ORIGINAL PAPER

Th1-type immune response to infection by pYV-curedphoP-phoQ null mutant of Yersinia pseudotuberculosisis defective in mouse model

Subodh Kumar Æ K. Balakrishna ÆG. S. Agarwal Æ S. Merwyn Æ G. P. Rai ÆH. V. Batra Æ A. A. Sardesai Æ J. Gowrishankar

Received: 4 August 2008 / Accepted: 16 October 2008 / Published online: 5 November 2008

� Springer Science+Business Media B.V. 2008

Abstract The PhoP-PhoQ two-component system

of Yersinia pseudotuberculosis, a Gram-negative

enteric pathogen which causes a variety of gastroin-

testinal and extraintestinal infections in humans, has

been shown to be necessary for virulence. A phoP-

phoQ null mutant of a strain of Y. pseudotuberculosis

cured of its native plasmid pYV was obtained and

studied for generation of immune response in mouse

model following intravenous inoculation. The phoP-

phoQ null mutant elicited much weaker IgG antibody

response to whole cell sonicated (WCS) antigen, in

particular that of IgG2a isotype. Interferon-c levels

were also significantly reduced in cultured spleno-

cytes of mice immunized with phoP-phoQ null

mutant. The null mutant was found to be about 72-

fold less virulent than the parent isogenic strain of

Y. pseudotuberculosis. Average counts in spleen of

mice inoculated with the null mutant were observed

to reduce by at least four logs when compared with

the counts in the spleen of mice inoculated with

parent isogenic strain. We can thus suggest that the

Th1-type immune response of the phoP-phoQ null

mutant of Y. pseudotuberculosis is diminished in

mice.

Keywords Immune response � phoP �Recombineering � Yersinia pseudotuberculosis

Abbreviations

CFU Colony-forming units

ELISA Enzyme-linked immunosorbent assay

LFR Long flanking region

LD50 Lethal dose 50

PBS Phosphate buffer saline

YOPs Yersinia outer proteins

WCS Whole cell sonicated

Introduction

Yersinia pseudotuberculosis is a Gram-negative

enteric pathogen and causes a variety of gastrointes-

tinal and extraintestinal infection in humans with

high rates of postinfection complications (erythema

nodosum, arthritis, iritis, and nephritis) (Butler 1994;

Ljungberg et al. 1995). Y. pseudotuberculosis is

found either as commensal or pathogen in a wide

range of animals (birds, rodents, pigs, etc.) and is also

recovered from food and water sources. Epizootics

and human outbreaks may arise from these sources of

contamination (Paff et al. 1976). Expression of

virulence in Y. pseudotuberculosis requires, as in

S. Kumar (&) � K. Balakrishna � G. S. Agarwal �S. Merwyn � G. P. Rai � H. V. Batra

Division of Microbiology, Defence R&D Establishment,

Jhansi Road, Gwalior 474 002, India

e-mail: subodh_kumar@email.com

A. A. Sardesai � J. Gowrishankar

Laboratory of Bacterial Genetics, Centre for DNA

Fingerprinting and Diagnostics, ECIL Road, Hyderabad

500 007, India

123

Antonie van Leeuwenhoek (2009) 95:91–100

DOI 10.1007/s10482-008-9292-5

Y. pestis and Y. enterocolitica, the presence of a

common 70-kb virulence plasmid, the pYV (known

as pCD1 in Y. pestis), which encodes a number of

secreted virulence determinants called Yersinia outer

proteins (YOPs) (Gemski et al. 1980; Portnoy and

Falkow 1981). Yersinia strains having mutation in

YOP genes are known to be highly attenuated in

mouse infection model. Apart from the plasmid-

borne virulence determinants, expression of many

virulence factors is also governed by chromosome-

based genes. One class of these genes can be the

virulence determinants themselves, such as irp-1

which encodes for high-molecular-weight protein-1

and is part of the yersiniabactin biosynthesis appara-

tus. Yersiniabactin is a siderophore that enables

uptake of iron by yersiniae (Carniel 2001). The Mn

cofactored superoxide dismutase (SodA) provides

resistance to oxygen radicals derived from phago-

cytes (Roggenkamp et al. 1997). The second category

of chromosome-based virulence determinants are

two-component systems in which, in response to

external stimuli, the membrane-located sensor com-

ponent undergoes a conformational change resulting

in phosphorylation of the regulator component. This

in turn affects the latter’s ability to bind to DNA at

specific promoter sites and thus modulates its activity

as a transcriptional regulator.

The phoP-phoQ operon is a typical bacterial two-

component regulatory system comprised of mem-

brane-associated sensor kinase (PhoQ) and

cytoplasmic transcriptional regulator (PhoP). This

locus regulates numerous cellular activities of Gram-

negative bacteria by activating or repressing multiple

genes. The PhoP-PhoQ two-component system has

been extensively studied in Salmonella and has been

shown to regulate more than 40 different genes,

termed PhoP-activated (pag) and PhoP-repressed

(prg) genes (Miller and Mekalanos 1990). PhoP null

mutants of S. typhimurium are also markedly attenu-

ated for virulence in mice. The response regulator

PhoP has been shown to be important for survival of

Y. pseudotuberculosis and Y. pestis in macrophages

(Grabenstein et al. 2004; Oyston et al. 2000). A

Y. pseudotuberculosis phoP mutant was almost 100-

fold less virulent than the wild-type strain in murine

intestinal infection model (Grabenstein et al. 2004).

The aim of the present study was to determine the

relevance of the PhoP-PhoQ two-component system in

immunity to Y. pseudotuberculosis infection in mice.

Materials and methods

Bacterial strains, culture conditions, and plasmids

Y. pseudotuberculosis strain 1A (henceforth referred

to as 1A) (Khushiramani et al. 2006) was used in this

study and was procured from the WHO collaborating

centre at CDC, Fort Collins, USA. The strain belonged

to serotype O: 1a and was characterized by standard

biochemical tests, and a polymerase chain reaction

(PCR) specific for wzz gene of Y. pseudotuberculosis

(and Y. pestis) using primers Ypf20120-GGTGATG

AGCAAGTTCAAG and Ypr20538-GCTAAATCCA

CTGCTCGCTG (Bogdanovich et al. 2003). The strain

1A was cured of pYV plasmid. Curing was confirmed

by the method of Kado and Liu (1981). Strain 1A and

its isogenic null mutant (DPQ1A, see later) were grown

in brain heart infusion (BHI) broth, Luria Bertani (LB)

broth, or LB agar (Difco) at 28�C. The broth media

were incubated overnight with aeration, whereas the

plates were incubated for 48 h. Escherichia coli DH5awere grown overnight in LB broth or LB agar at 37�C.

The media contained ampicillin (100 lg/ml) or chlor-

amphenicol (25 lg/ml) when appropriate. The bacteria

were counted by plate count method. Plasmid

pKOBEG-sacB, containing red genes of bacteriophage

lambda, was a kind gift from Elisabeth Carniel of

Pasteur Institute, Paris, France. The red genes (redcbaoperon) of plasmid pKOBEG-sacB are expressed

under the control of the arabinose-inducible pBAD

promoter and had chloramphenicol as selection

marker. pBluescript phagemid was obtained from

Stratagene and had ampicillin resistance marker.

phoP-phoQ null mutant construction

A phoP-phoQ null mutant of strain 1A was generated

by recombineering (Yu et al. 2000). The strategy

involved replacement of phoP-phoQ operon by ampi-

cillin gene. The ampicillin gene along with promoter

was amplified from pBluescript phagemid using

primers 50-AGAGTTGGTAGCTCTTGATC-30 and

50-CATTCAAATATGTATCCGCTC-30 (Yu et al.

2000). Long portions of 421 bases (392 bases upstream

to and 10 bases into phoP gene) and 336 bases (285

bases downstream to and 30 bases into phoQ gene)

were amplified by PCR using P3 (50-CAGATATTG

GCGTGAACATC-30) and P4 (50-GATCAAGAGC

TACCAACTCGAACCCGCATACACCAATCC-30),

92 Antonie van Leeuwenhoek (2009) 95:91–100

123

and P5 (50-ATGGCCCGTGGCTAACATGCC-30) and

P6 (50-GAGCGGA TACATATTTGAATGGGTCAG

CAACAAGATTGTCACG-30) primers, respectively,

targeting the phoP-phoQ locus of Y. pseudotubercu-

losis (accession no. AF333125). P4 and P6 primers had

overhang homologous to amp cassette at 30 end

(Fig. 1a). Both of these products along with amp

cassette were amplified by P3 and P5 primers by three-

way PCR (Derbise et al. 2003), to obtain a product of

1,919 bases called LFR Amp cassette. The PCR

amplification reaction mixtures contained 4 U mixed

3:1 Taq and Pfu (MBI Fermentas, Burlington) poly-

merases used with the Pfu supplier buffer, 0.2 lM of

each primer, and 200 mM dNTPs with template DNA

obtained from strain 1A. To create DPQ1A mutants,

protocol of Derbise et al. (2003) was used. Briefly,

plasmid pKOBEG-sacB was electroporated (Bio-Rad,

Hercules, CA) in strain 1A (Conchas and Carniel 1990)

and was grown in LB broth containing chloramphen-

icol (25 lg/ml) at 28�C until OD600 reached 0.2.

Expression of the red genes carried by pKOBEG-sacB

was induced by adding 0.2% (w/v) L-arabinose to the

medium for about 3 h. Bacteria were concentrated

200-fold and were made electrocompetent by three

washings in ice-cold 10% (v/v) glycerol. After elec-

troporation of LFR Amp cassette, cells were

transferred to 1 ml LB broth for 1.5 h at 28�C and

selection of transformants was achieved on LB agar

containing ampicillin (100 lg/ml). After primary

selection, mutants were grown on LB agar plates

without NaCl containing 10% (v/v) sucrose in order to

cure the pKOBEG- sacB plasmid.

Stress response assays

The survival of strains 1A and DPQ1A was deter-

mined under stress of high hydrogen peroxide and

salt concentrations (Flamez et al. 2008). Briefly,

cultures grown overnight at 28�C were centrifuged

and pelleted. The pelleted cells were resuspended in

LB broth supplemented with (a) 2.5 lM hydrogen

peroxide (Merck) and (b) 1 M sodium chloride

(Merck). Bacterial suspension [at final concentration

of (4.0–6.0) 9 108 CFU/ml for salt tolerance, and

(4.0–6.0) 9 105 CFU/ml for hydrogen peroxide tol-

erance] were incubated in stress conditions at 28�C

for 3 h without shaking. For both assays bacterial

survival was defined as the ratio of number of colony-

forming units (CFUs) after incubation in given stress

condition to the initial number of CFUs, multiplied

by 100.

Preparation of whole cell sonicated (WCS)

antigens

WCS antigens of strains 1A and DPQ1A were

prepared by earlier described method with slight

modifications (Kumar et al. 2001). Briefly, bacteria

were grown overnight in 20 ml BHI broth at 28�C

under shaking conditions (200 rpm). The growth was

harvested by centrifugation at 10,000g for 15 min.

The pellet was washed twice with 0.01 M phosphate

buffer saline (PBS, pH 7.2) and lysed by sonication.

The lysate was centrifuged at 10,000g for 15 min at

4�C to obtain clear cell free lysate and was called

WCS antigen. Protein concentration of WCS antigens

was determined by BCA kit (Pierce) and the aliquots

were stored at -20�C until used.

Fig. 1 Construction of phoP-phoQ null mutant (DPQ1A) of

Y. pseudotuberculosis strain 1A. a Three-way PCR strategy.

Three PCR products of Up region (422 bases), Down region(336 bases) and Amp gene (1,202 bases) were further amplified

by PCR using P3 and P5 primers to obtain a product of 1,919

bases, named LFR Amp cassette. b The 1,919 bp LFR Amp

cassette was electroporated in strain 1A harboring pKOBEG-

sacB plasmid and 12 transformants (lanes 1–12) were obtained,

of which 3 showed the integration of LFR Amp cassette in

genomic DNA when tested by P3/P5 PCR. The transformants

with no integration of LFR Amp cassette showed PCR product

of 2,809 bases. Lane 13, 1 kb DNA ladder; lane 14, positive

control (1A genomic DNA)

Antonie van Leeuwenhoek (2009) 95:91–100 93

123

Animals

All animal experiments, except immune response

studies, were carried out in 6- to 8-week-old Swiss-

Albino outbred female mice. The immune response

studies were carried out in 6- to 8-week-old female

BALB/c mice. All experiments had 10–12 animals in

each group unless stated. The mice were maintained

and used in accordance with the recommendations of

the committee for the purpose of control and

supervision of experiments on animals. The study

had the approval of Institutional Ethics Committee.

Strains 1A and DPQ1A were grown in LB broth at

28�C overnight for all animal experiments. The

bacteria were washed once with PBS (0.01 M, pH

7.2) and resuspended in the same buffer before

inoculation. Viable count was determined by pour

plate method to determine the exact number of

bacteria inoculated. All intravenous inoculations

were given in tail vein in 0.1 ml volume.

Determination of lethal dose 50 (LD50)

For determination of LD50, groups of five mice were

inoculated with each of various concentrations of

strain 1A (1.3 9 1010 to 1.3 9 106 CFU) and DPQ1A

(5.0 9 109 to 5.0 9 105 CFU) by intravenous route.

The dilutions of the culture were made in PBS

(0.01 M, pH 7.2). Number of mice surviving in each

group after 72 h was noted and LD50 was calculated

by the method of Reed and Muench (1938).

Colonization of spleen

Mice were inoculated by intravenous route with

strains 1A or strain DPQ1A with 9.8 9 108 CFU or

5.5 9 108 CFU, respectively. The mice inoculated

with strain 1A died on day 1, whereas the mice

inoculated with strain DPQ1A were sacrificed on day

1. Spleens of the animals were isolated, weighed,

homogenized, and plated for determination of CFU.

Detection of IgG and IgG isotypes by ELISA

BALB/c mice were inoculated by intravenous route

with strain 1A (1.8 9 106 CFU/dose) or DPQ1A

(1.4 9 107 CFU/dose). The control group of mice

were inoculated with PBS. The mice were given a

second dose after 2 weeks (1.5 9 106 CFU/dose,

strain 1A; 5.6 9 106 CFU/dose, strain DPQ1A). Sera

were collected for 4 weeks at weekly intervals to

quantify IgG antibody response. WCS antigen of

strains 1A or DPQ1A was used to quantify the

antibody response by ELISA method as described

earlier (Kumar et al. 2001). Briefly, the microtitration

plates (maxisorp, Nunc) were coated with WCS

antigen (10 lg/ml) in 0.05 M carbonate buffer (pH

9.6) and incubated at 37�C for 2 h. The plates were

blocked with blocking buffer (PBS containing 1% w/

v BSA) for 1 h at 37�C followed by overnight

incubation at 4�C. Next day, after two washings with

PBST (PBS containing 0.05% v/v Tween 20), diluted

sera in duplicate were added to the individual wells.

Initial screening was carried out with various dilu-

tions (1:100–1:800) of limited number of sera, and

finally dilution of 1:200 was chosen for all the

samples. For determining the IgG isotype response,

sera from each group of mice were pooled and tested

at 1:200 dilution in duplicate by three independent

ELISAs. After incubation at 37�C for 1 h, appropriate

anti-mouse conjugate was added at a dilution recom-

mended by the manufacturers for 1 h at 37�C. The

goat anti-mouse horseradish peroxidase (HRP) con-

jugate IgG antibody and isotype conjugates (labeled

with HRP or AP) were obtained from Sigma and

Pharmingen, respectively. The plates were washed

with PBST four or five times after each step. The

ELISA was developed in freshly prepared citrate

phosphate buffer (0.1 M, pH 5.0) with ortho-phenyl-

enediamine (0.4 mg/ml) and H2O2 (6%, 0.4 ll/ml) or

in diethanolamine buffer (10 mM, pH 9.5) containing

0.5 mM MgCl2 with para nitrophenyl phosphate

(1 mg/ml). The reaction was stopped by addition of

2.5 M H2SO4 or 3 M NaOH and absorbance was

measured at 492 or 405 nm in an ELISA reader.

Splenocyte proliferation assay and cytokine assay

For cell proliferation and cytokine assays, spleen

cells (lymphocytes) were prepared by lysing eryth-

rocytes with ammonium chloride solution (Kumar

et al. 2001). The cell proliferation was carried out

using alamar blue dye (Biosource, USA) by the

method of Zhi-Jun et al. (1997). Briefly, the spleno-

cytes were suspended in 96-well tissue culture plate

at ca. 1 9 106 cells/ml (100 ll/well) along with one

volume of antigen (10 lg/ml) in RPMI1640 medium.

Appropriate positive (Con A, 10 lg/ml) and negative

94 Antonie van Leeuwenhoek (2009) 95:91–100

123

controls were also included. After 48 h of incubation,

0.2 volume of alamar blue dye was added to each

well and the plate was incubated for further 15–18 h.

Experiments were carried out in triplicate wells for

each mouse. The reading was taken at 570 and

600 nm and results are expressed as mean specific

absorbance by subtracting the absorbance at 600 nm

from that at 570 nm. Supernatants from parallel

cultures were harvested after 72 h and stored at

-70�C until assayed for specific cytokine. The levels

of interferon-c (IFN-c) and interleukin-10 (IL-10)

were determined in culture supernatants using sand-

wich ELISA kits (R& D Systems, USA) as per

manufacturer’s instructions.

Statistical analysis

A statistical analysis to compare the groups was

performed using t test (Sigma Stat, Jandel Scientific,

USA). Mann–Whitney rank-sum test was used to

determine the P values, wherever the normality test

failed.

Results and discussion

In this study, a phoP-phoQ null mutant of Y. pseu-

dotuberculosis was constructed and was studied for

its ability to generate immune response in mice by

inoculation through intravenous route. The parent

Y. pseudotuberculosis strain was cured of 70 kb pYV

plasmid in order to avoid the immunodominant effect

of YOP proteins and effectors. Further, as pYV minus

strain was attenuated, mice were injected intrave-

nously to ensure immediate systemic spread of

bacteria. Recombineering approach (Yu et al. 2000)

was used to construct the phoP-phoQ null mutant.

Total 12 transformants were obtained, of which three

had disruption in the phoPQ locus. To confirm

correct insertion of LFR Amp cassette within phoPQ

locus, genomic DNA prepared from the transformants

was used as template for PCR with P3 and P5

primers. PCR with strain 1A DNA produced a

product of 2,809 bp, whereas the mutant genomic

DNA gave rise to a PCR product of 1,919 bp

(Fig. 1b). The mutants were further verified by

DNA sequencing (in both directions) using P3/P5

generated PCR products of strain 1A and mutant

clones. No point mutation was observed in the

flanking regions of LFR amp cassette and the deletion

of target gene was as expected. One of these mutants

(no. 5) was used in the present study and was named

as DPQ1A. We were unsuccessful in repeated

attempts to disrupt the phoPQ locus by using short

flanking regions (*50 bases) with amp cassette.

In order to ensure that we obtained the correct

mutant, phenotypic characterization of the mutant

strain DPQ1A was carried out under stress conditions.

The mutant strain DPQ1A was found to have

increased resistance to hydrogen peroxide and greater

susceptibility to salt (Fig. 2). The findings are in

accordance with results of earlier studies on phoP

mutant of Y. pseudotuberculosis and Y. pestis

(Oyston et al. 2000; Flamez et al. 2008). We then

determined the in vivo lethal dose 50 of both strains

after intravenous inoculation in mice. The LD50 of

strains 1A and DPQ1A was found to be

2.2 9 107 CFU and 1.6 9 109 CFU, respectively,

which is about 72-fold increase in LD50 of the

phoP-phoQ null mutant. Our results are similar to an

0

10

20

30

40

50

60

70

80

90

NaCl hydrogen peroxide

Bac

teria

l sur

viva

l (%

)

Strain 1A

Strain ∆PQ1A

Fig. 2 In vitro survival of

strain 1A and DPQ1A under

NaCl (1 M, 3 h) and

hydrogen peroxide (2.5 lM,

3 h) stress. Each bar is the

mean value ± standard

deviation of three

independent assays

Antonie van Leeuwenhoek (2009) 95:91–100 95

123

earlier study on Y. pseudotuberculosis (Grabenstein

et al. 2004) that had reported the LD50 of phoP

mutant to increase by 100-fold in murine intestinal

infection model. In the present study, with oral route

of infection, the mice were not killed even with the

highest tested dose of strain 1A (1 9 109 CFU),

possibly because of lack of native pYV plasmid.

The phoP-phoQ null mutant of Y. pseudotubercu-

losis was found to be attenuated for colonization of

spleen following intravenous inoculation in Swiss

Albino mice. The average bacterial count in mice

inoculated with strain 1A was 9.0 9 108 CFU/g of

spleen [range (6.0–13.0) 9 108 CFU/g of spleen].

The average count in mice inoculated with strain

DPQ1A was found to reduce by at least four logs and

was found to be 1.0 9 104 CFU/g of spleen [range

(1.4–20.3) 9 103 CFU/g of spleen]. Earlier studies

have shown that orogastric infection with Y. pseudo-

tuberculosis strain lacking yopH or yopE results in

diminished colonization of the mesenteric lymph

nodes, spleen or Peyer’s patches (Logsdon and

Mecsas 2003). The results of this study, therefore,

show that the phoP-phoQ null mutant of strain 1A of

Y. pseudotuberculosis, is highly impaired for coloni-

zation of spleen.

Immune response to strains 1A and its phoP-phoQ

null mutant, DPQ1A, was studied in mice after

intravenous inoculation. A group of control animals

inoculated with PBS was also included. A significant

rise in IgG antibodies to homologous WCS antigen

was observed in sera of animals inoculated with strain

1A when compared with control animals. As shown in

Fig. 3a, the rise in titre was significantly higher from

second week post immunization (p.i.) onwards and

peaked in third week p.i. (P \ 0.01). Similar signif-

icant rise in IgG antibodies to homologous WCS

antigen was also observed in sera of mice inoculated

with strain DPQ1A, which peaked in third week p.i.

(P \ 0.01) (Fig. 3b). However, the rise in antibodies

in the group of mice inoculated with strain DPQ1A

was significantly lower than the response observed in

the group of mice inoculated with strain 1A. This

response was similar even when the heterologous

WCS antigen was used to assess the response by

ELISA (Fig. 3a, b). To further define the humoral

responses induced after immunization, the titres of

serum IgG isotype antibodies IgG1, IgG2a, IgG2b and

IgG3 were determined in pooled sera samples at

weekly intervals. IgG2a and IgG2b antibody response

specific to homologous WCS antigens was observed

in mice of both groups. However, IgG2a antibody

response in mice immunized with strain DPQ1A was

significantly lower than in mice immunized with

strain 1A (Fig. 4a, b). IgG2b antibody response to

WCS antigen of strain DPQ1A was comparable in

mice of both groups (Fig. 4c, d). No IgG1 or IgG3

antibodies were detected in any of the mice. These

results show that strain 1A of Y. pseudotuberculosis is

OD

492

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0.40

0.45

****

**

** *

1st wkPre-immuneserum

2nd wk 3rd wk 4th wk0.0

0.1

0.2

0.3

0.4

0.5

0.6

****

**

***

++

+

(b)(a)

OD

492

1st wkPre-immuneserum

2nd wk 3rd wk 4th wk

Fig. 3 IgG antibody response to WCS antigen of strain 1A

and DPQ1A. The mice were inoculated through intravenous

route with strains 1A (s), DPQ1A (h) or PBS (D). The second

dose was inoculated 2 weeks after the first dose (shown by

arrows). Each symbol represents the mean value ± standard

deviation. Significant differences of comparison with normal

controls (PBS group) as determined by Student’s paired t test

are indicated by asterisks (P \ 0.05), double asterisks(P \ 0.01) or plus (P \ 0.001) signs in the same week. aIgG antibody response to WCS antigen of strain 1A. b IgG

antibody response to WCS antigen of strain DPQ1A

96 Antonie van Leeuwenhoek (2009) 95:91–100

123

able to initiate strong IgG response in mice after

intravenous inoculation. The humoral response to

mutant DPQ1A is greatly diminished. Further, the IgG

response was predominantly of IgG2a isotype, which

is suggestive of Th1-type immune response (Stevens

et al. 1988). It was also interesting to note that the

response in sera of mice immunized with strain 1A

still elicited high OD values for IgG, IgG2a, and

IgG2b when tested against WCS antigen of mutant

DPQ1A (Figs. 3b and 4b, d), which may indirectly

suggest that the antigens responsible for Th1 response

may be produced in phoP-phoQ null mutant, DPQ1A,

when grown at 28�C but are not expressed in mice.

Rise in IgG2b antibodies to the homologous antigen

was also observed at 3 weeks p.i. in both groups of

mice (Fig. 4c, d). The exact nature/role of these

antibodies in immunity to Y. pseudotuberculosis

infection needs to be determined.

The cellular immune response was observed at the

end of 4 weeks p.i. by spleen cells proliferation assay

and cytokine profiling for IFN-c and IL-10, the two

important cytokines in Yersinia immunology. Spleno-

cyte proliferation was observed in mice of both

groups with no significant difference in values

between them (Fig. 5). Significant rise in IFN-clevels was observed in mice immunized with strain

1A, suggesting generation of Th1-type immune

response (Fig. 6). A significant reduction in IFN-clevels was observed in mice immunized with mutant

DPQ1A, supporting the results observed earlier for

IgG2a antibodies. It is established that IFN-c can

activate macrophages, which might in turn be able to

kill a pathogen, and earlier studies on Y. pseudotu-

berculosis (Grabenstein et al. 2004) and Y. pestis

(Oyston et al. 2000) have shown that phoP mutants

are defective for replication in macrophages. The

OD

492

0

1

2

3

(a)

0

1

2

3

4(b)

OD

405

0

1

2

Pre-immune sera

1st wk 2nd wk 3rd wk 4th wk

(c) (d)

0

1

2

OD

492

OD

405

Pre-immune sera

1st wk 2nd wk 3rd wk 4th wk

Fig. 4 IgG isotype response to WCS antigen of strains 1A and

DPQ1A in mice inoculated through intravenous route with

strains 1A (s), DPQ1A (h) or PBS (D). Second immunization

was done 2 weeks after first dose (shown by arrows). a IgG2a

isotype response to WCS antigen of strain 1A. b IgG2a isotype

response to WCS antigen of strain DPQ1A. c IgG2b

isotype response to WCS antigen of strain 1A. d IgG2b

isotype response to WCS antigen of strain DPQ1A

Antonie van Leeuwenhoek (2009) 95:91–100 97

123

possible lack of replication of DPQ1A in macro-

phages can partially explain the lack of appropriate

immune response. IL-10 is secreted by macrophages,

B cells, and several subtypes of T cells such as Th2 or

regulatory T cells, and has antiprotective role in

yersiniosis (Bohn and Autenrieth 2004). LcrV is one

of the antigens of Yersinia that is involved in

upregulation of IL-10 (Sing et al. 2002). In the

present study, IL-10 production was observed in mice

immunized with strain 1A and DPQ1A (Fig. 6). This

suggests that, apart from LcrV, some other protein of

Y. pseudotuberculosis is also involved in

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

1A ∆PQ1A PBS

Mice

Mea

n sp

ecifi

c ab

sorb

ance

1A Antigen ∆PQ1A Antigen Unstimulated

*

* *

*Fig. 5 Splenocyte

proliferation response to

WCS antigen of strain 1A

and DPQ1A. Results are

expressed as mean specific

absorbance (570-600 nm)

and represent the mean

(±SE) value. Significant

differences for comparison

with unstimulated

splenocytes as determined

by Student’s paired t test are

indicated by asterisks(P \ 0.001)

0200400600800

10001200140016001800

1A ∆PQ1A PBS

Mice

Con

cent

ratio

n (p

g/m

L)

1A Antigen ∆PQ1A Antigen Unstimulated

‡****

†

0

100

200

300

400

500

600

700

1A ∆PQ1A PBS

Mice

Con

cent

ratio

n (p

g/m

L)

*

**

*

*

IFN-γ

IL-10

1A Antigen ∆PQ1A Antigen Unstimulated

Fig. 6 a IFN-c, and b IL-

10 production in cultured

spleen cells of mice

inoculated with strain 1A,

DPQ1A or PBS control.

Results are expressed in pg/

mL and represent the mean

(±SE) value. Significant

differences for comparison

with unstimulated cells as

determined by Student’s

paired t test are indicated by

asterisks (P \ 0.05) and

double asterisks (P \ 0.01).

The significant difference of

comparison between 1A

and DPQ1A groups of mice

are indicated by daggers(P \ 0.01) and doubledaggers (P \ 0.001). ND,

not detected

98 Antonie van Leeuwenhoek (2009) 95:91–100

123

upregulation of IL-10 and its regulation is not

controlled by the phoP-phoQ two-component system.

From the data obtained in the present study it can

be concluded that, following intravenous inoculation,

the phoP-phoQ null mutant of Y. pseudotuberculosis

is attenuated for colonization of spleen and is unable

to elicit Th1-type immune response in mouse model.

An earlier study has shown that there was a tenfold

decrease in viability of Y. pseudotuberculosis in

murine macrophages between 5 and 24 h of infection

(Grabenstein et al. 2004). A recent study by the same

group revealed that three phoP-regulated genes

whose products were predicted to promote resistance

to antimicrobial peptides (ugd and pmrK) or low

Mg2? conditions (mgtC), are important for survival

of Y. pestis in murine macrophages (Grabenstein

et al. 2006). In light of the results of the present

study, it would be interesting to find out in the future

whether the lack of Th1-type immune response is due

to the gradual decrease of bacteria or due to the

product of any of the three genes found to be

important for the survival of Yersinia in macro-

phages. Nonetheless, evidence from the present study

shows that the chromosomal-based gene(s) is (are)

important in eliciting the Th1-type immune response,

and as Yersinia is an intracellular pathogen in an

early part of its life cycle, Th1-type immune response

elicited by chromosome may be important in

protection.

Acknowledgments The authors are thankful to the Director

of DRDE for providing the necessary facilities and

encouragement. Authors are also grateful to Dr. Elisabeth

Carniel of the Pasteur Institute, Paris, for the kind gift of

plasmid pKOBEG-sacB.

References

Bogdanovich T, Carniel E, Fukushima H, Skurnik M (2003)

Use of O-antigen gene cluster- specific PCRs for the

identification and O-genotyping of Yersinia pseudotuber-culosis and Yersinia pestis. J Clin Microbiol 11:5103–

5112. doi:10.1128/JCM.41.11.5103-5112.2003

Bohn E, Autenrieth IB (2004) Immune response to Yersinia. In:

Carniel E, Hinnebusch JB (eds) Yersinia molecular and

cellular biology. Horizon Biosciences, Norfolk, pp

169–191

Butler T (1994) Yersinia infections: centennial of the discovery

of the plague bacillus. Clin Infect Dis 19:655–661

Carniel E (2001) The Yersinia high-pathogenicity island: an

iron uptake island. Microbes Infect 3:561–569. doi:

10.1016/S1286-4579(01)01412-5

Conchas RF, Carniel E (1990) A highly efficient electropora-

tion system for transformation of Yersinia. Gene 87:133–

137. doi:10.1016/0378-1119(90)90505-L

Derbise A, Lesic B, Dacheux D, Ghigo JM, Carniel E (2003) A

rapid and simple method for inactivating chromosomal

genes in Yersinia. FEMS Immunol Med Microbiol

38:113–116. doi:10.1016/S0928-8244(03)00181-0

Flamez C, Ricard I, Arafah S, Simonet M, Marceau M (2008)

Phenotypic analysis of Yersinia pseudotuberculosis 32777

response regulator mutants: new insight into two com-

ponent system regulon plasticity in bacteria. Int J Med

Microbiol 298:193–207. doi:10.1016/j.ijmm.2007.05.005

Gemski P, Lazere JR, Casey T, Wohlhieter JA (1980) Presence

of a virulence- associated plasmid in Yersinia pseudotu-berculosis. Infect Immun 28:1044–1047

Grabenstein JP, Marceau M, Pujol C, Simonet M, Bliska JB

(2004) The response regulator PhoP of Yersinia pseudo-tuberculosis is important for replication in macrophages

and for virulence. Infect Immun 72:4973–4984. doi:

10.1128/IAI.72.9.4973-4984.2004

Grabenstein JP, Fukuto HS, Palmer LE, Bliska JB (2006)

Characterization of phagosome trafficking and identifica-

tion of PhoP regulated genes important for survival of

Yersinia pestis in macrophages. Infect Immun 74:3727–

3741. doi:10.1128/IAI.00255-06

Kado CI, Liu S-T (1981) Rapid procedure for detection and

isolation of large and small plasmids. J Bacteriol

145:1365–1373

Khushiramani R, Tuteja U, Shukla J, Panikkar A, Batra HV

(2006) Virulence markers of LCR plasmid in Indian iso-

lates of Yersinia pestis. APMIS 114:15–22. doi:10.1111/

j.1600-0463.2006.apm_254.x

Kumar S, Ray P, Singh H, Ganguly NK (2001) Immunoge-

nicity and protective role of an IgA reactive 31 kDa

antigen of Vibrio cholerae O139. J Med Microbiol

50:489–498

Ljungberg P, Valtonen M, Harjola VP, Kaukoran Tatolvanen

SS, Vaara M (1995) Report of four cases of Yersiniapseudotuberculosis septicaemia and a literature review.

Eur J Clin Microbiol Infect Dis 14:804–810. doi:10.1007/

BF01690998

Logsdon LK, Mecsas J (2003) Requirement of Y. pseudotu-berculosis effectors YopH and YopE in colonization and

persistence in intestinal and lymph tissues. Infect Immun

71:4595–4607. doi:10.1128/IAI.71.8.4595-4607.2003

Miller SI, Mekalanos JJ (1990) Constitutive expression of

phoP regulon attenuates Salmonella virulence and sur-

vival within macrophages. J Bacteriol 172:2485–2490

Oyston PC, Dorrell N, Williams K, Li S-R, Green M, Titball RW,

Wren BW (2000) The response regulator phoP is important

for survival under conditions of macrophage-induced stress

and virulence in Yersinia pestis. Infect Immun 68:3419–

3425. doi:10.1128/IAI.68.6.3419-3425.2000

Paff JR, Triplett DA, Saari TN (1976) Clinical and laboratory

aspects of Yersinia pseudotuberculosis infections, with a

report of two cases. Am J Clin Pathol 66:101–110

Portnoy DA, Falkow S (1981) Virulence associated plasmids

from Yersinia enterocolitica and Yersinia pestis. J Bac-

teriol 148:877–883

Reed LJ, Muench H (1938) A simple method for estimating

50% end points. Am J Hyg 27:493–497

Antonie van Leeuwenhoek (2009) 95:91–100 99

123

Roggenkamp A, Bittner T, Leitritz L, Sing A, Heesemann J

(1997) Contribution of Mn cofactured superdismutase

(SodA) to the virulence of Yersinia enterocolitica sero-

type O:8. Infect Immun 65:4705–4710

Sing A, Rost D, Tvardovskaia N, Roggenkamp A, Wiedemann

A, Kirschning CJ, Aepfelbacher M, Heesemann J (2002)

Yersinia V antigen exploits toll-like receptor 2 and CD 14

for intreleukin-10 mediated immunosupression. J Exp

Med 196:1017–1024. doi:10.1084/jem.20020908

Stevens TL, Bossie A, Sanders VM, Fernandez-Botran R,

Coffman RL, Mosmann TR, Vitetta ES (1988) Regulation

of antibody isotype secretion by subset of antigen specific

helper T cells. Nature 334:255–258. doi:10.1038/

334255a0

Yu D, Ellis HM, Lee E-C, Jenkins NA, Copeland NG, Court

DL (2000) An efficient recombination system for chro-

mosome engineering in Escherichia coli. Proc Natl Acad

Sci USA 97:5978–5983. doi:10.1073/pnas.100127597

Zhi-Jun Y, Sriranganathan N, Vaught T, Arastu SK, Ahmed

SA (1997) A dye based lymphocyte proliferation assay

that permits multiple immunological analyses: mRNA,

cytogenetics, apotosis and immuophenotyping studies. J

Immunol Methods 210:25–39. doi:10.1016/S0022-1759

(97)00171-3

100 Antonie van Leeuwenhoek (2009) 95:91–100

123