The Bacteriophage T4 Transcriptional Activator MotA Accepts Various Base-pair Changes within its...

The Bacteriophage T4 Transcriptional Activator MotAAccepts Various Base-pair Changes within itsBinding Sequence

Philip Marshall, Mridula Sharma and Deborah M. Hinton*

Laboratory of Molecular andCellular Biology, NationalInstitute of Diabetes andDigestive and Kidney DiseasesNational Institutes of HealthBethesda, MD 20892, USA

During infection, bacteriophage T4 regulates three sets of genes: early,middle, and late. The host RNA polymerase is capable of transcribingearly genes, but middle transcription requires the T4-encoded transcrip-tional activator, MotA protein, and the T4 co-activator, AsiA protein,both of which bind to the sigma 70 (s70) subunit of RNA polymerase.MotA also binds a DNA sequence (a MotA box), centered at positionÿ30. The identi®cation of more than 20 middle promoters suggested thata strong match to the MotA box consensus sequence (t/a)(t/a)TGCTT(t/c)Awas critical for MotA activation. We have investigated how speci®c basechanges within the MotA box sequence affect MotA binding and acti-vation in vitro, and we have identi®ed seven new middle promotersin vivo. We ®nd that an excellent match to the s70 ÿ10 consensussequence, rather than an excellent match to the MotA box consensussequence, is an invariant feature of MotA-dependent promoters. Manysingle base changes in the MotA box are tolerated in binding and acti-vation assays, indicating that there is more ¯exibility in the sequencerequirements for MotA than was previously appreciated. We also ®ndthat using the natural T4 DNA, which contains glucosylated, 5-hydoxy-methylated cytosine residues, affects the ability of particular MotA boxsequences to activate transcription. We suggest that MotA and AsiA mayfunction like certain eukaryotic TAFs (TATA binding protein (TBP)associated factors) whose binding to TBP results in transcription fromnew core promoter sequences.

# 1999 Academic Press

Keywords: activation; AsiA; bacteriophage; MotA; transcription*Corresponding author

Introduction

Transcription from bacteriophage T4 middle pro-moters (reviewed by Stitt & Hinton, 1994) isaccomplished by the host RNA polymerase, but itrequires both an activator, the T4 MotA protein(Mattson et al., 1974, 1978), and a co-activator, theT4 AsiA protein (Ouhammouch et al., 1994). TheMotA activator binds to middle promoter DNA(Hinton, 1991; Schmidt & Kreuzer, 1992; March-

Amegadzie & Hinton, 1995), but it also binds tothe sigma 70 (s70) subunit of RNA polymerase(Gerber & Hinton, 1996). AsiA also binds to s70

(Stevens, 1972, 1976; Stevens & Rhoton, 1975), andrecent work has shown that this binding inhibitsthe interaction of s70 with its consensus ÿ35sequence (Adelman et al., 1997; Colland et al.,1998).

The identi®cation of more than 20 T4 middlepromoters (Nivinskas et al., 1989; Stitt & Hinton,1994) revealed two highly conserved sequenceelements in the ÿ10 and ÿ30 regions of these pro-moters. The ÿ10 element matches the ÿ10 consen-sus sequence for s70, TAnnnT (Siebenlist et al.,1980; Harley & Reynolds, 1987). This suggests thatT4 middle promoters, like typical Escherichia colipromoters, require an interaction between domain2.4 of s70 and the ÿ10 region of the promoter(Siegele et al., 1989; Waldburger et al., 1990;Dombroski, 1997). Footprints of the polymerase/

Present addresses: P. Marshall, Ottawa GeneralHospital Research Institute, 501 Smythe Road, Ottawa,Ontario, Canada K1H 8L6; M. Sharma, AgResearch,Ruakura, East Street, Hamilton, New Zealand.

Abbreviations used: s70, sigma 70 subunit of RNApolymerase; TBP, TATA binding protein; TAFs, TBPassociated factors; BSA, bovine serum albumin.

E-mail address of the corresponding author:[email protected]

Article No. jmbi.1998.2373 available online at http://www.idealibrary.com on J. Mol. Biol. (1999) 285, 931±944

0022-2836/99/030931±14 $30.00/0 # 1999 Academic Press

AsiA/MotA complex at the middle promoter PuvsX

support this idea (Hinton et al., 1996a). However,PuvsX, like other middle promoters, lacks a matchto the s70 ÿ35 consensus sequence, and footprintsof polymerase/AsiA/MotA at PuvsX indicate thatthe presence of MotA and AsiA alters the protein-DNA contacts made by polymerase in the ÿ35region (Hinton et al., 1996a; M.S., P.M. & D.M.H.,unpublished results). Instead of a s70 ÿ35 consen-sus sequence, middle promoters have a differentconsensus sequence of (t/a)(t/a)TGCTT(t/c)A (aMotA box) centered at position ÿ30 (Brody et al.,1983; Guild et al., 1988). Within the set of middlepromoters, this MotA box sequence is highly con-served. This conservation has implied that theremight be rigid sequence requirements within theMotA box sequence for MotA binding and acti-vation.

Here, we have examined how changes in theMotA box sequence affect MotA binding and tran-scriptional activation in vitro and in vivo. We havefound that the set of acceptable base-pairs in theMotA box sequence is broader than was previouslyinferred from the consensus sequence. In addition,we have found that for the middle promoter, P46

(Guild et al., 1988; Hsu & Karam, 1990), cytosinemodi®cation, which is present in natural T4 DNA,affects MotA-dependent transcription.

Results

Deletion and mutational analyses of the T4middle promoter PuvsX

Analyses of the T4 middle promoter PuvsX

showed that the sequences between ÿ18 and ÿ38were important for MotA activation. Althoughsequences upstream of position ÿ38 stimulatedtranscription under certain conditions, they werenot required for MotA activation (March-Amegadzie & Hinton, 1995). However, MotA pro-tected large regions of PuvsX from DNase I diges-tion: from ÿ59 to ÿ45, from ÿ40 to ÿ25 and from�40 to �57 on the template strand (March-Amegadzie & Hinton, 1995; designated as regionsI, I, and III, respectively, in Figure 1). These areasinclude matches to the MotA box consensussequence centered at ÿ51 (region I) and at ÿ30 andÿ35 (region II) as well as a downstream regionwhich lacks a match to the MotA box sequence(region III). We had found that mutation of theoverlapping MotA boxes at ÿ35 did not affectMotA activation of PuvsX (Hinton et al., 1996a). Toexplore the contributions of other regions for tran-scription and binding, we constructed plasmids inwhich these sequences were mutated or deleted(Figure 1). We found that the T4 sequencesbetween ÿ34 and �3 were suf®cient for MotA acti-vation, and only the MotA box at ÿ30 was critical.Mutation, inversion, or deletion of the box at ÿ51,deletion of the �40 to �57 region, or increasing thespacing between the boxes at ÿ51 and ÿ30 by 5 bp

(half a helical turn) did not signi®cantly affect tran-scription.

DNase I footprint analyses (results not shown)showed that mutation of the ÿ35 MotA boxes hadno effect on the footprint, but mutation of theMotA box at ÿ30 speci®cally eliminated protectionof region II (see Figure 1 for the positions ofregions I, II, and III). Thus, the MotA box at ÿ30 iscritical both for MotA binding to region II and foractivation of transcription. Although the MotA boxat ÿ51 and positions �40 to �57 were not necess-ary for MotA-dependent transcription, thesesequences were required for DNase I protection ofregions I and III, respectively. Furthermore, insert-ing 5 bp between positions ÿ41 and ÿ42 simplyincreased the spacing between protected regions Iand II by 5 bp. This indicates that DNA phasing isnot important for MotA binding to regions I andII. Taken together, the DNase I footprints indicatethat MotA binds independently to each of thethree protected regions of PuvsX.

Sequence requirements for MotA binding andactivation in vitro

The MotA box at ÿ30 of PuvsX has an excellentmatch to the highly conserved consensus sequenceof (t/a) (t/a) TGCTT (t/c) A (Brody et al., 1983;Guild et al., 1988). The CTT at the center of the con-sensus sequence (positions ÿ30 to ÿ28 of PuvsX; seeFigure 1) is invariant among the original set of T4middle promoters (Nivinskas et al., 1989; Stitt &Hinton, 1994). However, MotA protected region IIIof PuvsX (Figure 1) from DNase I digestion, and thisregion lacks a CTT (March-Amegadzie & Hinton,1995). In addition, there was a twofold activationby MotA when the CTT of the ÿ30 MotA box ofPuvsX was changed to ACT (Figure 1). Therefore,we analyzed the sequence requirements for MotAbinding and transcriptional activation in moredetail. Table 1 summarizes the ability of variousmutant versions of the MotA box sequence to com-pete with a wild-type MotA box for binding toMotA. In assays with 50-fold excess competitor,mutation of the G at position ÿ31 to an A or T ormutation of the C at position ÿ30 to a T was dele-terious. However, other single base changes atÿ33, ÿ32, ÿ30, ÿ29, ÿ28, or ÿ26 resulted inreasonable competitors. In addition, the duplexthat contained positions �39 to �53 downstreamof the start of PuvsX transcription (region III inFigure 1) was a good competitor in this assay. Inthe presence of 300-fold excess competitor, everymutant MotA box, even ones with multiplechanges, could compete with the wild type MotAbox sequence for binding.

We also examined the effect of the MotA boxmutations on MotA activation of transcriptionin vitro. In the reactions shown in Figure 2 andTable 2, multiple rounds of transcription were per-formed using T4-modi®ed RNA polymerase iso-lated from infected cells. In other assays, singleand multiple round transcriptions were performed

932 Sequence Requirements for T4 MotA Activation

Figure 1. PuvsX and mutant variants. Top, PuvsX sequence is shown from ÿ59 to �57 with �1 designating the start of transcription. The match to the MotA box consensussequence at ÿ30 is shown by the ®lled arrow. Other matches to the MotA box sequence (centered at ÿ35 and ÿ51) are shown as broken arrows. Regions on the templatestrand that are protected by MotA from DNase I digestion (March-Amegadzie & Hinton, 1995) are designated as I, II, and III. Underneath are shown the sequences of var-ious PuvsX promoter mutants; sequence changes are in bold and underlined. The sequences corresponding with the ÿ10 and ÿ30 regions in the various mutant promotersare boxed along with the s70 ÿ10 sequence and the ÿ30 MotA box sequence present in PuvsX. Mutant/wild-type represents the amount of RNA seen in the presence ofMotA from the mutant promoter relative to that from a PuvsX wild-type promoter, containing positions ÿ94 to �83, present in the same reaction mixture. Fold activation iscalculated as (amount of RNA synthesized by modi®ed polymerase plus MotA)/(amount of RNA synthesized by modi®ed polymerase alone). For the wild-type promoter,the fold activation was 14(�3).

with polymerase modi®ed only by the presence ofAsiA protein (results not shown). Similar resultswere obtained with these various transcriptionconditions. The promoter with the wild-type MotAbox yielded 14-fold more RNA with modi®edpolymerase plus MotA than with modi®ed poly-merase alone. All of the single base mutations,except ÿ31G! A, resulted in promoters that wereactivated eightfold or higher in the presence ofMotA and yielded levels of MotA-dependent RNAthat were at least 25 % of that produced by thewild-type (Table 2). The ÿ30C! A mutationresulted in a promoter that was indistinguishablefrom wild-type (Figure 2, lanes 5 and 6; Table 2),and replacement of the ÿ30 MotA box with the�39 to �53 region resulted in a promoter that wasactivated by MotA (Figure 2, lanes 15 and 16;Table 2). Thus, a MotA box with a center motif ofGATT works well in both the in vitro binding andtranscription assays. We conclude that the protec-tion of region III by MotA (positions �40 to �57)arises from the presence of a MotA box with the

sequence AAAGATTAA (positions �45 to �53downstream of PuvsX; Figure 1).

Of the mutants we tested, the only single basemutant promoter that was not substantially acti-vated by MotA was ÿ31G! A (Figure 2, lanes 3and 4; Table 2). In the absence of MotA, this pro-moter yielded a high level of RNA, but addition ofMotA increased the level of RNA only about two-fold. Thus, the ÿ31G! A mutation convertedPuvsX from a promoter that is primarily dependenton MotA into one that is only marginally depen-dent.

Identification of new T4 middle promoters

To investigate sequence diversity among naturalmiddle promoters, we performed primer extensionanalyses of RNA isolated from T4 motA� and T4motAÿ infections. In some cases, we selected pri-mers to scan regions of the T4 genome which wereknown to express prereplicative genes, but whichlacked nearby middle promoters. In other cases,

Table 1. Binding of MotA to mutant MotA box sequences

MotA box present asHow effective is the competitorb

at an excess ofcompetitora 50-fold 300-fold

ÿ34 ÿ 26PuvsX TTTGCTTAA 100% 100%Mutantsÿ33T! G TGTGCTTAA 81% 100%ÿ32T! A TTAGCTTAA 30% 70%ÿ31G! A TTTACTTAA 4% 59%ÿ31G! T TTTTCTTAA 0% 44%ÿ30C! T TTTGTTTAA 0% 66%ÿ30C! G TTTGGTTAA 65% 94%ÿ30C! A TTTGATTAA 92% 101%ÿ29T! C TTTGCCTAA 60% 88%ÿ28T! G TTTGCTGAA 56% 84%ÿ26A! G TTTGCTTAG 52% 85%�39!� 53 AAAGATTAA 65% 92%Multiple TTATACTAA 0% 19%

mutant 1Multiple TTATACTTA 0% 13%

mutant 2

a Except for the duplexes �39!�53 and multiple mutant 2, the MotA box sequence (shown under-lined below) was present within the double-stranded oligomer:

50 GATCCTATTTGCTTAATAATCCA 3030 GATAAACGAATTATTAGGTAT 50

Numbers refer to positions within the PuvsX sequence; the base change(s) from the PuvsX sequence isshown in bold.

The �39!�53 oligo contains positions from �39 to �53 downstream of the start of PuvsX (seeFigure 1),which are present (shown underlined below) within the sequence:

50 GATCCATTGAAAAGATTAATAATCCA 30GTAACTTTTCTAATTATTAGGTAT 50

Multiple mutant 2 is present (underlined) within the sequence:

50 AATTATTATACTTAGATTA 3030 TTAATAATATGAATCTAAT 50

b Competitive effectiveness was calculated by the formula given in Materials and Methods. For experi-ments with 50-fold excess of competitor to DNA, the fraction bound without competitor was 28(�6)%and the fraction bound with wild-type competitor was 4.8(�2.0)%. For experiments with 300-fold excessof competitor to DNA, the fraction bound without competitor was 29(�8)% and the fraction bound withwild-type competitor was 1.6(�0.8)%. Data represent averages of two to eight experiments, except for�39!�53 competitor at 300-fold excess which is from a single experiment.


we performed computer searches to locate ÿ10regions and various MotA box motifs which hadnot been previously assigned as promoters. Wethen selected primers to target those sequences fortesting. We identi®ed seven new MotA-dependenttranscripts (Figure 3). The sequence at the start ofeach of these transcripts (Figure 4) contains anexcellent match to the s70 ÿ10 consensus sequence,

positioned from 5 to 6 bp upstream of the mappedMotA-dependent ends. Thus, we conclude thatthese RNAs initiate at legitimate transcription startsites downstream from unidenti®ed MotA-depen-dent promoters. We have designated these newmiddle promoters as P42, P61, P55, P55.9, P55.8, Ptd,and PnrdA (Figure 4). P61 and P42 each contain aMotA box at ÿ30 that matches the consensus

Figure 2. In vitro transcription from promoters having a wild-type MotA box or a MotA box with speci®c basechanges. Reactions contained both the wild-type MotA box (pMotbox digested with SspI) and mutant MotA box(pMotbox derivative digested with BsaAI) templates and modi®ed RNA polymerase isolated from a T4 infectionwithout (odd lanes) or with (even lanes) MotA. See Table 2 for MotA box sequences and Materials and Methods forreaction conditions. The positions of wild-type and mutant promoter generated transcripts are indicated.

Table 2. Transcription from promoters with mutant MotA box sequences

MotA BoxaLevel of RNA mutant/

wild-typeb Fold activation by MotAc

wild-type (PuvsX) TTTGCTTAA 14�4Mutantsÿ32T! A TTAGCTTAA 25 % 8ÿ31G! A TTTACTTAA 57 %d 2ÿ30C! A TTTGATTAA 96 % 17ÿ30C! G TTTGGTTAA 52 % 15ÿ30C! T TTTGTTTAA 40 % 12ÿ29T! C TTTGCCTAA 35 % 20ÿ28T! G TTTGCTGAA 33 % 14ÿ26A! G TTTGCTTAG 39 % 12�39!�53 AAAGATTAA 30 % 28Multiple TTATACTAA �10 % e

mutant 1

a MotA box sequences are present within the plasmid pMotbox which contains the PuvsX sequencesfrom ÿ34 to �83.

b Level of RNA observed in the presence of MotA from the mutant promoter relative to that from thewild-type promoter present in the same reaction mixture.

c Calculated as (amount of RNA synthesized by modi®ed polymerase plus MotA)/(amount of RNAsynthesized by modi®ed polymerase alone). Wild-type value represents the average of ten experiments.

d Only half of this RNA is MotA-dependent.e Level of RNA from mutant promoter too low to calculate ratio accurately.

Sequence Requirements for T4 MotA Activation 935

sequence well. However, the other promoters con-tain changes within the MotA box center motif thathad not been seen before. P55, P55.9, P55.8, and Ptd

have the sequences GGTC, GCTA, GCAT, andGGTT, respectively, while PnrdA has multiplechanges with its ÿ30 region, resulting in noobvious match to the MotA box motif.

An excellent match to the sss70 ÿ10 consensussequence is a necessary, but insufficientrequirement for MotA-dependent transcription

An examination of the 31 identi®ed T4 middlepromoters (Figure 4; Nivinskas et al., 1989; Stitt &Hinton, 1994) reveals that all but one (see Discus-sion) have the s70 ÿ10 consensus sequenceTAnnnT. The sequence of P55 demonstrates theimportance of this match in the ÿ10 region. Twoother possible MotA boxes occur upstream of theÿ30 region: a perfect match to the consensus MotAbox sequence (shown by the ®lled arrow inFigure 4) and a match to a MotA box with a centermotif of GATT (shown by the broken arrow).However, each of these possible MotA boxes lacksa good match to the s70 ÿ10 sequence at theappropriate distance, and in the primer extensionassay, only the 50 ends corresponding with P55

were observed. This result suggests that the need

for an excellent match to the s70 ÿ10 consensusoutweighs the need for a perfect match to theMotA box consensus sequence.

Given that some MotA-activated transcriptionoccurred in vitro from promoters lacking a recog-nizable MotA box (Figure 1) and in vivo from PnrdA

(Figure 3), we wondered if any perfect ÿ10sequence (TATAAT) by itself could be used as aMotA-dependent promoter. The overwhelmingmajority of T4 early and middle genes are orientedin the same direction (counterclockwise) on the T4genome (Guha & Szybalski, 1968). Therefore, weperformed computer searches of the appropriatestrand of the T4 genome (Kutter et al., 1994) for thesequence TATAAT. From this analysis, we selectedthree sequences that had not been identi®ed asearly or middle promoters: Pvs, P5R0, and Pcd

(Figure 5). All three candidates have ideal ÿ10regions. In fact, Pvs has the same sequence as PuvsX

from positions ÿ16 to ÿ6. However, all containmultiple mismatches to the MotA box consensussequence. Primer extension analyses of RNA fromT4 motA� and T4 motAÿ infections failed to detectany MotA-dependent 50 ends coming from thesepossible promoters (results not shown). Thus, anexcellent s70 ÿ10 sequence by itself is not suf®cientto de®ne a middle promoter.

Figure 3. Primer extension analyses of T4 middle promoters. Primer extension analyses for each indicated promoterwere performed as described in Materials and Methods using RNA isolated from suppressing (�) or non-suppressing(ÿ) E. coli NapIV infected with T4amG1 (amber mutation of motA). Except for P42(�), analyses are shown in duplicate.In each case, the MotA-dependent 50 end(s) are indicated. GATC lanes show the sequence obtained with wild-typeT4 DNA, the same labeled primer, and ddGTP, ddATP, ddTTP, and ddCTP, respectively.


Although a ÿ30C!A MotA box is activated byMotA in vitro, it is not activated when presentin the T4 genome

The ÿ30C! A mutation, which produces aMotA box with a center motif of GATT, resulted ina very active promoter in vitro (Figure 2, lanes 5and 6; Table 2). Because no such naturally occur-ring promoter was identi®ed previously or in ourscreen, we searched the complete T4 sequence forthis type of promoter and examined seven possiblecandidates: Pcd.3, Pe.1, P5R, Panti-late, Ppset.1, P550, andP40 (Figure 5). Except for the ÿ30C! A change, allof these potential promoters match the derivedMotA box consensus sequence quite well. Further-more, Pcd.3 has a MotA box sequence that is nearlyidentical with the �39 to �53 promoter that wasactive in vitro (Figure 2, lanes 15 and 16; Table 2).Pcd.3, Panti-late, Pe.1, and P5R also contain excellentÿ10 regions that match those found in naturallyoccurring middle promoters. However, primerextension analyses failed to detect 50 ends thatwould be expected if these promoters were active(results not shown). It is possible that these promo-ters appeared inactive because their transcripts

were rapidly degraded. However, the fact that noapparent promoter activity was found in sevendifferent cases strongly argues that a MotA boxwith the center motif of GATT cannot be used forMotA-dependent transcription during T4 infection.

MotA-dependent activation of the middlepromoter P46 is affected by the presence ofmodified cytosine residues in the DNA

Of all the single base changes that we testedin vitro, only the ÿ31G! A promoter, which has acenter motif of ACTT, was poorly activated byMotA (Figure 2, lanes 3 and 4; Table 2) This resultwas puzzling because one naturally occurring T4middle promoter, P46, contains the ACTT motif.Primer extension analysis (Figure 3) con®rmed theearlier designation of P46 as a MotA-dependentpromoter in vivo (Guild et al., 1988; Hsu & Karam,1990). Because there are sequence differencesbetween P46 and the ÿ31G! A promoter that weused in Figure 2, we tested the in vitro transcrip-tional activity of two templates containing the P46

sequence. One template contained just the core

Figure 4. Sequences of T4 middle promoters identi®ed by primer extension analyses. Top, Original ConsensusSequence refers to the inferred consensus sequence from the previously identi®ed set of 24 middle promoters (listedby Stitt & Hinton, 1994, except for P31 which is given by Nivinskas et al., 1989). The size of the base represents itsconservation within this data set; letters in bold were invariant. Underneath are shown the sequences of the sevennew middle promoters identi®ed in this study and the sequence of P46 (reported by Guild et al., 1988; Hsu & Karam,1990). Underlined base denotes the RNA 50 end(s) determined by primer extension analyses (see Figure 3). A sha-dowed base indicates a base not seen in that position in the original set. Filled and broken arrows denote matches toMotA boxes with a center motif of GCTT or GATT, respectively, found at a positions other than ÿ30 in P55.


sequences of this promoter (from ÿ34 to �1;Figure 6, lanes 1 and 2), while another containedadditional sequences both upstream and down-stream of the P46 start site (positions ÿ124 to �201;Figure 6, lanes 3-4). Like the ÿ31G! A promoter,these templates also failed to yield substantialMotA-dependent transcription in vitro. However,unlike the ÿ31G! A template, both of these P46

templates were poor substrates for polymerase inthe absence of MotA, indicating that the ability ofthe ÿ31G! A promoter to give a high level ofMotA-independent transcription was due to othersequence differences.

Failure to observe MotA-dependent transcriptionfrom P46 in our in vitro system could re¯ect theneed for other transcription factors. To test this, wetranscribed the natural T4 template using eithermodi®ed polymerase isolated after T4 infection(Figure 7, lanes 5-8) or polymerase modi®ed onlyby the addition of AsiA (Figure 7, lanes 2-4) andthen assayed P46 transcription by primer extensionanalysis. Signi®cant MotA activation of transcrip-tion was observed in both cases, indicating thattranscription from P46 can be accomplished with aminimal system of polymerase, AsiA, and MotA.The amount of RNA observed in lanes 5-8 is muchless than that seen in lanes 2-4, because modi®ed

polymerase from a T4 infection has low activity(Hinton et al., 1996b, and references cited therein).

Natural T4 DNA is modi®ed by the presence ofglucosylated, hydroxymethylated residues at pos-ition 5 of the cytosine base (Carlson et al., 1994). Toask whether this modi®cation is important for P46

activation, we transcribed the wild-type T4 tem-plate and two different deoxycytosine (dC)-con-taining T4 DNA. T4 phage that produce (dC) DNAmust contain multiple mutations to be viable(Carlson & Miller, 1994). The two dC DNAs usedin this experiment were obtained from phageswhose mutations should be identical except thatT4 JW2095 has a large deletion that removes T4gene denB, while T4 JW819 has point mutationswithin denB (see Materials and Methods fordetails). Using the T4 dC DNA from JW819 andJW2095, we observed a 2.3-fold or 9.5-fold acti-vation of P46 by MotA, respectively, while a 23-fold activation was seen with the wild-type tem-plate (Table 3). In contrast, MotA activation ofPuvsX and PsegA, two middle promoters with GCTTmotifs, was similar or greater when using either ofthe T4 (dC) DNAs than when using the wild-typeDNA (Table 3). Taken together, these resultssuggest that the cytosine modi®cation present in

Figure 5. Tested promoter sequences that failed to yield detectable MotA-dependent 50 ends in vivo. Designationsare the same as described in the legend to Figure 4.


wild-type T4 DNA affects MotA activation of tran-scription from P46.

Discussion

What defines a T4 middle promoter?

MotA activation of bacteriophage T4 middle pro-moters provides a simple system for investigatingthe actions of a DNA binding activator (MotA), aco-activator (AsiA), and E. coli RNA polymerase.At the start of this work, the list of more than 20MotA-dependent promoters (Nivinskas et al., 1989;Stitt & Hinton, 1994) had revealed two highly con-served regions: the s70 consensus sequence ofTAnnnT centered at ÿ10 and a MotA box consen-sus sequence of (t/a)(t/a)TGCTT(t/c)A centered atÿ30 and located from 11 to 13 bp upstream of theÿ10 region (Brody et al., 1983; Guild et al., 1988).Every promoter in this set contained CTT at thecenter of this MotA box, and all but one containeda center motif of GCTT. Thus, it seemed likely thatstrong matches to the consensus sequences in boththe ÿ10 and ÿ30 regions were essential for middlepromoter activity. However, our analyses of MotAbinding and activation using mutant MotA boxsequences show that MotA can tolerate changes at

the most highly conserved positions of the MotAbox sequence, and that the CTT trinucleotide is notan invariant feature of a MotA box. Our in vivo stu-dies con®rm that there are several natural T4middle promoters whose ÿ30 regions lack a per-fect match to the GCTT MotA box motif. If thesepromoters are analogous to PuvsX, then they do notrequire sequences upstream of ÿ34. However, wedo not yet know if sequences outside of the ÿ30region are needed for some of these promoters tocompensate for a poorer match to the MotA box,or if the modi®ed cytosine residues present inwild-type T4 DNA provide additional speci®cityfor binding and activation.

In contrast with the results with the MotA boxsequence, our analyses reinforce the idea thatmiddle promoters must have a strong match to thes70 ÿ10 consensus sequence. Of the 31 T4 middlepromoters now identi®ed (Nivinskas et al., 1989;Stitt & Hinton, 1994; this paper), only P43 has anassigned sequence which is not TAnnnT. P43 wasassigned the sequence GAGTAT (Guild et al., 1988;Hsu & Karam, 1990) because it lies 12 bp down-stream of a MotA box with a GCTT motif. How-ever, a perfect ÿ10 sequence of TATAAT is foundjust 3 bp downstream of this assigned ÿ10. In thelight of our ®ndings, we would assign the ÿ10region of P43 to the TATAAT sequence and thenaccept a ÿ30 region that deviates from the MotAbox consensus sequence.

Cytosine modification of the DNA can affectMotA transcription

Although previous studies have shown that T4modi®cation of its cytosine residues is not requiredfor MotA binding or activation of many promoterswith a center motif of GCTT (Hinton, 1991;Schmidt & Kreuzer, 1992; Ouhammouch et al.,1995; Adelman et al., 1997), we found discrepancieswith MotA boxes having a center motif of ACTTor GATT when using (dC)-containing DNA versusmodi®ed T4 DNA. Two different promoters withcenter motifs of GATT, the ÿ30C! A promoterand the �39!� 53 promoter, were active whenpresent in plasmid DNA, and duplexes with thesesequences bound MotA well. However, in vivoscreens failed to detect RNA ends initiating fromGATT motif sequences. The opposite result wasseen with the ACTT motif. The duplex DNA withthe ACTT motif bound MotA poorly, and therewas little to modest activation from the ACTTmotif promoter P46 when present in plasmidDNA, PCR-generated templates or T4 (dC)-con-taining DNA. However, P46 was very active whenpresent in modi®ed T4 DNA. These results suggestthat T4 modi®cation of its cytosine residues affectsMotA action at certain MotA box sequences. How-ever, because this phenomenon has not been seenwith promoters having the GCTT motif, it seemsunlikely that the glucosyl, 5-hydroxymethyl moietyaffects MotA binding directly by providing arequired contact for MotA. Perhaps cytosine modi-

Figure 6. In vitro transcription from the T4 middlepromoter P46. Multiple round transcription reactionscontained both a PuvsX template (pMotbox digested withSspI, lanes 1-2; PuvsX PCR product, lanes 3-4) and a P46

template (pP46 digested with BsaAI, lanes 1-2; P46 PCRproduct, lanes 3-4), MotA, and either T4-modi®ed poly-merase or polymerase modi®ed with AsiA, as indicated.Reaction conditions were as detailed in Materials andMethods, except that lanes 3-4 contained 0.03 pmol ofDNA, 0.7 pmol of unmodi®ed polymerase modi®edwith 2 pmol of AsiA and as indicated, 1.5 pmol MotA.The PuvsX and the P46 transcripts (or their expected pos-itions) are identi®ed.


®cation in¯uences whether a particular structurecan be attained. By this reasoning, the modi®cationwould promote the structure in the ACTT motif,but inhibit the structure in the GATT motif.Further studies are needed to determine the contri-bution of this modi®cation to MotA activation.

Does MotA activation represent a novel type ofprokaryotic activation?

In E. coli, there are many promoters which lackgood ÿ35 sequences and require activators (forreviews, see Busby & Ebright, 1994; Hochschild &Dove, 1998). Class I activators bind the DNA atsequences located at ÿ60 or upstream, and simul-taneously contact an a subunit. Class II activatorsbind to the DNA just upstream of the ÿ35 region,making contact with s70 and/or a. In both cases, ithas been proposed that the presence of the activa-tor stabilizes the interaction of s70 with sequencesin the ÿ35 region that match the s70 ÿ35 consen-sus poorly. Although T4 middle promoters lack a

s70 ÿ35 consensus sequence and both MotA andAsiA bind directly to s70 (Gerber & Hinton, 1996),MotA-dependent activation of PuvsX does not ®teither of these paradigms. All of the sequencesneeded for MotA-dependent transcription fromPuvsX are between ÿ34 and �3 and importantelements lie within the center of the ÿ30 MotA box(positions ÿ29 to ÿ32). Thus, the sequences neededfor MotA activation reside within the core promo-ter sequences. Furthermore, footprints of polymer-ase/AsiA/MotA at PuvsX indicate that there is amajor rearrangement of the protein-DNA contactsin the ÿ30 region from what is observed with pro-moters that use class I, class II, or no activators(Hinton et al., 1996a; M.S., P.M. & D.M.H., unpub-lished results). Thus, at middle promoters thereappears to be a switch to new core promotersequences rather than a stabilization of the inter-action of s70 with a poor match to its ÿ35 consen-sus.

Although MotA and AsiA appear to have noprokaryotic equivalents, their behavior is some-what similar with that of particular eukaryoticTAFs (TATA binding protein (TBP) associated fac-tors; for a review, see Verrijzer & Tijan, 1996).TAFs bind directly to TBP, a component of each ofthe three eukaryotic polymerases (pol I , pol II, andpol III). In pol II, TBP is needed to contact theTATA box sequence found within the core of mostpol II promoters, just as s70 makes direct contactwith the ÿ10 and ÿ35 elements of E. coli promo-ters. However, TBP is also required for transcrip-tion from TATA-less pol II promoters as well astranscription from pol I and pol III promoterswhich lack TATA boxes. A set of TAFs (human

Figure 7. Primer extension ana-lyses of P46 RNA generated fromT4 DNA in vivo and in vitro. Primerextension analyses were performedas described in Materials andMethods using RNA isolated in vivofrom suppressing E. coli NapIVinfected with T4amG1 (ambermutation of motA) or RNA gener-ated in vitro with wild-type T4DNA as a template and as indi-cated, MotA, AsiA, and T4-modi-®ed polymerase or unmodi®edpolymerase. Lanes 7 and 8 rep-resent an overexposure of lanes 5and 6, respectively. The position ofthe end that represents the P46 tran-script is indicated.

Table 3. Transcription from wild-type T4 and T4 dC-containing DNA

Fold activation by MotAa atT4 template P46 PuvsX PsegA

Wild-type 23 19 38(dC) JW819 2.3 14 38(dC) JW2095 9.5 17 64

a Level of primer extended ends observed in the reactionwith MotA, AsiA, and RNA polymerase relative to thatobserved in the reaction with AsiA and polymerase (see Materi-als and Methods for details).


TAFIs 110, 63, and 48), which are responsible forthe switch in promoter preference from TATA-con-taining pol II promoters to rRNA pol I promoters(Beckman et al., 1995), share functional similaritieswith MotA and AsiA. TAFI 48 inhibits TBP recog-nition of the pol II TATA box sequence (Beckmanet al., 1995) while AsiA inhibits the ability of s70 torecognize its ÿ35 consensus sequence (Adelmanet al., 1997; Colland et al., 1998). TAFIs 110/63 bindDNA (although weakly), and their binding to TBPdirects the TAFI48-TBP complex toward pol I pro-moter sequences. MotA binding to the DNA andto s70 is necessary for the switch to middle promo-ter sequences. Thus, the T4 MotA/AsiA modelmay represent a prokaryotic version of TAF-mediated promoter switching that is employed bythe eukaryotic polymerases.

Materials and Methods

Proteins and reaction buffers

MotA, AsiA, and T4 modi®ed polymerase wereobtained as described (Hinton et al., 1996b). Unmodi®edE. coli RNA polymerase was purchased from USB ofAmersham Life Science. Kglu transcription buffer (Zou& Richardson, 1991) contains 40 mM Tris-acetate(pH 7.9), 150 mM potassium glutamate, 4 mM mag-nesium acetate, 0.1 mM EDTA, 0.1 mM DTT, and100 mg/ml BSA (bovine serum albumin).

DNA

pDKT90, which contains the PuvsX sequence from ÿ94to �83 inserted into the SmaI site of the vector pTZ19U(Amersham Life Science), and pDKT90�HD andpDKT90�NH, in which the PuvsX sequence in pDKT90has been deleted from ÿ94 to ÿ38 and ÿ18, respectively,have been described (March-Amegadzie & Hinton,1995). The plasmid harboring the ÿ35 mutation (p(ÿ35mutant); Figure 1) has been described (designated aspMS1403 by Hinton et al., 1996b). The plasmids p(ÿ30mutant), p(ÿ51 mutant), p(ÿ51 inverse), and p(5 bpinsert) were constructed by in vitro mutagenesis ofpDKT90. Plasmid p(ÿ56 to �18) was generated by inser-tion of a double-stranded oligonucleotide with the PuvsX

sequence from ÿ56 to �18 into the SmaI site of pTZ19U(Figure 1). Plasmid p(ÿ56 to �83) was constructed as fol-lows (Figure 1): a polymerase chain reaction (PCR) withAmpliTaq DNA polymerase (Perkin Elmer), pDKT90 astemplate, and oligomers that annealed 135 basesupstream and 167 bases downstream of the start ofPuvsX, generated a 302 bp fragment. This fragment wasdigested with both MboII, which cleaves at position ÿ50within PuvsX, and EcoRI, which cuts within the vectorsequence downstream of PuvsX. This fragment was thenligated to pTZ19U, which had been cleaved with XbaIand EcoRI, in the presence of a double-stranded oligomerthat recreated the PuvsX sequence to ÿ56 and providedan XbaI site for ligation with the vector.

Oligodeoxyribonucleotides were either synthesizedusing a 381A DNA synthesizer (Applied Biosystems,Inc.) or were purchased from Cruachem, Inc., MidlandCerti®ed Reagent Co., or Genosys Biotechnologies, Inc.Oligomers were puri®ed by reverse-phase chromatog-raphy. Molar concentrations (per molecule of oligonu-cleotide) were calculated from A260 measurements.

Labeled wild-type MotA box DNA, used for gel retar-dation assays, was generated by ®rst labeling one of thesingle strands with T4 polynucleotide kinase and[g-32P]ATP. This strand was then hybridized to thecomplementary strand by heating both oligomers to90-95 �C for two minutes in a solution containing 20 mMTris-HCl (pH 7.5), 2 mM MgCl2, 50 mM NaCl, and thenslowly cooling to room temperature. Unincorporatednucleotides were removed by chromatography through aG-25 spin column (Pharmacia, LKB). Other non-radio-active double-stranded oligomers were used directlyafter hybridization.

Recombinant plasmids were engineered by introdu-cing the various MotA box duplexes between the BamHIand NdeI sites of pDKT90. Thus, pMotbox contains thewild-type sequence of PuvsX from ÿ34 to �84 while themutant plasmids contain the changes indicated inTable 2. Plasmid p(ÿ34 to �3) was constructed by repla-cing the NdeI to EcoRI fragment of pMotbox, which con-tains PuvsX sequences from ÿ19 to �83, with a double-stranded oligomer that contains PuvsX sequences fromÿ19 to �3. Plasmid pP46 was constructed by inserting adouble-stranded oligomer containing sequences thatextend from ÿ34 to �1 of the T4 middle promoter P46

between the BamHI and EcoRI sites of pDKT90, thusreplacing the sequences of PuvsX with those of P46.

Dideoxy sequencing reactions (Sanger et al., 1977)were performed to con®rm the expected mutations inthe pDKT90 and pMotbox derivatives. Transcriptiontemplates were generated from these plasmids by restric-tion with either BsaAI or SspI enzymes which cleave 490or 698 bp, respectively, downstream of the start site ofPuvsX in pDKT90. Transcription templates for PuvsX andP46 were also obtained as PCR products of wild-type T4DNA, primers, and pfu polymerase (Stratagene). Tem-plate DNA, isolated after electrophoresis on agarose gels,were puri®ed by using DNA puri®cation kits fromQiagen or Promega.

DNA substrates for DNase I footprinting, labeled onthe 50 end of the bottom (template) strand, were obtainedas polymerase chain reaction products of pDKT90 or thepDKT90 derivatives and oligonucleotides spaced to yieldproducts of 199 to 264 bp (described by March-Amegadzie & Hinton, 1995). After electrophoresis on 4 %(w/v) polyacrylamide gels, the desired products wereexcised, isolated by electroelution, and puri®ed by usingthe Wizard PCR prep kit (Promega).

The T4 strains JW819 and JW2095, which produce(dC) T4 DNA, were gifts of J. Wiberg (Pittsford, NewYork). JW2095 is T4 56amE51, 42amN55, denAnd28, alc10,�H23 (�H23 is a several kb deletion which extends fromwithin rII into ac, and thus removes denB). JW819 wasderived from JW2095 and its phenotype is consistentwith a T4 56amE51, 42amN55, denAnd28, alc10, and denB-D2a2 phage (see Warner et al., 1970; Vetter & Sadowski,1974; Kutter et al., 1975; Carlson & Wiberg, 1983; Snyder& Jorissen, 1986, for information about these mutations).Thus, JW819 should differ from JW2095 only by the pre-sence of the denBD2a2 double point mutations in denBrather than the �H23 deletion. Wild-type T4 DNA and(dC) containing DNA from JW819 and JW2095 were iso-lated and puri®ed as described (Hinton et al., 1985).DNA sequence analyses of wild-type T4, JW819, andJW2095 DNAs indicated that all three have the samesequence surrounding the P46 start site.


DNase I footprints

DNase I digestions were performed and products sep-arated as described (March-Amegadzie & Hinton, 1995).

Densitometer scans of autoradiograms

Films were scanned using either a Desktop Plus scan-ner from Protein Databases, Inc. or an Arcus II scannerfrom AGFA and quanti®ed using Diversity One softwarefrom Protein-Databases, Inc.

Competition binding assays

Labeled wild-type MotA box duplex (0.04 pmol) wasincubated at 4 �C for 30 minutes in a reaction (10 ml) con-taining 1 pmol MotA, Kglu transcription buffer, and 0, 2,or 12 pmol of the short duplexes containing the variousmutations within the MotA box sequence. Sucrose (1 mlof a 60 % (w/v) solution) was added and the reactionloaded on a native 12 % (w/v) polyacrylamide (37.5,acrylamide:1,bis-acrylamide). Protein-DNA complexeswere resolved from free DNA by electrophoresis at 10V/cm for three hours at 4 �C. Competitive effectivenesswas calculated as follows:

[(fraction bound without competitor - fraction boundwith mutant competitor )/(fraction bound without com-petitor - fraction bound with wild type as competitor)] X100.

In vitro transcription of plasmid and PCR templates

Unless otherwise indicated, reactions (5 ml) containingDNA (0.04 pmol total), 1 pmol MotA, Kglu transcriptionbuffer, 50 mM each of ATP, GTP, and CTP, 2.5 mM[a-32P]UTP, and 0.35 pmol T4-modi®ed RNA polymerasewere incubated at 37 �C for 7.5 minutes. A solution ofcold rNTPs (0.5 ml of 6 mM each NTP) was added, andthe reaction incubated for an additional 7.5 minutes at37 �C. The RNA was then isolated and separated by elec-trophoresis as described (Hinton, 1991).

In vitro transcription of T4 DNA

Reactions (100 ml) containing 6.3 mg DNA (either wild-type DNA, JW819 (dC) DNA, or JW2095 (dC) DNA),Kglu transcription buffer, 285 mM each ATP, GTP, andCTP, 14 mM UTP, and as indicated, 50 pmol MotA,50 pmol AsiA, and either 7 pmol T4-modi®ed RNApolymerase or 10 pmol unmodi®ed RNA polymerasewere incubated at 37 �C for eight minutes. A 10 ml sol-ution of 6 mM each rNTP was added, and the reactionswere incubated for an additional eight minutes. RNAwas isolated and puri®ed as described for the labeledRNA products, except that the RNA was treated asdescribed (Hinton, 1989), dissolved in 12 ml of 10 mMTris-Cl (pH 7.9), 1 mM EDTA, and then used for primerextension analyses.

Computer search for possible T4 middlepromoter sequences

The T4 sequence database (detailed by Kutter et al.,1994) contains the complete sequence of the T4 genome.This database was searched for speci®c sequences (thes70 ÿ10 consensus sequence, TATAAT or TAnnnT, andvarious MotA box motifs) using the Find patterns com-mand of the Wisconsin Package of the Genetics Compu-

ter Group, Version 8, running on the VAX/VMS Cluster,Frederick Biomedical Supercomputing Center, NCI-FCRDC, Frederick, Maryland.

Isolation of in vivo RNA and primerextension analyses

RNA was isolated from NapIV suppressing or non-suppressing cells (Nelson et al., 1982; denoted by K.Kreuzer, Duke University, Durham, NC) that had beeninfected for four minutes with T4D� or the motA ambermutant T4amG1 (Mattson et al., 1978; denoted by K.Kreuzer) using method II described by Hinton (1989).Primer extension analyses were performed as described(Hinton, 1991) using AMV reverse transcriptase (AMVRT XL from Life Sciences, Inc.), all four dNTPs or allfour dNTPs plus ddGTP, and the following (50-32P)-labeled oligonucleotides that annealed approximately100 bases downstream from the predicted 50 end of theRNA (T4 sequence coordinates (Kutter et al., 1994) aregiven in parentheses; sequences of primers are availableupon request): P42 (26195-26214); P61 (19021-19040); P55

(40116-40137); P55.9 (42712-42732); P55.8 (42712-42732); Ptd

(145036-145058); PnrdA (142620-142641); P46 (34911-34935); PuvsX and PsegA (23663-23681); Panti-late (108973-108994); Pcd.3 (133667-133689); Pe.1 (67841-67859); P5R

(79218-79240); Ppset.1 (135320-135335); P55' (40116-40137);P40 (23383-23414); Pvs (61829-61852); P5R' (79218-79240);Pcd (132909-132931). (Except for Panti-late, promoter namesare based on the name of the ®rst downstream gene.Panti-late would express RNA starting at position 109100that is antisense to the late gene 24.) Dideoxy sequencingreactions (Sanger et al., 1977) were performed with wild-type T4 DNA, the labeled primers, and Sequitherm poly-merase (Epicentre Technologies) to generate sequenceladders for the primer extension analyses.

Acknowledgments

We thank John Wiberg for the gift of T4 strains JW819and JW2095, Sonja Bockenhauer for constructing theplasmids p(ÿ56 to �18) and p(5 bp insert), and NancyNossal, Anthony Furano, and Tom Schneider for helpfuldiscussions.

References

Adelman, K., Orsini, G., Kolb, A., Graziani, L. & Brody,E. N. (1997). The interaction between the AsiA pro-tein of bacteriophage T4 and the s70 subunit ofEscherichia coli RNA polymerase. J. Biol. Chem. 272,27435-27443.

Beckman, H., Chen, J.-L., O'Brien, T. & Tijan, R. (1995).Coactivator and promoter-selective properties ofRNA polymerase I TAFs. Science, 270, 1506-1509.

Brody, E., Rabussay, D. & Hall, D. H. (1983). Regulationof transcription of prereplicative genes. In Bacterio-phage T4 (Mathews, C. K., Kutter, E. M., Mosig, G.& Berget, P. B., eds), pp. 174-183, American Societyfor Microbiology, Washington, DC.

Busby, S. & Ebright, R. (1994). Promoter structure, pro-moter recognition, and transcription activation inprokaryotes. Cell, 79, 743-746.

Carlson, K. & Wiberg, J. (1983). In vivo cleavage of cyto-sine-containing bacteriophage T4 DNA to geneti-


cally distinct, discretely sized fragments. J. Virol. 48,18-30.

Carlson, K. & Miller, E. S. (1994). Preparing phage withunmodi®ed DNA. In Molecular Biology of Bacterio-phage T4 (Karam et al., eds), pp. 433-434, AmericanSociety for Microbiology, Washington, DC.

Carlson, K., Raleigh, E. A. & Hattman, S. (1994). Restric-tion and modi®cation. In Molecular Biology ofBacteriophage T4 (Karam et al., eds), pp. 369-381,American Society for Microbiology, Washington,DC.

Colland, F., Orsini, G., Brody, E. N., Buc, H. & Kolb, A.(1998). The bacteriophage T4 AsiA protein: a mol-ecular switch for sigma 70-dependent promoters.Mol. Microbiol. 27, 819-829.

Dombroski, A. J. (1997). Recognition of the ÿ10 promo-ter sequence by a partial polypeptide of s70 in vitro.J. Biol. Chem. 272, 3487-3494.

Gerber, J. S. & Hinton, D. M. (1996). An N-terminalmutation in the bacteriophage T4 motA gene yieldsa protein that binds DNA but is defective for acti-vation of transcription. J. Bacteriol. 178, 6133-6139.

Guha, A. & Szybalski, W. (1968). Fractionation of thecomplementary strands of coliphage T4 DNA basedon the asymmetric distribution of the poly U andpoly U,G binding sites. Virology, 34, 608-616.

Guild, N., Gayle, M., Sweeney, T., Hollingsworth, T.,Modeer, T. & Gold, L. (1988). Transcriptional acti-vation of bacteriophage T4 middle promoters bythe motA protein. J. Mol. Biol. 199, 241-258.

Harley, C. B. & Reynolds, R. P. (1987). Analysis of E. colipromoter sequences. Nucl. Acids Res. 15, 2343-2361.

Hinton, D. M. (1989). Transcript analyses of theuvsX ÿ 40-41 region of bacteriophage T4. Changesin the RNA as infection proceeds. J. Biol. Chem. 264,14432-14439.

Hinton, D. M. (1991). Transcription from a bacterio-phage T4 middle promoter using T4 motA proteinand phage-modi®ed RNA polymerase. J. Biol. Chem.266, 18034-18044.

Hinton, D. M., Silver, L. L. & Nossal, N. G. (1985). Bac-teriophage T4 DNA replication protein 41. Cloningof the gene and puri®cation of the expressed pro-tein. J. Biol. Chem. 260, 12851-12857.

Hinton, D. M., March-Amegadzie, R., Gerber, J. S. &Sharma, M. (1996a). Characterization of pre-tran-scription complexes made at a bacteriophage T4middle promoter: involvement of the T4 MotA acti-vator and the T4 AsiA protein, a s70 binding pro-tein, in the formation of the open complex. J. Mol.Biol. 256, 235-248.

Hinton, D. M., March-Amegadzie, R., Gerber, J. &Sharma, M. (1996b). The bacteriophage T4 middletranscription system: T4-modi®ed RNA polymerase,AsiA (sigma-70 binding protein), and the transcrip-tional activator MotA. Methods Enzymol. 274, 43-57.

Hochschild, A. & Dove, S. L. (1998). Protein-protein con-tacts that activate and repress transcription. Cell, 92,597-600.

Hsu, T. & Karam, J. D. (1990). Transcriptional mappingof a DNA replication gene cluster in bacteriophageT4. Sites for initiation, termination and mRNA pro-cessing. J. Biol. Chem. 265, 5303-5316.

Kutter, E., Beug, A., Sluss, R., Jensen, L. & Bradley, D.(1975). The production of undegraded cytosine-con-taining DNA by bacteriophage T4 in the absence ofdCTPase and endonucleases II and IV, and itseffects on T4-directed protein synthesis. J. Mol. Biol.99, 591-607.

Kutter, E., Stidham, T., Guttman, B., Kutter, E., Batts,D., Peterson, S., Djavakhishvili, T., Arisaka, F.,Mesyanzhinov, V., RuÈ ger, W. & Mosig, G. (1994).Genomic map of bacteriophage T4. In MolecularBiology of Bacteriophage T4 (Karam et al., eds), pp.491-519, American Society for Microbiology,Washington, DC.

March-Amegadzie, R. & Hinton, D. M. (1995). The bac-teriophage T4 middle promoter PuvsX: analysis ofregions important for binding of the T4 transcrip-tional activator MotA and for activation of tran-scription. Mol. Microbiol. 15, 649-660.

Mattson, T., Richardson, J. & Goodin, D. (1974). Mutantof bacteriophage T4D affecting expression of manyearly genes. Nature, 250, 48-50.

Mattson, T., van Houwe, G. & Epstein, R. H. (1978). Iso-lation and characterization of conditional lethalmutations in the mot gene of bacteriophage T4.J. Mol. Biol. 126, 551-570.

Nelson, M. A., Ericson, M., Gold, L. & Pulitzer, J. F.(1982). The isolation and characterization of TabRbacteria: hosts that restrict bacteriophage T4 rIImutants. Mol. Gen. Genet. 188, 60-68.

Nivinskas, R. G., Raudonikiene, A. & Guild, N. (1989).A new early gene upstream of the middle gene 31in bacteriophage T4: cloning and expression. Mol.Biol. (Moscow), 23, 739-749.

Ouhammouch, M., Orsini, G. & Brody, E. N. (1994). TheasiA gene product of bacteriophage T4 is requiredfor middle mode RNA synthesis. J. Bacteriol. 176,3956-3965.

Ouhammouch, M., Adelman, K., Harvey, S. R., Orsini,G. & Brody, E. N. (1995). Bacteriophage T4 MotAand AsiA proteins suf®ce to direct Escherichia coliRNA polymerase to initiate transcription at T4middle promoters. Proc. Natl Acad. Sci. USA, 92,1415-1419.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNAsequencing with chain-terminating inhibitors. Proc.Natl Acad. Sci. USA, 74, 5463-5467.

Schmidt, R. P. & Kreuzer, K. N. (1992). Puri®ed motAprotein binds the ÿ30 region of a bacteriophage T4middle-mode promoter and activates transcriptionin vitro. J. Biol. Chem. 267, 11399-11407.

Siebenlist, U., Simpson, R. B. & Gilbert, W. (1980). E. coliRNA polymerase interacts homologously with twodifferent promoters. Cell, 20, 269-281.

Siegele, D. A., Hu, J. C., Walter, W. A. & Gross, C. A.(1989). Altered promoter recognition by mutantforms of the s70 subunit of Escherichia coli RNApolymerase. J. Mol. Biol. 206, 591-603.

Snyder, L. & Jorissen, L. (1986). Molecular proof thatbacteriophage T4 alc and unf genes are the samegene. J. Bacteriol. 168, 833-838.

Stevens, A. (1972). New small polypeptides associatedwith DNA-dependent RNA polymerase of Escheri-chia coli after infection with bacteriophage T4. Proc.Natl Acad. Sci. USA, 69, 603-607.

Stevens, A. (1976). A salt-promoted inhibitor of RNApolymerase isolated form T4 phage-infected E. coli.In RNA Polymerase (Losick, & Chamberlin, , eds),pp. 617-627, Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

Stevens, A. & Rhoton, J. C. (1975). Characterization ofan inhibitor causing potassium chloride sensitivityof an RNA polymerase from T4 phage-infectedEscherichia coli. Biochemistry, 14, 5074-5079.

Stitt, B. & Hinton, D. (1994). Regulation of middle-modetranscription. In Molecular Biology of Bacteriophage T4


(Karam et al., eds), pp. 142-160, American Societyfor Microbiology, Washington, DC.

Verrijzer, C. P. & Tijan, R. (1996). TAFs mediate tran-scriptional activation and promoter selectivity.Trends Biochem. Sci. 21, 338-342.

Vetter, D. & Sadowski, P. D. (1974). Point mutants inthe D2a region of bacteriophage T4 fail to induceT4 endonuclease IV. J. Virol. 14, 207-213.

Waldburger, C., Gardella, T., Wong, R. & Susskind,M. M. (1990). Changes in conserved region 2 of

Escherichia coli s70 affecting promoter recognition.J. Mol. Biol. 215, 267-276.

Warner, H. R., Snustad, D. P., Jorgensen, S. E. &Koerner, J. F. (1970). Isolation of bacteriophage T4mutants defective in the ability to degrade hostdeoxyribonucleic acid. J. Virol. 5, 700-708.

Zou, L. & Richardson, J. P. (1991). Enhancement of tran-scription termination factor rho activity with potass-ium glutamate. J. Biol. Chem. 266, 10201-10209.

Edited by M. Yaniv

(Received 2 June 1998; received in revised form 23 October 1998; accepted 28 October 1998)


The Bacteriophage T4 Transcriptional Activator MotA Accepts Various Base-pair Changes within its...

Documents

Transcript of The Bacteriophage T4 Transcriptional Activator MotA Accepts Various Base-pair Changes within its...