TGFβ3 secretion by three-dimensional cultures ofhuman dental apical papilla mesenchymal stemcellsRodrigo A. Somoza1*, Cristian A. Acevedo1, Fernando Albornoz1, Patricia Luz-Crawford2,Flavio Carrión2, Manuel E. Young1 and Caroline Weinstein-Oppenheimer31Centro de Biotecnología, Universidad Técnica Federico Santa María, Valparaíso, Chile2Laboratorio de Inmunología, Universidad de los Andes, Santiago, Chile3Escuela de Química y Farmacia, Facultad de Farmacia, Universidad de Valparaíso, Chile

Abstract

Mesenchymal stem cells (MSCs) can be isolated from dental tissues, such as pulp and periodontal lig-ament; the dental apical papilla (DAP) is a less-studied MSC source. These dental-derived MSCs are ofgreat interest because of their potential as an accessible source for cell-based therapies and tissue-engineering (TE) approaches. Much of the interest regarding MSCs relies on the trophic-mediated re-pair and regenerative effects observed when they are implanted. TGFβ3 is a key growth factor in-volved in tissue regeneration and scarless tissue repair. We hypothesized that human DAP-derivedMSCs (hSCAPs) can produce and secrete TGFβ3 in response to micro-environmental cues. For this,we encapsulated hSCAPs in different types of matrix and evaluated TGFβ3 secretion. We found thatdynamic changes of cell–matrix interactions and mechanical stress that cells sense during the transi-tion from a monolayer culture (two-dimensional, 2D) towards a three-dimensional (3D) culture con-dition, rather than the different chemical composition of the scaffolds, may trigger the TGFβ3secretion, while monolayer cultures showed almost 10-fold less secretion of TGFβ3. The study ofthese interactions is provided as a cornerstone in designing future strategies in TE and cell therapythat are more efficient and effective for repair/regeneration of damaged tissues. Copyright © 2015John Wiley & Sons, Ltd.

Received 3 February 2014; Revised 2 October 2014; Accepted 7 January 2015

Keywords mesenchymal stem cells; SCAP; TGFβ3; alginate; fibrin; 3D culture

1. Introduction

It is estimated that, every year, millions of peopleworldwide are left with skin scars after damage causedby trauma or degenerative diseases. Tissue engineering(TE) has enabled the development of novel strategies thatallow proper tissue healing under conditions in which tra-ditional therapeutic methods are not effective. These ap-proaches are based mainly on the development of skinsubstitutes using scaffolds and cells, which are implantedafter damage. Mesenchymal stem cells (MSCs) have greattherapeutic potential because of their multilineage

differentiation capacity (Somoza and Rubio, 2012), easeof isolation from multiple adult tissues (da Silva Meirelleset al., 2006; Huang et al., 2009) and secretion of growthfactors (GFs) (Caplan and Dennis, 2006; Meirelles et al.,2009). This trophic activity has emerged as the main ther-apeutic effect of MSCs when implanted for tissue regener-ation purposes (Meirelles et al., 2009). These findingshave allowed the elucidation of a perivascular in vivoniche of MSCs as pericytes, in which they participate inthe homeostasis and repair of vascularized tissues (Crisanet al., 2008). MSCs secrete a great variety of cytokines andGFs that mediate anti-apoptotic, angiogenic, immunoreg-ulatory and anti-scarring processes, along with others(Meirelles et al., 2009). Several of these GFs are impor-tant in TE approaches, including basic fibroblast GF(bFGF), vascular endothelial growth factor (VEGF),platelet-derived GF (PDGF) and hepatocyte GF (HGF)

*Correspondence to: R. A. Somoza, Centro de Biotecnologia,Universidad Federico Santa Maria; Avda España 1680,Valparaiso, Chile. E-mail: rodrigo.somoza@gmail.com

Copyright © 2015 John Wiley & Sons, Ltd.

JOURNAL OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE RESEARCH ARTICLEJ Tissue Eng Regen Med (2015)Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/term.2004

(Barrientos et al., 2008). Nevertheless, TGFβ3 secretionby MSCs has not been described, although its mRNA ex-pression has been detected as part of broader analysis ofexpression in bone marrow-derived MSCs (Park et al.,2007) and periodontal ligament-derived cells (Pinkertonet al., 2008). TGFβ3 plays a key role in tissue regenerationand better quality repair without scar tissue generation(Ferguson and O’Kane, 2004). This role was evident asTGFβ3 is the most widely expressed TGFβ isoform in em-bryonic tissue and oral mucosa, in comparison to TGFβ1,TGFβ2 and other GFs involved in tissue repair (Occlestonet al., 2008; Schrementi et al., 2008). Studies in animalsand humans have established that the exogenous applica-tion of TGFβ3 produces an accelerated repair, togetherwith an orderly remodelling of ECM, which ultimatelyproduces a strong and elastic tissue, unlike scar formation(Ferguson et al., 2009; Hao et al., 2008). As MSCs are con-sidered pericytes, orchestrating repair process invascularized tissues, it has been proposed that they maybe activated by unspecified injury signals, which directsthem towards a medicinal cell phenotype (trophic) thatwill produce bioactive molecules locally (Caplan andCorrea, 2011). The conditions that produce the specificactivation of MSCs need to be investigated. It has beensuggested that these activation elements are injury-likesignals provided by damaged tissue (Liu et al., 2006; Ohet al., 2009). Probably these signals are unspecified solu-ble or ECM-derived factors; however, signals producedby mechanical forces might have an effect on the ’medici-nal’ phenotype of MSCs (Engler et al., 2006; Pinkertonet al., 2008; Wang and Thampatty, 2008).

The objective of this work was to evaluate the produc-tion and secretion of TGFβ3 by MSCs isolated from thehuman dental apical papilla (hSCAPs) when cells are cul-tured under 3D conditions within scaffolds, as a means ofevaluating matrix interaction effects on MSCs behaviour.

2. Methods

2.1. Cell culture

Dental apical papilla tissues were isolated from exfoliatedthird molars from patients aged 15–35 years. Each patientsigned an informed consent after the tooth was extracted,due orthodontic reasons and after the authorization ofthe dental surgeon. Successful isolation of viable cellswas achieved from four samples (four donors). The dentaltissues were washed several times with phosphate-buffered saline (PBS; 0.1 M, pH 7.3) supplemented withstreptomycin–penicillin (100 μg/ml and 100 U/ml; Gibco,USA). The tissue was cut into 1–2 mm3 pieces and thenplaced on 10 cm2 culture dishes in Dulbecco’s modifiedEagle’s medium (DMEM; Hyclone Thermo-Scientific,USA) supplemented with 10% fetal bovine serum (FBS;Biological Industries, Israel) and streptomycin–penicillin.The explants were incubated in a humidified atmosphereat 37°C in 5% CO2 until outgrowing cell colonies were

present in sufficient numbers. When the cells reached80% confluence they were detached with a 0.25%trypsin/2.65 mM EDTA solution and further expanded.

2.2. Immunomagnetic cell sorting

Cell sorting based on CD105 and CD271 (MSCs markers)co-expression was performed using CELLection™ PanMouse IgG Dynabeads® (Invitrogen, Carlsbad, CA,USA), following the manufacturer’s guidelines; 1 × 107

cells were suspended in PBS + 0.1% bovine serum albu-min (BSA; Sigma-Aldrich, St. Louis, MO, USA) and 0.6%sodium citrate (Merck) at 4°C and mixed with 25 μlmicrobeads coated with CD105 (Invitrogen) and CD271(Abcam) monoclonal antibodies. The positive bound cellswere then isolated from the unbound cells using amagnet. Sorted cells were detached from the micro-spheres with DNAse (Invitrogen). CD105/CD271-positiveand -negative cells were further expanded until sufficientnumbers were achieved for subsequent experiments. Ex-pression of CD271 and CD105 was confirmed byimmunocytofluorescence (data not shown). Passage 2–4cells were characterized based on the minimal criteriastated by the International Society for Cellular Therapyfor MSC denomination (Dominici et al., 2006).

2.3. Cellular viability and proliferation

To examine cell viability and proliferation, we performed acolorimetric assay usingWST-1 reagent (Roche, Germany),a tetrazolium salt that is converted into formazan dye bymitochondrial dehydrogenases. Cells were seeded at a den-sity of 4 × 103 cells/cm2 and, at different time points (24,48 and 72 h), the assay was performed following the man-ufacturer’s instructions. The absorbance at 450 nm wasnormalized with respect to day 0.

2.4. Mesenchymal differentiation protocols

For adipogenic and osteogenic differentiation, cells wereseeded at a density of 2.5 × 104 cells/cm2 and laterstimulated with adipogenic induction medium [DMEMlow-glucose, supplemented with 100 mg/ml isobu-tylmethylxanthine (Calbiochem, La Jolla, CA, USA),1 mM dexamethasone, 0.2 U/ml insulin (Humalog) and100 mM indomethacin (Sigma-Aldrich)] or osteogenic in-duction medium [DMEM low-glucose, containing 10%FBS, 0.1 mM dexamethasone, 50 μg/ml ascorbate-2-phosphate and 10 mM β-glycerophosphate (Sigma-Al-drich)] for 10 and 21 days, respectively. To assessadipogenic and osteogenic differentiation, intracellularlipid droplets were revealed by staining with oil red O(Merck, West Point, PA, USA) and matrix mineralizationby staining with alizarin red (Sigma-Aldrich), respec-tively. For chondrogenic differentiation, cells were cul-tured at a density of 5 × 103 cells/ml in 10 μl DMEMhigh-glucose containing 10% FBS to achieve the adequate

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

three-dimensional (3D) conditions for micromassformation. After 2 h the medium was replaced withchondrogenic differentiation medium (DMEM high-glucose, supplemented with 0.1 μM dexamethasone,50 μg/ml ascorbate-2-phosphate, 0.2 U/ml insulin and10 ng/ml TGFβ3). After 7 days, proteoglycan depositionwas revealed with safranin O (Merck) staining. Non-stimulated cultures were used as a control and weremaintained in DMEM with 10% FBS; the medium wasreplaced twice a week.

2.5. Flow-cytometry immunophenotypedetermination

A total of 0.5 × 106 cells were incubated with specific in-dividual monoclonal antibodies (1:200 dilutions), conju-gated with fluorescein isothiocyanate (FITC) orphycoerythrin (PE) in 200 μl PBS for 30 min in the darkat room temperature. The primary antibodies used wereCD34 (Beckmann Coulter), CD44 (Caltag, Invitrogen),CD45 (Immunotech, Beckmann Coulter), CD73 (BDPharmingen), CD90 (BD Pharmingen) and CD105(Caltag, Invitrogen). The cells were then diluted in 4 mlPBS, centrifuged and then resuspended with 600 μlPBS–formaldehyde (2%). Acquisition and analysis wereperformed using a flow cytometer (Coulter Epics XL,Beckman Coulter, Gainesville, FL, USA) and System IISoftware (Beckman Coulter). The isotype controls usedwere immunoglobulin G (IgG)1 FITC and IgG1 PE mono-clonal antibodies.

2.6. Intracellular determination of TGFβ3

Cells were fixed and permeabilized with Fix and Perm®reagents (Invitrogen) and incubated with TGFβ3 mono-clonal antibody (RandD Systems, USA), followed bywashing steps and incubation with AlexaFluor 488 sec-ondary antibody (Invitrogen).

2.7. 3D culture

2.7.1. In fibrin

A fibrin clot was prepared using a fibrinogen solution(54 mg/ml) consisting of lyophilized fibrinogen [78% pro-tein, 87% clottable protein (Sigma)] in sterile milliQ (mQ)water at 37°C and a thrombin solution (300 NIH/ml),which was prepared by dissolving thrombin (MP ICN Bio-medicals, USA) in sterile mQ water at 37°C with CaCl2(30 mM) and NaCl to adjust the osmolarity to 300 mOsM.Passage 4 cells (4 × 105 cells/ml) were suspended in thethrombin solution and mixed with an equal volume of fi-brinogen solution (25 μl each). The fibrin capsules werecultured on standard medium (DMEM 10% FBS) for differ-ent time periods.

2.7.2. In alginate

Cells were seeded on 1.2% w/v alginate in 0.9% NaCl so-lution, pH 7.2, at a density of 4 × 105 cells/ml. Thealginate–cell solution was deposited drop by drop on a100 mM CaCl2 solution under constant gentle agitation,using a 22G syringe and a perfusion pump. The capsuleswere incubated for 10 min in the CaCl2 solution under ag-itation and then washed three times with 0.9% NaCl. Thecapsules were cultured on the wells of a 24-well platewith standard medium (DMEM, 10% FBS) for varioustime periods.

2.8. In integrated implant system (IIS)

IIS is a chitosan–gelatin–hyaluronan polymeric scaffold,which was prepared using the method described by Liuet al. (2004). Briefly, a 1% gelatin solution (USP grade,Merck, Germany) was mixed with chitosan (2% in 1%acetic acid) and hyaluronic acid (0.01%) at 50°C in propor-tions of 7:2:1, respectively. The polymers solution was thenpoured into a Petri dish, cooled, frozen and lyophilizedusing a LioBras L101 (Brazil). The matrix was crosslinkedby the use of a 50 mM 2-morpholino-ethanesulphonicacid (MES), 20 mM 1-ethyl-(3,3-dimethyl-aminopropyl)-carbodiimide (EDC) and N-hydroxysuccinimide (NHS)(MES–EDC–NHS) solution. The scaffold was thencut into 1 × 1 cm pieces and disinfected by incu-bation with 75% ethanol for 24 h. The cells wereintegrated onto the scaffold by in situ gelification offibrin (20 mg/ml fibrinogen and 130 NIH/ml thrombinplus 30 mM CaCl2).

2.9. Conditioned media

Media were collected at different time points (24, 48 and72 h) from the different culture conditions (triplicates),centrifuged at 2500 × g, stored at –80°C and thawed atthe time of analysis. Lactate production and glucose con-sumption by cells were measured in triplicate in the condi-tioned media, using commercial enzymatic kits (SentinelDiagnostic, Italy).

2.10. ELISA assay

Levels of active TGFβ3 in the conditioned media werequantified using an ELISA kit (DuoSet ELISA, RandDSystems, Minneapolis, MN, USA), according to the man-ufacturer’s directions. Prior to ELISA determination,TGFβ3 present in the conditioned medium was activatedwith 1 N HCl and then the solution was neutralizedwith 1.2 N NaOH and HEPES. The optical density(OD) at 450 nm was read using a Bio-Rad 550 micro-plate reader.

TGFβ3 secretion by hSCAPs

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

2.11. RT–PCR analysis

Total RNA was isolated using TRIZOL® reagent(Invitrogen) according to the manufacturer´s instructions.RNA concentration was determined spectrophotometri-cally, followed by treatment with RNase-free DNase(Invitrogen). Then, 1 μg total RNA was used for reverse-transcription of mRNAmolecules to DNA copies. Real-timePCR was performed in a capillary containing cDNA, PCRLightCycler-DNAMaster SYBRGreen reaction mix (Roche,Indianapolis, IN, USA), 3–4 mMMgCl2 and 0.5 mM of eachspecific primer (see Table 1), using a LightCycler®thermocycler (Roche). To ensure that amplicons were de-rived from mRNA and not from genomic DNA amplifica-tion, negative controls without reverse transcriptase wereperformed. Negative PCR results were validated by ampli-fication of the housekeeping gene GAPDH. All primerswere designed using AmplifX software (Nicolas Jullien;CNRS, Aix-Marseille Université, France).

2.12. Biostatistical analysis

Biostatistical analyses were performed using a multivari-ate approach. Analyses were done using SIMCA-P(UMETRICS, Sweden) and Multiexperimental Viewer(TM4) software (Saeed et al., 2003). The statistical toolsused included principal component analysis (PCA), con-tribution analysis based on PCA, hierarchical clustering(Ward dendrogram) and Pearson’s correlation analysis.Cross-validation was performed to determine the optimalnumber of principal components (Bro et al., 2008).

Eleven kinds of variables were used: biomass, cellgrowth rate, glucose (concentration and consumption),lactate (concentration and production), TGFβ3 (concen-tration, production and mRNA), EGF mRNA and PDGFmRNA. The data (observation) used to fit the statisticalmodels were obtained from different states of cell culturesstudied: monolayer cell culture, fibrin cell culture and algi-nate cell culture (each being sampled at 24, 48 and 72 h).

3. Results

3.1. Cell isolation and compliance with thestemness definition

Based on the Mesenchymal and Tissue Stem Cell Commit-tee of the International Society for Cellular Therapy

recommendations for the minimal criteria to define hu-man MSCs (Dominici et al., 2006), the cells were charac-terized based on their morphology, adherence toplastic, tri-mesenchymal lineage differentiation potential(adipogenic, osteogenic and chondrogenic) and expres-sion of CD105, CD73, CD90 and CD44 surface markersand lack of expression for haematopoietic markers, suchas CD34 and CD45 (Figure 1). Explant-derived cells fromDAP were sorted using immunomagnetic beads, based onCD271 and CD105 co-expression. Expression of bothmarkers was confirmed by immunocytofluorescence afterthe cell-sorting procedure (data not shown). Althoughmost cells were CD105-positive (CD105+), CD271 expres-sion was not observed in all CD105+ cells and probablywe had a heterogeneous population of cells based on theexpression of these two markers. The CD271+CD105+

sorted cells exhibited different properties compared withtheir CD271–CD105– counterparts, which is in agreementwith the MSC definition, i.e. they adhere to plastic(Figure 1A), show higher proliferation rates and differen-tiate through mesodermal lineages (Figure 1B–D,Table 2).

3.2. TGFβ3 production by hSCAP-derivedCD105+CD271+ cells

Preliminary data based on dot–blot analysis suggestedthat monolayer cultures of hDAP-derived CD105+CD271+

cells did not secrete TGFβ3 into the medium (data notshown). However, intracellular flow-cytometry analysisrevealed that these cells were in fact producing TGFβ3but were not secreting it into the medium (Figure 2).

3.3. Three-dimensional (3D) culture ofhSCAP-derived CD105+CD271+ cells

The results shown in Figure 2 prompted the search forculture conditions that could allow these cells to secreteTGFβ3 to the medium. For the study of the effects of 3Dculture conditions on hSCAP-derived CD105+CD271+

cells, they were immobilized on three different typesof matrix: alginate, fibrin and a chitosan-based scaffold.Alginate is a polysaccharide derived from algae, whichdoes not provide adequate signalling to cells, since itlacks adhesion ligands such as the arginine–glycine–aspartic acid (RGD) peptide sequence. This is notthe case of fibrin and chitosan, both containing

Table 1. Primer sequences used for GF gene expression analysis

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Amplicon (bp) Accession No.

TGFβ3 agcgctatatcggtggcaagaatc cctccaagttgcggaagcagtaat 390 NM_003239.2EGF tggcccagtggaataacgattgac caccaagcagttccaagcctcttt 308 NM_001963.4FGF-2 gtgctaaccgttacctggctatga tatagctttctgcccaggtcctgt 206 NM_002006.4VEGF ttgcttgccattccccacttga gaacagcccagaagttggacgaaa 390 NM_003376.5PDGF tgagatgctgagtgaccactcgat cactgtctcacacttgcatgcca 460 NM_002608.2GAPDH caaaatcaagtggggcgatgctg tgtggtcatgagtccttccacgat 283 NM_002046.4

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

adhesion-signalling moieties. The cell immobilizationprocedure did not affect the viability of the cells (datanot shown). However, changes in proliferative capacityand metabolic activity were seen in immobilized cells

(Figure 3). Proliferation in 3D culture conditions slightlydecreased relative to monolayer culture (Figure 3A) andthe lowest proliferation rate was seen in cellsimmobilized in alginate. To measure metabolic activity,glucose consumption and lactate production on cells cul-tured under the different conditions were determined(Figure 3B, C). Cells in 3D conditions, regardless ofthe type of scaffold, consumed less glucose, whereas lac-tate production was variable among the conditions. Inorder to quantify the differences in metabolic activityamong the growth conditions, the lactate/glucose yieldwas calculated (Ylactate/glucose, Figure 3D): a value inthe range 0–2 implies a normal cell metabolism,whereas a Ylactate/glucose > 2 indicates that the cell ener-getic metabolism changed drastically, which couldmean, for example, that cells under these culture

Table 2. Properties of CD271+CD105+ and CD271–CD105–

hSCAPs

hSCAPPopulaton-doubling

time (PDT) (h)

Mesenchymaldifferentiation

A O C

CD271+CD105+ 35 + + +CD271–CD105– 51 – + –

A, adipocytes; O, osteoblasts; C, cartilage.

Figure 1. Characterization of hSCAP-derived CD105+CD271+ cells. (A) Adherent layers of cultured hSCAP-derived CD105+CD271+

cells. (B) Alizarin red staining as an indication of calcium deposition after osteogenic induction. (C) Lipid accumulation was detectedwith oil red O staining after adipogenic induction. (D) Safranin O staining as an indicator of proteoglycan production and micromassformation after chondrogenic induction. (E) Flow-cytometry data, showing expression of the MSC surface markers CD105, CD90,CD73 and CD44 and negative for CD34 and CD45. Black-filled histograms represent cells incubated with unrelated isotype-matchedantibodies

Figure 2. Intracellular expression of TGFβ3 by hSCAP-derived CD105+CD271+. Intracellular expression of TGFβ3 was assessed byflow cytometry; the majority of the cells expressed TGFβ3 protein intracellularly (96.95% of CD105-positive cells)

TGFβ3 secretion by hSCAPs

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

conditions metabolized more glutamine than glucose.The cells cultured under monolayer and fibrin condi-tions showed a Ylactate/glucose < 2, indicating a normalmetabolism, as opposed to alginate- or chitosan-immobilized cells, which showed higher values for thisindex (Figure 3D).

3.4. TGFβ3 secretion by hSCAP-derivedCD105+CD271+ cells cultured under 3Dconditions

TGFβ3 present in the conditioned media was quantified todetermine whether different culture conditions stimulatecells to release the protein into the extracellular milieu.For quantification, triplicate calibration curves were per-formed in each determination. Secreted TGFβ3 concentra-tions were expressed as pg/ml/104 cells (Figure 4). Asignificant difference was observed between monolayerculture compared with 3D conditions. However, no differ-ences were observed between the different matrices, sug-gesting that the change in status from monolayer to 3Dculture provided the necessary signalling for TGFβ3 to besecreted into the extracellular medium. On the otherhand, it was also observed that the levels of secretedTGFβ3 significantly decreased after 24 h. Significantchanges in TGFβ3 secretion between monolayer cultureand 3D cultures were noted at all times studied (Figure 4).

3.5. Gene expression of TGFβ3 and other GFs

RNA extraction from cultured cells in the matrices wasperformed using a modification of the protocol describedby Wang and Stegemann (2010), which is optimized toisolate RNA from complex samples where ion complexesform between matrix molecules and nucleic acids, whichresult in low yields of RNA. The amount of RNA extractedfrom cells seeded in IIS was not sufficient to obtain cDNAfor analysis, due to the complexity of the polymeric ma-trix. We increased the cell density in the IIS; however,we could not extract sufficient good-quality RNA fromthese samples, even using the modified protocol (Wangand Stegemann, 2010). Quantitative gene expressionanalysis did not show significant differences between pos-itive samples because of this; only qualitative gene expres-sion of different GFs is shown in Table 3. TGFβ3expression was observed under all the conditions,confirming that the control of TGFβ3 production and lib-eration to the extracellular medium is controlled up-stream, probably at the secretion machinery level.

3.6. Biostatistical modelling

In order to find associations between the different vari-ables measured in the culture conditions, we performedbiostatistical modelling based on multivariate analysis

Figure 3. Metabolic state of hSCAP-derived CD105+CD271+ cells. (A) 3D cultured cells showed similar proliferation rates. (B) Lactateproduction on 3D cultured cells decreased compared to monolayer, except for IIS cultured cells (*p < 0.05). (C) Monolayer culturesshowed higher glucose consumption levels (*p < 0.05). (D) The lactate/glucose yield (Ylactate/glucose) was higher on alginate and IISimmobilized cells, which represent a drastic change in their metabolic activity; this yield corresponds to the slope of the plottedvalues of glucose vs lactate for each condition; data were collected from at least three independent experiments. PDT, population-doubling time

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

(Figure 5). PCA showed four types of cellular behaviour(Figure 5; PC1–PC2 hyperplane). The latter was corrobo-rated using clustering analysis, which showed four de-fined groups (Figure 5; dendrogram). Accordingly, withPCA, monolayer cultures (24, 48 and 72 h) are very differ-ent compared with other cell culture conditions. No differ-ences were observed in cell behaviour between 3D cultureconditions (fibrin and alginate) at the same time points(24, 48 and 72 h); therefore, these conditions are locatedin separate quadrants within the analysis.

The PCA modelling emphasizes that fibrin and alginateculture conditions at 24 h were most influential on theproduction of TGFβ3 and, to a lesser extent, on its geneexpression (Figure 5; PCA loadings). At 48 h in alginateand fibrin culture, the most affected variables were glu-cose concentration, TGFβ3 concentration and PDGF ex-pression (Figure 5; PCA loadings).

We performed a contribution analysis with respect tothe change in culture conditions (Figure 5; contributionanalysis). This allowed us to establish the contributionof the chemical composition of the matrix to eachchange of variable. Within this analysis we observed thatfibrin encapsulation had a higher contribution to the al-teration of the variables when the conditions were mod-ified from a monolayer culture towards a 3D culturecondition.

We found a number of significant (p < 0.05) correla-tions between variables (Figure 5; Pearson’s correlationanalysis). Interestingly, there was a strong positivecorrelation between TGFβ3 production and its concentra-tion (r = 0.61; p = 0.04). PDGF gene expression was cor-related with TGFβ3 concentration (r = 0.87; p = 0.001)and TGFβ3mRNA (r = 0.60; p = 0.04). TGFβ3 concentra-tion was correlated with glucose (r = 0.75; p = 0.001)and lactate (r = –0.73; p = 0.01). Thus, the correlationanalysis shows a strong relationship among TGFβ3, PDGFand glycolysis.

4. Discussion

To date, many studies have shown that adult stem cellsare present in various tissues, including bone marrow,neural tissue, skin, retina, adipose tissue and umbilicalcord, among others (Mimeault and Batra, 2008). Thisproperty of many adult tissues is certainly a great advan-tage for cell therapy applications; however, many of thesetissues are difficult to obtain and isolation of stem cellscan be methodologically complicated and have adverseside-effects. In the present investigation, we isolated adultstem cells from hDAP obtained from third molars, usingimmunomagnetic cell sorting based on the co-expressionof CD271 and CD105. Both markers are expressed in bone

Figure 4. TGFβ3 secretion by hSCAP-derived CD105+CD271+ cells. TGFβ3 secretion was upregulated nine-fold in 3D cultured cellscompared to monolayer culture. Secretion decreased at 48 and 72 h. Measures were made in triplicate on independent experiments.Significant changes were observed between monolayer and 3D cultures at all time points (p values are shown). Secretion in all 3Dconditions significantly decreased at later time points compared to values at 24 h (#p < 0.05)

Table 3. Expression of GF in hSCAPs cultured under differentconditions

Time (h) M F A

TGFβ3 24 + + +48 + + +72 + + +

EGF 24 – – –

48 ± – +72 + + –

FGF2 24 + + +48 + + +72 + + +

VEGF 24 – – –

48 – – –

72 – – –

PDGF 24 – + +48 – + +72 – – –

The results are shown qualitatively as: +, positive expression; –, noexpression; ±, one negative sample (n = 3).M, monolayer; F, fibrin; A, alginate.

TGFβ3 secretion by hSCAPs

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

marrow-derived-MSCs (BM-MSCs). MSCs expressingCD271 have been shown to have a higher proliferative ca-pacity (Quirici et al., 2002; Jarocha et al., 2008). More-over, it has been suggested that CD271 is probably oneof the most selective markers for obtaining more homoge-neous populations of BM-MSCs (Jones and McGonagle2008) and could eventually be used as a sole marker forMSCs identification (Flores-Torales et al., 2010). On theother hand, CD105 is one of the traditional MSC markers;cells expressing this marker have favourable properties,such as higher proliferation and differentiation capacities(Roura et al., 2006; Jarocha et al., 2008). We verified thathSCAPs have properties comparable to those of BM-MSCs.

hSCAPs were isolated and described for the first time(Sonoyama et al., 2006) from third molars of adults aged18–20 years.

Several studies have reported the presence of MSC-likecells in numerous tissues (da Silva Meirelles et al., 2008).These have led to the hypothesis that the true niche ofMSCs is perivascular. There is evidence that supports aperivascular location for MSCs (Crisan et al., 2008). Thishas led to suggestion that all MSCs are pericytes (Caplan,2008). CD146 is a classic pericyte marker, used to isolateand expand pericytes in vitro (Crisan et al., 2008).hSCAPs also express CD146 (Laberge and Cheung,2011). Furthermore, Stro-1 staining of apical papilla has

Figure 5. Biostatistical modelling. Observations modelled were: monolayer cell culture, fibrin cell culture and alginate cell culture,each observed at 24, 48 and 72 h. Variables modelled were: biomass, cell growth rate, glucose (concentration and consumption), lac-tate (concentration and production), TGFβ3 (concentration, production and mRNA), EGF mRNA and PDGF mRNA

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

shown that the positive stain is located in the perivascularregion as well as other regions dispersed in the tissue, sug-gesting that hSCAPs also have a perivascular niche(Sonoyama et al., 2008). Therefore, it has been proposedthat MSCs present as pericytes in all vascularized tissues,including dental tissues, could have the ability to sensethe environment and thus change their phenotype accord-ing to the needs of a particular tissue, for example by thesecretion of various factors, triggering a regenerativemicro-environment in the affected tissues (Caplan andCorrea, 2011). The specific signals that activate the me-dicinal phenotype of MSCs are not known, although thereis evidence that certain inflammatory and mechanical sig-nals could be involved (Bilodeau and Mantovani, 2006;Liu et al., 2006a).

There is a change in the concept regarding the clinicalpotential of MSCs, and this is reflected in the fact thatmost MSCs-based clinical trials currently under develop-ment rely on the known trophic capabilities of MSCs(http://clinicaltrials.gov).

As far as it is known, there are no data concerning thesecretion profile of hSCAPs, in contrast to the abundantexisting information about the BM-MSCs secretome(Meirelles et al., 2009). The most commonly secretedGFs by BM-MSCs are FGF2, VEGF, PDGFBB, TGFβ1 andvarious other cytokines (Caplan and Dennis, 2006; Liuet al., 2006). Comparative studies have shown that MSCsisolated from bone marrow, umbilical cord blood and ad-ipose tissue show comparable characteristics with respectto growth factor expression profiles (Schinköthe et al.,2008). These precedents suggest that dental tissue-derived MSCs may also produce many of the factors de-scribed for MSCs from other tissues. There are not manystudies regarding the expression/secretion of TGFβ3, asmost of the published work regarding TGFβ3 and MSCsis related to chondrogenic induction (Minguell et al.,2001) and has not been considered as part of the MSC se-cretion profile. High-throughput studies have reportedlow levels of TGFβ3 expression by MSCs (Liu and Hwang,2005; Smiler et al., 2010). Although we were not able todetect TGFβ3 by dot–blot immunoassay, cells constitu-tively secrete a small amount of TGFβ3 which can be de-tected by ELISA (Figure 4). This has been reported forMSCs isolated from other tissues (Liu and Hwang, 2005;Smiler et al., 2010). Our results suggest that these cells re-quire an external stimulus to activate TGFβ3 secretionthrough a particular pathway. The mechanism by whichTGFβ3 is secreted has not been described. It is known thatthe precursor protein of TGFβ is proteolysed within thecell from the C-terminal, but remains non-covalently at-tached to the latency peptide, forming a small latencycomplex. This complex is exported from the cell, whereit binds to the latent TGFβ-binding protein (Flandersand Burmester 2003). The classical (or canonical) secre-tory pathway is involved in constitutive secretion of smallamounts of proteins from the trans-Golgi network to thecell surface (Duitman et al., 2011). In some cell types,such as macrophages, this constitutive pathway can be up-regulated to increase the secretion of certain proteins

when the cells are activated (Stow et al., 2009). The pro-teins to be secreted transit from the trans-Golgi system tothe plasma membrane and may be stored in granules untiltheir secretion is activated by specific signals (Duitmanet al., 2011).

4.1. Phenotype induction: TGFβ3 secreting cells

Previous studies have shown that 3D culture can providesignals for cells to exert more complex functions, such assecretion of GFs (Acevedo et al., 2010). Moreover, it isknown that, as the first event of cellular response to a ma-terial, cell adhesion influences cell morphology, viability,proliferation and differentiation (Kang et al., 2011). Addi-tionally, 3D culture enables cells to adopt a native mor-phology, facilitating cell–ECM interactions enhancingsignalling processes (Grayson et al., 2006); therefore,the signals to which cells are exposed are different fromthose to which they are exposed during conventionalmonolayer culture. Fibrin is a bioactive scaffold for cellsas it contains specific signal moieties, such as the RGD se-quence, that cells recognize via integrins (Janmey et al.,2009). It has been observed that cell immobilization in fi-brin triggers specific cell responses, including changes inprotein secretion (Acevedo et al., 2010; Sporn et al.,1995). Previous work has demonstrated that fibrin immo-bilization overproduces TGFβ and PDGF in humankeratinocytes, and that glycolysis is significantly corre-lated with TGFβ secretion (Acevedo et al., 2010). Cell re-sponse to a fibrin surface is dependent on specificaspects of the structure of the fibrin molecule (signals me-diated by integrin recognition), as well as events gener-ated during the polymerization process (release offibrinopeptides A and B). It has been shown that fibrino-peptides can trigger changes in the cellular responses ofcells in contact with fibrin (Sporn et al., 1995). In contrast,alginate does not produce this type of signal; therefore,we do not expect to provide an adequate chemical envi-ronment for cells to exert advance functions mediated byinteractions with the alginate matrix. The integrated im-plant system (IIS) used in this study corresponds to atissue-engineered product that has been successful in pre-clinical studies in the treatment of wounds (Weinstein-Oppenheimer et al., 2010). The polymer matrix is formedby chitosan, gelatin and hyaluronic acid. As in the case offibrin, biomaterials comprising this polymer matrix havebioactive properties because they contain specific do-mains, such as the RGD signal (Tan et al., 2007). Unlike fi-brin and alginate encapsulation, the cells seeded on theIIS are arranged within the porous mesh. Cells are incor-porated into the scaffold using fibrin as a vehicle, by insitu gelation (Weinstein-Oppenheimer et al., 2010). Sincefibrin is used as a carrier and is polymerized with thecells within it, the overall physiological effect on cellsmay be similar to that of capsule formation. By ELISAquantitation we found a significant change in the secre-tion of TGFβ3 to cells cultured under 3D conditions atall times analysed, compared with monolayer culture

TGFβ3 secretion by hSCAPs

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

(Figure 4; t-test, *p < 0.05). This change corresponded toa secretion increase of approximately nine-fold at 24 h ofculture (19 pg/ml/104 cells in monolayer to 174 pg/ml/104 in the matrices) and nearly four-fold at 48 and 72h. The levels of TGFβ3 secreted are in agreement withthose reported for this and other GFs (Acevedo et al.,2010; Engler et al., 2006; Eshghi and Schaffer, 2008;Liu et al., 2006; Rehman et al., 2004). No significant dif-ferences were observed in TGFβ3 secretion among 3Dculture conditions at different time points, suggestingthat the matrix chemical composition has a minor rolein this phenomenon.

Effects due to cell immobilization are often not consid-ered, and many of the differences we observed betweenmonolayer and 3D culture conditions may be due to theeffects of cell–ECM interactions, such as cellular stressproduced by the immobilization process (Schneideret al., 1996; Sun et al., 2007), changes in cellular metabo-lism (Constantinidis et al., 1999; Simpson et al., 2006) ormechanical stimulation (Constantinidis et al., 1999;Bilodeau and Mantovani, 2006). Because cellular metabo-lism is altered in 3D culture compared to monolayerculture (Figure 3), this may have significant implicationsin the use of matrices, because metabolism affects all cellphysiology (Deorosan and Nauman, 2011). Our resultssuggest that the different chemical compositions of the

matrices do not a priori influence TGFβ3 secretion. Activa-tion of the cells to a secretory phenotype could be pro-duced by the physiological changes that cells experiencewhen moving from a monolayer culture condition to a3D condition (Constantinidis et al., 1999; Simpson et al.,2006). Cell dynamic interactions, where the adhesiveconnections between the cells and the ECM are createdand simultaneously removed, can lead to cellular responsesthat are not observed under conventional culture condi-tions (Bilodeau andMantovani 2006). These dynamic inter-actions may increase immediately after the immobilizationprocess, which could explain the increased secretion ofTGFβ3 at 24 h (Figure 4). At later times this dynamic statebetween the matrix and the cells decreases, because thecells are adapted to the new condition.

It has been shown that periodontal ligament-derivedcells respond to mechanical deformation (Pinkertonet al., 2008). In this study the authors observed an over-expression of TGFβ1 and TGFβ3 upon mechanical defor-mation. This is especially relevant for the cells that com-prise the dental tissues, which are much more exposedto mechanical forces (Pinkerton et al., 2008).

Along with assessing the secretion of TGFβ3, we stud-ied the metabolic changes that cells undergo when theyare immobilized, compared to the monolayer culture con-dition. We also evaluated the expression of other GFs

Figure 6. Proposed model for TGFβ3 secretion by hSCAPs. When culture conditions are altered (2D to 3D culture), cells are exposedto stimuli that produce physiological changes. During the immobilization process, the cells undergo surface tension produced by me-chanical forces during matrix polymerization. These forces could activate intracellular signalling pathways that influence the mea-sured phenomena (glycolysis, secretion of TGFβ3, gene expression). Dynamic changes between cell–matrix interactions earlyduring the immobilization process could also be involved. Glucose and lactate concentrations appear to have some influence in theprocess: glucose on PDGF gene expression and TGFβ3 secretion and lactate on the protein stability in solution. Autocrine signallingby TGFβ3 could also affect its own secretion (positively at the beginning and negatively at later times). Specific interactions givenby the chemical composition of the matrix, such as RGD signal, could be affecting the observed changes. Finally, there was a consti-tutive expression of TGFβ3 mRNA, which may be an indication that these cells are in a preconditioned state to produce the growthfactor. In this system the availability of nutrients is not restricted due to diffusive phenomena (data not shown). Figure made withimages available at Servier Medical Art (www.servier.fr)

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

under the different culture conditions. With these data webuilt a TGFβ3 secretion model based on changes that cellsexperience when they move from a 2D (monolayer) to-wards a 3D culture condition (Figure 6).

This research has focused on TGFβ3, due to its relevancein tissue regeneration. The results of this study showed thatchanges in the culture system could generate significantchanges in cell biology. The study of these interactions isprovided as a cornerstone in designing future strategies intissue engineering and cell therapy that are more efficientand effective for repair/regeneration of damaged tissues.We are currently studying the particular mechanism(s) thatcould be involved in the phenomenology we describe here.

Conflict of interest

The authors declare no conflicts of interest.

Acknowledgements

We thank Dr Maximo Hernandez and Megasalud for providingtechnical support with dental samples and Donald Lennon forcritical reading of the manuscript. This research was supportedby Comisión Nacional de Investigación Científica y Tecnológica(CONICYT; Grant No. Fondef D07i1075). R.A.S. is the recipientof a doctoral fellowship from CONICYT.

Author contributions

R.A.S., M.E.Y. and C.W.O. designed the research; R.A.S.performed experiments; C.A.A. performed biostatisticalanalysis; F.A. synthesized the IIS and provided data inter-pretation; P.A.L. performed flow-cytometry analysis, ex-perimental design and data interpretation; and F.C., R.A.S., M.E.Y., C.W.O. and C.A.A. analysed data and wrotethe paper.

References

Acevedo CA, Somoza RA, Weinstein-Oppen-heimer C et al. 2010; Growth factor produc-tion from fibrin-encapsulated humankeratinocytes.Biotechnol Lett32: 1011–1017.

Barrientos S, Stojadinovic O, Golinko MS et al.2008; Growth factors and cytokines inwoundhealing. Wound Repair Regen 16: 585–601.

Bilodeau K, Mantovani D. 2006; Bioreactorsfor tissue engineering: focus on mechani-cal constraints. A comparative review. Tis-sue Eng 12: 2367–2383.

Bro R, Kjeldahl K, Smilde A et al. 2008;Cross-validation of component models: acritical look at current methods. AnalBioanal Chem 390(5): 1241–1251.

Caplan AI. 2008; All MSCs are pericytes? CellStem Cell 3: 229–230.

Caplan AI, Correa D. 2011; The MSC: an in-jury drugstore. Cell Stem Cell 9: 11–15.

Caplan AI, Dennis JE. 2006; Mesenchymalstem cells as trophic mediators, J CellBiochem 98: 1076–1084.

Laberge T, Cheung HS. 2011; Multipotentdental stem cell source for regenerativemedicine. In Embryonic Stem Cells-Differ-entiation and Pluripotent Alternatives,Kallos MS (ed). InTech: Rijeka, Croatia.

Constantinidis I, Rask I, Long RC et al. 1999;Effects of alginate composition on the met-abolic, secretory, and growth characteris-tics of entrapped βTC3 mouse insulinomacells. Biomaterials 20: 2019–2027.

Crisan M, Yap S, Casteilla L et al. 2008; Aperivascular origin for mesenchymal stemcells in multiple human organs. Cell StemCell 3: 301–313.

Da Silva Meirelles L, Chagastelles PC, NardiNB. 2006; Mesenchymal stem cells residein virtually all post-natal organs and tis-sues. J Cell Sci 119: 2204–2213.

Da Silva Meirelles L, Caplan AI, Nardi NB.2008; In search of the in vivo identity ofmesenchymal stem cells. Stem Cells 26:2287–2299.

Deorosan B, Nauman EA. 2011; The role ofglucose, serum, and three-dimensional cellculture on the metabolism of bone

marrow-derived mesenchymal stem cells.Stem Cells Int 2011: 429187.

Dominici M, Le Blanc K, Mueller I et al. 2006;Minimal criteria for defining multipotentmesenchymal stromal cells. The Interna-tional Society for Cellular Therapy positionstatement. Cytotherapy 8: 315–317.

Duitman EH, Orinska Z, Bulfone-Paus S.2011; Mechanisms of cytokine secretion:a portfolio of distinct pathways allows flex-ibility in cytokine activity. Eur J Cell Biol90: 476–483.

Engler AJ, Sen S, Sweeney HL et al. 2006;Matrix elasticity directs stem cell lineagespecification. Cell 126: 677–689.

Eshghi S, Schaffer DV. 2008; Engineering mi-croenvironments to control stem cell fateand function. In StemBook: Harvard StemCell Institute: http://www.ncbi.nlm.nih.gov/books/NBK27048/.

Ferguson MWJ, O’Kane S. 2004; Scar-freehealing: from embryonic mechanisms toadult therapeutic intervention. Phil TransR Soc Lond B Biol Sci 359: 839–850.

Ferguson MWJ, Duncan J, Bond J et al. 2009;Prophylactic administration of avoterminfor improvement of skin scarring: threedouble-blind, placebo-controlled, phaseI/II studies. Lancet 373: 1264–1274.

Flanders KC, Burmester JK. 2003; Medicalapplications of transforming growthfactor-β. Clin Med Res 1: 13–20.

Flores-Torales E, Orozco-Barocio A,Gonzalez-Ramella OR et al. 2010; TheCD271 expression could be alone for es-tablisher phenotypic marker in bone mar-row derived mesenchymal stem cells.Folia Histochem Cytobiol 48: 682–686.

Grayson WL, Zhao F, Izadpanah R et al.2006; Effects of hypoxia on human mesen-chymal stem cell expansion and plasticityin 3D constructs. J Cell Physiol 207:331–339.

Hao J, Varshney RR, Wang DA. 2008; TGF-β3: a promising growth factor in engineeredorganogenesis. Expert Opin Biol Ther 8:1485–1493.

Huang GT-J, Gronthos S, Shi S. 2009; Mesen-chymal stem cells derived from dental tis-sues vs those from other sources: theirbiology and role in regenerative medicine.J Dent Res 88: 792–806.

Janmey PA, Winer JP, Weisel JW. 2009; Fi-brin gels and their clinical and bioengi-neering applications. J R Soc Interface 6:1–10.

Jarocha D, Lukasiewicz E, Majka M. 2008;Advantage of mesenchymal stem cells(MSCs) expansion directly from purifiedbone marrow CD105+ and CD271+

cells. Folia Histochem Cytobiol 46:307–314.

Jones E, McGonagle D. 2008; Human bonemarrow mesenchymal stem cells in vivo.Rheumatology (Oxford) 47: 126–131.

Kang SW, Cha BH, Park H et al. 2011; The ef-fect of conjugating RGD into 3D alginatehydrogels on adipogenic differentiation ofhuman adipose-derived stromal cells.Macromol Biosci 11: 673–679.

Liu CH, Hwang SM. 2005; Cytokine interac-tions in mesenchymal stem cells from cordblood. Cytokine 32: 270–279.

Liu H, Mao J, Yao K et al. 2004; A study on achitosan–gelatin–hyaluronic acid scaffoldas artificial skin in vitro and its tissue engi-neering applications. J Biomater Sci PolymEd 15: 25–40.

Liu Y, Dulchavsky DS, Gao X et al. 2006;Wound repair by bone marrow stromalcells through growth factor production. JSurg Res 136: 336–341.

Meirelles LDS, Fontes AM, Covas DT et al.2009; Mechanisms involved in the thera-peutic properties of mesenchymal stemcells. Cytokine Growth Factor Rev 20:419–427.

Mimeault M, Batra SK. 2008; Recent prog-ress on tissue-resident adult stem cell biol-ogy and their therapeutic implications.Stem Cell Rev 4: 27–49.

Minguell JJ, Erices A, Conget P. 2001; Mes-enchymal stem cells. Exp Biol Med (May-wood) 226: 507–520.

TGFβ3 secretion by hSCAPs

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term

Occleston NL, Laverty HG, O’Kane S et al.2008; Prevention and reduction of scar-ring in the skin by transforming growthfactor-β3 (TGFβ3): from laboratory discov-ery to clinical pharmaceutical. J BiomaterSci Polym Ed 19: 1047–1063.

Oh JY, Kim MK, Shin MS et al. 2009; Cyto-kine secretion by human mesenchymalstem cells cocultured with damaged cor-neal epithelial cells. Cytokine 46: 100–103.

Park HW, Shin JS, Kim CW. 2007; Proteomeof mesenchymal stem cells. Proteomics 7:2881–2894.

Pinkerton MN, Wescott DC, Gaffey BJ et al.2008; Cultured human periodontal liga-ment cells constitutively express multipleosteotropic cytokines and growth factors,several of which are responsive to mechan-ical deformation. J Periodont Res 43:343–351.

Quirici N, Soligo D, Bossolasco P et al. 2002;Isolation of bone marrow mesenchymalstem cells by anti-nerve growth factor re-ceptor antibodies. Exp Hematol 30:783–791.

Rehman J, Traktuev D, Li J et al. 2004; Secre-tion of angiogenic and antiapoptotic fac-tors by human adipose stromal cells.Circulation 109: 1292–1298.

Roura S, Farré J, Soler-Botija C et al. 2006;Effect of aging on the pluripotential capac-ity of human CD105+ mesenchymal stemcells. Eur J Heart Fail 8: 555–563.

Saeed AI, Sharov V, White J et al. 2003; TM4:a free, open-source system for microarraydata management and analysis. Biotech-niques 34: 374–378.

Schinköthe T, Bloch W, Schmidt A. 2008; Invitro secreting profile of human mesen-chymal stem cells. Stem Cells Dev 17:199–206.

Schneider M, Marison IW, von Stockar U.1996; The importance of ammonia inmammalian cell culture. J Biotechnol 46:161–185.

Schrementi ME, Ferreira AM, Zender C et al.2008; Site-specific production of TGFβ inoral mucosal and cutaneous wounds.Wound Repair Regen 16: 80–86.

Simpson NE, Grant SC, Gustavsson L et al.2006; Biochemical consequences of algi-nate encapsulation: a NMR study ofinsulin-secreting cells. Biomaterials 27:2577–2586.

Smiler DG, Soltan M, Soltan C et al. 2010;Growth factors and gene expression ofstem cells: bone marrow compared withperipheral blood. Implant Dent 19:229–240.

Somoza RA, Rubio FJ. 2012; Cell therapyusing induced pluripotent stem cells or so-matic stem cells: this is the question. CurrStem Cell Res Ther 7: 191–196.

SonoyamaW, Liu Y, FangD et al. 2006;Mesen-chymal stem cell-mediated functional toothregeneration in swine. PLoS One 1: e79.

Sonoyama W, Liu Y, Yamaza T et al. 2008;Characterization of the apical papilla andits residing stem cells from human imma-ture permanent teeth: a pilot study. JEndod 34: 166–171.

Sporn LA, Bunce LA, Francis CW. 1995; Cellproliferation on fibrin: modulation by fibri-nopeptide cleavage. Blood 86: 1802–1810.

Stow JL, Low PC, Offenhäuser C et al. 2009;Cytokine secretion in macrophages andother cells: pathways and mediators.Immunobiology 214: 601–612.

Sun ZJ, Lv GJ, Li SY et al. 2007; Differentialrole of microenvironment inmicroencapsu-lation for improved cell tolerance to stress.Appl Microbiol Biotechnol 75: 1419–1427.

Tan H, Gong Y, Lao L et al. 2007; Gelatin/chi-tosan/hyaluronan ternary complex scaf-fold containing basic fibroblast growthfactor for cartilage tissue engineering. JMater Sci Mater Med 18: 1961–1968.

Wang L, Stegemann JP. 2010; Extraction ofhigh quality RNA from polysaccharide ma-trices using cetyltrimethylammonium bro-mide. Biomaterials 31: 1612–1618.

Wang JHC, Thampatty BP. 2008; Mechano-biology of adult and stem cells. Int Rev CellMol Biol 271: 301–346.

Weinstein-Oppenheimer CR, Aceituno AR,Brown DI et al. 2010; The effect of an au-tologous cellular gel–matrix integrated im-plant system on wound healing. J TranslMed 8: 59.

R. A. Somoza et al.

Copyright © 2015 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2015)DOI: 10.1002/term