Technical and Biological Issues Relevant to Cell Typing with Aptamers

Technical and Biological Issues Relevant to Cell Typing with

Aptamers

Na Li,† Jessica N. Ebright,† Gwendolyn M. Stovall, Xi Chen, Hong Hanh Nguyen, Amrita Singh,Angel Syrett, and Andrew D. Ellington*

Department of Chemistry and Biochemistry, Institute for Cell and Molecular Biology, University of Texas atAustin, Austin, Texas 78712

Received December 5, 2008

A number of aptamers have been selected against cell surface biomarkers or against eukaryotic tissueculture cells themselves. To determine the general utility of aptamers for assessing the cell surfaceproteome, we developed a standardized flow cytometry assay and carried out a comprehensive studywith 7 different aptamers and 14 different cell lines. By examining how aptamers performed with avariety of cell lines, we identified difficulties in using aptamers for cell typing. While there are someaptamers that show excellent correlation between cell surface binding and the expression of a biomarkeron the cell surface, other aptamers showed nonspecific binding by flow cytometry. For example, it hasrecently been claimed that an anti-PTK7 (protein tyrosine kinase 7) aptamer identified a new biomarkerfor leukemia cells, but data with the additional cell lines shows that it is possible that the aptamerinstead identifies a propensity for adherence. Better understanding and controlling for the role ofbackground and nonspecific binding to cells should open the way to using arrays of aptamers fordescribing and quantifying the cell surface proteome.

Keywords: aptamer • in vitro selection • SELEX • biomarker • cancer • array • adherence

IntroductionBeing able to identify biomarkers on tumors, or to otherwise

develop prognostic indicators for different tumors, wouldgreatly impact cancer diagnosis and treatment. In this regard,the search for such tumor biomarkers is the focus of manycurrent studies.1,2 Researchers have recently been aggressivelyseeking more diagnostic tumor markers through proteomicsscreens. It is also hoped that proteomics approaches will yielda combination of biomarkers that may be more diagnostic thana single tumor marker.

Antibodies have historically been the predominant reagentof choice for protein biomarker detection, and their adaptationto microarrays is proceeding rapidly.3,4 Recently, however,selected nucleic acid binding species (aptamers) have provenuseful as reagents for identifying and labeling cell surfacemarkers.5 It has even been suggested that aptamers capableof binding cell surface proteins may be useful for typing cells.6

Aptamer arrays might be as readily constructed as geneexpression microarrays, and thus could potentially be usefulfor proteomics research.7 This prompted us to question whetheraptamers against cell surface proteins were in general usefulreagents for labeling cells or for examining the expression ofthe cell surface proteome.

While it is true that aptamers can be used to label cells, thereare great differences in the abilities of anticell surface antigenaptamers to actually recognize proteins in the highly complex

context of the cell surface. Just as antibodies can often proveidiosyncratic in their abilities to reliably label cells, cautionmust be taken when using aptamers as cell typing reagents.To better identify both the limitations and opportunities forusing aptamers to explore the cell surface proteome, we carriedout a comprehensive experiment with 7 aptamers and 14 celllines. Our results suggest some simple, common sense rulesfor quantitatively using aptamers with cells and thereby avoid-ing identifying or misinterpreting background binding.

Materials and Methods

Aptamers. The ssDNA aptamer sequences and the DNAtemplates for RNA aptamers shown in Table 1 were orderedfrom IDT (Integrated DNA Technologies, Coralville, IA) withan additional 24 nt sequence (5′-GAATTAAATGCCCGCCAT-GACCAG-3′) added to their 3′ end for labeling via hybridization.DNA templates for RNA aptamers also had a T7 promotersequence (5′-TAATACGACTCACTATA-3′) added to their 5′ ends.5′ Fluorescein-labeled and biotinylated complementary se-quences (called a capture oligonucleotide, sequence ) 5′-CTGGTCATGGCGGGCATTTAATTC-3′) were also ordered fromIDT. ssDNA aptamers were diluted for use, while ssDNAtemplates for RNA aptamers were first PCR amplified usingcorresponding primers (see below) and then transcribed andgel-purified. Unmodified RNA aptamers were transcribed usingan Ampliscribe kit (Epicenter, Madison, WI) and 2′-fluoropy-rimidine-modified RNA aptamers were prepared using a Duras-cribe kit (Epicenter).

* Towhomcorrespondenceshouldbeaddressed.E-mail:[email protected]. Phone: (512) 471-6445. Fax: (512) 471-7014.

† These two authors contributed equally.

2438 Journal of Proteome Research 2009, 8, 2438–2448 10.1021/pr801048z CCC: $40.75 2009 American Chemical SocietyPublished on Web 03/09/2009

Primers for the amplification of DNA templates are listedbelow, where the T7 promoter sequences are underlined andthe binding sites for hybridization of fluorescein-labeled orbiotinylated oligonucleotides are in italics:

Anti-Her 3 (human EGFR related 3) aptamer (unmodifiedRNA):

Forward primer: 5′-TAATACGACTCACTATAGGGAATTCC-3′Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCGAG-

GATCCCGAACGGACCGC-3′Anti-TNC (Tenascin C) aptamer (2′-fluoropyrimidine-modi-

fied RNA):Forward primer: 5′-TAATACGACTCACTATAGGGAGGACGAT-

GCGG-3′Reverse primer: 5′-CTGGTCATGGCGGGCATTTAAT-

TCTCGCGCGAGTCGTCTG-3′Anti-PSMA (prostate specific membrane antigen) aptamer

(2′-fluoropyrimidine-modified RNA):Forward primer: 5′-TAATACGACTCACTATAGGGAGGACGAT-

GCGG-3′Reverse primer: 5′-CTGGTCATGGCGGGCATTTAAT-

TCTCGGGCGAGTCGTCTG-3′Anti-EGFR (epidermal growth factor receptor) aptamer

(unmodified RNA):Forward primer: 5′-TAATACGACTCACTATAGGCGCTCCGAC-

CTTAGTCTCTG-3′Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCTCT-

GCTGTGCTACACGGTTC-3′Aptamer Labeling. All RNAs were gel purified after tran-

scription and quantitated by measuring the absorbance at 260nm using a NanoDrop spectrophotometer (Thermo Scientific,Wilmington, DE). Three methods were used to label anti-EGFRaptamers with fluorophores. First, direct labeling of RNA wascarried out by transcribing the double-stranded DNA templatefrom the T7 Phi2.5 promoter using fluorescein-AMP as aninitiator (Adegenix, Monrovia, CA). In detail, the DNA template

(5′-GGCGCTCCGACCTTAGTCTCTGCAAGATAAACCGTGCTATT-GACCACCCTCAACACACTTATTTAATGTATTGAACGGACCTACG-AACCGTGTAGCACAGCAGA-3′) was PCR amplified with a forwardprimer containing the T7 Phi2.5 promoter (5′- GATAATACGACT-CACTATTAGGCGCTCCGACCTTAGTCTCTG-3′) and a reverseprimer (5′-TCTGCTGTGCTACACGGTTC-3′). Transcription wascarried out according to the recommended fluorescein-labelingconditions supplied by Adegenix.8,9

Second, for labeling through extension, an additional 24 ntsequence (5′-GAATTAAATGCCCGCCATGACCAG-3′) was addedto the templates of RNA aptamers by PCR with an extendedreverse primer (5′-CTGGTCATGGCGGGCATTTAATTCTCT-GCTGTGCTACACGGTTC-3′). Extended double-stranded DNAwas used as the template for transcription. Equal amounts ofextended RNAs and 5′ fluorescein-labeled or biotinylatedcapture oligonucleotides were annealed by heating samples to70 °C for 3 min and then slowly cooling them to 25 °C at therate of 1 °C/s. RNAs annealed with fluorescein-labeled oligo-nucleotides were used for flow cytometry.

Finally, RNAs annealed to biotinylated capture oligonucle-otides were further incubated with streptavidin-phycoerythrin(SA-PE, Prozyme, San Leandro, CA) at a biotinylated captureoligonucleotide:SA-PE ratio of 2:1 for 15 min at 25 °C. This lattermethod was eventually used for all other aptamers.

The unselected pool RNA (N62, the same pool from whichthe anti-EGFR aptamer was selected) was also labeled by theabove three methods and used as a negative control for flowcytometry.

Cell Culture. The cell lines used in this study are shown inTable 2. Cells were all purchased from ATCC (American typeCulture Collection, Manassas, VA) except U251 which wasobtained from the DCTD Tumor Repository, National CancerInstitute at Frederick (Frederick, MA), A4573 from the labora-tory of Dr. Chris Denny at UCLA, and MDA-MB-435 from thelaboratory of Dr. Konstantin Sokolov at University of Texas at

Table 1. Aptamers Used in This Study

nameselection

targetcell assay

target Kd composition sequence reference

A30 Human EGFR MCF7 45 nM RNA GGGAAUUCCGCGUGUGCCAGCGAAAGUU 22Related 3 (HER3) GCGUAUGGGUCACAUCGCAGGCACAUGU

CAUCUGGGCGGUCCGUUCGGGAUCCUC

S1.3/S2.2 Mucin 1 (MUC1) MCF7 0.135 nM ssDNA GGGAGACAAGAATAAACGCTCAAGCAGTTGATCCTTTGGATACCCTGGTTCGACAGGAGGCTCACAACAGGC 20

E9P2-2 Tenascin C (TNC) U251 4 nM RNA, 2′-Fluoro-Py GGGAGGACGAUGCGGUGCCCACUAUGCGUGCCGAAAAACAUUUCCCCCUCUACCCCAGACGACUCGCGCGA 21

xPSM-A9 Prostate Specific LNCaP 2.1 nM RNA, 2′-Fluoro-Py GGGAGGACGAUGCGGACCGAAAAAGACCUMembrane Antigen GACUUCUAUACUAAGUCUACGUUCCCAGA(PSMA) CGACUCGCCCGA 16

sga16 CCRF-CEM cells CCRF-CEM 5 nMa ssDNA TTTAAAATACCAGCTTATTCAATTAGTCACA(binds PTK7 protein) CTTAGAGTTCTAGCTGCTGCGCCGCCGGG

AAAATACTGTACGGATAGATAGTAAGTGCAATCT 6, 27

TD05 Ramos cells Ramos 74.7 nMa ssDNA AACACCGGGAGGATAGTTCGGTGGCTGTT(binds IGHM protein) CAGGGTCTCCTCCCGGTG 6, 29

J18b Epithelial Growth A431 7 nM RNA GGCGCUCCGACCUUAGUCUCUGCAAGAUFactor Receptor (EGFR) AAACCGUGCUAUUGACCACCCUCAACACA

CUUAUUUAAUGUAUUGAACGGACCUACGAACCGUGUAGCACAGCAGA

a Kd determined using cells, not purified protein or peptide b Unpublished data.

Issues Relevant to Cell Typing with Aptamers research articles

Journal of Proteome Research • Vol. 8, No. 5, 2009 2439

Austin. A549 cells were maintained at 37 °C and 5% CO2 inF-12K media supplemented with 10% FBS (Invitrogen, Carls-bad, CA). A4573, A431, and MDA-MB-435 were grown in DMEMmedia with 10% FBS. MCF7, U251, LNCaP, Ramos, CCRF-CEM,HeLa, PC3, HL60, KG1, and K562 were grown in RPMI 1640media with 10% FBS. All media types were purchased fromATCC.

Flow Cytometry. For adherent cell lines, cells were firstwashed with DPBS (Invitrogen) and then trpyinsinzed with 1mL of 0.05% trypsin-EDTA (Invitrogen). After 2-10 min, thereaction was terminated by adding 5 mL of growth media. Cellswere counted using a hemocytometer, and 5 × 106 cells wereused for the flow cytometry assay. The cells were pelleted at2000g for 10 s (or 150-200g for 5 min) and washed with 1 mLof DPBS, followed by 2 washes with 1 mL of binding buffer(DPBS with 5 mM MgCl2 (Sigma Aldrich, St. Louis, MO)). Thecells were resuspended in 1 mL of binding buffer containingBSA (1 mg/mL, Sigma Aldrich) and tRNA from Brewer’s yeast(0.1 mg/mL, Roche, Indianapolis, IN), and 100 µL of aliquotswere introduced into each of 10 tubes (5 × 105 cells per tube).Each tube represented a separate binding reaction, includingcells alone, the biotinylated capture oligonucleotide and SA-PE, the 7 different aptamers plus the biotinylated captureoligonucleotide with SA-PE, and anti-PTK7 (protein tyrosinekinase 7) antibody (anti-PTK7-PE, human, 1:20, Miltenyi Biotec,Auburn, CA). The final concentration of aptamer in the 100 µLof binding reactions was 100 nM. The aptamer:biotinylatedcapture oligonucleotide:SA-PE annealing reactions were carriedout as described above for 30 min at 25 °C. Cells were thenwashed once with 100 µL of binding buffer containing BSA andtRNA, and twice with binding buffer. Cell pellets were storedon ice until they could be analyzed using a FACSCalibur(Becton Dickinson, San Jose, CA). Each pellet was resuspendedin 300 µL of binding buffer immediately before the flowcytometry analysis.

For each binding reaction, 10 000 events were collected andanalyzed using BD CellQuest Pro software. Fluorescein-labeledsamples were analyzed using the FL1-H detector and PE-labeled samples were analyzed using the FL2-H detector. Flowcytometry data was gated with WinMDI 2.8 (The ScrippsResearch Institute, La Jolla, CA) and the delimited data setswere then exported to MATLAB (The MathWorks, Natick, MA).Intact cells were identified by using a plot of FSC-H againstSSC-H. The fluorescence value for the aptamer hybridized tothe biotinylated capture oligonucleotide:SA-PE was divided bythe mean fluorescence background (the biotinylated captureoligonucleotide:SA-PE alone).

Impact of Valency on Aptamer Binding. Aptamer valencywas engineered by connecting multiple aptamers either on anoligonucleotide template or via SA. The oliognucleotide tem-plate was: 5′- fluorescein -CATTTGCATTTAGGACCAACACAAT-TACCGATCATCACCACTTCTACTTA-3′ (fluorescein-A2tB). Theanti-EGFR aptamer J18 was extended at its 3′ end with either5′-UUGUGUUGGUCCUAAAUGCAAAUG-3′ (Aptamer J18.A′) orwith5′-UAAGUAGAAGUGGUGAUGAUCGGU-3′(AptamerJ18.B′).Some 10 nM extended J18 aptamers were hybridized with anequal amount of the fluorescein-labeled template. Nucleic acidswere heated to 70 °C for 3 min in binding buffer, and cooledto 25 °C at 1 °C/s.

For SA-mediated multimer assembly, Aptamer J18 wasextended at its 3′ end with 5′-GAAUUAAAUGCCCGCCAUGAC-CAG. This aptamer could then bind to a biotinylated, fluorescein-labeled capture oligonucleotide. Following annealing, theduplex was incubated with different concentrations of SA (from1 nM to 20 nM) at 25 °C for 10 min.

The RNA complexes were applied to A431 cells and bindingwas analyzed by flow cytometry with the FL1-H detector (forfluorescein).

Confocal Microscopy. Twenty-four hours before labeling,U251 cells were seeded into 8-chamber slides in RPMI 1640with 10% FBS. Aptamer samples were prepared in the samemanner as for flow cytometry. Cells were washed 3 times with100 µL of binding buffer and then incubated with each aptamerin 100 µL of binding buffer at 37 °C for 30 min. After binding,the cells were washed 3 times with 100 µL of binding buffer,and then stored in 100 µL of binding buffer during imaging.Images were collected with a Leica TCS SP2 AOBS confocalmicroscope (Leica Microsystems, Mannheim, Germany) with63× oil immersion optics. The laser line at 543 nm (forexcitation of PE) was provided by a HeNe laser.

Western Blot Analysis of PTK7 Expression. One million eachof CCRF-CEM, Ramos, HL60, A4573, MDA-MB-435, and KG1cells were used for Western blot analysis. Adherent cells weretrypsinized before counting. Trypsinized cells were washed 3times with ice-cold DPBS and then lysed with 40 µL of RIPAbuffer (Pierce, Rockford, IL) on ice for 10 min. After spinningthe lysate at 16 060g for 5 min, the clarified supernatant wasremoved and incubated with 4× loading dye (240 mM Tris-HCl pH 6.8, 20% 2-mercaptoethanol, 8% SDS, 40% glycerol, and0.2% bromophenol) at 70 °C for 10 min. Sixteen microliters ofeach sample was loaded onto a 4-12% NuPAGE Bis-Tris gel(Invitrogen) along with a Benchmark prestained protein ladder(Invitrogen). After running at 200 V for 1 h, the protein wastransferred to a nitrocellulose membrane (Invitrogen) for 1 hat 30 V. The nitrocellulose membrane was rinsed 3 times withPBST (PBS with 0.02% Tween 20 (Sigma Aldrich)), blocked with5% milk for 30 min at 25 °C, and incubated with anti-PTK7-PEantibody diluted 1:100 in 5% milk for 1 h at 25 °C. The blotwas then washed 3 times with PBST (5 min each time),incubated with antimouse IgG (H+L), alkaline phosphataseconjugate (Promega, Madison, WI), diluted 1:3000 in 5% milkfor 1 h, washed 3 times with PBST (5 min each time), and thenrinsed with water twice. The color was developed by addingWestern Blue Stabilized Substrate for alkaline phosphatase(Promega).

Results

Optimization of Aptamer-Mediated Flow CytometryAssay. A variety of methods have been developed for labelingaptamers for the flow cytometry assay, and different labels have

Table 2. Cell Lines Used in This Study

cell linegrowth

properties disease

Ramos Suspension Burkitt’s lymphomaMDA-MB-435 Adherent Breast ductal carcinomaLNCaP Adherent Prostate carcinomaHL60 Suspension Acute promyelocytic leukemiaMCF7 Adherent Breast adenocarcinomaA4573 Adherent Ewing’s sarcomaCCRF-CEM Suspension Acute lymphoblastic leukemia (ALL)KG1 Suspension Acute myelogenous leukemia (AML)K562 Suspension Chronic myelogenous leukemia (CML)HeLa Adherent Cervix adenocarcinomaU251 Adherent GlioblastomaA431 Adherent Epidermoid carcinomaPC3 Adherent Prostate adenocarcinomaA549 Adherent Lung carcinoma

research articles Li et al.

2440 Journal of Proteome Research • Vol. 8, No. 5, 2009

previously been successfully used.6,10-13 To compare thesemethods, we utilized an RNA aptamer selected against EGFR,and an epidermoid carcinoma cell line (A431) known tooverexpress EGFR on its surface. Aptamers were extended attheir 3′ ends with a 24 nt sequence so that an identicalbiotinylated, antisense capture oligonucleotide could be usedto label all aptamers. Another advantage of this method forthese studies is that both RNA and DNA aptamers could belabeled in the same way and thus directly compared.

While we previously found that the constant regions ofaptamers do not greatly contribute to aptamer secondarystructure,14 it was possible that on an individual basis the 3′extensions would impede folding. To determine whether theadded sequence would interfere with aptamer structure andbinding, the secondary structures of the aptamers were pre-dicted in both the presence and absence of the 3′ extensionusing the program MFOLD.15 The extension does not appearto interfere with the folding of some aptamers, such as the anti-CEM/PTK7 aptamer, but may interfere with others, such as theanti-PSMA aptamer, and the anti-HER3 and anti-EGFR aptam-ers (Figure 1). This raised the interesting question of whetherthe capture oligonucleotide could “rescue” the aptamer andpromote binding functionality. In all cases except for the anti-MUC1 aptamer, the aptamer:capture oligonucleotide com-plexes were found to bind to their cognate cells, indicating thatthis method is generally useful for labeling aptamers.

Next, the hybridized, biotinylated aptamers were fluores-cently labeled by incubation with SA-PE (Figure 2A, bottom).This routinely gave much stronger signals than annealing theextended aptamer with a fluorescein-labeled capture oligo-nucleotide (Figure 2A, middle) or directly labeling aptamersvia transcription initiation with fluorescein-AMP (Figure 2A,top). Cells labeled with fluorescein-labeled RNA (Figure 2B, topand middle) and with PE (Figure 2B, bottom) were analyzedby flow cytometry. Different detectors were used to optimize

responsivity with the two different reporters. The signal im-provement for anti-EGFR aptamer labeling of A431 cells relativeto a negative control (unselected pool RNA) was calculatedusing Equation 1 for each of the labeling methods:

Direct labeling of Aptamer J18 with fluorescein-AMP gave a16-fold signal increase relative to unselected pool RNA. Labelingvia capture oligonucleotide hybridization proved somewhatmore effective. Labeling with the fluorescein-labeled captureoligonucleotide yielded a 50-fold signal increase, while hybrid-izing the extended anti-EGFR aptamer with the biotinylatedcapture oligonucleotide and then conjugating to SA-PE yieldeda 400-fold increase. Thus, the signal due to PE-labelingincreased 8- and 25-fold compared with fluorescein-labelingby hybridization and transcription, respectively. This extraor-dinary increase was likely due to the increased fluorescenceyield of PE relative to fluorescein, and potentially to themultivalent display of the aptamer on SA.

To assess the latter possibility, we have attempted to observeimprovements in binding due to valency for both the anti-PSMA (not shown) and anti-EGFR aptamers and have foundnone. In the case of the anti-EGFR aptamer, we first determineda suitable Aptamer J18 concentration for A431 cell labeling, aconcentration that gave a substantial signal but was notsaturating. Different ratios of Aptamer J18 and SA were mixedto form complexes with different valencies and then appliedto A431 cells. No difference in binding was observed (Figure3A). We also assembled two J18 aptamers onto a fluorescein-

Figure 1. Impact of extensions on secondary structure. To determine whether the extension sequences interfered with the formationof aptamer structures, the predicted secondary structures of aptamers were determined using the MFOLD algorithm with and withoutthe pink highlighted extension sequence (but in the absence of an antisense oligonucleotide). (A) Structures of the anti-PSMA aptamer.(B) Structures of the anti-CEM/PTK7 aptamer.

Fold signal increase )fluorescene of aptamer labeled cells - cell auto fluorescence

fluorescence of pool labeled cells - cell auto fluorescence(1)



labeled DNA template. Again, the Aptamer J18 monomer anddimer constructs yielded similar signals for binding to A431(Figure 4B).

Typing Cells with Aptamers and Flow Cytometry. Labelingvia the biotinylated capture oligonucleotide and SA-PE wasclearly the superior method for cell typing, and had the greatbenefit of being equally useful for DNA, RNA, and modifiedRNA aptamers. We therefore attempted to determine whetherthis method could in fact be generalized by adapting it tothe flow cytometry analysis of seven different anticell aptam-ers with multiple cell lines. The seven aptamers chosen forthese experiments were those for which: (a) sequence datawas available; (b) some evidence existed that they specificallybound a cell surface protein or a cell; and (c) flow cytometry,microscopy, or radiolabeling data confirmed binding to cells.

The 2′-fluoropyrimidine-modified anti-PSMA aptamers A9and A10 were among the first aptamers to be isolated against

a known tumor marker.16 These aptamers have been shownto specifically bind to PSMA-expressing LNCaP cells but not

Figure 2. Fluorescent labeling of aptamers. (A) Different methods for labeling. (Top) Transcription with fluorescein-AMP as an initiator.Middle: hybridization to a fluorescein-labeled capture oligonucleotide. (Bottom) Hybridization to a biotinylated capture oligonucleotidefollowed by incubation with SA-PE. (B) Flow cytometry scans of labeled anti-EGFR aptamers bound to A431 cells. (Top and middle)Fluorescein-labeled samples (analyzed with the FL1-H detector). (Bottom) Phycoerythrin-labeled samples (analyzed with the FL2-Hdetector). The lines filled with blue are unlabeled cells. Green lines represent the cell population labeled by the fluorescently labeledunselected N62 pool RNA, and pink lines represent cells labeled by the fluorescently labeled anti-EGFR aptamer.

Figure 3. Aptamers binding to HeLa cells by flow cytometry. HeLacells were trypsinized and then incubated with anti-TNC aptamer,anti-MUC1 aptamer, anti-PSMA aptamer, anti-HER3 aptamer,anti-Ramos aptamer, anti-CEM/PTK7 aptamer, anti-EGFR aptam-er, and anti-PTK7 antibody (all PE-labeled) for 30 min at 25 °C.



PSMA-deficient PC3 cells. Both aptamers have also been usedfor cell-specific siRNA delivery.17-19 A DNA aptamer for anepithelial tumor marker, MUC1 (mucin 1), was isolated usingpurified protein, and has been reported to bind to the surfaceof MCF7 cells.20 TNC is a protein located primarily on theextracellular matrix that may play a role in tumor growth andtissue remodeling, and a modified RNA aptamer was isolatedagainst both purified TNC and TNC-expressing U251 glioblas-toma cells.21 EGFR and HER3 are members of a receptortyrosine kinase family. Overexpression or overactivity of thesetwo proteins has been reported in numerous cancers. RNAaptamers against EGFR and HER3 have been isolated usingpurified protein and have shown binding to the surface of A431and MCF7 cells respectively (anti-EGFR aptamer data unpub-lished).22 Finally, whole cell aptamer selections have been usedto obtain aptamers that bind selectively to the cell surface, butwithout foreknowledge of precisely which surface antigen isbeing selected against or bound. Aptamers have been isolatedagainst Ramos and CCRF-CEM cells. The cell surface proteinsthe selected aptamers bound were subsequently identified asIGHM (Immunoglobin Heavy Mu Chain) for Ramos cells andPTK7 for CCRF-CEM cells.13,23

The fourteen cell lines chosen for these experiments includedcell lines where aptamer binding had previously been shownand additional lines for which binding might be expected (i.e.,an antigen was present), and lines for which binding might not

be expected (i.e., the antigen was absent). While we arerecapitulating some known results as a positive control for ourmethods (e.g., binding of anti-CEM/PTK7 aptamers to CCRF-CEM cells), this study represents the first attempt to compre-hensively determine whether aptamers can be used for celltyping and biomarker identification, and the only attemptwhere results with otherwise disparate aptamers can be directlycompared with one another.

All 14 cell lines were labeled with all 7 aptamers and theresults evaluated by flow cytometry. A PE-labeled anti-PTK7antibody was also used as a positive control for the anti-CEM/PTK7 aptamer. Representative results are shown with the HeLacell line in Figure 3. The anti-EGFR aptamer bound as expected,given that HeLa cells are known to express this biomarker.24

Somewhat unexpectedly, both the anti-CEM/PTK7 aptamer,which had been touted as specific for leukemia lines, and theantibody to PTK7 bound to this cervical cancer line. All of theother aptamers tested did not show noticeable binding overbackground (SA-PE with the biotinylated capture oligonucle-otide alone).

Similar experiments were carried out against the other celllines, and the combined results are presented in Figure 5. Wehave taken the quantitative flow cytometry data, and repre-sented it in a false color or “heat map” profile. The quantitationfor this profile was based on the normalized logarithmic valueof the geometric mean of the FL2-H signal. The heat map can

Figure 4. Valency and binding. (A) Organization via SA. (Top) Anti-EGFR aptamer J18 was hybridized to an oligonucleotide that containedboth fluorescein and biotin (left), and the complex was further conjugated to SA, leading to a number of different stoichiometries andpossible configurations. (Bottom) Binding of Aptamer J18:SA conjugates to A431 cells, as analyzed by flow cytometry. Ten nanomolaraptamer was used with varying amounts (0-20 nM) of SA. (B) Organization by a DNA template. (Top) Aptamer J18 was extended withtwo different sequences (A′ and B′) hybridized to a fluorescein-labeled, organizing DNA template that contains the complementarysequences (A and B). (Bottom) Binding of Aptamer J18:DNA template conjugates to A431 cells, as analyzed by flow cytometry. Tennanomolar labeled template was hybridized to either 10 nM A′ extension, or 10 nM B′ extension, or both.



be used to visually ascertain how a set of aptamers can be usedto type different cell lines.

The different cell lines were clustered in the heat map bycalculating the Pearson distances among the labeling profilesfor different cell lines. Although the clustering here does notimpart information beyond what is visually obvious, suchanalyses may prove to be especially useful as the number ofaptamers against cell surfaces increases, just as statisticalanalyses of large microarray data sets have proven to bevaluable in identifying functionally important features in geneexpression experiments. That said, the small number of aptam-ers available for the current study did not lead to an obviousclustering of similar tissues or tumors, a finding similar to thatpreviously observed with antibodies against tumor biomarkers,and one which again emphasizes the molecular heterogeneityand clonal evolution of cancers.25,26

Confirming Flow Cytometry Data with Confocal Micro-scopy. There were two aptamers that did not bind as expectedto cell lines overexpressing their corresponding protein targets.One was the anti-MUC1 aptamer to MCF7 cells and the otherwas the anti-TNC aptamer to U251 cells. Under our assayconditions, we did not observe binding of the anti-MUC1aptamer to adherent MCF7 cells (data not shown). However,because TNC is an extracellular matrix glycoprotein, wehypothesized that it might become disconnected from the cellsurface of U251 cells during trypsinization and would beremoved during wash steps. To test this hypothesis, weattempted to use the anti-TNC aptamer to label adherent cells,and visualized the results via confocal microscopy (Figure 6).The fluorescent images are shown on the left with correspond-ing optical images on the right. The pattern of aptamer bindingto U251 cells is consistent with the flow cytometry data, withthe anti-EGFR aptamer, anti-CEM/PTK7 aptamer, and anti-

PTK7 antibody showing significant binding. Although the anti-TNC aptamer did not bind to U251 cells by flow cytometry, itshowed very strong binding to U251 cells by microscopy.

Western Blot Analysis of PTK7. The anti-CEM/PTK7 aptam-er was originally reported to bind specifically to leukemia celllines.6,27,28 However, we found that it bound to a wide rangeof cell lines, as did the corresponding anti-PTK7 antibody,including numerous cell lines that were not of hematopoieticorigin (i.e., A431, U251, HeLa, and A4573 cells, see also Table2). Since the presence or absence of PTK7 on cells was notwholly obvious in the literature and information about whatcell lines express PTK7 was limited, we performed Western blotanalyses with the anti-PTK7 antibody to rectify the reportedspecificity of the aptamer with our own results. Lysates wereprepared from one million cells from each of 6 chosen cell lines.The CCRF-CEM cell line was of course used as it was the targetfor the original selection of the anti-CEM/PTK7 aptamer.Ramos cells were used as a known negative selection control.A4573 and KG1 cells were representative of adherent andsuspension cell lines, respectively, that showed strong bindingby flow cytometry to both the anti-PTK7 antibody and aptamer.The MDA-MB-435 and HL60 cell lines were representative ofadherent and suspension cell lines that showed greatly reducedbinding by flow cytometry. Anti-PTK7 antibody from mouseand alkaline phosphatase-conjugated mouse IgG were used asthe primary and secondary antibodies for Western blot analyses.

As shown in Figure 7, a distinct band of the expected size of118 kDa was readily detected in the lanes containing CCRF-CEM, A4573, and KG1 cell lysates, consistent with the flowcytometry data. The band was not observed in the negativecontrol, Ramos cells. Likewise, in the lanes containing MDA-MB-435 and HL60 cell lysates, a band was not clearly observedabove background. Taken together, these results suggest that

Figure 5. Cell typing by aptamers. Seven cell surface binding aptamers, one antibody, and 14 cell lines were used to determine distinctbinding patterns, which are shown in a false-colored matrix. Cell typing experiments for each cell line were repeated 2 to 4 times, andthe average ratio of aptamer binding to background binding for each cell type is shown here. The identities of the cell lines are shownin the column on the right and the identities of the aptamers are shown along the bottom. The color scale correlates color with theratio of mean fluorescence signal obtained from cells treated with a given aptamer hybridized to a capture oligonucleotide:PE conjugateto that obtained from cells treated with the capture oligonucleotide:PE conjugate alone.



small amounts of protein targets cannot be reliably detectedrelative to background binding by aptamer conjugates with flowcytometry, and only strong, positive signals should be used fordiagnostic applications. Based on a comparison of the flowcytometry and Western blot data, it would seem reasonable tosuggest that a signal five- to 10-fold above background binding(see Figure 5 above) gives greater surety that a given biomarkeris actually present on the surfaces of cells.

Discussion

The use of aptamers as reagents in flow cytometry wasintroduced more than 10 years ago.12 Since then, differentstrategies have been developed to label aptamers with fluoro-phores for flow cytometry analysis. DNA aptamers targetingmammalian or bacteria cells were labeled with fluorescein,Alexa 488, and Alexa 647 either through PCR amplification withprimers modified with fluorescent labels.6,10,11,29 or by directchemical synthesis.12,13 Due to the difficulties inherent in thechemical synthesis of RNA, 5′ end modifications of RNAaptamers are often achieved by initiating RNA transcriptionwith guanosine or adenosine derivatives.8,9 For instance, tolabel LNCaP cells, transcription of an anti-PSMA aptamer wasinitiated with fluorescein-labeled guanosine.18 While it iscommon practice to label nucleic acids with fluorescein, wehave found that labeling aptamers with this single organicfluorophore yielded very weak signals. Phycoerythrin is one ofthe brightest dyes, and has been used to label both antibodiesand aptamers for flow cytometry analysis.30 However, thesevarious methods obviously lead to different labels beingincorporated at different positions to different extents. Thismakes it difficult to directly compare the performance of oneaptamer with another. Therefore, in the current study wedeveloped a generic and simple method to label both RNA andDNA aptamers with PE. This method could also be adapted to

Figure 6. Imaging aptamer binding to U251 cells by confocal microscopy. Phycoerythrin-labeled aptamers and the anti-PTK7 antibody(PTK7 Ab) were incubated with U251 cells in an 8-chamber slide for 30 min at 37 °C and 5% CO2 and were imaged by confocal microscopy.Fluorescent images are on the left and optical images are on the right. (A) Anti-TNC aptamer. (B) Anti-MUC1 aptamer. (C) Anti-PSMAaptamer. (D) Anti-HER3 aptamer. (E) Anti-Ramos aptamer. (F) Anti-CEM/PTK7 aptamer. (G) Anti-EGFR aptamer. (H) Anti-PTK7 Ab. Scalebar, 20 µm.

Figure 7. Western blot analysis of PTK7. Proteins were extractedfrom various cell lines, separated on a gel, and detected withthe anti-PTK7 antibody. The arrow denotes the expected size ofPTK7.



label the same aptamers with other oligonucleotide-conjugatedfluorophores, such as SA-conjugated Alexa dyes, and thus canbe used to quickly compare labels and approaches. Forcommercial or other high-throughput applications it may beuseful to simply synthesize a minimized aptamer with apendant biotin. By contrast, our method remains a powerfultool for initial screening of aptamers for identification of speciesthat might further be optimized for use in high-throughputdiagnostic applications.

Overall these results (including negative results) emphasizeseveral features relevant to the use of aptamers as reagents forimmunohistochemical procedures: first, aptamers that functionwell in one assay do not always function in the same way whenadapted to new analytical methods. This is of course also truefor antibodies, especially different antibody preparations ormixtures. That said, since aptamers can be readily obtained asdefined chemical entities (sequences), they should show goodbatch-to-batch reproducibility, while antibodies produced byimmunization may not.

Second, aptamers may not always be adaptable to newmethods or applications, because the conditions under whichan aptamer was selected are not always chosen with itseventual use or purpose in mind. The original selectionconditions (buffer, ions) should be matched in subsequentbinding studies. The context of the cognate protein marker mayalso be important. If an isolated protein was used for selection,there is no guarantee that the aptamer will still recognize thatprotein in the context of the cell surface, or in the context of agiven sample preparation regime.

Third, binding to the cell surface may be more readilyobserved by some techniques than others. For example, whileTNC is not found on trypsinized cells and is not seen by flowcytometry, it is found in the matrix surrounding cells and canbe seen by microscopy using nontrypsinized cells. Similarly,the anti-HER3 aptamer is reported to bind to MCF7 cells usingradiolabeling techniques, but binding could not be observedhere by flow cytometry.22,31

Fourth, aptamers (like most other reagents) can bind non-specifically to cells. There were a number of small but repro-ducible flow cytometry signals from different cell lines that maynot be indicative of specific binding, and therefore should likelybe disregarded in the development of typing and diagnosticassays. For example, both the anti-TNC aptamer and anti-PSMAaptamers showed low but significant binding to MDA-MB-435cells, even though it is unlikely that either protein is found onthis line. In general, we found 2′-fluoropyrimidine-modifiedRNA gave higher background labeling than did unmodifiedRNA or DNA. The significant background binding exhibited byaptamers may also account for the apparent selection of ananti-MUC1 aptamer that does not appear to bind specificallyto its target cell line. Studies of the anti-MUC1 aptamer do notgenerally show data comparing binding to other cell lines, andso the positive signals that have previously been observed maybe nonspecific background binding.20 In addition, the anti-MUC1 antibodies cannot compete with the anti-MUC1 aptamerfor binding to cells, which could indicate that they are bindingseparate targets. Nonspecific binding might be exacerbated bythe fluorophores used to observe binding, but this problem canpotentially be solved by removing dead cells during FACS-basedselections.32

On the basis of these observations, it seems reasonable torequire that cell surface binding experiments always includeat least two negative controls: first, a nonbinding sequence

(such as a scrambled aptamer) or pool should be used as acontrol for nonspecific binding; and second, some cell line thatis not expected to bind a given aptamer should be shown tobe incapable of binding that aptamer. These are relativelystraightforward negative controls, but are frequently not in-cluded in aptamer studies. Moreover, because of issues withnonspecific binding it is important to quantitate bindingrelative to a negative control, rather than describe qualitativeinteractions generalized “positive” or “negative”.

With these caveats in mind, general features are still evidentfrom the combined and clustered aptamer-binding data (seeFigure 5). For example, some aptamers (i.e., anti-Ramos, anti-PSMA, and anti-HER3) label only one or a few cell types, whileother aptamers (i.e., anti-EGFR, and anti-CEM/PTK7) label anumber of different cell lines. While there are often overlappingrecognition patterns (compare HeLa and U251 cells), relativelabeling can define cell lines. For example, A431 and MDA-MB-435 cells could be distinguished from other cells based notonly on strong binding of one aptamer (anti-EGFR and anti-HER3, respectively), but also by ancillary binding (specific ornonspecific) of other aptamers. This supports the notion thatgroups of aptamers may eventually prove useful for typing cellsor tumors.

Beyond technical issues, there is also the question of whethercell surface selection techniques (Cell SELEX) will prove usefulin discovering new biomarkers that may be useful for typingcells. The ultimate utility of Cell SELEX will depend in part uponhow many different targets can be identified, and whether thosetargets are truly diagnostic of cell type or state. For example,while prostate-specific membrane antigen is found on thesurfaces of prostate tumors, it is also found on neovasculaturethroughout the body.33 Similarly, the aptamer initially selectedagainst CCRF-CEM cells was suggested to be quite specific forthese cells.6 When the target of this aptamer was identified asPTK7, this was assumed to be a biomarker for some leuke-mias.28 Our comparative studies can potentially provide in-sights into this hypothesis, or whether there may be otherbiological alternatives. We now find that many different typesof tumor cells apparently express PTK7, as confirmed by bothaptamer and antibody labeling.

While the generic binding of the anti-CEM/PTK7 aptamerto multiple tumor cell types may reflect a wider role inoncogenesis, this finding also prompted us to determinewhether there might be another possible reason for its iden-tification during selections against tissue culture cells.34 Themajority of cell lines to which the anti-PTK7 aptamer andantibody were found to bind were adherent in their observedgrowth. Leukemia cell lines are generally described as growingin suspension, but CCRF-CEM has also been described asforming an adherent epitheloid monolayer in addition to themajority of cells in suspension (DSMZ, German Collection ofMicroorganisms and Cell Cultures, http://www.dsmz.de/human_and_animal_cell_lines/info.php?dsmz_nr)240). Wetherefore tested several of the leukemia suspension lines(CCRF-CEM, Ramos, and KG1) used in this study to see if theywould form an epitheloid monolayer. Cells were carried forseveral passages without vigorous pipetting that would disturbsuch a layer, and we found that a semiadherent layer did formwith CCRF-CEM and KG1 cells (which express PTK7), thoughnot Ramos cells (which do not express PTK7).

Since the original cell SELEX that produced the anti-CEM/PTK7 aptamer used CCRF-CEM cells in a positive selection stepfollowed by Ramos cells as a negative selection step, it is



possible that what was actually being selected against was notthe differences between the leukemias, but rather the differ-ences between the propensity for adherence. This hypothesisis supported by the fact that PTK7 has been linked to roles inplanar cell polarity during mammalian development, and bythe role of PTK7 homologues in neuronal cell adhesion.35,36

Though the full function of PTK7 is not known, it has adefective catalytic domain, and its extracellular domain hasbeen shown to have the greatest homology with members ofthe immunoglobulin superfamily whose function is oftenrelated to cell adhesion.37

An aptamer specific for adherent cell lines may have verydifferent diagnostic implications than one selected against abiomarker for a disease state. In general, it would seem oddfor primary leukemias to have adherent properties; indeed,other adherence markers, such as cadherin and CD44, arefrequently lost, silenced, or cleaved from the cell surface insome leukemias.38-42 In particular, soluble PTK7 has beenshown to inhibit the activation of focal adhesion kinase, abiomarker for the aggression of acute myeloid leukemia (AML),and to decrease cell motility.43,44 That said, it is unclear whetherthe soluble PTK7 is acting in a manner that is similar to orantagonistic to cell surface PTK7. Other studies have shownthat adherence factors can be expressed in chronic myelog-enous leukemias (CML), but the one CML line that we assayed(K562) showed no obvious expression of PTK7.45 Overall,aptamers selected against leukemia cell lines that show thepropensity to become adherent may not be as useful foridentifying biomarkers and distinguishing leukemia patientsamples as aptamers selected against primary leukemia cells.24

At the least, binding to the purported biomarker in patientsamples should be carefully validated with quantitative datathat supports qualitative assessments and further followed upwith antibody studies.

The complexity and diversity of the cell surface proteomepresents a considerable analytical challenge for cell-typeidentification, yet at the same time that very complexityprovides an opportunity to use multiplex detection and patternrecognition for cell typing. By establishing a standard fluorescent-labeling and flow cytometry method, and by providing quan-titative and interpretive bounds for understanding when andhow to apply these assays, we have advanced the potentialutility of aptamers as cell typing reagents. Understanding andcontrolling for the role of background and nonspecific bindingto cells opens the way to using arrays of aptamers for describingand quantifying the cell surface proteome.

Acknowledgment. Funding was provided by theWelch Foundation (F1654) and the Center for CancerNanotechnology Excellence (17666630-33956-A).

References(1) Kulasingam, V.; Diamandis, E. P. Tissue culture-based breast

cancer biomarker discovery platform. Int. J. Cancer 2008, 123 (9),2007–12.

(2) Simpson, R. J.; Bernhard, O. K.; Greening, D. W.; Moritz, R. L.Proteomics-driven cancer biomarker discovery: looking to thefuture. Curr. Opin. Chem. Biol. 2008, 12 (1), 72–7.

(3) Wingren, C.; Borrebaeck, C. A. Antibody microarrays: current statusand key technological advances. Omics 2006, 10 (3), 411–27.

(4) Borrebaeck, C. A.; Wingren, C. High-throughput proteomics usingantibody microarrays: an update. Expert. Rev. Mol. Diagn. 2007,7 (5), 673–86.

(5) Chu, T.; Ebright, J.; Ellington, A. D. Using aptamers to identify andenter cells. Curr. Opin. Mol. Ther. 2007, 9 (2), 137–44.

(6) Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z. C.; Chen, H. W.; Mal-likaratchy, P.; Sefah, K.; Yang, C. J.; Tan, W. Aptamers evolved from

live cells as effective molecular probes for cancer study. Proc. Natl.Acad. Sci. U.S.A. 2006, 103 (32), 11838–43.

(7) Syrett, H. A.; Collet, J. R.; Ellington, A. D. Aptamer Microarrays. InFunctional Nucleic Acids for Analytical Applications; Lu, Y., Li, Y.,Eds.; Integrated Analytical Systems; Springer: New York, 2009.

(8) Huang, F.; Wang, G.; Coleman, T.; Li, N. Synthesis of adenosinederivatives as transcription initiators and preparation of 5′ fluo-rescein- and biotin-labeled RNA through one-step in vitro tran-scription. Rna 2003, 9 (12), 1562–70.

(9) Li, N.; Yu, C.; Huang, F. Novel cyanine-AMP conjugates for efficient5′ RNA fluorescent labeling by one-step transcription and replace-ment of [gamma-32P]ATP in RNA structural investigation. NucleicAcids Res. 2005, 33 (4), e37.

(10) Hamula, C. L.; Zhang, H.; Guan le, L.; Li, X. F.; Le, X. C. Selectionof aptamers against live bacterial cells. Anal. Chem. 2008, 80 (20),7812–9.

(11) Berezovski, M. V.; Lechmann, M.; Musheev, M. U.; Mak, T. W.;Krylov, S. N. Aptamer-facilitated biomarker discovery (AptaBiD).J. Am. Chem. Soc. 2008, 130 (28), 9137–43.

(12) Davis, K. A.; Abrams, B.; Lin, Y.; Jayasena, S. D. Use of a high affinityDNA ligand in flow cytometry. Nucleic Acids Res. 1996, 24 (4), 702–6.

(13) Xiao, Z.; Shangguan, D.; Cao, Z.; Fang, X.; Tan, W. Cell-specificinternalization study of an aptamer from whole cell selection.Chemistry 2008, 14 (6), 1769–75.

(14) Cowperthwaite, M. C.; Ellington, A. D. Bioinformatic analysis ofthe contribution of primer sequences to aptamer structures. J. Mol.Evol. 2008, 67 (1), 95–102.

(15) Zuker, M. Mfold web server for nucleic acid folding and hybridiza-tion prediction. Nucleic Acids Res. 2003, 31 (13), 3406–15.

(16) Lupold, S. E.; Hicke, B. J.; Lin, Y.; Coffey, D. S. Identification andcharacterization of nuclease-stabilized RNA molecules that bindhuman prostate cancer cells via the prostate-specific membraneantigen. Cancer Res. 2002, 62 (14), 4029–33.

(17) Chu, T. C.; Twu, K. Y.; Ellington, A. D.; Levy, M. Aptamer mediatedsiRNA delivery. Nucleic Acids Res. 2006, 34 (10), e73.

(18) McNamara, J. O., 2nd.; Andrechek, E. R.; Wang, Y.; Viles, K. D.;Rempel, R. E.; Gilboa, E.; Sullenger, B. A.; Giangrande, P. H. Celltype-specific delivery of siRNAs with aptamer-siRNA chimeras.Nat. Biotechnol. 2006, 24 (8), 1005–15.

(19) Wullner, U.; Neef, I.; Eller, A.; Kleines, M.; Tur, M. K.; Barth, S.Cell-specific induction of apoptosis by rationally designed bivalentaptamer-siRNA transcripts silencing eukaryotic elongation factor2. Curr. Cancer. Drug. Targets 2008, 8 (7), 554–65.

(20) Ferreira, C. S.; Matthews, C. S.; Missailidis, S. DNA aptamers thatbind to MUC1 tumour marker: design and characterization ofMUC1-binding single-stranded DNA aptamers. Tumour Biol. 2006,27 (6), 289–301.

(21) Hicke, B. J.; Marion, C.; Chang, Y. F.; Gould, T.; Lynott, C. K.; Parma,D.; Schmidt, P. G.; Warren, S. Tenascin-C aptamers are generatedusing tumor cells and purified protein. J. Biol. Chem. 2001, 276(52), 48644–54.

(22) Chen, C. H.; Chernis, G. A.; Hoang, V. Q.; Landgraf, R. Inhibitionof heregulin signaling by an aptamer that preferentially binds tothe oligomeric form of human epidermal growth factor receptor-3. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (16), 9226–31.

(23) Mallikaratchy, P.; Tang, Z.; Kwame, S.; Meng, L.; Shangguan, D.;Tan, W. Aptamer directly evolved from live cells recognizesmembrane bound immunoglobin heavy mu chain in Burkitt’slymphoma cells. Mol. Cell. Proteomics 2007, 6 (12), 2230–8.

(24) Berkers, J. A.; van Bergen en Henegouwen, P. M.; Boonstra, J. Threeclasses of epidermal growth factor receptors on HeLa cells. J. Biol.Chem. 1991, 266 (2), 922–7.

(25) Chang, H.; Benchimol, S.; Minden, M. D.; Messner, H. A. Alter-ations of p53 and c-myc in the clonal evolution of malignantlymphoma. Blood 1994, 83 (2), 452–9.

(26) Tan, D.; Deeb, G.; Wang, J.; Slocum, H. K.; Winston, J.; Wiseman,S.; Beck, A.; Sait, S.; Anderson, T.; Nwogu, C.; Ramnath, N.; Loewen,G. HER-2/neu protein expression and gene alteration in stage I-IIIAnon-small-cell lung cancer: a study of 140 cases using a combina-tion of high throughput tissue microarray, immunohistochemistry,and fluorescent in situ hybridization. Diagn. Mol. Pathol. 2003,12 (4), 201–11.

(27) Shangguan, D.; Cao, Z. C.; Li, Y.; Tan, W. Aptamers evolved fromcultured cancer cells reveal molecular differences of cancer cellsin patient samples. Clin. Chem. 2007, 53 (6), 1153–5.

(28) Shangguan, D.; Cao, Z.; Meng, L.; Mallikaratchy, P.; Sefah, K.;Wang, H.; Li, Y.; Tan, W. Cell-specific aptamer probes for mem-brane protein elucidation in cancer cells. J. Proteome Res. 2008, 7(5), 2133–9.



(29) Tang, Z.; Shangguan, D.; Wang, K.; Shi, H.; Sefah, K.; Mallikratchy,P.; Chen, H. W.; Li, Y.; Tan, W. Selection of aptamers for molecularrecognition and characterization of cancer cells. Anal. Chem. 2007,79 (13), 4900–7.

(30) Davis, K.; Lin, Y.; Abrams, B.; Jayasena, S. D. Staining of cell surfacehuman CD4 with 2′-F-pyrimidine-containing RNA aptamers forflow cytometry. Nucleic Acids Res. 1998, 26 (17), 3915–24.

(31) Park, E.; Baron, R.; Landgraf, R. Higher-order association states ofcellular ERBB3 probed with photo-cross-linkable aptamers. Bio-chemistry 2008, 47 (46), 11992–2005.

(32) Raddatz, M. L.; Dolf, A.; Endl, E.; Knolle, P.; Famulok, M.; Mayer,G. Enrichment of cell-targeting and population-specific aptamersby fluorescence-activated cell sorting. Angew. Chem., Int. Ed. 2008,47, 5190–3.

(33) Chang, S. S.; Reuter, V. E.; Heston, W. D.; Bander, N. H.; Grauer,L. S.; Gaudin, P. B. Five different anti-prostate-specific membraneantigen (PSMA) antibodies confirm PSMA expression in tumor-associated neovasculature. Cancer Res. 1999, 59 (13), 3192–8.

(34) Shin, W. S.; Maeng, Y. S.; Jung, J. W.; Min, J. K.; Kwon, Y. G.; Lee,S. T. Soluble PTK7 inhibits tube formation, migration, and invasionof endothelial cells and angiogenesis. Biochem. Biophys. Res.Commun. 2008, 371 (4), 793–8.

(35) Lu, X.; Borchers, A. G.; Jolicoeur, C.; Rayburn, H.; Baker, J. C.;Tessier-Lavigne, M. PTK7/CCK-4 is a novel regulator of planar cellpolarity in vertebrates. Nature (London) 2004, 430 (6995), 93–8.

(36) Pulido, D.; Campuzano, S.; Koda, T.; Modolell, J.; Barbacid, M. Dtrk,a drosophila gene related to the trk family of neurtrophin recep-tors, encodes a novel class of neural cell adhesion molecule. EMBOJ. 1992, 11, 391–404.

(37) Jung, J. W.; Ji, A. R.; Lee, J.; Kim, U. J.; Lee, S. T. Organization ofthe human PTK7 gene encoding a receptor protein tyrosine kinase-like molecule and alternative splicing of its mRNA. Biochim.Biophys. Acta 2002, 1579 (2-3), 153–63.

(38) Kremmidiotis, G.; Baker, E.; Crawford, J.; Eyre, H. J.; Nahmias, J.;Callen, D. F. Localization of human cadherin genes to chromo-

some regions exhibiting cancer-related loss of heterozygosity.Genomics 1998, 49 (3), 467–71.

(39) Corn, P. G.; Smith, B. D.; Ruckdeschel, E. S.; Douglas, D.; Baylin,S. B.; Herman, J. G. E-cadherin expression is silenced by 5′ CpGisland methylation in acute leukemia. Clin. Cancer Res. 2000, 6(11), 4243–8.

(40) Shimamoto, T.; Ohyashiki, J. H.; Ohyashiki, K. Methylation ofp15(INK4b) and E-cadherin genes is independently correlated withpoor prognosis in acute myeloid leukemia. Leuk. Res. 2005, 29 (6),653–9.

(41) Takubo, T.; Kanashima, H.; Terada, Y.; Aoyama, Y.; Nakamae, H.;Yamamura, R.; Shima, E.; Makita, K.; Tanaka, K.; Ohta, K.; Yamane,T.; Hino, M.; Kamitani, T.; Tatsumi, N. Clinical significance ofserum E-cadherin levels in patients with haematological malig-nancies. Haematalogia (Budap) 2002, 31 (4), 319–25.

(42) Loeffler-Ragg, J.; Steurer, M.; Ulmer, H.; Skvortsov, S.; Kircher, B.;Herold, M.; Zwierzina, H.; Stauder, R. Elevated levels of serumCD44 and E-cadherin predict an unfavourable outcome in my-elodysplastic syndromes. Leukemia 2006, 20 (11), 2064–7.

(43) Shin, W.; Maeng, Y.; Jung, J.; Min, J.; Kwon, Y.; Lee, S. Soluble PTK7inhitbits tube formation, migration and invasion of endothelialcells and angiogenesis. Biochem. Biophys. Res. Commun. 2008, 371,793–8.

(44) Ruidavets, J.; Cariven, P.; Demur, C.; Payrastre, B.; Laurent, G.;Racaud-Sultan, C. Expression of focal adhesion kinase in acutemyeloid leukemia is associated with enhanced blast migration,increased cellularity, and poor prognosis. Cancer Res. 2004, 64,3191–7.

(45) Pasternak, G.; Hochhaus, Schultheis, B.; Hehlmann, R. Chronicmyelogenous leukemia: molecular and cellular aspects. J. CancerRes. Clin. Oncol. 1998, 124, 643–60.

(46) Smith, J. E.; Medley, C. D.; Tang, Z.; Shangguan, C. L.; Tan, W.Aptamer-Conjugated Nanoparticles for the Collection and Detec-tion of Multiple Cancer Cells. Anal. Chem. 2007, 79 (8), 3075–82.

PR801048Z



Technical and Biological Issues Relevant to Cell Typing with Aptamers

Documents

Transcript of Technical and Biological Issues Relevant to Cell Typing with Aptamers