of the CaR was confirmed by immunostain-ing of bone cells isolated from the long bones ofCaR�/� mice (Fig. 2A), which revealed that numerous,if not all, of the isolated bone cells are CaR-positive (redsignal). Both CaR�/� and CaR�/� mice possess matureTRAP-positive multinucleated osteoclasts, which ap-peared similar in size and number of nuclei (Fig. 2).We failed to find any CaR immunoreactivity in bonecells isolated from CaR�/� mice (Fig. 2B), confirmingthe specificity of the immunostaining for the CaR.

Thus, the CaR was shown to be expressed in the plasmamembrane of both mature and preosteoclasts. Of noteis the apparent localization of the CaR immunoreactiv-ity in the cytosol in this cell type, a finding reported inseveral other cell types as well (33–35) despite the

Figure 1. Analysis of CaR expression at mRNA and proteinlevels. A) RT-polymerase chain reaction (RT-PCR) amplifica-tion of CaR mRNA isolated from RAW 264.7 cells (lane 1 and2; RAW) and from RAW differentiated osteoclast-like cells(lane 3 and 4; OCLs) obtained after RANKL (50 ng/ml)stimulation revealed that both cell types express CaR mRNA.MW standards and negative control (lane 5). B) Amplificationof CaR mRNA by quantitative real-time PCR confirmed thatboth cells express CaR mRNA and suggests that the mRNA isexpressed at a higher level in OCLs than in undifferentiatedRAW 264.7 cells. Data are representative of the mean semof 3 independent experiments. C) Immunostaining of OCLsand D) mature rabbit osteoclasts (OCs) using 4637 rabbitprimary anti-CaR Ab and LRG mouse primary anti-CaR Ab,respectively. E) Western blot analysis, using 4637 Ab, con-firmed that both OCLs (lanes 1 and 2) and OCs (lanes 4and 5) express CaR at the protein level. Lane 3 illustratesresults using protein isolated from CaR-transfected HEK-293 cells (positive control). Immunoreactivity was detectedusing the DAKO 3-amino-9-ethyl carbazole Substrate Sys-tem (DAKO Corp., Carpenteria, CA, USA) and an ECLsystem (PerkinElmer Life Sciences). Figure 2. Bone cells isolated from CaR�/� and CaR�/� mice

exhibit TRAP-positive multinucleated osteoclasts. Hoechststaining for nuclei (blue): bone cells isolated from CaR�/�

(A) and CaR�/� (B) mice showed multinucleated cells.Staining for TRAP activity (black) with a leukocyte acidphosphatase kit (Sigma): as shown in these representativepictures, isolated bone cells from both CaR�/� and CaR�/�

mice showed TRAP-positive cells. Staining for the CaR with anAlexaFluor 546-conjugated, secondary Ab (red signal): asexpected, bone cells isolated from mice lacking exon 5 of theCaR, encoding for portion of the extracellular domain of thereceptor (CaR�/�), appear negative for 4637 staining (B)while numerous, if not all, cells isolated from CaR�/� micewere detected as positive (A). Cells derived from bothCaR�/� and CaR�/� mice appear to generate TRAP-positivemultinucleated osteoclasts. Confocal images (400�).

E1948 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal

presumed plasma membrane localization of the maturefunctional protein that mediates the actions of extra-cellular calcium on these cells.

The CaR is involved in osteoclast differentiation

Because CaR�/� mice demonstrate severe hyperpara-thyroidism accompanied by hypercalcemia and hy-pophosphatemia (36), it is difficult to draw definitiveconclusions concerning the role played by the CaR inosteoclasts based solely on histological analysis. In thisstudy, we assessed the ability of bone marrow cells(BMC) isolated from both CaR�/� and CaR�/� miceto differentiate into TRAP-positive osteoclasts. Equalnumbers of BMC isolated from CaR�/� and CaR�/�

mice were cultured for 5 days in the presence orabsence of RANKL (50 ng/ml) and M-CSF (25 ng/ml).As shown in Fig. 3A, the osteoclastic differentiation thatoccurs from BMC isolated from CaR�/� mice wasreduced by 70% compared with that taking place inBMC isolated from CaR�/� mice (P0.001). Consis-

tent with this result, antagonizing the action of the CaRin RAW 264.7 cells with the DN-CaR reduced osteoclas-tic differentiation by 50% compared with �-Gal trans-fected RAW264.7 cells (Fig. 3B, P0.001). However, inboth cases osteoclastic differentiation was not com-pletely abrogated, suggesting that CaR deficiency im-pairs but does not block osteoclastogenesis.

The CaR is involved in calcium-inducedosteoclast apoptosis

In these experiments we first confirmed that Cao2�

(from 1.8 to 20 mM) induces apoptosis of maturerabbit osteoclasts in a dose-dependent manner (Fig.4A). Indeed, DN-CaR transfection of the mature rabbitosteoclasts partially but significantly abrogated the cal-cium-induced osteoclast apoptosis, indicating thatCao

2�-elicited apoptosis of osteoclasts depends at leastin part on CaR-dependent Cao

2� sensing. As shown inFig. 4A, osteoclast apoptosis in the DN-CaR-transfectedcells was reduced by 40% compared with that in�-Gal-transfected osteoclasts, when cells were culturedin the presence of 20 mM Cao

2� (P�0.015). To confirmthe importance of a G-protein-coupled, receptor-basedmechanism in the regulation of osteoclast apoptosis, weinvestigated the involvement of the PLC and inositol1,4,5-triphosphate (IP3) signaling pathways using spe-cific pharmacological inhibitors (U73122, 2-APB andSKF-96365). All three compounds significantly inhib-ited osteoclast apoptosis, which was reduced from 56 2% (cells treated with 20 mM Cao

2� alone) to 13 3%(U-73122; 10 �M), 30 2% (2-APB; 50 �M), and 22 2% (SKF-96365; 10 �M), respectively (Fig. 4B). We alsoshowed that the specific caspase inhibitory peptides,Z-VAD-fmk (Fig. 4C) and Z-LEHD-fmk (Fig. 4D), signif-icantly and dose-dependently inhibited calcium (20mM) -evoked apoptosis of osteoclasts, indicating thatCao

2� induces apoptosis of mature osteoclasts in acaspase-dependent manner.

Calcium sensing through the CaR activates NF-�B inmature rabbit osteoclasts

Komarova et al. recently demonstrated that RANKL-induced nuclear translocation of NF-�B is regulated bya PLC-dependent mechanism (37). Because of the roleplayed by NF-�B in both osteoclast differentiation andsurvival, we speculated that NF-�B activation may play akey role as a mediator of the osteoclast calcium sensingmechanism. As described before, NF-�B activation wasassessed by the nuclear translocation of NF-�B inmature rabbit osteoclasts as assessed by immunofluores-cence (37). The entire osteoclast population was exam-ined (usually 100–200 osteoclasts per coverslip), andmature osteoclasts were rated as positive for nucleartranslocation of NF-�B when the NF-�B fluorescentlabeling of one or more of the nuclei exceeded that ofthe cytoplasm (Fig. 5A, B). RANKL (50 ng/ml) tran-siently and significantly increased the percentage of�-Gal-transfected osteoclasts showing nuclear localiza-

Figure 3. Role played by CaR in osteoclast differentiation invitro. A) Bone marrow cells (BMC) isolated from CaR�/� andCaR�/� mice were cultured for 5 days in the presence ofRANKL (50 ng/ml) and M-CSF (25 ng/ml). Data are ex-pressed as the percentage of TRAP-positive cells derived ineach experiment from CaR�/� BMC cultured with RANKLand M-CSF (109 to 365 TRAP-positive cells were observed ineach well). Data are representative of 4 independent experi-ments (n�12). ***P 0.001 compared with the number ofTRAP-positive cells derived from CaR�/� mice. B) �-Gal- orDN-CaR-transfected RAW 264.7 cells (�-Gal RAW or DN-CaRRAW) were cultured for 5 days in the presence of 50 ng/mlRANKL. Data are expressed as the percentage of TRAP-positive cells counted in each experiment from �-Gal-trans-fected RAW cells when cultured for 5 days with RANKL (138to 302 TRAP-positive multinucleated cells were observed ineach well). Data are representative of 3 independent experi-ments (n�12). ***P 0.001 compared with �-Gal-transfectedRAW cells cultured for 5 days in the presence of RANKL (50ng/ml).

E1949THE CaR AND OSTEOCLAST CALCIUM SENSING

tion of NF-�B. As shown in Fig. 5C, under these cultureconditions NF-�B activation is maximal at 1 h (529%,P0.001), then gradually decreases until 12 h, when itreaches a plateau where �20% of the osteoclasts re-main positive for nuclear translocation of NF-�B. Asshown in Fig. 5D, when osteoclasts were cultured for upto 12 h with 20 mM Cao

2� alone, nuclear translocationof NF-�B was transient and appeared to be as rapid asduring RANKL-induced nuclear translocation of NF-�B. Maximum activation was observed at 1 h, when61 7% of the osteoclasts exhibit nuclear translocation

of NF-�B (P0.001). The nuclear translocation ofNF-�B then slowly decreased to reach a plateau at 6 h( 25%), when NF-�B activation remained significantlydifferent from that observed in osteoclasts cultured for1 h in the presence of 1.8 mM Cao

2� (P0.01). CaR-DNtransfection of the cells dramatically reduced the highCao

2�-induced NF-�B activation (Fig. 5D). Thus, 1 hafter addition of high Cao

2� (20 mM), the percentageof osteoclasts showing nuclear localization of NF-�Bsignificantly decreased from 61 7% to 15 1%(P0.01). When osteoclasts were pretreated for 30 min

Figure 4. Role played by CaR in Cao2�-induced apoptosis of rabbit osteoclasts. A) Increasing levels of Cao

2� (from 1.8 mM to20 mM) stimulate, to varying extents, apoptosis of �-Gal- and DN-CaR-transfected mature rabbit osteoclasts. Data are expressedas means sem of 3 independent experiments. **P 0.01 and ***P 0.001 compared with their respective controls (i.e., �-Galor DN-CaR-transfected osteoclasts cultured for 48 h in the presence of 1.8 mM Cao

2�). B) We also assessed the role of the PLCand intracellular calcium signaling in Cao

2�-induced osteoclast apoptosis using three well-described pharmacological blockers[i.e., U73122 (10 �M), 2-APB (50 �M) and SKF-96365 (10 �M)]. Data are expressed as means sem of 3 independentexperiments. ***P 0.001 compared with osteoclasts cultured for 48 h in the presence of 20 mM Cao

2�. C, D) Effects ofZ-VAD-fmk (caspase 3 inhibitory peptide) or Z-LEHD-fmk (caspase 9 inhibitory peptide) on Cao

2�-induced apoptosis of rabbitosteoclasts. Data are expressed as means sem of 2 independent experiments. *P 0.05 and ***P 0.001 compared withcultures treated with Cao

2� (20 mM) alone.

E1950 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal

with U73122 (10 �M), high Cao2�-induced NF-�B

activation was significantly reduced compared with thatpresent in cells treated with 20 mM Cao

2� (Fig. 5E).U73343 (10 �M), a less potent pharmacological inhib-itor of PLC, was without effect on the high Cao

2�-induced nuclear translocation of NF-�B (data notshown). As shown in Fig. 6, when cells were preincu-bated for 30 min with 5 �M of a well-known inhibitor ofNF-�B (Ro106–9920), the ability of high extracellularcalcium concentrations to stimulate mature rabbit os-teoclast apoptosis was completely abrogated.

DISCUSSION

It is now well accepted that the balance of proliferation,differentiation, and apoptosis of bone cells determinesthe size of the osteoclast or osteoblast populations atany given time in the life of the bone. Since these initialobservations, several positive or negative regulators ofosteoclast differentiation and apoptosis were brought

to light, including hormones, cytokines, and growthfactors. We provide evidence here suggesting that CaRstimulation, as occurs when cells are submitted to anincreased level of Cao

2�, should be considered in asimilar manner.

Expression of the CaR in osteoclasts was first de-scribed by Kameda et al. (17), who pointed out in 1998that CaR expression in mature osteoclasts may play afunctional role in bone resorption through a directeffect of extracellular calcium on various activities ofosteoclasts. Despite the importance of the skeleton inCao

2� homeostasis, to date only indirect evidence hasconfirmed such a hypothesis (14, 18, 38, 39). Inconsis-tent with these in vitro data, histological analysis ofbones from CaR�/� mice rescued by inactivation of thePTH gene failed to reveal any evidence for CaR’sinvolvement in the regulation of osteoclast activity andin osteoblast recruitment in vivo (40), explaining whythe CaR has been thought to play a minor, if any, rolein osteoclast biology (40, 41).

Due to the severe hyperparathyroidism present in

Figure 5. Role played by CaR in nuclear translocation of NF-�B. As illustrated in panels A, B (confocal imagery: 200�),osteoclasts were rated positive for nuclear translocation of NF-�B only when the NF-�B fluorescent labeling of one or more ofthe nuclei exceeded that of the cytoplasm (B). C) �-Gal-transfected rabbit osteoclasts were treated with RANKL (50 ng/ml) orits vehicle for various times for up to 12 h. Samples were then fixed at the indicated times, and p65 localization was determinedby immunofluorescence. Data are expressed as means sem of the percentage of osteoclasts exhibiting nuclear localization ofNF-�B on each coverslip and are representative of 3–6 independent experiments. **P 0.01 and ***P 0.001 compared withvehicle-treated �-Gal-transfected osteoclasts. D) �-Gal- or DN-CaR-transfected rabbit osteoclasts were treated with 20 mM Cao

2�

or its vehicle for up to 12 h. Data are representative of 3–8 independent experiments. **P 0.01 and ***P 0.001 comparedwith �-Gal-transfected osteoclasts cultured with 1.8 mM Cao

2� (bGal�vehicle). $$P 0.01 compared with �-Gal-transfectedosteoclasts cultured with 20 mM Cao

2� (bGal�Ca 20 mM). E) �-Gal-transfected rabbit osteoclasts were simultaneously treatedwith 20 mM Cao

2� and U73122 (10 �M) or its vehicle. Data are representative of 3–8 independent experiments.**P 0.01 and***P 0.001 compared with �-Gal-transfected osteoclasts cultured with 1.8 mM Cao

2� (bGal�vehicle). $P 0.05 comparedwith �-Gal-transfected osteoclasts cultured with 20 mM Cao

2� (bGal�Ca 20 mM).

E1951THE CaR AND OSTEOCLAST CALCIUM SENSING

CaR�/� mice (40) and the resultant effects of PTH onosteoclastogenesis (42), we chose to assess osteoclasto-genesis in vitro using bone marrow cultures fromCaR�/� mice. Utilizing this approach, we clearly estab-lished that bone marrow cells isolated from CaR�/�

mice show a reduced capacity to differentiate intoTRAP-positive multinucleated cells. This result was con-firmed by a decrease in the differentiation of RAW264.7 cells to multinucleated, osteoclast-like cells ob-served after CaR-DN transfection, providing strongevidence that the CaR exerts a direct effect on oste-oclastogenesis.

Mature osteoclasts and preosteoclasts both appearedto express CaR, suggesting that stimulation of the CaRacts not only on osteoclast differentiation but may alsoregulate bone resorption and the osteoclast life span.Confirming such a hypothesis, we showed that increas-ing levels of Cao

2� up to 20 mM rapidly led to apoptosisof mature osteoclasts through a classical caspase-3 and�9-dependent mechanism. Calcium (20 mM) -inducedosteoclast apoptosis at least partially involves a G-protein-coupled receptor, the CaR, which may trigger aPLC-dependent release of intracellular calcium storesand induce osteoclast apoptosis when stimulated.These results agree completely with those published byMalgaroli et al. (11) and Bennett et al. (16), who haveshown that osteoclasts “sense” elevated extracellularcalcium through a process involving PLC activation andthe associated rise in intracellular calcium (Cai

2�).Nonetheless, probably because of the presence of re-sidual dimeric WT CaR, which remains active in maturerabbit osteoclasts even after DN-CaR transfection,Cao

2�-induced osteoclast apoptosis was not preventedentirely. From the data we gathered regarding the roleplayed by the CaR in RANKL-induced osteoclastogen-esis and osteoclast apoptosis, it can be speculated that

activation of the CaR may participate physiologically inboth promoting and inhibiting differentiation overranges of calcium concentration that differ from oneanother. Therefore, knockout of the CaR results in lossof both effects. This might provide a mechanism forinitially permitting osteoclastogenesis to proceed, theninhibiting it, as bone resorption increases and the localcalcium concentration rises. The proapoptotic actionof high calcium concentrations could further reducethe pool of osteoclasts in this latter setting. It would beof interest in future studies to look at genes upstream ofthe cellular events regulated in the osteoclast by theCaR, namely, osteoclastic differentiation, its inhibitionby calcium, and apoptosis.

As observed in the assay of osteoclast apoptosis, weshowed that Cao

2�-induced NF-�B activation is down-stream of the stimulation of both CaR and PLC inmature rabbit osteoclasts. Hence, based our data,Cao

2�-evoked activation of NF-�B could be linked toinduction of apoptosis of mature osteoclasts (Fig. 7).Whereas NF-�B is most commonly involved in suppress-ing apoptosis by transactivating the expression of anti-apoptotic genes, it is not surprising it could also pro-mote programmed cell death in mature osteoclasts.Thus, several lines of evidence gathered during the pastdecade indicate that NF-�B can enhance the expressionof death-promoting genes such as p53, c-Myc, Bcl-xS, orFas in response to certain death-inducing signals and incertain cell types (43–46). To date, we cannot fullyexplain how the high Cao

2�-induced NF-�B activationmediates osteoclast apoptosis while RANKL-stimulatedNF-�B nuclear translocation does not (data not shown),although high Cao

2� and RANKL could clearly differ inthe full range of signaling pathways they activate. That

Figure 6. Role played by NF-�B activation in Cao2�-induced

apoptosis of rabbit osteoclasts. We assessed the role of awell-known inhibitor of NF-�B activation (Ro106–99200) inCao

2�-induced osteoclast apoptosis. Data are expressed asmeans sem of 3 independent experiments. ***P 0.001compared with osteoclasts cultured for 48 h in the presenceof Cao

2�.

Figure 7. Schematic diagram summarizing the role played bythe CaR in osteoclast precursors and mature osteoclasts.Expressed by osteoclast precursors and mature osteoclasts,the CaR appears to play a key role in both the differentiationand apoptosis of osteoclasts. Upon stimulation by extracellu-lar calcium, the CaR activates phospholipase C, which isresponsible for translocation of NF-�B from the cytoplasm tothe nucleus in mature osteoclasts. Most likely in associationwith other transcription factors, Cao

2� induced activation ofNF-�B, then led mature osteoclasts into apoptosis.

E1952 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal

NF-�B is the only transcription factor responsible forthe control of mature osteoclasts apoptosis seems in-conceivable. Spatiotemporal activation of other tran-scription factors, such as AP-1 and NFAT, needs to befurther studied in order to provide more compellingdata regarding their relative importance in the highcalcium-induced apoptosis of mature osteoclasts.

Consistent with data recently published by Xu et al.(39) in which the reciprocal regulation between highCao

2� and RANKL signaling was initially highlighted,our data strongly suggest that a tight partnership existsbetween RANKL and the CaR in osteoclasts. It can bespeculated that Cao

2� sensing through the CaR mayplay a key role in NF-�B nuclear translocation, andtherefore affects both osteoclast differentiation andapoptosis. Molecular interactions, which may exist be-tween the CaR, RANK, and perhaps other proteins inboth mature osteoclasts and preosteoclasts, need to befurther investigated in order to provide greater insightinto the molecular mechanisms that regulate the oste-oclast life span under physiological conditions.

In addition to CaR, members of subfamily C of thesuperfamily of G-protein-coupled receptors such asmGluRs (47), GABABRs (48), and, more recently,GPRC6A (49), have been shown to sense extracellularcalcium apparently due to conserved binding sites intheir large extracellular domains (50). GPRC6A wasrecently shown to respond not only to basic aminoacids, but also to extracellular calcium and calcimimet-ics, indicating it could potentially mediate extracellularcalcium sensing in some of the same tissues in whichthe CaR is expressed (49). However, differences existbetween the CaR and other putative calcium sensors,such as their apparent affinity for calcium. For exam-ple, high concentrations of Cao

2� of up to 40 mM werenecessary to fully activate GPRC6A whereas a lowerconcentration of 5 mM Cao

2� can maximally activateCaR, suggesting that GPRC6A may preferentially exertits actions in tissues where high local extracellularconcentrations exist, such as in bone. From our data wecannot exclude the possibility that GPRC6A plays a rolein calcium-induced NF-�B nuclear translocation. Fur-ther studies are needed to determine whether GPRC6Aheterodimerizes with the CaR on bone cells and if it isinhibited by the dominant negative CaR used in ourstudies. However, we unequivocally demonstrated thatbone marrow cells isolated from CaR�/� mice exhibit areduced ability to differentiate into mature osteoclasts,strongly suggesting that even in the putative presenceof GPRC6A, CaR deficiency directly affects osteoclastfunction.

In summary, our data clearly demonstrate that theCaR is intimately involved in processes that controlboth osteoclast differentiation and osteoclast apoptosis.Hence, as observed in other tissues involved in calciumhomeostasis, such as parathyroid glands, calcium sens-ing through the CaR may play a pivotal role in therelease of calcium from bone and thereby control twoof the most important steps that regulate osteoclastactivities.

We especially thank Robert Butters for his technical assis-tance. Confocal microscopy was carried out at the Brighamand Women’s Hospital Confocal Microscopy Core Facility(Boston, MA, USA).

REFERENCES

1. Roodman, G. D. (1999) Cell biology of the osteoclast. Exp.Hematol. 27, 1229–1241

2. Lacey, D. L., Timms, E., Tan, H. L., Kelley, M. J., Dunstan, C. R.,Burgess, T., Elliott, R., Colombero, A., Elliott, G., Scully, S., et al.(1998) Osteoprotegerin ligand is a cytokine that regulatesosteoclast differentiation and activation. Cell 93, 165–176

3. Burgess, T. L., Qian, Y., Kaufman, S., Ring, B. D., Van, G.,Capparelli, C., Kelley, M., Hsu, H., Boyle, W. J., and Dunstan,C. R., et al. (1999) The ligand for osteoprotegerin (OPGL)directly activates mature osteoclasts. J. Cell Biol. 145, 527–538

4. Kong, Y. Y., Yoshida, H., Sarosi, I., Tan, H. L., Timms, E.,Capparelli, C., Morony, S., Oliveira-dos-Santos, A. J., Van, G.,Itie, A., et al. (1999) OPGL is a key regulator of osteoclastogen-esis, lymphocyte development and lymph-node organogenesis.Nature 397, 315–323

5. Lacey, D. L., Tan, H. L., Lu, J., Kaufman, S., Van, G., Qiu, W.,Rattan, A., Scully, S., Fletcher, F., Juan, T., et al. (2000) Osteo-protegerin ligand modulates murine osteoclast survival in vitroand in vivo. Am. J. Pathol. 157, 435–448

6. Li, J., Sarosi, I., Yan, X. Q., Morony, S., Capparelli, C., Tan,H. L., McCabe, S., Elliott, R., Scully, S., Van, G., et al. (2000)RANK is the intrinsic hematopoietic cell surface receptor thatcontrols osteoclastogenesis and regulation of bone mass andcalcium metabolism. Proc. Natl. Acad. Sci. U. S. A. 97, 1566–1571

7. Anderson, H. C. (1997) An antagonist of osteoclast integrinsprevents experimental osteoporosis. J. Clin. Invest. 99, 2059

8. Spurr, N. K. (2003) Genetics of calcium sensing—regulation ofcalcium levels in the body. Curr. Opin. Pharmacol. 3, 291–294

9. Hofer, A. M. (2005) Another dimension to calcium signaling: alook at extracellular calcium. J. Cell Sci. 118, 855–862

10. Silver, I. A., Murrills, R. J., and Etherington, D. J. (1988)Microelectrode studies on the acid microenvironment beneathadherent macrophages and osteoclasts. Exp. Cell Res. 175, 266–276

11. Malgaroli, A., Meldolesi, J., Zallone, A. Z., and Teti, A. (1989)Control of cytosolic free calcium in rat and chicken osteoclasts.The role of extracellular calcium and calcitonin. J. Biol. Chem.264, 14342–14347

12. Miyauchi, A., Hruska, K. A., Greenfield, E. M., Duncan, R.,Alvarez, J., Barattolo, R., Colucci, S., Zambonin-Zallone, A.,Teitelbaum, S. L., and Teti, A. (1990) Osteoclast cytosoliccalcium, regulated by voltage-gated calcium channels and extra-cellular calcium, controls podosome assembly and bone resorp-tion. J. Cell Biol. 111, 2543–2552

13. Zaidi, M., Moonga, B. S., and Adebanjo, O. A. (1999) Novelmechanisms of calcium handling by the osteoclast: a review-hypothesis. Proc. Assoc. Am. Physicians 111, 319–327

14. Lorget, F., Kamel, S., Mentaverri, R., Wattel, A., Naassila, M.,Maamer, M., and Brazier, M. (2000) High extracellular calciumconcentrations directly stimulate osteoclast apoptosis. Biochem.Biophys. Res. Commun. 268, 899–903

15. Zaidi, M., Shankar, V. S., Tunwell, R., Adebanjo, O. A., Mackrill,J., Pazianas, M., O’Connell, D., Simon, B. J., Rifkin, B. R.,Venkitaraman, A. R., et al. (1995) A ryanodine receptor-likemolecule expressed in the osteoclast plasma membrane func-tions in extracellular Ca2� sensing. J. Clin. Invest. 96, 1582–1590

16. Bennett, B. D., Alvarez, U., and Hruska, K. A. (2001) Receptor-operated osteoclast calcium sensing. Endocrinology 142, 1968–1974

17. Kameda, T., Mano, H., Yamada, Y., Takai, H., Amizuka, N.,Kobori, M., Izumi, N., Kawashima, H., Ozawa, H., Ikeda, K., et al.(1998) Calcium sensing receptor in mature osteoclasts, whichare bone resorbing cells. Biochem. Biophys. Res. Commun. 245,419–422

18. Kanatani, M., Sugimoto, T., Kanzawa, M., Yano, S., and Chihara,K. (1999) High extracellular calcium inhibits osteoclast-like cellformation by directly acting on the calcium sensing receptor

E1953THE CaR AND OSTEOCLAST CALCIUM SENSING

existing in osteoclast precursor cells. Biochem. Biophys. Res.Commun. 261, 144–148

19. Scheven, B. A., Visser, J. W., and Nijweide, P. J. (1986) In vitroosteoclast generation from different bone marrow fractions,including a highly enriched haematopoietic stem cell popula-tion. Nature 321, 79–81

20. Koga, T., Inui, M., Inoue, K., Kim, S., Suematsu, A., Kobayashi,E., Iwata, T., Ohnishi, H., Matozaki, T., Kodama, T., et al. (2004)Costimulatory signals mediated by the ITAM motif cooperatewith RANKL for bone homeostasis. Nature 428, 758–763

21. Kanaoka, K., Kobayashi, Y., Hashimoto, F., Nakashima, T.,Shibata, M., Kobayashi, K., Kato, Y., and Sakai, H. (2000) Acommon downstream signaling activity of osteoclast survivalfactors that prevent nitric oxide-promoted osteoclast apoptosis.Endocrinology 141, 2995–3005

22. Ho, C., Conner, D. A., Pollak, M. R., Ladd, D. J., Kifor, O.,Warren, H. B., Brown, E. M., Seidman, J. G., and Seidman, C. E.(1995) A mouse model of human familial hypocalciuric hyper-calcemia and neonatal severe hyperparathyroidism. Nat. Genet.11, 389–394

23. Foged, N. T., Delaisse, J. M., Hou, P., Lou, H., Sato, T., Winding,B., and Bonde, M. (1996) Quantification of the collagenolyticactivity of isolated osteoclasts by enzyme-linked immunosorbentassay. J. Bone Miner. Res. 11, 226–237

24. Collin-Osdoby, P., Anderson, F., and Osdoby, P. (2003) Primaryisolation and culture of chicken osteoclasts. Methods Mol. Med.80, 65–88

25. Chattopadhyay, N., Yano, S., Tfelt-Hansen, J., Rooney, P., Kanu-parthi, D., Bandyopadhyay, S., Ren, X., Terwilliger, E., andBrown, E. M. (2004) Mitogenic action of calcium sensing receptoron rat calvarial osteoblasts. Endocrinology 145, 3451–3462

26. Yamaguchi, T., Kifor, O., Chattopadhyay, N., and Brown, E. M.(1998) Expression of extracellular calcium (Cao

2�) sensingreceptor in the clonal osteoblast-like cell lines, UMR-106 andSAOS-2. Biochem. Biophys. Res. Commun. 243, 753–757

27. Goldsmith, P. K., Fan, G., Miller, J. L., Rogers, K. V., and Spiegel,A. M. (1997) Monoclonal antibodies against synthetic peptidescorresponding to the extracellular domain of the human Ca2�

receptor: characterization and use in studying concanavalin Ainhibition. J. Bone Miner Res. 12, 1780–1788

28. Kifor, O., Kifor, I., Moore, F. D., Jr., Butters, R. R., Jr., andBrown, E. M. (2003) m-Calpain colocalizes with the calciumsensing receptor (CaR) in caveolae in parathyroid cells andparticipates in degradation of the CaR. J. Biol. Chem. 278,31167–31176

29. Kameda, T., Ishikawa, H., and Tsutsui, T. (1995) Detection andcharacterization of apoptosis in osteoclasts in vitro. Biochem.Biophys. Res. Commun. 207, 753–760

30. Mentaverri, R., Kamel, S., Wattel, A., Prouillet, C., Sevenet, N.,Petit, J. P., Tordjmann, T., and Brazier, M. (2003) Regulation ofbone resorption and osteoclast survival by nitric oxide: possibleinvolvement of NMDA-receptor. J. Cell. Biochem. 88, 1145–1156

31. Tfelt-Hansen, J., MacLeod, R. J., Chattopadhyay, N., Yano, S.,Quinn, S., Ren, X., Terwilliger, E. F., Schwarz, P., and Brown,E. M. (2003) Calcium sensing receptor stimulates PTHrP releaseby pathways dependent on PKC, p38 MAPK, JNK, and ERK1/2in H-500 cells. Am. J. Physiol. 285, E329–E337

32. Yano, S., Mentaverri, R., Kanuparthi, D., Bandyopadhyay, S.,Rivera, A., Brown, E. M., and Chattopadhyay, N. (2005) Func-tional expression of beta-chemokine receptors in osteoblasts:role of regulated upon activation, normal T cell expressed andsecreted (RANTES) in osteoblasts and regulation of its secretionby osteoblasts and osteoclasts. Endocrinology 146, 2324–2335

33. Ziegelstein, R. C., Xiong, Y., He, C., and Hu, Q. (2006)Expression of a functional extracellular calcium sensing recep-tor in human aortic endothelial cells. Biochem. Biophys. Res.Commun. 342, 153–163

34. Bruce, J. I., Yang, X., Ferguson, C. J., Elliott, A. C., Steward,M. C., Case, R. M., and Riccardi, D. (1999) Molecular andfunctional identification of a Ca2� (polyvalent cation) sensingreceptor in rat pancreas. J. Biol. Chem. 274, 20561–20568

35. Chattopadhyay, N., Cheng, I., Rogers, K., Riccardi, D., Hall, A.,Diaz, R., Hebert, S. C., Soybel, D. I., and Brown, E. M. (1998)Identification and localization of extracellular Ca2� sensingreceptor in rat intestine. Am. J. Physiol. 274, G122–G130

36. Anderson, J. J., and Garner, S. C. (1998) Phytoestrogens andbone. Baillieres Clin. Endocrinol. Metab. 12, 543–557

37. Komarova, S. V., Pilkington, M. F., Weidema, A. F., Dixon, S. J.,and Sims, S. M. (2003) RANK ligand-induced elevation ofcytosolic Ca2� accelerates nuclear translocation of nuclearfactor kappa B in osteoclasts. J. Biol. Chem. 278, 8286–8293

38. Takahashi, E., Mukohyama, H., Aoki, K., Duarte, W. R., Lerner,U. H., Ohya, K., Omura, K., and Kasugai, S. (2002) Highextracellular calcium affects osteoclastogenesis in mouse bonemarrow cell culture. J. Med. Dent. Sci. 49, 109–120

39. Xu, J., Wang, C., Han, R., Pavlos, N., Phan, T., Steer, J. H.,Bakker, A. J., Joyce, D. A., and Zheng, M. H. (2005) Evidence ofreciprocal regulation between the high extracellular calciumand RANKL signal transduction pathways in RAW cell derivedosteoclasts. J. Cell. Physiol. 202, 554–562

40. Garner, S. C., Pi, M., Tu, Q., and Quarles, L. D. (2001) Ricketsin cation sensing receptor-deficient mice: an unexpected skele-tal phenotype. Endocrinology 142, 3996–4005

41. Zaidi, M., Adebanjo, O. A., Moonga, B. S., Sun, L., and Huang,C. L. (1999) Emerging insights into the role of calcium ions inosteoclast regulation. J. Bone Miner. Res. 14, 669–674

42. Boyce, B. F., Xing, L., Shakespeare, W., Wang, Y., Dalgarno, D.,Iuliucci, J., and Sawyer, T. (2003) Regulation of bone remodel-ing and emerging breakthrough drugs for osteoporosis andosteolytic bone metastases. Kidney Int. Suppl. S2–S5

43. Wu, H., and Lozano, G. (1994) NF-kappa B activation of p53. Apotential mechanism for suppressing cell growth in response tostress. J. Biol. Chem. 269, 20067–20074

44. La Rosa, F. A., Pierce, J. W., and Sonenshein, G. E. (1994)Differential regulation of the c-myc oncogene promoter by theNF-kappa B rel family of transcription factors. Mol. Cell. Biol. 14,1039–1044

45. Chen, X., Kandasamy, K., and Srivastava, R. K. (2003) Differen-tial roles of RelA (p65) and c-Rel subunits of nuclear factorkappa B in tumor necrosis factor-related apoptosis-inducingligand signaling. Cancer Res. 63, 1059–1066

46. Chan, H., Bartos, D. P., and Owen-Schaub, L. B. (1999) Activa-tion-dependent transcriptional regulation of the human Faspromoter requires NF-kappaB p50–p65 recruitment. Mol. Cell.Biol. 19, 2098–2108

47. Kubo, Y., Miyashita, T., and Murata, Y. (1998) Structural basisfor a Ca2� sensing function of the metabotropic glutamatereceptors. Science 279, 1722–1725

48. Saunders, R., Nahorski, S. R., and Challiss, R. A. (1998) Amodulatory effect of extracellular Ca2� on type 1alpha metabo-tropic glutamate receptor-mediated signalling. Neuropharmacol-ogy 37, 273–276

49. Pi, M., Faber, P., Ekema, G., Jackson, P. D., Ting, A., Wang, N.,Fontilla-Poole, M., Mays, R. W., Brunden, K. R., Harrington, J. J.,and Quarles, L. D. (2005) Identification of a novel extracellularcation sensing G-protein coupled receptor. J. Biol. Chem. 280,40201–40209

50. Hofer, A. M., and Brown, E. M. (2003) Extracellular calciumsensing and signalling. Nat. Rev. Mol. Cell. Biol. 4, 530–538

Received for publication April 21, 2006.Accepted for publication August 7, 2006.

E1954 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal

The FASEB Journal • FJ Express Summary

The calcium sensing receptor is directly involved inboth osteoclast differentiation and apoptosis

R. Mentaverri,*,†,1 S. Yano,* N. Chattopadhyay,* L. Petit,† O. Kifor,*S. Kamel,† E. F. Terwilliger,‡ M. Brazier,† and E. M. Brown**Division of Endocrinology, Diabetes and Hypertension, Brigham and Women’s Hospital, HarvardMedical School, Boston, Massachusetts, USA; †Unite de Recherche sur les Mecanismes de laResorption Osseuse (Universite de Picardie) et INSERM, ERI-12, Amiens, France; and ‡Departmentof Medicine, Beth Israel Deaconess Medical Center, Boston, Massachusetts, USA

To read the full text of this article, go to http://www.fasebj.org/cgi/doi/10.1096/fj.06-6304fje

SPECIFIC AIMS

The aim of the present study was to investigate whetherthe calcium sensing receptor (CaR) in osteoclast pre-cursors and mature osteoclasts participates in the con-trol of osteoclast differentiation and apoptosis.

PRINCIPAL FINDINGS

1. The CaR is expressed by preosteoclasts as well asmature osteoclasts

To assess the role played by the CaR to sense extracel-lular calcium (Cao

2�), we focused on whether osteoclastprecursors and mature osteoclasts express the CaR.Reverse transcription polymerase chain reaction (PCR)and quantitative real-time PCR showed that undifferen-tiated RAW 264.7 cells and RAW differentiated oste-oclast-like cells (OCLs) express CaR mRNA. CaR ex-pression was also assessed by immunostaining andimmunoblotting, showing that differentiated and iso-lated mature osteoclasts are both immunoreactive forthe CaR. Most if not all mature osteoclasts isolated fromthe long bones of CaR�/� mice are CaR-positive,whereas CaR immunoreactivity was absent in bone cellsisolated from CaR�/� mice, confirming antibody (Ab)specificity.

2. The CaR is involved in osteoclast differentiation

Because CaR�/� mice demonstrate severe hyperpara-thyroidism accompanied by hypercalcemia and hy-pophosphatemia, it is difficult to reach conclusions asto the role played by the CaR in osteoclasts based solelyon histological analysis. We assessed the ability of bonemarrow cells (BMC) isolated from CaR�/� andCaR�/� mice to differentiate into tartrate-resistant acidphosphatase-positive cells in the presence of a receptoractivator of NF-�B ligand (RANKL, 50 ng/ml) andmacrophage colony-stimulating factor (M-CSF; 25 ng/

ml). Osteoclast differentiation that takes place fromBMC isolated from CaR�/� mice was reduced by 70%vs. BMC isolated from CaR�/� mice (P�0.001). Con-sistent with this result, antagonizing the activity of theCaR in RAW 264.7 cells with a dominant negative formof the CaR (DN-CaR) also reduced osteoclastic dif-ferentiation by 50% vs. control, �-Gal-transfected RAW264.7 cells (P�0.001).

3. The CaR is involved in calcium-induced osteoclastapoptosis

We first confirmed that Cao2� (1.8 to 20 mM) induces

apoptosis of mature rabbit osteoclasts in a dose-depen-dent manner. Transfection of these osteoclasts with theDN-CaR partially but significantly reduced calcium-induced osteoclast apoptosis, indicating that highCao

2�-evoked apoptosis of osteoclasts depends at leastin part on CaR-dependent Cao

2� sensing (Fig. 1). Toconfirm the importance of a G-protein-coupled, recep-tor-based mechanism in regulating osteoclast apoptosis,we investigated the involvement of phospholipase C(PLC) and the inositol 1,4,5-triphosphate (IP3) signal-ing pathways using specific pharmacological inhibitors(U73122, 2-APB, and SKF-96365). All three compoundssignificantly inhibited osteoclast apoptosis, which de-creased from 56 � 2% (cells treated with 20 mM Cao

2�

alone) to 13 � 3% (U-73122; 10 �M), 30 � 2% (2-APB;50 �M), and 22 � 2% (SKF-96365; 10 �M), respec-tively. We also showed that inhibitory peptides Z-VAD-fmk and Z-LEHD-fmk significantly and dose-depen-dently inhibited calcium (20 mM) -elicited apoptosis ofosteoclasts, indicating that Cao

2� induces mature oste-oclast apoptosis in a caspase-dependent manner.

1 Correspondence: Unite de Recherche sur les Mecanismesde la Resorption Osseuse et INSERM, ERI-12, 1 rue desLouvels, 80037 Amiens, France. E-mail: romuald.mentaverri@sa.u-picardie.fr

doi: 10.1096/fj.06-6304fje

2562 0892-6638/06/0020-2562 © FASEB

4. Calcium sensing through the CaR activates NF-�Bin mature rabbit osteoclasts

NF-�B plays a pivotal role in the control of two keyevents that regulate the osteoclast life span: osteoclastdifferentiation and survival. Because nuclear transloca-tion of NF-�B was recently shown to be under thecontrol of intracellular calcium signaling in matureosteoclasts after RANKL stimulation, we next investi-gated whether NF-�B activation participates in theosteoclast calcium sensing mechanism. NF-�B activa-tion was assessed by the nuclear translocation of NF-�Bin mature rabbit osteoclasts as assessed by immunoflu-orescence. When osteoclasts were cultured for up to12 h with 20 mM Cao

2�, NF-�B nuclear translocationwas transient and appeared to be as rapid as RANKL-induced nuclear translocation of NF-�B (Fig. 2). Asobserved for high Cao

2�-induced osteoclast apoptosis,Cao

2�-elicited NF-�B activation was dramatically re-duced in DN-CaR-transfected osteoclasts comparedwith �Gal-transfected cells, suggesting that NF-�B acti-vation is involved in the calcium “sensing” capacity ofosteoclasts. Consistent with our findings describedabove, pharmacological inhibition of PLC usingU73122 (10 �M) also inhibited Cao

2�-induced NF-�Bnuclear translocation in mature rabbit osteoclasts.When cells were preincubated for 30 min with 5 �M ofRo106–9920, the ability of high extracellular calciumconcentrations to stimulate mature rabbit osteoclastapoptosis was abrogated.

CONCLUSIONS AND SIGNIFICANCE

Osteoclasts are giant multinucleated cells that arisefrom the proliferation, differentiation, and fusion of

mononuclear hematopoietic progenitors (GM-CFU)through a process that is regulated by both local andsystemic factors. It is now well established that raisingCao

2� to levels comparable to those resulting from localbone resorption inhibits osteoclast differentiation andosteoclastic bone resorption. Osteoclasts can “sense”increasing levels of Cao

2�, which in turn appear totrigger a rapid rise in the cytosolic calcium concentra-tion, disassembly of podosomes, and osteoclast apopto-sis. However, relatively little is known about the precisecellular mechanisms underlying the effects of Cao

2� onosteoclast function. In this study we assessed osteoclas-togenesis in vitro using bone marrow cultures fromCaR�/� mice. Using this approach, we established thatbone marrow cells isolated from CaR�/� mice showeda reduced capacity to differentiate into TRAP-positivemultinucleated cells. This was confirmed by the de-crease in the differentiation of RAW 264.7 cells ob-served after DN-CaR transfection, providing strongevidence that the CaR exerts a direct effect on osteo-clastogenesis.

Both mature osteoclasts and preosteoclasts appearedto express the CaR, suggesting that stimulation of the

Figure 1. Increasing Cao2� (1.8–20 mM) promotes apoptosis

of �Gal-transfected mature rabbit osteoclasts, an effect atten-uated in DN-CaR-transfected osteoclasts. Data are expressedas mean � sem of 3 independent experiments. **P � 0.01and ***P � 0.001 compared with their respective controls(i.e., �Gal- or DN-CaR-transfected osteoclasts cultured for48 h in the presence of 1.8 mM Cao

2�).

Figure 2. In response to high Cao2�, NF-�B moves from the

cytoplasm (A) to the nucleus (B) in mature rabbit osteoclasts.Maximum translocation is observed at 1 h, when 61 � 7% ofthe osteoclasts exhibit nuclear localization of NF-�B. Nuclearlocalization of NF-�B then slowly decreases to reach a plateauat 6 h (�25%), when NF-�B activation remains significantlydifferent from that observed in osteoclasts cultured for 1 h inthe presence of 1.8 mM Cao

2� (P�0.01). When DN-CaR-transfected rabbit osteoclasts were treated with 20 mM Cao

2�

for up to 12 h, Cao2�-induced activation of NF-�B was

dramatically reduced compared with �-Gal-transfected osteo-clasts (C).

2563THE CaR AND OSTEOCLAST CALCIUM SENSING

CaR acts not only on osteoclast differentiation but mayalso regulate osteoclast life span. Confirming this hy-pothesis, we showed that up to 20 mM of Cao

2� rapidlypromotes the apoptosis of mature osteoclasts through aclassical caspase-3- and �9-dependent mechanism. Wealso found that calcium-induced osteoclast apoptosis atleast partially involves the CaR, which on activation maytrigger a PLC-dependent release of intracellular cal-cium stores that leads to osteoclast apoptosis. In sup-port of these data, we demonstrated that high Cao

2�

triggers nuclear translocation of NF-�B in mature rab-bit osteoclasts and that Cao

2�-induced NF-�B activationis downstream of CaR and PLC stimulation. We con-clude that Cao

2�-induced NF-�B activation may belinked to the induction of apoptosis of mature osteo-clasts. Thus, Cao

2� sensing through the CaR may play akey role in NF-�B nuclear translocation and so affectnot only osteoclast apoptosis, but likely also osteoclastdifferentiation. From the data we gathered regardingthe role played by the CaR in RANKL-induced oste-oclastogenesis and osteoclast apoptosis, it can bespeculated that activation of the CaR may participatephysiologically both in promoting and inhibiting differ-entiation over ranges of calcium concentration thatdiffer from one another. Therefore, knockout the CaRresults in loss of both effects. This might provide amechanism for initially permitting osteoclastogenesisto proceed, then inhibiting it as bone resorption in-creases and the local calcium concentration rises.

In summary, our data clearly demonstrate that theCaR is intimately involved in processes that controlosteoclast differentiation and osteoclast apoptosis inthe systems investigated here through a signaling path-way involving activation of the CaR, phospholipase C,

and NF-�B. As observed in other tissues, such as theparathyroid glands, calcium sensing through the CaRmay play a pivotal role in the release of calcium frombone, and therefore control two of the most importantsteps that regulate the overall activity of osteoclasts(Fig. 3).

Figure 3. Schematic diagram summarizing the role played byCaR in osteoclast precursors and mature osteoclasts. Ex-pressed by osteoclast precursors and mature osteoclasts, CaRappears to play a key role in osteoclast differentiation andapoptosis. On activation by increases in the extracellularcalcium concentration known to occur in association withosteoclastic bone resorption, CaR stimulates phospholipaseC, which is responsible for promoting translocation of NF-�Bfrom the cytoplasm to the nucleus in mature osteoclasts. Mostlikely in association with other transcription factors, Cao

2�-induced activation of NF-�B then leads mature osteoclastsinto apoptosis.

2564 Vol. 20 December 2006 MENTAVERRI ET AL.The FASEB Journal