Traffic 2009; 10: 1685–1695 © 2009 John Wiley & Sons A/S

doi:10.1111/j.1600-0854.2009.00984.x

A Secretory Golgi Bypass Route to the Apical SurfaceDomain of Epithelial MDCK Cells

Heidi Tveit1, Linn Kristin Aa. Akslen1, Gro Live

Fagereng1, Michael A. Tranulis2

and Kristian Prydz1,∗

1Department of Molecular Biosciences, University ofOslo, Oslo, Norway2Department of Basic Sciences and Aquatic Medicine,Norwegian School of Veterinary Science, Oslo, Norway*Corresponding author: Kristian Prydz,Kristian.Prydz@imbv.uio.no

Proteins leave the endoplasmic reticulum (ER) for the

plasma membrane via the classical secretory pathway,

but routes bypassing the Golgi apparatus have also been

observed. Apical and basolateral protein secretion in

epithelial Madin-Darby canine kidney (MDCK) cells dis-

play differential sensitivity to Brefeldin A (BFA), where

low concentrations retard apical transport, while baso-

lateral transport still proceeds through intact Golgi cis-

ternae. We now describe that BFA-mediated retardation

of glycoprotein and proteoglycan transport through the

Golgi apparatus induces surface transport of molecules

lacking Golgi modifications, possessing those acquired in

the ER. Low concentrations of BFA induces apical Golgi

bypass, while higher concentrations were required to

induce basolateral Golgi bypass. Addition of the KDEL

ER-retrieval sequence to model protein cores allowed

observation of apical Golgi bypass in untreated MDCK

cells. Basolateral Golgi bypass was only observed after

the addition of BFA or upon cholesterol depletion. Thus,

in MDCK cells, an apical Golgi bypass route can transport

cargo from pre-Golgi organelles in untreated cells, while

the basolateral bypass route is inducible.

Key words: apical, basolateral, cholesterol depletion,

epithelial cells, glycoproteins, Golgi bypass route, intra-

cellular transport, MDCK, proteoglycans, the Golgi

apparatus

Received 14 May 2009, revised and accepted for publica-

tion 25 August 2009, uncorrected manuscript published

online 9 September 2009, published online 17 September

2009

In polarized epithelial cells with distinct apical and baso-lateral plasma membrane domains, protein transport andsorting mechanisms operating in the secretory pathwayensure delivery of proteins with proper posttranslationalmodifications to the correct cell surface area.

Although protein transport in the secretory route has beena field of intense study for some decades, there are stillmechanistic unknowns. In epithelial Madin-Darby caninekidney (MDCK) cells, the established view is that apical

and basolateral proteins co-migrate to the trans-Golginetwork at the terminus of the Golgi apparatus, fromwhere the proteins are transported in membrane carri-ers to their respective target domains. In recent years,however, more studies advocate the view that apical andbasolateral cargo may segregate early in the secretorypathway, either in the endoplasmic reticulum (ER), theER-Golgi intermediate compartment (IC), or in the earliestGolgi cisternae (reviewed in 1).

Normal glycosylation and Golgi-dependent transport ofproteins to the cell surface in mammalian cells is blockedby the prostaglandin-like drug brefeldin A (BFA), butsome proteins still arrive at the plasma membrane byroutes commonly termed nonclassical secretion mecha-nisms (2–4). Such Golgi-independent transport pathwaysare either ER-dependent or ER-independent. The formerrequire protein insertion into, and translocation through,the ER membrane, but do not proceed to the Golgi cis-ternae. The latter are depicted as protein translocationdirectly from the cytoplasmic phase through the plasmamembrane (3,4).

Glycoproteins that translocate into the ER, but bypassGolgi cisternae, could reach the cell surface in tubulesor carriers derived from the IC. Thus, N-glycans areadded in the ER, but will not acquire Endo-H resistanceand will arrive at the cell surface in their high-mannosestate (2). Proteoglycans (PGs), on the other hand, obtaintheir polymerized glycosaminoglycan (GAG) chains in theGolgi apparatus and acquire only the first sugars ofthe linker tetrasaccharide prior to Golgi entry (5). Thus,both secreted glycoproteins and PGs that bypass theGolgi apparatus may be distinguished from those passingthrough, but the PGs are most easily followed due to thelarge shift in molecular mass caused by the lack of GAGchains in the bypass route.

Golgi membranes of MDCK cells are morphologicallyand functionally more resistant to BFA treatment than inmost other cell lines. However, low drug concentrationsreduce apical protein transport, but without affectingbasolateral Golgi passage and modifications, while higherBFA concentrations reduce secretory transport in bothdirections, without reducing retrograde toxin transportthrough Golgi cisternae (6).

We have expressed a model PG, serglycin (SG) taggedwith a C-terminal green fluorescent protein (GFP), inMDCK cells. Previously, we have shown that most ofthe GAGs attached to SG-GFP are of the chondroitinsulfate (CS) type, and we have now monitored thesynthesis and transport of SG-GFP in the absence and

www.traffic.dk 1685

Tveit et al.

presence of BFA. At low BFA concentrations (2 μg/mL),a fraction of SG-GFP was secreted apically with pre-Golgi modifications, consisting of only a part of the linkerregion, while normal Golgi synthesis and transport ofSG-GFP took place in the basolateral route. Increasingthe BFA concentration (5 μg/mL) induced Golgi bypass ofSG-GFP also in the basolateral direction. A concomitantaccumulation of SG-GFP in the Golgi region was observedby live confocal microscopy. Thus, bypass of the Golgiapparatus by SG-GFP was induced because transportthrough the Golgi apparatus was retarded or blocked,while Golgi elements were still capable of GAG synthesis.

We next transferred the retardation load to the molecule intransit, by expressing SG-GFP with a C-terminal KDEL ER-retrieval signal. The intracellular fraction of SG-GFP-KDELwas several fold increased when compared with SG-GFP,because of the retrieval signal, but some SG-GFP-KDELwas still released to the medium with full GAG modifica-tions. Noticeably, however, a fraction of the SG-GFP-KDELwas also released to the apical medium, without poly-merized GAG chains. Similar results were obtained forKDEL-linked rat growth hormone (rGH) with reporter GAGsites. Thus, a Golgi bypass route in the apical direction is anoption in untreated MDCK cells. A basolateral Golgi bypassroute could be induced by BFA or cholesterol depletion.

Results

We have previously shown that a secretory PG (SG-GFP)expressed in epithelial MDCK cells acquires GAG chains ofdifferent lengths and sulfation intensities in the apical andbasolateral secretory pathways (7,8). This substantial dif-ference in GAG synthesis indicated that the two pathwayssegregate prior to encountering enzymes responsible forGAG polymerization and sulfation in the Golgi apparatus,a view supported by studies of glycoprotein ligands inMDCK cells (9,10), and by studies in other mammaliancell types (11) and in yeast (12,13).

Brefeldin A induces Golgi bypass in MDCK cells

The increased interest in the early stages of the secretorypathway in conjunction with polarized sorting, lead us toreinvestigate the effect of BFA on the apical and basolat-eral secretory routes. What happens to cargo moleculeswhen one of these pathways is selectively blocked? Wehave utilized MDCK cell lines that stably express eitherthe recombinant PG SG-GFP, a variant of this model PGwith the ER-retrieval sequence KDEL, or the recombinantsecreted glycoprotein Doppel-GFP (sDPL-GFP; Figure 1B).SG-GFP is predominantly transported to the apical surfacein untreated MDCK cells (7,8). Incubation in the presenceof 2 μg/mL BFA reduced the apical secretion of fullymodified SG-GFP, while the basolateral secretion wasnot reduced, but sometimes rather stimulated (Figure 1Aand 2A), in agreement with previous observations of theBFA effect on total protein secretion in MDCK cells (14)and repeated by us in Figure 1A. A novel observation was,

(A)

(B)

Figure 1: The effect of BFA on secretion of endogenous

proteins and SG-GFP. A) MDCK cells and MDCK cells stablyexpressing SG-GFP were grown on filters to confluency andincubated in the presence of 0, 2 or 5 μg/mL BFA duringa 24-h metabolic labeling period with [35S]-Cys/Met. Thecells were harvested, and macromolecules from apical andbasolateral MDCK media were purified by Sephadex G-50 finegel filtration, while SG-GFP was purified by IP with anti-GFP.The purified macromolecules and SG-GFP were loaded onto4–12% SDS–PAGE gradient gels, and visualized and quantifiedby ImageQuant. Four to six independent experiments for eachdata set are summarized in the graphs. B) Schematic presentationof the constructs used: SG-GFP, human SG with GFP fusedC-terminally; SG-GFP-KDEL, human SG with C-terminal GFPfollowed by the ER-retrieval signal KDEL; Sec-DPL-GFP, theovine Doppel protein without GPI-anchor, with GFP fused atthe C-terminal end; rGH-GAG, rat growth hormone with the GAGattachment domain of SG inserted between rat growth hormoneand GFP; rGH-GAG-KDEL, rGH-GAG, rat growth hormone withthe GAG attachment domain of SG inserted between rat growthhormone and GFP followed by the ER-retrieval signal KDEL.

however, that a low molecular weight variant of SG-GFPcould be observed in the apical medium (Figure 2A, lane7), of similar or slightly lower mass than the molecularform generated by chondroitinase ABC (cABC) digestionof CS GAG chains. This variant became the predominatingform of SG-GFP in the apical medium upon incubationwith 5 μg/mL BFA, a concentration at which this lowmolecular weight form of SG-GFP also started to appearin the basolateral medium (Figure 2A, B).

Cargo accumulates in the secretory pathway in the

presence of BFA

To investigate whether secretion of SG-GFP without Golgimodifications was a result of impeded Golgi entry or

1686 Traffic 2009; 10: 1685–1695

Apical Golgi Bypass in MDCK Cells

(A)

(B)

Figure 2: Effect of BFA on SG-GFP secretion from MDCK

cells. A) MDCK cells stably expressing SG-GFP were grown toconfluency on filters and treated with 0, 2 or 5 μg/mL BFAduring 24 h of metabolic labeling with [35S]-Cys/Met. SG-GFPwas immunoprecipitated with anti-GFP from apical (Api) andbasolateral (Baso) media, run on 412% SDS–PAGE gels andvisualized by phosphorimaging. Ctr, untreated samples; H, HNO2

treatment for heparan sulfate degradation; C, cABC treatment forchondroitin sulfate degradation. B) Five independent experimentsas described in A were preformed, and the amount ofunglycosylated ( in Figure 2A) SG-GFP was quantified byImageQuant. The amount of secreted unglycosylated SG-GFPis represented by arbitrary units, where apical secretion ofunglycosylated SG-GFP in the presence of 5 μg/mL BFA is setto 1.0.

a block at another stage, we subjected MDCK cellsexpressing SG-GFP to live confocal imaging after severalhours in the presence of BFA. At time zero, the cargomolecule SG-GFP colocalized well with a red fluorescentGolgi marker. After addition of 5 μg/mL BFA, colocalizationof SG-GFP with the ceramide lipid Golgi marker was notlost, and the Golgi marker distribution was not significantlyaltered, but SG-GFP had accumulated gradually in theGolgi apparatus after 3 and 6 h in the presence ofBFA (Figure 3A). This indicates that entry into the Golgiapparatus is not blocked at this BFA concentration, butrather gradually delayed, due to the accumulation ofcargo within the Golgi apparatus, probably caused by ablock in cargo exit. Increasing the BFA concentration to

(A)

(B)

Figure 3: Localization of SG-GFP in BFA-treated cells. A)MDCK cells stably expressing SG-GFP were grown on glassbottom microwell dishes. A red fluorescent lipid Golgi marker(BODIPY TR ceramide) was added to the medium, and the cellswere visualized in a confocal microscope. 0, 5 or 50 μg/mL BFAwas subsequently added, and the cells were visualized again after3 and 6 h. SG-GFP (green) and Golgi lipid marker (red) in cells inthe same well are presented vertically in neighboring panels after0, 3 and 6 h. B) MDCK cells expressing SG-GFP were grown toconfluency on filters. Some filters were metabolically labeled inthe presence of 0, 5 or 50 μg/mL BFA for 16 h before harvestof media, while other filters were treated 3 h with 50 μg/mLBFA (*) prior to and during 16 h of metabolic labeling with [35S]-Cys/Met, also followed by harvesting of apical and basolateralmedia. SG-GFP was immunoprecipitated from both apical (Api)and basolateral (Baso) media, run on 4–12% SDS–PAGE gelsand visualized by phosphorimaging.

Traffic 2009; 10: 1685–1695 1687

Tveit et al.

50 μg/mL did not dramatically alter the distribution ofthe lipid Golgi marker, although some change cannot beruled out, but seemed to delay the cargo molecule SG-GFP in a pre-Golgi compartment. Concomitant with thiswas the enhanced appearance of two SG-GFP bands oflow molecular weight (Figure 3B). Both of these bandscarry stubs of GAG chains shorter than those derivedby enzymatic digestion of CS chains. For cells grownon filters and treated with 5 or 50 μg/mL BFA, therewas in both cases a small, but detectable amount offully glycosylated SG-GFP that had been transportedthrough the Golgi apparatus and secreted to the apical andbasolateral media. However, in these experiments, BFAwas added simultaneously with the metabolic label. As theconfocal images indicated induction of a pre-Golgi blockafter 3 h in the presence of 50 μg/mL BFA (Figure 3A),we performed experiments where the drug was added3 h prior to onset of the metabolic labeling. The newlysynthesized SG-GFP molecules were then only detectedwith pre-Golgi modifications in the apical and basolateralmedia (Figure 3B, lanes 4 and 8).

The Golgi apparatus in BFA-treated cells is capable of

glycosaminoglycan synthesis

One possible explanation of the effect of BFA could bethat unmodified SG-GFP is still transported through a Golgiapparatus incapable of GAG chain synthesis, first in theapical direction and then also in the basolateral directionat higher concentrations of BFA. To investigate whetherthe Golgi apparatus in BFA-treated MDCK cells, whichis seemingly quite intact when observed in the confocalmicroscope (even in the presence of 50 μg/mL BFA),has the capacity of GAG polymerization, we isolated Golgifractions from cells incubated with 50 μg/mL BFA to studyGAG synthesis in vitro. We have previously demonstratedthat Golgi fractions isolated from MDCK cells treated with5 μg/mL BFA have the full capability of synthesizing sul-fated GAG chains when incubated in the presence ofcytosol (15). We now isolated Golgi fractions from MDCKcells treated with 50 μg/mL BFA and compared the invitro GAG synthesis capacity to that of control cells. Thepreincubation with and presence of the high concentrationof BFA did not significantly reduce GAG synthesis capac-ity, either with cytosol from pig brain, or with rat livercytosol (Figure 4). This indicates that the variant of thecargo molecule SG-GFP that appears in the medium with-out Golgi modifications has not passed through a Golgiapparatus, which is unable to polymerize GAG chains, butrather has been transported via routes bypassing the Golgiapparatus.

SG-GFP bypassing the Golgi apparatus carries less

than four glycans at attachment sites

Although SG-GFP has eight potential GAG attachmentsites, only approximately half of these are utilized in MDCKcells (unpublished observations). Degradation of the CSchains by cABC removes all but six glycan units, whiletreatment with chondroitinase AC II (ACII) removes all but

Figure 4: In vitro Golgi GAG synthesis. MDCK cells stablyexpressing SG-GFP were grown to confluency on 500 cm2 tissueculture plates, and treated (dark grey) or not (light grey) with 50μg/mL BFA for 24 h before the cells were scraped off the dishes.Golgi fractions were isolated (as described in Materials andMethods) from treated and untreated MDCK cells and incubatedfor 2 h with 0.3 μCi/mL [35S]sulfate, an ATP-regenerating systemand Mn2+, in the absence or presence of 50 μg/mL BFA, andwith or without cytosol isolated from rat liver hepatocytes (ratcytosol) or pig brain (pig cytosol). In vitro synthesized sulfatedGAG chains were purified by Sephadex G50 fine chromatographyand incorporated 35S-sulfate was quantified in a scintillationcounter. Three independent Golgi fractions were analyzed foreach incubation type.

four sugars (Figure 5B). SG-GFP secreted into the apicaland basolateral media in the presence of BFA (5 μg/mL)has an even lower molecular mass (Figure 5A, lanes 4and 7), indicating the presence of less than four sugar unitsper attachment site. While the first xylose, and in somereports also the subsequent galactose unit, are thought tobe added prior to Golgi entry, the subsequent steps arethought to occur in the Golgi apparatus (16). In agreementwith this, the Golgi bypass route seems to diverge fromthe classical secretory route prior to Golgi entry.

BFA also induces Golgi bypass of glycoproteins

Induction of a Golgi bypass route by BFA is not limited toPGs. Most N-glycanated proteins passing through Golgicisternae acquire resistance to endoglycosidase H (EndoH). MDCK cells that express the extracellular portion ofthe prion-like glycoprotein Doppel with GFP fused at theC-terminus (sDPL-GFP, Figure 1B), secrete this protein toboth the apical and basolateral medium of filter-grownMDCK cells. When incubated in the presence of 5 or50 μg/mL BFA, Endo-H resistance is lost for both theapically and the basolaterally secreted glycoprotein, whilethe protein still carries N-glycans as shown by PNGaseF treatment (Figure 6A). At the lower BFA concentration(2 μg/mL) the apically secreted fraction is more sensitiveto Endo-H treatment than the basolateral counterpart,indicating a selective induction of apical Golgi bypass alsofor glycoproteins (Figure 6B).

1688 Traffic 2009; 10: 1685–1695

Apical Golgi Bypass in MDCK Cells

(A)

(B)

Figure 5: Modifications of SG-GFP after BFA treatment. A)MDCK cells stably expressing SG-GFP were grown to confluencyon filters, metabolically labeled for 24 h with [35S]-Cys/Met and inthe presence or absence of 5 μg/mL BFA followed by harvestingof media and immunoprecipitation of SG-GFP with anti-GFP,from apical and basolateral media. Stars indicate the doubletband that appears upon BFA treatment. The immunoprecipitatedSG-GFP was treated with cABC or ACII, before the sampleswere loaded onto a 10% SDS–PAGE gel and visualized byphosphorimaging. B) A schematic presentation of the linker regionand first disaccharides of a CS chain, and the sugars remainingafter cABC and ACII treatement. Xyl, xylose; Gal, galactose; GlcA,glucuronic acid.

Apical Golgi bypass transport in untreated MDCK

cells

We next wanted to investigate whether Golgi bypassroutes as such existed in untreated MDCK cells or onlyafter induction by BFA. Instead of experimentally delayingcargo molecules by BFA treatment, we took an alternativeapproach, where a C-terminal ER-retrieval sequence(KDEL) was fused to SG-GFP (SG-GFP-KDEL, Figure 1B) inan attempt to delay the cargo molecules underway to thecell surface also in untreated MDCK cells. It has previouslybeen shown that, although this retrieval sequence isrecognized by KDEL receptors, a fraction of the ligandmolecules are transported to the cell surface (17,18). Inline with those observations, also SG-GFP-KDEL appearedto some extent both in apical and basolateral media withfull GAG modification. The addition of KDEL to SG-GFP,however, also allowed the observation of the PG in theapical medium in a low molecular weight form (Figure 7A,arrowhead, B). Thus, we were able to observe a secretoryGolgi bypass route also in untreated MDCK cells, butonly in the direction of the apical surface (Figure 7A,B,lanes 1 and 5). The unglycosylated form of SG-GFP-KDELconstituted approximately 5% of the total apical secretionof this PG. The secretion of the fully glycosylated formshowed an apical preference slightly less stringent thanpreviously demonstrated for SG-GFP (7,8). After allowingapical and basolateral secretion for 16 h, the secretedamount was less than 10% of the sum of the secretedand cell associated SG-GFP-KDEL (Figure 7C). To furtherestablish the apical bypass phenomenon, we transfectedMDCK cells to express rGH fused to GFP. This is originallya non-glycosylated protein, which is transported in fairlyequal amounts to the apical and basolateral surfaces. Toallow rGH to report on the transport route to the cellsurface, we inserted the GAG modification domains fromSG between the rGH and the GFP domains (Figure 1B).This domain is modified with GAG chains, as observedin Figure 8A, lanes 5 and 7. The GAG chain modificationdoes not influence the apical and basolateral transportratio to the same extent as N-glycan sites, and the GAG-modified state is clearly distinguishable from the statewithout GAGs observed in the presence of 5 μg/mL BFA.Addition of the KDEL ER-retrieval sequence (Figure 1B)led to predominant secretion of a variant of rGH-GAG-KDEL without GAGs into the apical medium, whilebasolateral secretion was observed in the presence ofBFA (Figure 8A,B). These data strengthen the conclusionthat the Golgi bypass route in untreated MDCK cellsis predominantly apical, while it is randomized in thepresence of 5 μg/mL BFA.

Basolateral Golgi bypass can be induced by

cholesterol depletion

A Golgi-independent transport route to the cell surface hasbeen implicated in cholesterol transport (19). We thereforeinvestigated the effect of cholesterol depletion on trans-port of SG-GFP-KDEL to the apical and basolateral surfacesin MDCK cells. The depletion regime was a combinationof inhibition of cholesterol synthesis by lovastatin (Lo) and

Traffic 2009; 10: 1685–1695 1689

Tveit et al.

(B)(A)

Figure 6: Modification of the N-glycans of sDPL-GFP. A) MDCK cells stably expressing sDPL-GFP were grown to confluency onfilters, and treated for 3 h (*) with 0, 5 or 50 μg/mL BFA, before replacing all media with the same regime (0, 5 or 50 μg/mL BFA) andincubating further for another 16 h. B) In a parallel experiment the cells were also treated for 16 h with 2 μg/mL BFA before harvesting.The same relative amounts from apical (Api) and basolateral (Baso) media were left untreated (Ctr) or were treated with either PNGaseF or Endo H prior to western blotting with anti-GFP. Arrows indicate novel bands formed from sDPL-GFP carrying Endo-H sensitiveglycans upon treatment with this enzyme.

(A)

(B)

(C)

Figure 7: Secretion of SG-GFP-KDEL from MDCK cells monolayers treated with BFA. A) MDCK cells and MDCK cells stablyexpressing SG-GFP-KDEL were grown to confluency on filters. Media from untreated and BFA-treated (2, 5 or 50 μg/mL) cells wereharvested after 16 h, run on SDS–PAGE gels (4–12%) and western blot analysis was performed with anti-GFP. The same relativeamounts of SG-GFP-KDEL from apical (Api) and basolateral (Baso) media was analyzed. Arrows indicate the position of SG-GFP-KDELwithout GAG chains. B) One-fourth of the amount of apical medium used in panel A, lanes 1 to 4 was used for western blotting,performed as in A for better comparison with the basolateral samples. C) The data from five independent experiments conducted in theabsence of BFA (as described for Figure 7A), quantified after western blotting, are presented. Lysed cell fractions, were loaded onto thesame gels as apical and basolateral medium samples, and the amounts of SG-GFP-KDEL secreted (Api, apical secretion; Baso, basolateralsecretion), relative to the amounts retained intracellularly were quantified (secreted, retained). The amounts of fully glycosylated andunglycosylated SG-GFP-KDEL were also quantified for SG-GFP-KDEL secreted apically (no unglycosylated SG-GFP-KDEL is detectedbasolaterally in the absence of BFA), presented as relative amounts (Glycosylated, Unglycosylated). For each quantitative aspect onelight gray and one dark gray bar will add to 100%.

extraction of cholesterol from the apical and basolateral

cell surface domains by methyl-β-cyclodextrin (CD). This

treatment did not alter the secretion of fully modified SG-

GFP-KDEL into the apical medium significantly (although

the average was slightly decreased), but enhanced the

basolateral secretion (Figure 9A, B), in agreement with

what has previously been observed for the bulk of sulfatedmacromolecules (20).

The low molecular weight version of SG-GFP-KDEL wasnot detectable in the basolateral medium in untreatedMDCK cells (Figure 9B, lane 4), but was clearly visibleapically, as also shown in Figure 7. Upon cholesterol

1690 Traffic 2009; 10: 1685–1695

Apical Golgi Bypass in MDCK Cells

(A)

(B)

Figure 8: Secretion of rGH-GAG and rGH-GAG-KDEL from

MDCK cells in the absence and presence of BFA. A) MDCKcells stably transfected to express rGH-GAG or rGH-GAG-KDELwere grown to confluency on filters. Then the filters wereincubated for 16 h in the presence or absence of 5 μg/mL BFAbefore apical (Api) and basolateral (Baso) media were harvested.Medium samples were loaded onto 4–12% SDS–PAGE gelsand western blot analysis was performed, using anti-GFP. B)The data from four independent experiments were quantifiedand the secreted unglycosylated form of rGH-GAG-KDEL (arrowFigure 8A) is presented relatively to the secretion of apical control(Figure 8A, lane 1).

depletion, however, unmodified SG-GFP-KDEL appearedalso basolaterally (Figure 9A, lane 3). Thus, a basolateralGolgi bypass route is inducible, not only by BFA but alsoby cholesterol depletion.

Discussion

The view that all proteins en route to the cell surfacefollow the same ER-Golgi-cell surface track has beenchallenged on several occasions. A criterion that has beenused to distinguish the classical secretory pathway from‘nonclassical’ alternatives is whether surface transport issensitive to BFA or not (reviewed in 2). However, in someepithelial cell lines, like PtK1 (21) and MDCK (6), the Golgiapparatus is morphologically quite resistant to BFA, andbasolateral protein transport through the Golgi apparatusis still functional at 5 μg/mL of the drug (14).

(A)

(B)

Figure 9: Cholesterol depletion of MDCK cells expressing SG-

GFP-KDEL. A) MDCK cells stably expressing SG-GFP-KDEL weregrown to confluency on filters, before cholesterol was depletedby adding both 8 μg/mL Lo and 10 mM methyl-β-cyclodextrin (CD)as described in Materials and Methods. Media were harvested,and the same relative amounts of apical (Api) and basolateral(Baso) media were loaded and run on 10% SDS–PAGE gels,followed by western blotting with anti-GFP. A representative gelshowing SG-GFP-KDEL with Golgi modifications (around 220 kDa)and also without GAG chains ( ) is presented. Data from sixexperiments are summarized in B after quantification of blotsby phosphorimaging. Basolateral secretion of unglycosylated SG-GFP-KDEL is not included, because it is undetectable in untreatedcells (B).

Traffic 2009; 10: 1685–1695 1691

Tveit et al.

Figure 10: Summary of basic and

inducible secretory transport routes

in MDCK cells. Secretory transportroutes through Golgi stacks existto both the apical ( ) andbasolateral ( ) surfaces. An api-cal transport route that bypasses theGolgi apparatus ( ) can also bedetected. Apical transport through theGolgi apparatus is reduced while baso-lateral transport is stimulated by lowconcentrations of BFA and cholesteroldepletion. BFA treatment or choles-terol depletion induces a novel Golgibypass route in the basolateral direction( ).

In recent years, evidence for unconventional protein secre-tion has been generated from several biological systems,like Dictyostelium (22), PC 12, HeLa, and NRK cells (23)and Drosophila epithelial cells (24). In Dictyostelium andDrosophila, unconventional secretion requires the Golgireassembly stacking protein (GRASP) protein (22,24),while in the three cell lines, rab1 positive tubular struc-tures extend from the pre-Golgi IC compartment towardthe cell surface (23). At the same time, more and moreproteins have been shown to reach the cell surface with-out posttranslational modifications typically acquired inthe Golgi apparatus (25–28), several of which are des-tined for the apical surface in epithelial cells (29,30), butnonclassical basolateral transport has also been reportedin Drosophila (24).

The increased interest in Golgi-independent cell surfacetransport requires an intensified focus on the pre-GolgiIC elements (23,2). These are structurally composed ofa spherical coat protein I (COP I) and p58 positive bodywith rab 1 positive tubular extensions attached. The tubu-lar, rab1 positive pathway toward the cell surface did notrequire COP I in the cell lines tested, in agreement with theinsensitivity to BFA (31,23). Although various treatmentshave been shown to sensitize MDCK cells to BFA, a thor-ough study of coat proteins in the early secretory pathwayhas not been conducted. It has been shown, however, thatclathrin is important for basolateral sorting and transportof several proteins in MDCK cells (32). Thus, if the api-cal and basolateral pathways segregate at an early stage,clathrin might play a role, possibly also by contributing tothe relative BFA resistance of the basolateral pathway.

Previous studies have shown that low concentrations ofBFA induce a rerouting of apical proteins to the basolateralsurface of MDCK cells (33). Here we could show that inaddition, both a secretory PG (SG-GFP) and a secretoryglycoprotein (sDPL-GFP) still reach the apical medium, butwithout proper Golgi modifications in the presence of 2μg/mL BFA, while basolateral secretion proceeded nor-mally after Golgi passage. At higher BFA concentrations(5–50 μg/mL BFA), basolateral secretion also occurredwithout Golgi modifications (Figures 2A and 6A) for thesemodel proteins, and for an originally unglycosylated proteinwith inserted GAG attachment sites (rGH-GAG), followedby GFP and the ER-retrieval signal KDEL. These data showthat basolateral Golgi bypass is inducible.

Analysis of cells expressing SG-GFP by live confocalmicroscopy indicated that reduced secretion via the clas-sical secretory pathway in the presence of BFA could bedue to an accumulation of secretory protein in the Golgiapparatus. Thus, the primary action of BFA in MDCK cellscould be at the exit from the Golgi apparatus, where apicalexit is more sensitive than exit toward the basolateral sur-face. Retardation in the Golgi apparatus is likely to resultin an ‘overflow’ in a pre-Golgi compartment, like the IC,from where surface transport bypassing the Golgi appara-tus could take place (23). The fact that reduction in apicalsecretion of fully modified SG-GFP and sDPL-GFP inducesselective apical Golgi bypass at low BFA concentrations,indicates that sorting in the apical direction could havetaken place already prior to Golgi entry. As Golgi fractionsretain their capability of GAG chain synthesis in vitro inthe presence of 50 μg/mL BFA (Figure 4), it is unlikely that

1692 Traffic 2009; 10: 1685–1695

Apical Golgi Bypass in MDCK Cells

SG-GFP merely has passed through the Golgi apparatuswithout obtaining GAG chains. In fact, the variant enteringthe Golgi bypass route seems to carry less than the foursugars of the linker region remaining after ACII treatmentof CS chains (Figure 5A). Only one or two sugar unitsare thought to be added to GAG sites prior to Golgi entry(reviewed in 5), thus this observation is in accordance withan early divergence of the Golgi bypass route from theclassical secretory pathway.

The fact that Golgi-independent surface transport routeshave been outlined for several classes of proteins (4)lead us to ask whether such routes exist in untreatedepithelial MDCK cells. To this end, we asked whetherprolonging the occupancy time of a cargo molecule bythe addition of a C-terminal KDEL ER-retrieval sequencecould mimic the BFA effect. In agreement with previousstudies of KDEL-tagged decorin (18), some SG-GFP-KDELwas secreted with full Golgi modifications. However, avariant without GAG chains could also be detected, butin the apical medium only. Thus, an apical Golgi bypassroute has been demonstrated in epithelial MDCK cells,but is so far only proven in the apical direction. Additionalsupport for the apical Golgi bypass route was obtained byfusing the KDEL sequence to rGH, a well-known solublemodel protein for the secretory pathway in MDCK cells.Rat growth hormone was in addition fused to GFP andto the GAG attachment region of SG, to allow reportingof Golgi passage or bypass. Also this model protein wasmainly transported apically without Golgi modifications,while efficient basolateral Golgi bypass transport was onlyobserved in the presence of BFA.

Apical and basolateral membrane domains of epithelialcells have different content of proteins and lipids. Theapical membrane has been argued to possess a ‘raft-like’character, while the basolateral surface has been com-pared with the plasma membrane of non-polarized cells.Although both membrane domains contain cholesterol,it actually seems as if the basolateral surface has thehigher content (34,35). BFA-independent transport to thecell surface has previously been implicated in lipid trans-port (36,37), particularly of cholesterol (19). We have someyears ago shown that cholesterol depletion of MDCK cellsreduces the general secretory capacity in the apical direc-tion, while basolateral secretion is not decreased, butrather stimulated (20). We now have performed choles-terol depletion of MDCK cells transporting SG-GFP-KDELto the apical surface both via the classical secretory path-way and via the Golgi bypass route, to address how theseroutes were affected by lowering the cellular cholesterollevel. Transport via the classical apical secretory pathwaywas not significantly affected, while transport via the api-cal Golgi bypass route was induced (Figure 9B). In thebasolateral direction, a Golgi bypass route, which wasnot detectable in control cells, was induced to a levelcomparable with the apical counterpart upon cholesteroldepletion. Basolateral secretion via the classical secretorypathway was also induced.

In conclusion, a Golgi bypass route exists in the apicaldirection of untreated cells of the kidney epithelial cell lineMDCK. A basolateral Golgi bypass route has not yet beendemonstrated in this cell line under normal circumstances,but may be activated by BFA or cholesterol depletion(summarized in Figure 10). Still, a basolateral bypass routein untreated cells cannot be completely excluded andmight be detectable for other cargo molecules than thosestudied here.

There are several possible explanations of a physiologicalrequirement for a Golgi bypass route to the apical plasmamembrane. The internal environment of the classical Golgisecretory route and the activity of certain proteins in transitmight not be compatible – the internal environment couldharm the proteins in transit, by the proteolytic cleavage orby the addition of inhibitory modifications. Alternatively,the proteins in transit (like ion pumps) could harm theinternal environment of the classical secretory pathwayand are therefore transported via an alternative route.We have recently shown that synthesis of PGs in theapical and basolateral secretory pathways of MDCK cellsdisplays differential sensitivity to neutralization of the Golgilumen. Neutralization was carried out by blocking the H+-ATPase with Bafilomycin A1 treatment. These studiesindicated that the apical route has a more acidic internalenvironment (38). Another observation of physiologicalimportance could be that nonclassical Golgi bypasstransport of proteins to the plasma membrane occursfaster than via the classical Golgi transport route, thushaving the ability to supply the plasma membrane fasterwith newly synthesized proteins and lipids (2). In addition,receptors and other proteins at the plasma membranehave been found with both high-mannose and complexN-glycan isoforms (39), with their functions or life-timesregulated by the nature of their N-glycan structures (2,40).More experiments are required, however, to follow up onthese lines of explanation and to more globally understandthe physiological role of the apical Golgi bypass transportobserved in kidney epithelial MDCK cells.

Materials and Methods

Recombinant DNA constructsThe construct coding the PG SG-GFP (Figure 1B) was designed as previ-ously described (7). SG-GFP-KDEL was amplified using SG as a template,and polymerase chain reaction (PCR) was performed using 5′-primer(5′-ATGCTAGCATGATGCAGAAGCTACTCAAA-3′) and 3′-primer (5′-GAATTCTTATTAAAGTTCGTCTTTCTTGTACAGCTCGTC-3′) followed by ligationinto NheI and EcoRI digested pEGFP-C1 vector (Clontech). sDPL-GFPwas amplified by PCR using the previously described ovine DoppelDNA (41) as template, together with 5′-primer (5′-CACTGTGACTTTTGGTTGATGGTGAGCAAGGGCGAGGAG-3′) and 3′-primer (5′-ATTAGCTCGAGTCTACTACTTGTACAGCTCGTCCATG-3′) followed by ligation into pEGFP-N3,using EcoRI and BamHI restriction sites. The rGH-GAG was designed byfirst using the rGH (kind gift from Joachim Fullekrug/Kai Simons, MaxPlanck Inst.) as template and 5′-primer (5′-CTCGAGATGGCTGCAGACTCTCAGACTC-3′) and 3′-primer with the GAG region from the SG (5′-GTTCTCGAGACTATTCCGTTAGGAAGCCACTCCCAGATCCTGATCCAGAGCCGGAGCCGGAGCCGAAGCCTGATCCAGAGTAGTCCTCGAAAGCACAGCTGC

Traffic 2009; 10: 1685–1695 1693

Tveit et al.

T-3′). Another PCR was performed before ligating the product into thepEGFP-N3 (Clontech) expression vector using XhoI and EcoRI. The same5′-primer was used, but now the 3′-primer was (5′-GAATTCGCTTCCGTTAGGAAGCCACTCC-3′). To make the rGH-GAG-KDEL the rGH-GAG was usedas template, with the same 5′-primer as for SG-GAG, while the 3′-primer was (5′-GAATTCTTATTAAAGTTCGTCTTTCTTGTACAGCTCGTC-3′).The PCR product was ligated into the pGEM®-T Vector (Promega), and therestriction enzymes XhoI and NotI were used prior to ligation of the PCRproduct into the pEGFP-N3 vector.

Cell culture and transfectionMDCK II cells were grown in Dulbecco’s modified Eagle’s medium with5% fetal calf serum (FCS) (PAA Laboratories), 1% penicillin/streptomycin,and L-glutamine (BioWhittaker) at 37◦C and 5% CO2.Transfection ofMDCK II cells was performed as previously described for the SG-GFPconstruct (7). For polarized studies of protein secretion, MDCK II cellswere grown on filters for 3 days to establish tight epithelial monolayers,followed by change to serum-free medium when western blotting ormetabolic labeling were performed, then harvesting after 16–24 h.

Immunoblotting and immunoprecipitationTransfected MDCK (106) cells were seeded on 4.7 cm2 filters (Costar 3412)and grown for 3 days. For immunoblotting, apical and basolateral serum-free media and cell fractions were harvested after 16 (BFA treatment) or24 h of incubation. Equal amounts of media and cell lysate (cells were lysedin 2 mL inositol phosphate (IP)-lysis solution (1% Nonidet P-40, 50 mM Tris,pH 7.5, 2 mM EDTA, 150 mM NaCl, and 35 μg/mL phenylmethylsulfonylfluoride) were resolved by 10% or 4–12% SDS–PAGE (BioRad) and elec-trotransferred onto polyvinylidene difluoride membranes (GE Healthcare)as described earlier (42). Membranes were probed with anti-GFP pAb(ab6556; Abcam), followed by alkaline phosphatase conjugated secondaryantibody (ECF™ Western Blotting Reagent Pack; GE Healthcare). Pro-teins were detected by chemifluorescence (Typhoon 9410 Variable ModeImager; GE Healthcare), and quantified by ImageQuant (GE Healthcare).The immunoprecipitaion was performed as previously described (7). Filter-grown cells were metabolically labeled for 24 h with [35S]Cys/[35S]Met(35S-Cys/Met) or [35S]sulfate (35S-SO2–

4 ), followed by harvesting, beforeimmunoprecipitation was performed with anti-GFP pAb (Abcam, ab290).

Quantification of macromoleculesTo quantify the amount of macromolecules secreted from MDCK II cells,the media from metabolically labeled cells were applied to Sephadex G-50Fine columns (8), followed by SDS–PAGE of the same relative volumes ofapical and basolateral media. The gels were fixed, treated with Amplify (GEHealthcare), dried, exposed to phosphorimager screens, scanned (Typhoon9410 Phosphorimager, GE Healthcare) and quantified by ImageQuant (GEHealthcare). Quantification of SG-GFP after IP was carried out in the sameway; SDS–PAGE followed by scanning in the Phosphorimager.

Glycan degradationFilter-grown cells were metabolically labeled as described above. Afterharvesting and immunoprecipitation, each sample was divided into threealiquots [control, cABC (Seikagaku Corp.) treatment for CS degradation at37◦C overnight, and HNO2 treatment for HS degradation (10 min at roomtemperature)] as described (43). To obtain protein cores with CS linkertetrasaccharides only, 175 mU of chondroitinase AC II Arthro (Seikagaku)were added to each sample, together with cABC buffer (pH 6) for 3 hat 37◦C. The relative same amount of apical and basolateral media fromMDCK cells expressing sDPL-GFP were treated with N-glycosidase F orEndo H (New England Biolabs) for 1 h at 37◦C, as recommended by themanufacturer.

Brefeldin A treatmentMDCK II and transfected MDCK II cells were grown on filters for 3 days,followed by change to serum-free medium and harvesting after another

16 h in the presence of 0, 2, 5 or 50 μg/mL BFA (Sigma). For metaboliclabeling experiments, 0, 2, 5 or 50 μg/mL BFA was normally added to thecells in medium containing the isotope label. However, (*) indicates that thecells were preincubated with 5 or 50 μg/mL BFA for 3 h prior to the additionof isotope label and harvesting after 16 h or alternatively, change to serum-free medium, incubation for 16 h, and processing for western blotting.

Cholesterol depletionTransfected MDCK II cells were grown on filters for 3 days, beforechanging to fresh medium containing Lo (8 μg/mL) (Calbiochem). Afteranother 48 h, fresh medium without FCS, but with Lo (8 μg/mL) and 10 mM

methyl-β-cyclodextrin (Sigma) was added and the cells were incubated foranother 16 h, followed by harvesting and immunoblotting.

In vitro incubation of Golgi fractionsMDCK cells were grown to confluency on 500 cm2 square tissue cultureplates (Corning) and incubated for 24 h in the absence or presence of50 μg/mL BFA before the cells were harvested and Golgi fractions wereisolated by subcellular fractionation as previously described (44). Aliquotsof Golgi fractions were incubated for 2 h with 0.3 μCi/mL [35S]sulfate in theabsence or presence of cytosol isolated from rat liver hepatocytes or pigbrain, an ATP-regenerating system, and Mn2+(15). Sulfated GAG chainssynthesized in vitro were purified as described earlier (8) by SephadexG-50 fine chromatography (as describe and quantified in a (Packard 1900TR) scintillation counter.

Confocal microscopy studiesCells were grown on glass bottom microwell dishes (MatTek, P35G-1.5-14-C), then the cells were washed with HEPES, incubated with red fluorescentlipid Golgi marker (BODIPY© TR ceramide complexed to BSA, Invitrogen,B34400) at 4◦C in 30 min (in HEPES), the cells were washed and newmedium (DME with 5% FCS medium) were added. The cells were furtherincubated in the absence or presence of different concentrations of BFAin a 37◦C chamber in the presence of 5% CO2. Confocal images wereobtained using an Olympus FluoView 1000 inverted microscope, equippedwith a PlanApo × 60/1.10 oil objective.

Acknowledgments

This work was supported by grants 174796, 174548 (FUGE) and 183613(FUGE to GLYCONOR) from the Norwegian Research Council.

References

1. Prydz K, Dick G, Tveit H. How many ways through the Golgi maze?Traffic 2008;9:299–304.

2. Marie M, Sannerud R, Avsnes Dale H, Saraste J. Take the ‘A’ train: onfast tracks to the cell surface. Cell Mol Life Sci 2008;65:2859–2874.

3. Nickel W, Seedorf M. Unconventional mechanisms of protein trans-port to the cell surface of eukaryotic cells. Annu Rev Cell Dev Biol2008;24:287–308.

4. Nickel W, Rabouille C. Mechanisms of regulated unconventionalprotein secretion. Nat Rev Mol Cell Biol 2009;10:148–155.

5. Prydz K, Dalen KT. Synthesis and sorting of proteoglycans. J Cell Sci2000;113:193–205.

6. Sandvig K, Prydz K, Hansen SH, van Deurs B. Ricin transport inbrefeldin A-treated cells: correlation between Golgi structure andtoxic effect. J Cell Biol 1991;115:971–981.

7. Tveit H, Dick G, Skibeli V, Prydz K. A proteoglycan undergoes differentmodifications en route to the apical and basolateral surfaces of Madin-Darby canine kidney cells. J Biol Chem 2005;280:29596–29603.

8. Vuong TT, Prydz K, Tveit H. Differences in the apical and basolateralpathways for glycosaminoglycan biosynthesis in Madin-Darby caninekidney cells. Glycobiology 2006;16:326–332.

1694 Traffic 2009; 10: 1685–1695

Apical Golgi Bypass in MDCK Cells

9. Paladino S, Sarnataro D, Pillich R, Tivodar S, Nitsch L, Zurzolo C.Protein oligomerization modulates raft partitioning and apical sortingof GPI-anchored proteins. J Cell Biol 2004;167:699–709.

10. Alfalah M, Wetzel G, Fischer I, Busche R, Sterchi EE, Zimmer KP,Sallmann HP, Naim HY. A novel type of detergent-resistant mem-branes may contribute to an early protein sorting event in epithelialcells. J Biol Chem 2005;280:42636–42643.

11. Emery G, Parton RG, Rojo M, Gruenberg J. The trans-membraneprotein p25 forms highly specialized domains that regulate membranecomposition and dynamics. J Cell Sci 2003;116:4821–4832.

12. Morsomme P, Prescianotto-Baschong C, Riezman H. The ERv-SNAREs are required for GPI-anchored protein sorting fromother secretory proteins upon exit from the ER. J Cell Biol2003;162:403–412.

13. Castillon GA, Watanabe R, Taylor M, Schwabe TM, Riezman H.Concentration of GPI-anchored proteins upon ER exit in yeast. Traffic2009;10:186–200.

14. Low SH, Wong SH, Tang BL, Tan P, Subramaniam VN, HongW. Inhibition by brefeldin A of protein secretion from the apicalcell surface of Madin-Darby canine kidney cells. J Biol Chem1991;266:17729–17732.

15. Fjeldstad K, Pedersen ME, Vuong TT, Kolset SO, Nordstrand LM,Prydz K. Sulfation in the Golgi lumen of Madin–Darby caninekidney cells is inhibited by brefeldin A and depends on a factorpresent in the cytoplasm and on Golgi membranes. J Biol Chem2002;277:36272–36279.

16. Silbert JE, Sugumaran G. Biosynthesis of chondroitin/dermatan sul-fate. IUBMB Life 2002;54:177–186.

17. Miesenbock G, Rothman JE. The capacity to retrieve escaped ERproteins extends to the trans-most cisterna of the Golgi stack. J CellBiol 1995;129:309–319.

18. Jonsson M, Eklund E, Fransson LA, Oldberg A. Initiation of thedecorin glycosaminoglycan chain in the endoplasmic reticulum-Golgiintermediate compartment. J Biol Chem 2003;278:21415–21420.

19. Urbani L, Simoni RD. Cholesterol and vesicular stomatitis virus Gprotein take separate routes from the endoplasmic reticulum to theplasma membrane. J Biol Chem 1990;265:1919–1923.

20. Prydz K, Simons K. Cholesterol depletion reduces apical transportcapacity in epithelial Madin-Darby canine kidney cells. Biochem J2001;357:11–15.

21. Ktistakis NT, Roth MG, Bloom GS. PtK1 cells contain a nondiffusible,dominant factor that makes the Golgi apparatus resistant to brefeldinA. J Cell Biol 1991;113:1009–1023.

22. Kinseth MA, Anjard C, Fuller D, Guizzunti G, Loomis WF,Malhotra V. The Golgi-associated protein GRASP is required forunconventional protein secretion during development. Cell 2007;130:524–534.

23. Sannerud R, Marie M, Nizak C, Dale HA, Pernet-Gallay K, Perez F,Goud B, Saraste J. Rab1 defines a novel pathway connecting thepre-Golgi intermediate compartment with the cell periphery. Mol BiolCell 2006;17:1514–1526.

24. Schotman H, Karhinen L, Rabouille C. dGRASP-mediated noncanoni-cal integrin secretion is required for Drosophila epithelial remodeling.Dev Cell 2008;14:171–182.

25. Baldwin TA, Ostergaard HL. The protein-tyrosine phosphatase CD45reaches the cell surface via golgi-dependent and -independentpathways. J Biol Chem 2002;277:50333–50340.

26. Flowerdew SE, Burgoyne RD. A VAMP7/Vti1a SNARE complex dis-tinguishes a non-conventional traffic route to the cell surface used byKChIP1 and Kv4 potassium channels. Biochem J 2009;418:529–540.

27. Maxson JE, Enns CA, Zhang AS. Processing of hemojuvelin requiresretrograde trafficking to the Golgi in HepG2 cells. Blood 2009;113:1786–1793.

28. Sura-Trueba S, Aumas C, Carre A, Durif S, Leger J, Polak M, de RouxN. An inactivating mutation within the first extracellular loop of thethyrotropin receptor impedes normal posttranslational maturation ofthe extracellular domain. Endocrinology 2009;150:1043–1050.

29. Rennolds J, Boyaka PN, Bellis SL, Cormet-Boyaka E. Low temperatureinduces the delivery of mature and immature CFTR to theplasma membrane. Biochem Biophys Res Commun 2008;366:1025–1029.

30. Yu L, Helms MN, Yue Q, Eaton DC. Single-channel analysis offunctional epithelial sodium channel (ENaC) stability at the apicalmembrane of A6 distal kidney cells. Am J Physiol Renal Physiol2008;295:F1519–F1527.

31. Ying M, Flatmark T, Saraste J. The p58-positive pre-golgi interme-diates consist of distinct subpopulations of particles that showdifferential binding of COPI and COPII coats and contain vacuolarH(+)-ATPase. J Cell Sci 2000;11:3623–3638.

32. Deborde S, Perret E, Gravotta D, Deora A, Salvarezza S, Schreiner R,Rodriguez-Boulan E. Clathrin is a key regulator of basolateral polarity.Nature 2008;452:719–723.

33. Low SH, Tang BL, Wong SH, Hong W. Selective inhibition of proteintargeting to the apical domain of MDCK cells by brefeldin A. J CellBiol 1992;118:51–62.

34. Remaley AT, Farsi BD, Shirali AC, Hoeg JM, Brewer HB Jr. Differ-ential rate of cholesterol efflux from the apical and basolateralmembranes of MDCK cells. J Lipid Res 1998;39:1231–1238.

35. Lebreton S, Paladino S, Zurzolo C. Selective roles for cholesteroland actin in compartmentalization of different proteins in theGolgi and plasma membrane of polarized cells. J Biol Chem2008;283:29545–29553.

36. Vance JE, Aasman EJ, Szarka R. Brefeldin A does not inhibit themovement of phosphatidylethanolamine from its sites for synthesisto the cell surface. J Biol Chem 1991;266:8241–8247.

37. Shiao YJ, Vance JE. Sphingomyelin transport to the cell surface occursindependently of protein secretion in rat hepatocytes. J Biol Chem1993;268:26085–26092.

38. Grondahl F, Tveit H, Prydz K. Neutralization of endomembranecompartments in epithelial MDCK cells affects proteoglycan synthesisin the apical secretory pathway. Biochem J 2009;418:517–528.

39. Kuo TT, de Muinck EJ, Claypool SM, Yoshida M, Nagaishi T,Aveson VG, Lencer WI, Blumberg RS. N–glycan moieties in neonatalFc receptor determine steady-state membrane distribution anddirectional transport of IgG. J Biol Chem 2009;284:8292–8300.

40. Guo HB, Johnson H, Randolph M, Lee I, Pierce M. Knockdownof GnT-Va expression inhibits ligand-induced downregulation ofthe epidermal growth factor receptor and intracellular signal-ing by inhibiting receptor endocytosis. Glycobiology 2009;19:547–559.

41. Tranulis MA, Espenes A, Comincini S, Skretting G, Harbitz I. The PrP-like protein Doppel gene in sheep and cattle: cDNA sequence andexpression. Mamm Genome 2001;12:376–379.

42. Lund C, Olsen CM, Tveit H, Tranulis MA. Characterization of the prionprotein 3F4 epitope and its use as a molecular tag. J Neurosci Methods2007;165:183–190.

43. Sugumaran G, Katsman M, Silbert JE. Effects of brefeldin A on thelocalization of chondroitin sulfate-synthesizing enzymes. Activities insubfractions of the Golgi from chick embryo epiphyseal cartilage.J Biol Chem 1992;267:8802–8806.

44. Prydz K, Hansen SH, Sandvig K, van Deurs B. Effects of brefeldin Aon endocytosis, transcytosis and transport to the Golgi complex inpolarized MDCK cells. J Cell Biol 1992;119:259–272.

Traffic 2009; 10: 1685–1695 1695