[CANCER RESEARCH 51, 5565-5569, October 15, 1991]

T-Cell Receptor \ßGene Expression Differs in Tumor-infiltrating Lymphocytes

within Primary and Metastatic MelanomaTaizo Nitta, Robert Bell, Ko Okumura, Kiyoshi Sato,1 and Lawrence Steinman

Department of Neurology and Genetics, Stanford University School of Medicine, Stanford, California 94305 [T. N., R. B., L. S.J, and Departments of Immunology andNeurosurgery, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113, Japan ¡T.N., K. O., K. S.J

ABSTRACT

Expression of T-cell receptor (TCR) gene rearrangements in tumor-infiltrating lymphocytes (TILs) within primary and metastatic melanomaspecimens was studied. In order to analyze TCR gene transcription inTILs within these tissues, we analyzed reverse transcribed complementary DNA from mRNA directly from tissues using the polymerase chainreaction. The polymerase chain reaction-amplified products were confirmed by dot or Southern blot hybridization with Ca or C0 oligoprobes.First, we investigated the diversity of TCR Va and Vßgene usage inhuman malignant melanoma patients with multiple metastasis. We foundin one patient, bearing multiple skin lesions, that the patterns of TCRV«and V/3 repertoires in different sites of the skin (leg and chest wall)were almost the same. However, in another patient with skin and brainmelanomas, different TCR repertoires were presented.

Next, we examined the usage of murine TCR Vßgenes in TILs withinthe primary and metastatic sites (liver, lung, and brain) of C57BL/6 micebearing B16-F10 murine melanoma. The population of TILs in eachprimary and metastatic site expressed from one to four TCR V'/Jgenes.

In each metastatic site, the profile of TCR V/3 gene expression wasdifferent. A different TCR \0 usage in TILs distributed within métastasesof various organs may reflect differences in tumor antigenicity at thesesites or may be due to differential homing patterns to these tumors.

and Vßgenes in TILs within two human malignant melanomapatients. Interestingly, in one patient, bearing multiple cutaneous melanomas, expression of the TCR a and ßchain geneswas almost the same within two cutaneous regions, even thoughthey are located distantly (leg and chest wall). However, theother patient, suffering from primary (skin) and brain melanomas, showed a different usage of TCR genes. An experimentalmodel for studying the organ preference of metastasis wasestablished using a murine B16 melanoma cell line to sequentially select in vivo tumor cell subpopulations for enhancedlung, brain, ovary, or liver colonization (7).

TCR Vßusage in TILs at the primary tumor site and inmetastatic sites (liver, lung, and brain) of B16-F10 murinemelanoma is investigated here with the use of RNA-based PCRmethod as described (8). In order to analyze TCR gene transcription in these TILs, we analyzed cDNA reverse transcribedfrom mRNA directly from tissues using PCR rather than expanding TILs in vitro. We asked whether TCRs are restrictedand whether T-cells at the primary tumor sites and in metastaticlesions of liver, lung, and brain express different RNA transcripts of TCR Vßgenes.

INTRODUCTION

At the time of diagnosis of malignant melanoma, metastasisto regional and distant lymph nodes, liver, lung, and the centralnervous system may have already occurred in about 50% of allcases (1). During the past several decades, many advances havebeen made in the treatment of cancers (2-4). Modern treatmentmodalities have brought us closer to the control of manyprimary cancers. However, metastatic cancer has become increasingly important, both as a clinical entity and as a focus ofimmunological research. Therefore, it is essential to improveour understanding of the biology of these primary and metastatic lesions.

Recent studies have demonstrated a restricted TCR2 V«

expression in pathological specimens from demyelinatingplaques of brains with multiple sclerosis and in TILs of humanmelanomas (5, 6). An analysis of the TCR repertoire of TILsmay help to clarify their role in tumor destruction of thispopulation of cells and increase our understanding of the cellular and molecular basis of the lymphocyte-tumor interaction,thus contributing to the improvement of protocols for adoptiveimmunotherapy.

In this experiment, we first examined the usage of TCR Va

Received 4/22/91; accepted 8/1/91.The costs of publication of this article were defrayed in part by the payment

of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1To whom requests for reprints should be addressed, at Department ofNeurosurgery, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku Tokyo 113, Japan.

2The abbreviations used are: TCR, T-cell receptor; TIL, tumor-infiltratinglymphocyte; V, variable; J, joining; D, diversity; C, constant; cDNA, complementary DNA; IL-2, interleukin 2; MLC, mixed lymphocyte culture; MHC, majorhistocompatibility complex; bp, base pair(s), PCR, polymerase chain reaction;SDS, sodium dodecyl sulfate; SSPE, saline-sodium phosphate-EDTA.

MATERIALS AND METHODS

Human Melanoma Specimens. We studied two patients with multiplemalignant melanomas. One patient (P. R.) was suffering from multiplecutaneous melanomas. Two specimens (leg and chest wall) were obtained surgically. The specimens from the other patient (H. B.), withprimary skin melanoma and secondary brain metastasis, were obtainedat autopsy. Both samples came from the Department of Surgery,University of Arizona, Tucson, AZ. A portion of the tumor removedduring the operation and stored at —¿�70°Cwas used to extract total

RNA.Tumor Models. The primary tumor model was made by inoculating

5 x IO5B16-F10 murine melanoma cells into the back s.c. region of 8-week-old C57BL/6 mice (Jackson Laboratories, Alameda, CA). About10 days later, a tumor over 2x2x2 cm3 was obtained. The experimentalmetastasis model was done by intracardiac inoculation of 5 x IO4cells

according to published procedure (9). Two weeks later, multiple metastatic deposits could be found in liver, lung, and brain. They weresubjected to RNA extraction. In order to address the question whetherthere is any discrepancy of mRNA transcripts between the "native"TCR repertoire within tumor and in vitro activated TILs (bulk-TIL),we isolated TILs according to established procedures (10, 11). TILsderived from primary B16-F10 melanoma tumor mass were grown inthe presence of 100 units/ml recombinant IL-2 (Cetus, Emeryville, CA)for 4 days.

In Vitro Cytotoxicity Assay. Cytotoxicity of in vitro cultured TILswas examined against autologous melanoma cells (B16-F10) using astandard 5lCr release assay as described ( 10). Values represent the mean

of triplicate determinations. SD was less than 5%.Preparation of RNA and cDNA Synthesis. Total RNA from tumor

specimens and TILs was prepared in the presence of guanidiniumthiocyanate using RNA zol (Cinna/Biotex, Houston, TX) (12), and 0.1Mgof total RNA was used for the synthesis of single-stranded cDNAusing reverse transcriptase. Briefly, in a final volume of 20 ml 1x PCRbuffer (50 mivi KC1-20 mM Tris-Cl, pH 8.4-2.5 mM MgCl2), 1 mvi ofdeoxyribonucleotide triphosphates (Perkin-Elmer, Norwalk, CT), 20

5565

RETRACTED

July

1,19

92

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

ORGAN-SPECIFIC TCR V«GENE EXPRESSION WITHIN MELANOMA TILs

units of RNAsin (BRL, Bethesda, MD), 100 pmol of random hexamer(Pharmacia, Piscataway, NJ), and 200 units of BRL Moloney murineleukemia virus reverse transcriptase (BRL) were incubated with RNA(2 Mg)for 40 min at 42°C.The reaction mixture was heated at 95°Cfor

5 min and then quickly chilled on ice (6, 8, 13).Amplification of cDNA by PCR. First, single-stranded cDNA from

human malignant melanoma samples was amplified using a Va-specificprimer with a human Ca primer or V/3 with C/3 primers at a finalconcentration of 1 >/Min each reaction. Sequences of the individualprimers were described in previous reports (5, 6). The size of amplifiedproducts ranged from about 250 to 450 bp. Oligonucleotides weresynthesized and column purified by Operon Technologies, Inc. (Alameda, CA). cDNA was also amplified with primers for human actinprimers (L-actin, S'-ACG AAG ACG GAC CAC CGC CCT CG-3';R-actin, 5'-CCCAC GTT GTG GOT GAC GCC GTC-3'). The ampli

fication was performed with 2.5 units of Taq polymerase (Ampli Taq;Perkin-Elmer, Cetus) on a DNA thermal cycler (Perkin-Elmer, Cetus)(13, 14). The PCR cycle profile was denaturation at 95°Cfor 1 min,annealing of primers at 55°Cfor 1 min, and extension of primers at72°Cfor 1 min for 35 cycles. PCR products were separated on 3%

Nusieve (FMC Corp.)-l% regular agarose gels. Expression of Va orVßgenes was considered positive when a rearranged band (300-450bp) was visualized with ethidium bromide staining and when the amplified product was positively hybridized with Ca- or C0-specific oli-gonucleotide probes on Southern blots. The size of amplified productsusing actin was 200 bp. Experiments were repeated twice per sample.Results were identical with a different aliquot of each sample.

Next, as in human primers, we synthesized 22 different V/3-specificoligonucleotides as 5'-sense primers and C/3-specific Oligonucleotidesas 3'-antisense primer (Table 1). The size of amplified products withV/3and 3'-C/3 primers ranged from 360 to 420 bp; however, Vß10, Vß

12, and Vß13 are shorter and are 290, 190, and 260 bp, respectively.Each cDNA sample was amplified using a V/3-specific primer with aC/3primer at a final concentration of 1 mM in each reaction. They werealso amplified with murine actin primers as a positive control (L-actin,5 ' -CAT CGT GGG CCG CTC TAG CCA A-3 ' ; R-actin, 5 ' -CCG GCCAGC CAA GTC CAG ACG C-3'). The procedure of amplification was

the same as in human samples. However, we were not able to obtainnonradioactive murine TCR Cßprobe; thus, we adopted the dot blothybridization method. Experiments were repeated three times usingsyngeneic murine models. We have detected V/3-C/3rearrangements of

all TCR Vßgene members in cDNA from allogenic MLC.Southern Blot Analysis. Two //I of Va-Ca and V/3-C/3 amplified

products were electrophoresed in a 2% agarose gel for l h and transferred onto nitrocellulose paper (12). Filters were prehybridized at 42°Cin 5x SSPE-5X Denhardt's solution-salmon sperm DNA (100 ¿ig/ml)-0.1% SDS and hybridized for l h at 42°Cwith a horseradish peroxidase-labeled Ca or C/3 oligonucleotide probe (Ca, 5'-CAG AAC CCT GACCCT GCC GTG TAC-3'; C/3, 5'-AGC GAC CTC GGT TGG GAACAC-3'). The filters were washed in Ix SSPE-0.1% SDS at room

temperature for 15 min and then in O.lx SSPE-0.1% SDS at roomtemperature for 15 min, and finally in 0.1 M phosphate-buffered salinefor 10 min. After washing, the hybridized blots were soaked in thechemiluminescence detection reagent (ECL gene detection system;Amersham) for 1 min and then placed under X-ray film for 3-5 min todevelop (15). In addition, human Va 7 PCR-amplified products werehybridized with Va 7-specific oligoprobe (5'-CTG GAG CTC CTGTAG AAG GAG-3') as well.

Dot Hybridization. Ten /<!of the reaction mixture containing amplified cDNA using individual sets of Vßand C/3 primers as describedwere hybridized with 7-32P-labeled C/3-specific oligonucleotide probe(5'-TTG ATG GCT CAÕ ACÕ AGG AG A CC-3'). As a negative

control, the PCR-amplified product of actin primers was also blotted.cDNA was prepared from 1 jig of total RNA isolated from a MLC ofmurine spleen cells (SJL, PLJ, BALB/c, B-10PL) and amplified witheach individual set of TCR Vß-Cßprimers, which were dot blotted aswell. After each sample was denatured with 0.4 M NaOH-25 mM EDTAfor 10 min at room temperature, the samples were applied to nitrocellulose paper (Gene Screen Plus; NEN Research Products, Boston, MA).

Table 1 Sequence of murine T-cell receptor ßprimersPrimer"V/31V/32V/3

3V/34V/35.1V/36V/3

7V/38.1V/38.2V/38.3V/39V/310V/311V/312V/313V/314V/3

15V/316V/317V/318V/319C/3Clone

(Ref.)1.9.2(32)ARI

(32)2B4(33)TB3(32)TB21(32)LB2(34)pHDSll(35)TB12(32)TB2

(32)TB23(32)V/8

2(36)Vß3(36)V/35(36)V/37(36)V/310(36)SJL33(37)SJL73(37)SJL4(37)Qk-24.1

(38)pMlpr2(39)V/3N3

(39)(40)5'—

»3'sequenceATCTAATCCTGGGAAGAGCAAATGGCGTCTGGTACCACGTGGTCAAGTGAAAGGGCAAGGACAAAAAGCGATATGCGAACAGTATCTAGGCACATAATCAAAGGAAAGGGAGAATCCTGATTGGTCAGGAAGGGCAATACCTGATCAAAAGAATGGGAGAATAACCATGACTATATGTACTGGATAACCACAACAACATGTACTGGATAGCCACAACTACATGTACTGGAGCTTGCAAGAGTTGGAAAACCAGATTATGTTTAGCTACAATAATAACAAGGTGACAGGGAAGGGACAAACCTACAGAACCCAAGGACTCAGCAGTTGCCCTCGGATCGATTTTCGCCGAGATCAAGGCTGTGGGCAGAGAACCATCTGTAAGAGTGGAACCATCAAATAATAGATATGGGGCAGTAGTCCTGAAAAAGGGCACACTCATCTGTCAAAGTGGCACTTCAAGACATCTGGTCAAAGGAAAAGGCCAAGCACACGAGGGTAGCC

" V/3nomenclature and the sequences follow that of Barth el al. (32) and otherreports (33-40).

Then the paper was fixed with UV light for 10 min, followed byprehybridization with 5x SSPE-Sx Denhard's-0.1 % SDS containingsalmon sperm DNA at 42°Cfor 3 h. Thereafter, samples were hybridized for 12-16 h with 1 x IO6c.p.m. of 32P-Iabeled oligoprobe at 42'C.Each oligonucleotide probe was labeled using [7-32P]ATP (New Eng

land Nuclear, Boston, MA) and polynucleotide kinase according to thepublished procedure (12).

RESULTS

Analysis of Va expression in TILs from two malignantmelanoma patients is shown in Table 2. A limited number ofone to four TCR Va gene segments were observed in TILs frommalignant melanomas. Two separate regions of tumors fromthe same patient were studied. In both regions (P. R.), Va 7and 12 were rearranged, whereas in one area (leg). Va 5 wasexpressed, and in the other area (chest wall), V«2 was present.Furthermore, predominant usage of Va 5 and 7 was demonstrated in all cutaneous counterparts from different patients.However, brain metastatic melanoma uses Va 1 and Va 13, butits cutaneous counterpart uses Va 5 and Va 7, as shown above(H. B.). No TCR Va and V/3 gene transcripts were seen inspecimens taken at autopsy from 10 normal brains (5). We alsoexamined mRNA transcripts of TCR Va and Vßin normalskin taken from the other autopsied case. The data are notshown, but almost all Va and Vßsubfamilies were equallyamplified. In all cases where a Va-Ca gene rearrangement wasvisualized on agarose gel electrophoresis with ethidium bromidestaining, positive hybridization was obtained on Southern blotting to the Ca-specific probe. Va 7-amplified products couldhybridize with Va 7-specific oligoprobe as well (Fig. 1). Theactin-amplified PCR product did not hybridize with this probe

as expected.TCR Vßrearrangements were also analyzed. Like Va genes,

the restricted usage of TCR Vßgenes was observed, and withVß7, 12 were predominantly expressed within all cutaneousmelanomas, but not in brain metastasis. The number of casesis limited, but it was suspected that there is organ specificityfor TCR a and ßchain gene usage of TILs within malignantmelanomas.

The efficiency of the chosen primers in amplifying Va-Carearrangement was examined. A MLC was done using spleen

5566

RETRACTED

July

1,19

92

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

ORGAN-SPECIFIC TCR V0 GENE EXPRESSION WITHIN MELANOMA TILs

cells from SJL, PLJ, B-10PL, and BALB/c mice. cDNA wasamplified with each individual set of 5' V/3 primers and 3' Cß

primers. Each V/3 primer amplified a rearranged V/3-D/3-J/3

product. Identity of the rearranged PCR product was confirmedby dot hybridization with a C/3-specific oligonucleotide probe.As a positive control for the PCR, the cDNA was also amplifiedwith actin primers. All cDNAs from all tumor sites were equallyamplified with actin primers.

The population of TILs in each primary and metastatic siteexpresses from one to four TCR V/3 genes (Table 3). In eachmetastatic site, the profile of TCR V/3 gene expression wasdifferent. V/3 12 was expressed in both primary lesions and inlung metastasis.

The amplified PCR products in Table 3 were further identified by hybridization with C/3-specific oligonucleotides probes.In all cases where the V/3 rearranged products were visualizedon agarose gel electrophoresis with ethidium bromide staining,a positive hybridization was observed (Fig. 2). Actin productswere not hybridized at all. Here, we also examined the TCRV/3 usage in activated TILs from each melanoma specimen,which were stimulated with phytohemagglutinin and recombinant IL-2 for 7 days. In vitro cultured TILs from various organswere examined for their cytotoxicities against "autologous"

B16-F10 melanoma cells. As Fig. 3 shows clearly, all TILsfrom primary regions and lung, brain, and liver metastatictumors show killing activity against B16-F10 target cells invitro. RNA from bulk-TILs of primary regions was extractedand reverse transcribed with the same procedure. Bulk-TILswere more diverse in their TCR usage than TILs in nativetissues. From this result, it appears that some T-cell populationsmay grow preferentially, and studies using cytotoxic T-cellclones do not always reflect the true distribution in TILs.

DISCUSSION

The majority of cancer deaths occur as a result of the processof metastasis, whereby malignant tumor cells spread from aprimary tumor to establish secondary growths at distant sites(7, 16). The identification and propagation of T-cells withantitumor reactivity are critical to the understanding of thehuman immune response to tumors, which may possibly beuseful in the successful implementation of adoptive immuno-therapy against cancer (6, 10, 17). TILs are currently underclinical investigation as an immunotherapeutic agent for thetreatment of cancer. In a recent study by Rosenberg and colleagues (4), 11 of 20 melanoma patients treated with a combination of TILs, IL-2, and cyclophosphamide showed significantregression, including 10 with a partial response. Although muchattention has been paid to TILs which can recognize and lyseautologous tumors, the diversity of individual populations undoubtedly influences their effectiveness in immunotherapy (18-

P.R. H.B.

O

ILe

2.0

300

Fig. 1. Southern blot analysis of PCR-amplified products. V«7-amplifiedproducts were hybridized with V«7-specific oligoprobe. No. at left, bp.

20). It was also reported that, among the sites of tumors whichwere observed to respond to IL-2-TIL therapy, lung and s.c.métastasesresponded better than bone or liver métastases,suggesting that tumors in different sites might have differentsusceptibilities to TILs (11). The development of metastasisdepends upon both host immune defense mechanisms and thesurface properties of tumor cells (21). The accumulation of T-cells at the tumor sites may reflect the immunological recognition of tumor antigens by the host (22). Therefore, the analysisof TCR gene usage of TILs may help to clarify the role intumor recognition of this population of cells and increase theunderstanding of the molecular basis of the lymphocyte-tumorinteraction, thus contributing to the improvement of protocolsfor adoptive immunotherapy.

Work by many laboratories has led to our current understanding of antigen recognition by T-cells (23, 24). It is now apparentthat clonally variable receptors made up of two different poly-peptide chains, a and /3, are found as receptors (TCRs) on thebulk of peripheral T-cells in mice and humans. These receptorsinteract with antigen-derived peptide fragments bound to products of MHC on the surface of target cells. The specificity ofT-cells arises from rearrangements of TCR V«and J«genesand V/3, D/3, and J/3 genes. TCR ßgenes in most mice arecomposed of approximately 21 V/3, 12 J/3, and two D/3 regions,the last being read in any frame to give additional variability.Combination of these different ingredients can probably giverise to at least 109 different receptors, about an order of magnitude more than there are T-cells in the animal. Are there anyobvious relationships between the «and ßcomposition of agiven TCR and its specificity? T-cells that recognize foreignantigens, as well as T-cells that mediate autoimmune diseases,demonstrate a limited repertoire of V gene usage, especiallywhen T-cells responding to a specific epitope in a restricted

Table 2 Usage of TCR Va and V0 genes in malignant melanoma patients

PatientP.R.H.

B.PatientP.R.

H. B.LesionSkin

(leg)Skin (chest) Va2Brain

V«1Skin(chest)LesionSkin

(leg)Skin (chest)Brain V/3 2 V/3 5.1Skin (chest)Va

5Va

5V07

V/37TVR

V«familiesV«

7Va7Va

7TVR

VßfamiliesVtf

12V09V/312V07,

V/38 V012Va

12. Va 14Va 12, Va14Va

13V/3

18V014

V/3 15

5567

RETRACTED

July

1,19

92

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

ORGAN-SPECIFIC TCR VßGENE EXPRESSION WITHIN MELANOMA TILs

Table 3 Usage of TCR Krf in murine TILs

Sample0PrimaryLung

Liver Vß2BrainVß2Bulk-TILsTCR

VrffamiliesV/34

V09 V(}12Vß12V/37

V.ni V/J12Vß

15V/3

15Vßti

V/nSV/3

Ig

' Experiments were repeated three times using syngenic murine models.

123 ,4,5,6 ,7,8.1,8.2,8.3,

PRIMARYTUMOR

Vß

1-9

10-19, Actln

LUNG META.1-9

10-19, Actln

Fig. 2. Dot hybridization of PCR products.Amplified cDNA using individual set of V/Jand C3 primers as described was hybridizedwith Cfî-specificoligonucleotide probe. As anegative control, the PCR-amplified productof actin primers was also blotted. META, metastasis. Ml K, mixed lymphocyte reaction.

LIVER META.

BRAIN META.

BULK-TILS

MLR

1-9

10-19, Actln

1-910-19, Actln

1-9

10-19, Actln

10 ' 11 ' 12 ' 13 ' 14 ' 15 ' 16 ' 17 ' 18 ' 19 'Actin

80

-. 60-

40-MO

IO

20-

Bulk-TILs

LungBrain

Liver

20 40 60

E/T

80 100

Fig. 3. In vitro cytotoxicity of TILs against B16-F10 mouse melanoma cells.E/T, 50:1.

MHC context are investigated (25, 26). In T-cell clones recognizing myelin basic protein and causing experimental allergicencephalitis, a limited repertoire of V genes is used (27, 28). T-cell clones from renal allograft recipients share similar ßchains(29). Our recent studies on TILs in ocular melanoma indicatethat these effector cells utilize a very limited repertoire of TCRgenes, and RNA transcripts of Va 7 were predominantly expressed (6).

In order to address the question about the different susceptibilities of TILs to tumors in different sites, we examined thediversity of TCR Va and V/3 gene usage in human malignantmelanoma patients with multiple metastasis. As our resultsshow, one patient, bearing multiple skin lesions, had almostthe same pattern of TCR V«and Vßrepertoire in differentsites of the skin. However, in the other patient, with skin andbrain melanoma, the dissociation of TCR repertoire betweenthe different sites was revealed. The human melanoma specimens used in this study were too small to establish T-cell clonesor even TILs in vitro. Therefore, we do not know the relationship of the TCR repertoire of TILs to T-cell specificity.

As a second step, we chose B16-F10 murine melanoma cellsas an experimental model of multiple metastatic melanoma toexamine the TCR repertoire in the tumors of different organs.Tumor cell sublines and clones exhibiting a broad spectrum ofmetastatic capabilities have been isolated from a number oftumor cell lines (30). So far, the best characterized are the B16melanoma cell lines; the B16-1 10 line exhibits high metastaticcolonizing potentials (21, 30). Our results show that TILswithin primary and lung, brain, and liver metastatic melanomasreveal the limited heterogeneity of TCR V/3genes and also sitespecificity of TCR gene usage. The basic biological implicationsof these findings suggest that host humoral immunity to melanoma may represent a major driving force favoring tumor

5568

RETRACTED

July

1,19

92

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

ORGAN-SPECIFIC TCR V0 GENE EXPRESSION WITHIN MELANOMA TILs

progression and metastasis. In the B16 melanoma line, therewas a greater expression of H-2 Class I and Class II proteinsby the highly metastatic FIO line as compared with the othersublines. Furthermore, the difference in cell behavior was explained on the basis of changes in the efficiency of T-cell-mediated MHC Class I restricted cytolysis, and it has beensuggested that I-A expression facilitates immune recognition ofother melanoma lines. We also examined the mRNA transcriptsof TCR V/3 within TILs from WHEI 164, a methylcholan-threne-induced fibrosarcoma, which originated from BALB/cmice. The results revealed that a restricted, but different, patternof TCR V/3 usage exists.3 The finding that TILs may be characterized by a dominant T-cell receptor gene rearrangementwill require determination of the role of such dominant infiltrating cells, and vice versa. A different TCR Vßusage in TILsdistributed in metastasis in various organs may reflect differences in tumor antigenicity at these sites or may be due todifferential homing patterns to these tumors (31). Further studies will be required, but our results might bring us one stepcloser to an understanding of the biology of cancer metastasis.

ACKNOWLEDGMENTS

We wish to thank Dr. Marianne Powell for providing us the humanmelanoma specimens.

REFERENCES

1. Akslen, L. A., Hove, L. M., and Hartveit, F. Metastatic distribution inmalignant melanoma. Invasion Meinst.. 7: 253-263, 1987.

2. Russell, S. J. Lymphokine gene therapy. Immunol. Today, 11: 196-200,1990.

3. Nitta, T., Sato, K., Vagita, H., Okumura, K., and Ishii, S. Preliminary trialof specific targeting therapy against malignant glioma. Lancet, 335: 368-371, 1990.

4. Rosenberg, S. A., Packard, B. S., Aebersold, P. M., Solomon, D., Topalian,S. L., Toy, S. T., Simon, P., Lotze, M. T., Yang, J. C, Seipp, C. A., Simpson,C, Carter, C., Bock, S., Schwartzenruber, D., Wei, J. P., and White, D. E.Use of tumor-infiltrating lymphocytes and interleukin-2 in the immunother-apy of patients with metastatic melanoma. N. Engl. J. Med., 319: 1676-1680, 1988.

5. Nitta, T., Oksenberg, J. R., Rao, N. A, and Steinman. L. Predominantexpression of T cell receptor Va 7 in tumor infiltrating lymphocytes of uvealmelanoma. Science (Washington DC), 249:672-674, 1990.

6. Nitta, T., Sato, K., Okumura, K., and Steinman, L. An analysis of T-cellreceptor variable region genes in tumor infiltrating lymphocytes withinmalignant tumors. Int. J. Cancer, 49: 1-6, 1991.

7. Van Alstine, J. M., Sorensen, P., Webber, T. J., Greig, R., Poste, G., andBrooks, D. E. Heterogeneity in the surface properties of B16 melanoma cellsfrom sublines with differing metastatic potential detected via two-polymeraqueous-phase partition. Exp. Cell Res., ¡64:366-378, 1986.

8. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.T., Mullís,K. B., and Erlich, H. A. Primer-directed enzymatic amplificationof DNA with a thermostable DNA polymerase. Science (Washington DC),239:487-491, 1988.

9. Conley, F. K. Development of a metastatic brain tumor model in mice.Cancer Res., 39: 1001-1007, 1977.

10. Itoh, K., Platsoucas, C. D., and Batch, C. M. Autologous tumor-specificcytotoxic T lymphocytes in the infiltrate of human metastatic melanomas. J.Exp. Med., 168:1419-1441, 1988.

11. Karpati, R. M., Banks, S. M., Malissen, B., Rosenberg, S. A., Sheard, M.A., Weber, J. S., and Hodes, R. J. Phenotypic characterization of murinetumor-infiltrating T lymphocytes. J. Immunol., 146: 2043-2051, 1991.

12. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: A Laboratory Manual, pp. 188-209. Cold Spring Harbor, NY: Cold Spring HarborLaboratory, 1982.

13. Kawasaki, E. S., Clark, S. C, Coyne, M. Y., Smith, S. D., Champlin, R.,Witte, O. N., and McCormick, F. P. Diagnosis of chronic myeloid and acutelymphocytic leukemias by detection of leukemia-specific mRNA sequencesamplified in vitro. Proc. Nati. Acad. Sci. USA, 85: 5698-5702, 1988.

14. Erlich, H. A. (ed.) PCR Technology, pp. 167-169. New York: StocktonPress, 1989.

3T. Nitta,R. Bell,K.Okumura,K.Sato,andL. Steinman,unpublisheddata.

15. Whitehead, T. P., Thorpe, G. H., Cater, T. J. N., Groucutt, C., and Kricka,L. Enhanced luminescence procedure for sensitive determination of peroxi-dase-labelled conjugates in immunoassay. Nature (Lond.), 305: 158-159,1983.

16. Schackert, G., and Fidler, I. J. Site-specific metastasis of mouse melanomasand a fibrosarcoma in the brain or meninges of syngeneic animals. CancerRes., 48: 3478-3484, 1988.

17. Rosenberg, S. A., Spiess, P., and Lafrieniere, R. A new approach to theadoptive immunotherapy of cancer with tumor-infiltrating lymphocytes. Science (Washington DC), 233: 1318-1321, 1986.

18. Kurnick, J. T., Bennett, W. P., Boyle, L. A., Grove, B. H., Hawes, G. E.,Kradin, R. L., Solovera, J., and Pandolfi, F. Tumor infiltrating lymphocytes:in vitro characterization and therapeutic uses. In: Cellular Immunity and theImmunotherapy of Cancer, pp. 405-412. New York: Wiley-Liss, Inc., 1990.

19. Topalian, S. L., Kasid, A., and Rosenberg, S. A. Immunoselection of a humanmelanoma resistant to specific lysis by autologous tumor-infiltrating lymphocytes. J. Immunol., //: 4467-4495, 1990.

20. Belldegrun, A., Kasid, A., Uppenkamp, M., Topalian, S., and Rosenberg, S.A. Human tumor infiltrating lymphocytes. Analysis of lymphokine mRNAexpression and relevance to cancer immunotherapy. J. Immunol., 142:4520-4526, 1989.

21. Nicolson, G. L., and Dulski, K. M. Organ specificity of metastatic tumorcolonization is related to organ-selective growth properties of malignantcells. Int. J. Cancer, 38: 289-294, 1986.

22. Burger, P. C., and Green, S. B. Patient age, histológica! features and lengthof survival in patients with glioblastoma multiforme. Cancer (Phila.), 59:1617-1625, 1987.

23. Marrack, P., and Kappler, J. The T cell receptor. Science (Washington DC),238: 1073-1079, 1987.

24. Blackman, M. A., Kapler, J. W., and Marrack, P. T-cell specificity andrepertoire. Immunol. Rev., 70/.-5-19, 1988.

25. Winoto, A., Urban, J. L., Lan, N. C., Goverman, J., Hood, L., and Hansburg,D. Predominant use of a Va gene segment in mouse T-cell receptors forcytochrome c. Nature (Lond.), 324: 679-682, 1986.

26. Hochgeshwender, U., Weltzien, H. U., Eichmann, K., Wallace, R. B., andEpplen, J. T. Preferential expression of a defined T-cell receptor /3-chaingene in hapten-specific cytotoxic T-cell clone. Nature (Lond.), 322:376-378,1986.

27. Zamvil, S. S., Mitchell, D. J., Lee, N. E., Moore, A. C., Waldor, M. K.,Sakai, K., Rothbard, J. B., McDevitt, H. O., Steinman, L., and Acha-Orbea,H. Predominant expression of a T cell receptor V/3 gene subfamily inautoimmune encephalitis. J. Exp. Med., 167: 1586-1596, 1988.

28. Acha-Orbea, H., Mitchell, D. J., Timmermann, L. Wraith. D. C., Tausch,G. S., Waldor, M. K., Zamvil, S. S., McDevitt, H. O„and Steinman, L.Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalitis allows specific immune intervention. Cell, 54: 263-273, 1988.

29. Miceli, M. C., and Finn, O. J. T cell receptor d-chain selection in humanallograft rejection. J. Immunol., 142: 81-86, 1989.

30. Jack, A. S., and McVeigh, K. L. A demonstration of a strain related restrictioneffect in the formation of experimental métastases.J. Pathol., 152: 37-45,1987.

31. Ames, I. H., Gagne, G. M., Garcia, A. M., John. P. A.. Scatorchia, G. M.,Tomar, R. H., and McAfee, J. G. Preferential homing of tumor-infiltratinglymphocytes in tumor-bearing mice. Cancer Immunol. Immunother., 29:93-100, 1989.

32. Barth, R., K., Kim, B. S., Lan, N. C., Hunkapiller, T., Sobieck, N., Winoto,A., Gershenfeld, H., Okada, C., Hansburg, D., Weissman, I. L., and Hood,L. The murine T-cell receptor uses a limited repertoire of expressed Vßgenesegments. Nature (Lond.), 316: 517-523, 1985.

33. Chien, Y., Gascoigne, N. R. J., Kavaler, J., Lee, N. E., and Davis, M. M.Somatic recombination in a murine T-cell receptor gene. Nature (Lond.),509:322-326,1984.

34. Patten, P., Yokota, T., Rothbard, J., Chien, Y., Arai, K., and Davis, M. M.Structure, expression and divergence of T-cell receptor /3-chain variableregions. Nature (Lond.), 312: 40-46, 1984.

35. Saito, H., Kranz, D. M., Takagaki, Y., Hayday, A. C, Eisen, H. N., andTonegawa, S. Complete primary structure of a heterodimeric T-cell receptordeduced from cDNA sequences. Nature (Lond.), 309: 757-762, 1984.

36. Behlke, M. A., Spinella, D. G., Chou, H. S., Sha, W„Hartl, D. L., and Loh,D. Y. T-cell receptor 0-chain expression: dependence on relatively fewvariable region genes. Science (Washington DC), 229: 566-570, 1985.

37. Behlke, M. A., Chou, H. S., Huppi, K., and Loh, D. Y. Murine T-cellreceptor mutants with deletions of/3-chain variable region genes. Proc. Nati.Acad. Sci. USA, 83: 767-771, 1986.

38. Kappler, J. W., Wade, T., White, J., Kushnir, E., Blackman, M., Bill, J.,Roehm, N., and Marrack, P. A T cell receptor \ßsegment that impartsreactivity to a class II major histocompatibility complex product. Cell, 49:263-271, 1987.

39. Louie, M. C., Nelson, C. A., and Loh, D. Y. Identification and characterization of new murine T cell receptor ßchain variable region (V/3)genes. J. Exp.Med., 170: 1987-1998, 1989.

40. Pullen, A. M., Potts, W., Wakeland, E. K., Kappler, J., and Marrack, P.Surprisingly uneven distribution of the T cell receptor V/3repertoire in wildmice. J. Exp. Med., ///: 49-62, 1990.

5569

RETRACTED

July

1,19

92

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

ANNOUNCEMENTS

Sixteenth Annual Cancer Symposium, October 26-28. 1992, Sheraton Harbor Island Hotel, San Diego, CA. Sponsored by the Stevens CancerCenter of Scripps Memorial Hospital. Credits: 20 hours CME Category 1. Registration fee: $390 for Physicians; $195 for Fellows or Residents.Contact: Meeting Management, Cancer Symposium, 5665 Oberlin Drive, Suite 110, San Diego, CA 92121. Telephone: (619) 453-6222; FAX:(619)535-3880.

Fourth Conference on DNA Topoisomerases in Therapy, October 26-29, 1992, Alumni Hall, New York University Medical Center, New York,NY. Credits: 25 category 1 credit hours AMA/PRA. Registration fee: $400; $150 for students and trainees. Contact: NYU Medical Center, Post-Graduate Medical School, 550 First Avenue, New York, NY 10016. Telephone: (212) 263-5295.

American Institute for Cancer Research Annual Research Conference—Diet and Cancer: Markers, Prevention, and Treatment, October 29-30,1992, Ritz Carlton Hotel, McLean, VA. Registration fee: $250 before October 1; $325 after October 1. Abstract deadline: September 15, 1992.Contact: Rita Taliaferro, Director, Conference Management Division. Associate Consultants, Inc., 1718 M Street, NW, Suite 293, Washington,DC 20036. Telephone: (202) 737-8062.

First International Conference on Gene Therapy of Cancer. November 5-7, 1992, Hotel del Coronado, San Diego, CA. Abstract deadline: July22, 1992. Contact: Cass Jones, Gene Therapy Conference, 7916 Convoy Court, San Diego, CA 92111. Telephone: (619) 565-9921; FAX: (619)565-9954.

Tenth Chemotherapy Foundation Symposium: Innovative Cancer Chemotherapy for Tomorrow, November 11-13, 1992, Holiday Inn CrownePlaza, New York, NY. Contact: Jaclyn Silverman, Division of Medical Oncology, Box 1178, Mount Sinai School of Medicine, One GustaveLevy Place, New York, NY 10029. Telephone: (212) 241-6772 or (212) 369-5440.

Fifth International Workshop on Breast Cancer and Immunology, November 16-17, 1992, Miyako Hotel, San Francisco, CA. Contact: CarolynKlinepeter, Cancer Research Fund of Contra Costa, 2055 North Broadway, Walnut Creek, CA 94596. Telephone: (510) 943-1182.

Uro-Oncology Update: 1993, January 9, 1993, Ritz-Carlton Hotel, Boston, MA. Registration fee: $75 for physicians. Contact: Boston UniversitySchool of Medicine, Continuing Medical Education, 80 East Concord Street, Boston, MA 02118. Telephone; (617) 638-4605.

Current Status and Future Directions of Immunoconjugates, January 15-17, 1993, Sonesta Beach Resort, Key Biscayne, FL. Contact: Divisionof Continuing Medical Education, University of Miami School of Medicine, P. O. Box 016960 (D23-3), Miami, FL 33101. Telephone: (305)547-6716; FAX: (305) 547-5613.

Seventh International Conference on the Adjuvant Therapy of Cancer, March 10-13, 1993, Tucson Convention Center, Tucson, AZ. Abstractdeadline: December 1, 1992. Contact: Ms. Nancy Rzewuski, Conference Coordinator, Arizona Cancer Center, The University of Arizona Collegeof Medicine, 1515 North Campbell Avenue, Room 2933, Tucson, AZ 85724. Telephone: (602) 626-2276; FAX: (602) 626-2284.

Eighth International Conference on Monoclonal Antibody Immunoconjugates for Cancer, March 18-20, 1993, San Diego Marriott Hotel andMarina, San Diego, CA. Oral abstact deadline: October 19, 1992; poster abstract deadline: December 11, 1992. Contact: Cass Jones, MonoclonalAntibody Conference, 7916 Convoy Court, San Diego, CA 92111. Telephone: (619) 565-9921; FAX: (619) 565-9954.

Seventh World Congress on Pain, August 22-27, 1993, Paris, France. Contact: International Association for the Study of Pain, 909 NE 43rdStreet, Suite 306, Seattle, WA 98105. Telephone: (206) 547-6409; FAX: (206) 547-1703.

Third International Congress on Oral Cancer. January 24-27, 1994, Hong Kong Convention and Exhibition Centre, Hong Kong. Contact: Dr.A. K. Varma, Secretary General, International Congress on Oral Cancer, A.F.C.D.E., Agram Post, Bangalore-560007, India, Telephone: 91-812-568782 or 91-812-564359, FAX: 91-812-580357; or Mr. Stephen Roxborough, Professional Conference Organizer, Third International Congresson Oral Cancer, Gardiner-Caldwell Communications Ltd., 22/F Hang Lung House, 184-192 Queen's Road. Central. Hong Kong, Telephone:

852-543-5922, FAX: 852-854-1267.

ErratumAn error has been found in the article by Manchester et al., entitled "Determinants of Polycyclic Aromatic Hydrocarbon-DNA Adducts in

Human Placenta," from the March 15, 1992, issue of Cancer Reserach (pp. 1499-1503). In the "Abstract" (p. 1499) and the "Results" section(p. 1451), the mean AHH activities are mistakenly reported as 13.0 ±4.0 (mean ±SE) pmol 3-OH-BP mg protein"' min"1 and 1.3 ±3.7 pmol3-OH-BP mg protein"1 min"1. The correct geometric means (derived from the data in Table 1) are 3.9 ±2.4 (mean ±SE) pmol 3-OH-BP mgprotein"' min"' for the placentas in which BPDE-DNA adducts were detected and 0.4 ±0.2 pmol 3-OH-BP mg protein"' min"1 for the placentasin which BPDE-DNA adducts were not detected. The P value of 0.03 (Student's t test) is correct.

RetractionThe article entitled "T-Cell Receptor VßGene Expression Differs in Tumor-infiltrating Lymphocytes within Primary and Metastatic

Melanoma," by T. Nitta, R. Bell, K. Okamura, K. Sato, and L. Steinman, which appeared in the October 15, 1991, issue of Cancer Research (pp.

5565-5569), has been retracted by its first author, Dr. Taizo Nitta, because it contains a number of serious inaccuracies and because Dr. LawrenceSteinman and Dr. Robert Bell were listed as authors of the article without their knowledge or permission. The Editors of Cancer Research wereinformed of this situation by Dr. Steinman and Dr. Bell.

3828

1991;51:5565-5569. Cancer Res   Taizo Nitta, Robert Bell, Ko Okumura, et al.   Lymphocytes within Primary and Metastatic Melanoma

Gene Expression Differs in Tumor-infiltratingβT-Cell Receptor V

  Updated version

  http://cancerres.aacrjournals.org/content/51/20/5565

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  .permissions@aacr.orgDepartment at

To request permission to re-use all or part of this article, contact the AACR Publications

on July 22, 2015. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from