STUDIES OF WAX GENES IN COTTON

(Gossypium arboreum)

MUHAMMAD YOUNAS

NATIONAL CENTRE OF EXCELLENCE IN

MOLECULAR BIOLOGY UNIVERSITY OF THE PUNJAB LAHORE PAKISTAN

(2009)

STUDIES OF WAX GENES IN COTTON (Gossypium arboreum)

A THESIS SUBMITTED TO

UNIVERSITY OF THE PUNJAB

IN FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY IN

MOLECULAR BIOLOGY

BY

MUHAMMAD YOUNAS

SUPERVISOR:

DR. TAYYAB HUSNAIN

NATIONAL CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY UNIVERSITY OF THE PUNJAB LAHORE PAKISTAN

(2009)

DEDICATED TO:

THE NO OF CJ

TABLE OF CONTENTS

LIST OF FIGURES X

LIST OF TABLES XIV

ABBREVIATIONS XV

ACKNOWLEDGEMENTS XVII

SUMMARY XIX

1 INTRODUCTION 1

2 LITERATURE VIEW 4

2.1 COTTON 4

2.2 BIOTIC AND ABIOTIC RESISTANCE 6

2.3 WAX 8

2.3.1 EPICUTICULAR WAX 8

2.3.2 EPICUTICULAR WAX ROLE AND SIGNIFICANCE IN PLANTS 9

2.3.3 EPICUTICULAR WAX GENES 10

2.3.4 EPICUTICULAR WAX AND COTTON 13

2.4 MUTATION 13

2.4.1 INDUCED MUTATION 13

2.4.2 WAX MUTANTS 15

2.4.3 MUTANTS AND GENES IDENTIFICATION 17

2.5 MICROARRAY 17

2.5.1 TYPES OF DNA MICROARRAY 18

2.5.2 MICROARRAY AND MUTANTS 19

2.5.3 MICROARRAY AND GENES IDENTIFICATION

20

3 MATERIALS AND METHODS 23

3.1 DEVELOPMENT OF WAX MUTANTS 23

3.1.1 MUTATION INDUCTION 23

3.1.2. WAX MUTANT SELECTION 25

3.1.3 WAX MUTANTS CONFIRMATION 26

3.1.3.1 SCANNING ELECTRON MICROSCOPY (SEM) 27

3.1.3.2 GC-MS ANALYSES 27

3.2 CONSTRUCTION OF cDNA LIBRARY 28

3.2.1 TOTAL RNA ISOLATION 28

3.2.2 AGAROSE GEL ELECTROPHORESIS 29

3.2.3 QUANTIFICATION OF TOTAL RNA 29

3.2.4 DNase TREATMENT 29

3.2.5 ISOLATION OF mRNA FROM TOTAL RNA 30

3.2.6 PRECIPITATION OF mRNA 31

3.2.7 DOUBLE STRAND cDNA CONSTRUCTION 31

3.2.8 LIGATING THE attB1 ADAPTER 33

3.2.9 cDNA SIZE SELECTION 33

3.2.10 GEL ELUTION 34

3.2.11 PERFORMING THE BP RECOMBINATION REACTION 34

3.3 PREPARATION OF CDNA MICROARRAY PLATFORM 36

3.3.1 CLONE PICKING AND CULTURING 36

3.3.2 PCR AMPLIFICATION OF INSERTS 37

3.3.3 CLONE SEQUENCING 38

3.3.4 SPOTING OF SLIDES 38

3.4 HYBRIDIZATION OF TARGET WITH cDNA MICROARRAY PLATFORM

39

3.4.1. TARGET PREPARATION 39

3.4.1.1. AMINOALLYL LABELING 39

3.4.1.2 REMOVAL OF UNINCORPORATED aa-dUTP AND FREE AMINES

40

3.4.1.3 COUPLING aa-cDNA TO CYANINE DYE ESTER 40

3.4.1.4 REMOVAL OF UNCOUPLED DYE 40

3.4.2 HYBRIDIZATION 41

3.4.2.1 PRE-HYBRIDIZATION 41

3.4.2.2 HYBRIDIZATION 41

3.4.2.3 SLIDE WASHING 41

3.5. SLIDE SCANNING 42

3.5.1 IMAGES PROCESSING AND RAW DATA GENERATION 42

3.6. DATA NORMALIZATION AND ANALYSIS 42

3.6.1. DATA NORMALIZATION 42

3.6.2. THE MIDAS PROJECT 43

3.6.3. TM4 MEV ANALYSIS 43

3.7. SEQUENCING OF DIFFERENTIALLY EXPRESSED TRANSCRIPTS

43

3.8. VALIDATION STUDIES BY QUANTITATIVE REAL-TIME PCR 44

3.9. BIOINFORMATIC STUDIES 45

3.9.1. BLAST SEARCH 45

3.9.2. GENE ONTOLOGY (GO) AND FUNCTIONAL ANNOTATION 46

3.9.3. GENE INVESTIGATOR BY RESPONSE VIEWER

46

4 RESULT 47

4.1 CHEMICAL AND PHYSICAL MUTAGENESIS 47

4.2 WAX MUTANTS 52

4.2.1 WAX MUTANTS SELECTION 52

4.2.2 WAX MUTANTS CONFIRMATION 57

4.2.2.1. EPICUTICULAR WAX MORPHOLOGY 57

4.2.2.2. GAS CHROMATOGRAPHY AND MASS SPECTROPHOTOMETER (GC-MS) ANALYSES

61

4.2.3 COMPOSITION OF EPICUTICULAR WAX 65

4.2.4 COMPARISON OF COTTON (G. arboreum) WILD AND WAX MUTANT PLANTS

68

4.3. cDNA LIBRARY 70

4.3.1 TOTAL RNA 70

4.3.2. SIZE SELECTION 72

4.3.3. cDNA LIBRARY CFU 73

4.3.4 PCR AMPLIFICATION 73

4.3.5 cDNA LIBRARY CLONE SEQUENCING 75

4.3.6 BIOINFORMATIC ANALYSES OF cDNA LIBRARY SEQUENCED CLONES

76

4.3.6.1. HOMOLOGY SEARCH 76

4.3.6.2. GENE ONTOLOGY (GO) AND FUNCTIONAL ANNOTATION 77

4.4. cDNA MICROARRAY 80

4.4.1. cDNA LABELING / TARGET PREPARATION 80

4.4.2 HYBRIDIZATION AND SCANNING 81

4.4.3. DATA NORMALIZATION 82

4.4.4. MICROARRAY DATA ANALYSIS 83

4.4.5. MICROARRAY RESULTS VALIDATION STUDIES 86

4.4.6. WAX POTENTIAL CANDIDATE ESTs FUNCTIONAL CATEGORIZATION By GO (GENE ONTOLOGY) ANNOTATION

87

4.4.7. GENE INVESTIGATOR EXPRESSIONAL ANALYSIS BY RESPONSE VIEWER

89

5 DISCUSSION 91

6 REFFERENCES 119

7 APPENDICES 159

X

LIST OF FIGURES Figure1. Thermocycling profile for the amplification of inserts by PCR 37

Figure2. Thermocycling profile for the sequencing PCR 38

Figure3. Thermocycling profile for the validation of the microarray results by Real-Time PCR

44

Figure4. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with gamma rays, by plotting germination percentage on Y-axis and Gamma rays Doses on X-axis.

48

Figure5. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Sodium Azoid (SA), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

48

Figure6. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays +Sodium Azoid (SA), by plotting germination percentage on Y-axis and mutagen Doses on X-axis.

49

Figure7. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Di-Ethyl Sulfate (DES), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

49

Figure8. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays+Di-Ethyl Sulfate (DES), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50

Figure9. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Ethyl Methane Sulphonate (EMS), by plotting germination percentage on Y-axis and mutagen Doses on X-axis.

50

Figure10. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays + Ethyl Methane Sulphonate (EMS), by plotting germination percentage on Y-axis and mutagen Doses on X-axis.

50

Figure11. Wax mutant selection in M2 generation on the basis of glossy leaves (A) Wild plant, showing non-glossy leaves. (B) M2 mutant plant with glossy leaves; a wax mutant's trait.

53

Figure12. Wax mutant selection in M2 generation on the basis of rapid chlorophyl extraction in 80% Ethanol for 1 h from leaves. (A) Wild plant and (B) M2 mutant plant, wax mutant showed rapid chlorophyll leaching in 80% Ethanol by greenish appearance.

53

XI

Figure13. Wax mutant selection in M2 generation on the basis of flower size (A) Normal flower size in wild plant. (B) Small flower size in M2 mutant plant, a wax mutant's trait.

54

Figure14. Wax mutant selection in M2 generation on the basis of aerial fusion. (A) Wild plant without aerial fusion. (B). Aerial fusion, indicated by arrows, in M2 mutant plant, a wax mutant's trait.

54

Figure15. Wax mutant selection in M2 generation on the basis of wrinkled leaves (A). Wild plant leaf, showing smooth margins, (B). M2 mutant plant leaf, with wrinkled margins, indicating by arrows, a wax mutant's trait.

55

Figure16. Wax mutant selection in M2 generation on the basis of stomatal indices. Comparison of wild (cont) and M2 mutant plants stomatal indices measured. Wax mutants showed increased stomatal indices compare to wild.

55

Figure17. Wax mutant selection in M2 generation on the basis of wax Gravimetric analysis. Gravimetric analysis and comparison in epicuticular wax load of wild (cont) and M2 mutant plants. Wax mutants have less wax load compared to wild.

56

Figure18. Hexane treated wild plant leaf (adaxial), showing no wax deposition. Arrow indicating stoma. Bar=5µm

58

Figure19. Wild plant (adaxial) leaf showing wax stripy layers (indicated by arrows). Bar= 5µm

59

Figure20. Cotton (G. arboreum) wax mutant (GaWM1) leaf (adaxial) showing alteration in wax deposition (dull thick embedded fiber like, indicated by arrows). Bar=5µm

59

Figure21. Cotton (G. arboreum) wax mutant (GaWM2) leaf (adaxial), showing alteration in wax deposition (irregular patches, indicated by arrows). Bar=5µm

60

Figure22. Cotton (G. arboreum) Wax mutant (GaWM3) leaf (adaxial) showing alteration in wax deposition (thin layers, indicated by arrows). Bar=5µm

60

Figure23. A portion of the cotton (G. arboreum) wild plant leaf total wax GC-MS TIC (total ion current trace), showing more wax concentrations in the form of peaks

62

Figure24. A portion of the cotton (G. arboreum) wax mutant (GaWM1) leaf total wax GC-MS TIC (total ion current trace), showing less wax concentrations compare to wild type in the form of peaks.

62

Figure25. A portion of the cotton (G. arboreum) wax mutant (GaWM2) leaf total wax GC-MS TIC (total ion current trace), showing less wax

63

XII

concentrations as compare to wild type in the form of peaks

Figure26. A portion of the cotton (G. arboreum) wax mutant (GaWM3) leaf total wax GC-MS TIC (total ion current trace), showing less wax concentrations compare to wild type in the form of peaks.

63

Figure27. Comparison of leaf total wax load in cotton (G. arboreum) wild and wax mutant plants (GaWM1, GaWM2, GaWM3)

64

Figure28. Comparison of cotton (G. arboreum) leaf epicuticular wax classes in wild and wax mutant (GaWM1, GaWM2, GaWM3) plant

67

Figure29. G. arboreum wild (Wt) and wax deficient mutants (GaWM1, GaWM2, & GaWM3) plants. The three wax mutants showing little glossiness as compare to wild (Wt) plant

69

Figure30. Comparison of hair-like trichomes (indicated by arrows) in cotton (G. arboreum) wild and wax mutant (GaWM1, GaWM2, & GaWM3) plants. Wax deficient mutants have showed more hairy trichomes than wild.

70

Figure31. Total RNA from cotton (G. arboreum) plant, showing two intact rRNA bands with mRNA smears.

71

Figure32. Nanodrop plots showing cotton (G. arboreum) total RNA, the single peak is the evidence of purity

71

Figure33. dscDNA synthesized for cDNA library construction resolved by gel electrophoresis for the size selection ≥ 1000 bp (1kb). M= 1Kb DNA ladder

72

Figure34. Confirmation of clones by PCR amplification Lane 1-96, PCR amplified cDNA clones M = 1Kb DNA Ladder

74

Figure35. A single sequenced clone from G. arboreum cDNA library, showing quality of sequence

75

Figure36. cDNA library sequences homology search result against non-redundant database (using BLASTN program)

76

Figure37. GO Molecular Functional categorization by annotation 78

Figure38. GO Cellular components categorization by annotation 78

Figure39. GO Cellular processes categorization by annotation 78

Figure40. Qualitative and quantitative confirmation of microarray target by Nanodrop (ND-1000).

80

XIII

Figure41. Microarray image showing hybridization of wild and wax deficient mutant (GaWM3) labeled cDNAs on cotton (G. arboreum) cDNA platform

81

Figure42. R-I plot for Raw Data on left and normalized data on right 82

Figure43. BLAST results for forty (40), wax potential candidate ESTs, against protein, nucleotide and EST databases

83

Figure44: Relative fold expression of Wax potential candidate ESTs in leaves of wild and wax mutant (GaWM3) cotton plants through Real-time PCR. Solid bars represent FAM (carboxyfluorescein) signals during the reaction

86

Figure45. Cotton (G .arboreum) wax potential candidate ESTs Cellular component categorization by GO annotation

88

Figure46. Cotton (G .arboreum) wax potential candidate ESTs Molecular Functional categorization by GO annotation

88

Figure47. Cotton (G .arboreum) wax potential candidate ESTs Biological Process categorization by GO annotation

88

Figure48. The expressional profile of wax potential candidate ESTs and their Arabidopsis orthologs (under biotic, abiotic & UV stresses), validating and strengthening of their candidateship

90

XIV

LIST OF TABLES

Table1. Actual Surface Water Availability (Million Acre Feet (MAF)

6

Table2. Plant groups with mutagenic treatments and pre-soaking time.

23

Table3. Sequences of the primers used in Real-time PCR with their GenBank Acc_No. and product sizes.

45

Table4. 50% seed germination doses of the physical, chemical mutagens and their combinations.

47

Table5. Selected wax mutant Lines with traits of selection and No: of plants in M2.

52

Table6. Wild cotton (G. arboreum) leaf epicuticular wax components and their retention time (Rt).

65

Table7. Leaf epicuticular wax classes in cotton (G. arboreum) wild and wax mutants (GaWM1, GaWM2, & GaWM3 )

67

Table8. Cotton (G. arboreum) biotic and abiotic stress responsive ESTs, their annotations and E-values

79

Table9. Cotton (G. arboreum) wax potential candidates ESTs, their accession numbers, mean expression ratios (log2), p values and homology with NCBI GenBank against nucleotide, EST and protein data bases.

84

XV

ABBREVIATIONS

mRNA Messenger ribonucleic acid

RNA Ribonucleic acid

DNA Deoxyribonucleic acid

cDNA Complementary Deoxyribonucleic acid

Cy3 Cyanine 3

Cy5 Cyanine 5

dNTP Deoxy nucleotide triphosphate

aadUTP Amino allyl Deoxy uridine triphosphate

ABA Abscic acid

LEA Late embryogenesis abundant

BSA Bovine serum albumin

TE Tris EDTA

EDTA Ethylene diamine tetra acetic acid

CTAB Cetyl Trimethyl Ammonium Bromide

PVP POLYVINYLPYRROLIDONE

SDS sodium dodecyl sulfate

DEPC Diethyl pyro carbonate

DTT Dithiothretol

SEM Scanning electron microascopy

GCMS Gas chromatograph mass spectrophotometer

EMS Ethyl methane sulphonate

DES Diethyl sulfate

SA Sodium azoid

Gy Gray

RT Reverse transcriptase

Rt Retention time

MS Mass spectra

LB Luria-Bertani

PCR Polymerase chain reaction

MIDAS Microarray data analysis system

MeV MultiExperiment Viewer

SSC Saline sodium citrate

XVI

SSTE Saline sodium tris EDTA

PCI Phenol chloroform isoamyl alcohol

UV Ultraviolet

ssDNA Single stranded deoxyribonucleic acid

dscDNA Double stranded complementary deoxyribonucleic acid

C Carbon

CAT Chloramphenicol O-acyltransferase

FAE1 Fatty acid elongation1

MMLV Moloney Murine Leukemia Virus

Pfu Pyrococcus Furiosus

Cfu Clone forming units

LET Linear energy transfer

cer Eceriferum

EST Expressed sequence tags

AARI Ayub Agriculture Research Institute

CEMB Centre of Excellence in Molecular Biology

PARAS Pakistan Radiation Services

PST Pre-soaking time

BSTFA Bis-(N,N-trimethylsilyl)-trifluoroacetamide

SOC Super Optimal broth with Catabolite repression

TAE Tris-acetate-EDTA

rpm Round per minute

DMSO Dimethyl sulfoxide

His Histidine

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GO Gene Ontology

SGD Seed Germination Dose

TIC Total ion current

kb Kilo-bases

VLCF Very long chain fatty acid

XVII

ACKNOWLEDGEMENTS

I am extremely grateful to almighty “ALLAH” whose bountiful blessing enabled me to

complete this research project as well as to write this thesis. He bestowed us with his "HOLY

QURAN", and prophet “MUHAMMAD” (Peace be upon him), who enlightens the hearts of us

in our lives. I wish to acknowledge several key figures that contributed much to my research

endeavor.

Firstly, I would like to acknowledge my gratitude to our greatly erudite and dignified

Professor Dr SHEIKH RIAZUDDIN, Director National Center of Excellence in Molecular

Biology, University of Punjab, for his compassion and help for the Ph.D. enrollment and

providing all necessary facilities during my research work.

I would like to express my heartful thanks to my kind and worthy supervisor Dr.

TAYYAB HUSNAIN Professor National Centre of Excellence in Molecular Biology,

University of the Punjab for his continuous support and encouragement from the

commencement to the submission in the present research studies. His wide knowledge and

logical way of thinking have been of great value for me. His understanding, encouraging and

personal guidance have provided a good basis for my research studies.

My gratitude is also extended to Dr. Bushra Rasheed and Dr. Ahmad Ali Shahid, for

their inspiring guidance and all that I learned from them in theory and practical research.

I would like to thank Dr. Zia-ur-rehman (PCSIR, Lahore) for GC-MS analyses and Dr.

Riaz (Director, Central Resources Lab, university of the Peshawar) for providing Scanning

Electron Microscopy (SEM) facilities.

Many thanks go in particular to Muhammad Irfan, Miss Muzna Zahur, Miss Assma

Maqbool and Miss Uzma Qaiser for their help, guidance, cooperation, advice, discussion and to

their critical comments during my research studies. I gratefully thank Mr. Abdul Qayyum Rao,

and Mr. Allah Bakhsh for their advice and guidance.

XVIII

Special thanks to my lab fellows, Mr. Adil Jamal, Mr. Naveed Shaid, and Miss Benish

Aftab, for their assistance and kind behavior.

I also want to thank Muhammd Ilyas (Scientific assistant), Muhammad Nisar,

Muhammad Azam (Lab Attendents), Muhammad Mumtaz and Muhammad Nazir (Field

assistants) for their assistance and timely help in lab and field work.

I would also like to thank my family and friends. Without their emotional support, this

project would not have been possible. Finally, I would like to thank my mother, brothers,

sisters, wife, daughter, sons and especially my cousin, Mr. Muhammad Ayub Barozai for their

endless love and sacrifice. This work is as much their as it is mine.

Muhammad Younas

XIX

SUMMARY The plant epicuticular wax acts as a first line of defense against various biotic and

abiotic stresses. The wax genes identification in one of the most drought tolerant cotton species

(Gossypium arboreum) can help in the development of stress tolerant plants. For this purpose

cDNA microarray is one of the best techniques to find out differentially expressed genes in wax

mutant and wild cotton (G. arboreum) plant. Physical and chemical mutagens like: gamma rays,

EMS, DES and SA (sodium azoid) were used to develop wax mutants. Three wax mutants were

confirmed by Scanning Electron Microscopy (SEM) and Gas Chromatography-Mass

Spectrophotometer (GC-MS). The epicuticular wax appears as smooth stripy layers in wild

cotton plant adaxial leaf under scanning electron microscopy. The GaWM1, GaWM2 and

GaWM3 cotton wax mutants have altered wax morphology from smooth strips to embedded

tubules/fibers, irregular patches and non-stripy smooth layers, respectively. The total wax load

on wild cotton plant is 183.7 ± 8.72 µgcm-2. The total wax load is 66.79% on GaWM1, 59.50%

on GaWM2 and 49.29% on GaWM3 as compared to wild. Its means there is 33.21%, 40.50%

and 50.71% reduction in total wax load, respectively. On the basis of total wax load reduction in

mutants, GaWM3 was selected for further studies. In the present study, cotton (G. arboreum)

leaf epicuticular wax chemical composition consists of alkanes, acids, esters, aldehydes

alcohols and unknown classes. The dominant wax class found in G. arboreum is alkane

following by acids, esters, aldehydes and alcohols. The alkane is 74% to total wax load in wild

cotton plant. 1,2-Benzenedicarboxalic acid, mono (2-ethyl hexyl) ester is found as the major

dominated wax component following by docosane, heneicosane, hexacosane, octadecane and

eicosane of the n-alkane family in asiatic diploid cotton (G. arboreum) leaf epicuticular wax. A

cDNA library from wild plant has been constructed. Ten thousands clones were randomly

picked and PCR amplified. The inserts size was found in a range of 1-1.5 kb. Seven hundred

seventy eight (778) clones were sequenced. Seventy eight percent (78%) clones didn't show

XX

significant homology to GenBank non-redundant database. It showed the potential of cotton (G.

arboreum) genome for the identification of new genes. Eleven percent (11%) clones have

homology with Arabidopsis, six percent (6%) with Gossypium and five percent (5%) showed

homology with other plants. Important biotic and abiotic stress tolerance gene classes like; ROS

scavengers, transmembrane protein, osmoprotectants, SOS, late embryo-abundant protein

(LEA), transcription factors, heat shock proteins and Lipocalin were found in the cDNA library.

The clones (amplified PCR products) were printed in duplicate at an expected ratio of 9,264

spots per microarray chip. The labeled cDNAs were prepared from total RNAs of wild and wax

mutant cotton plant. These labeled cDNAs were hybridized to cDNA chips, scanned and data

were analyzed. Forty (40) clones (as candidate of wax genes) were found down regulated in

wax mutant (GaWM3). The microarray results were validated by Real-time PCR. The EST

sequences of potential candidates for wax genes were BLAST to NCBI GenBank for their

homology search against nucleotide, EST and protein data bases, using BLASTX and

BLASTN. Out of forty, ten (10) ESTs were novel (didn’t showed any homology) to NCBI

GenBank nucleotide, EST and protein data bases. Eighteen (18) have shown homology in all

the three databases. Ten (10) have shown homology to only EST data base, one (1) to EST and

protein data bases and one (1) to nucleotide and protein data bases.

Functionally annotation clustered, forty (40) wax potential candidate ESTs into novel (10),

functionally unknown (10), involve in signaling pathway (5), lipid associated (4) and

miscellaneous (11).

CHAPTER: 1

INTRODUCTION

1

1. INTRODUCTION

Cotton is the world's leading source of natural fiber. Its contribution is mainly to textile

industry. It also plays a part in oil and bio-energy production (Zhang et al. 2008). The cotton genus

Gossypium is mainly consist of diploid species (45 species, 2n = 26) with allotetraploid species (5

species, 2n = 4x = 52). Two tetraploid species (G. hirsutum L. & G. barbadense L.) and two diploid

species (G. arboreum L. & G. herbaceum L.) are in normal agriculture practices. Ninety eight

percent (98%) world's cottons are produced by the tetraplod species, G. hirsutum & G. barbadanse,

and two percent (2%) by diploid species G. arboreum & G. herbaceum. Although the diploid

cotton species shares just 2% to the world cottons but are the vital source of important biotic and

abiotic resistant genes with superior agronomic and fiber characters. They also provide best

approach to study the Gossypium genome response to various biotic and abiotic stresses through

advanced technique of molecular biology (Sakhanokho et al. 2004). Among the diploid species,

especially, desi cotton (G. arboreum L.) has built-in desirable resistant genes for various biotic and

abiotic stresses like; drought, root rot, CLCV and insect pests (bollworms and aphids) (Mansoor et

al. 2003, Wheeler et al. 1999).

The importance of cotton can hardly be over emphasized in the economy of Pakistan. Cotton

is among the major resources of foreign exchange earning that accounts for 7.5 percent in

agriculture and about 1.6 percent to the country GDP. Almost two thirds of the country’s export

incomes are from the cotton goods and textiles which contribute more than $2.5 billion to the

country financial system, while hundreds of ginning factories and textile mills in the country

mainly depend upon cotton. Pakistan is among the top four cotton growing countries, who are the

responsible for production of 2/3 world’s cotton (Zhang et al. 2008). Presently in Pakistan, there is

2

9.3 percent reduction in the cotton crop due to various reasons, including biotic and abiotic stresses

(Economic Survey 2007-08).

In this stares we required those cotton varieties which resist these biotic and abiotic stresses.

This resistance in cotton to various stresses can be gained by improving the cotton plant through

stress resistant genes. The identification of stress resistant genes toward stress tolerant cotton is the

former step. There are several classes of genes for stress tolerance like transcription factor,

antioxidant, heat shock proteins, ion transporters, LEA protein, osmolyte (Wang et al. 2003), and

epicuticular wax genes (Jenks et al. 1994).

Epicuticular wax is one of the special features developed by plants to seal the aerial organs to

face and tolerate various biotic and abiotic stresses. It serves as a first line of defense to avoid non-

stomatal destructive water loss (Baur, 1998). The epicuticular waxes also contribute to other

additional functions in plant protection like, ultraviolet (UV) light reflection (Reicosky & Hanover,

1978, Kakani et al. 2003), restrict the attachment and growth of insects (Müller, 2006), increased

plant resistance against pathogens like bacteria and fungi (Carver & Gurr, 2006) and decreased

water deposition on the surface of the plant thus reducing retention of dust, pollen and air pollutants

(Kerstiens, 1996).

The plant epicuticular wax genes identification through molecular biology advances are

linked with the analyses of epicuticular wax mutants (Kunst et al. 2003). Deficiencies in the wax

layer are easily visible because mutant plants have a glossy appearance. This trait has become a

precise genetic marker, and several mutants affected in wax biosynthesis and deposition have been

isolated and studied in different plant species (Mariani et al. 2000). Various physical and chemical

mutagens have been used to develop wax-deficient mutants in various plant species like,

3

Arabidopsis (Koornneef et al. 1989), sorghum bicolor (Jenks et al. 1994), barley (Hordeum

vulgare) (von Wettstein-Knowles 1987), and maize (Zea mays)( Bianchi et al. 1978). According to

the literature the maximum number of identified loci involved in wax production and deposition

was reported in barley, which are 85. Next is Arabidopsis, with total 25 known wax mutants

showing different degrees of waxlessness is reported. The wax mutant varieties in Arabidopsis and

sorghum were produced by chemical and physical mutagens. Sorghum bicolor wax mutant plants

were produced by induced mutagenesis through diethyl sulfate and ethyl methane sulphonate

(Jenks et al. 1994) and in Arabidopsis through ethyl methane sulphonate (Koornneef et al. 1989).

Microarray provides an enormous stage for the identification of differentially expressed genes

in wild versus mutants (Girgis et al. 2007, Costaglioli et al. 2005). The microarray is basically used

for the differentially expressed gene studies (Hughes et al. 2001). Oligonucleotides and cDNA

based microarrays have great potential, for un-raveling gene functions and applications in various

fields of basic and applied research (Rishi et al. 2002). Transcriptional response of a genome

against a specific mutational event or environmental insult can be better understood using the

microarray technology. This technique has already been applied for identification of differentially

expressed genes in cancer and non-cancer, tissue and organ development, abiotic, biotic stresses,

chemical and toxicity treated organisms coupling with forward and reverse genetics (Alignan et al.

2006, Wu et al. 2005, Seki et al. 2002, Beth et al. 2005)

The present study is aimed to achieve a better understanding of the genes involved in wax

production and deposition in Gossypium arboreum leaves. An approach to develop epicuticular

wax mutants, construction of cDNA library from wild plant leaves and differential screening

through cDNA microarray was used. Potential wax candidate genes were identified along with

sequencing and blasting against already known genes.

CHAPTER: 2

REVIEW OF LITERATURE

4

2. REVIEW OF LITERATURE

2.1. COTTON

The word “cotton” is a modified form of “al qatan” (an Arabic word). No one knows how old

the cotton plant is. One of the first archeological discoveries of cotton usage in the world is located

in Pakistan at Mohenjo Daro. This site is over 5000 years old. Present day breeding and selection

are a continuation of the domestication process. The cotton plant is perennial tree but has been

domesticated to be grown as a pseudo-annual shrub. Wild species of cotton generally occur in frost-

free areas of the subtropical and tropical regions. Freezing temperatures kill the protoplast of all

cultivated species and most wild species. Therefore, cotton is a warm climate crop. It is planted in

spring or early summer and harvested in late fall or early winter. Cotton is sun loving plant but not

a water loving plant. Water requirements of cotton depend on weather conditions, but a successful

cotton harvest require at least 75cm of rain or irrigation water on average cotton is primarily grown

between 37 degree north and 32 degree south (ICAC, http://www.icac.org/cotton).

Cottons (Gossypium spp.) is a member of the genus Gossypium and the family Malvaceae.

Gossypium has 45–50 species. Majority of the species are diploids (2n = 26). Five (5) species are

allotetraploids (2n = 52). The species are clustered into eight (8) genome groups, referred as A to G

and K, on the basis of chromosome pairing affinities (Endrizzi et al. 1984). The species, referred as

(AD)1 to (AD)5 on the basis of their genome constitutions. Phylogenetic studies grouped the

diploid species of Gossypium into two major lineages, one is the 13 D-genome species lineage and

the other is 30-32 A-, B-, E-, F-, C-, G-, and K-genome species lineage, and the tetraploid species

into one lineage (5 AD). Only four species, two allotetraploids (G. hirsutum and G. barbadense)

and two diploids (G. herbaceum and G. arboreum) are cultivated (Wendel and R.C, 2003).

5

Gossypium hirsutum, also called as Upland cotton, Long Staple Cotton, or Mexican Cotton,

shares more than 90% of the world’s cotton, G. barbadense, also called as Sea Island Cotton, Extra

Long Staple Cotton, American Pima, or Egyptian Cotton, shares 8% of the world’s cotton, and G.

herbaceum, also known as Levant Cotton, and G. arboreum, also known as Tree Cotton, together

contribute 2% of the world’s cotton (Jiang et al. 1998).

Cotton is not only a source of textile fiber and oilseed crop, but also has importance for foil

energy and bioengergy production. According to the Food and Agriculture Organization (FAO) of

the United Nations (http://www.fao.org), the cotton planting area is almost 35 million hectares and

the total world’s cotton production had a record of about twenty three million metric tones in

2004/2005.

G. arboreum ( A genome ), has a number of better agronomic traits, such as disease and

insect resistance, high fiber strength, and tremendous plasticity, which upland cotton cultivars lack.

Due to these reasons G. arboreum is still planted. G. arboreum is generally considered as one of the

best member of the A genome (Endrizzi et al. 1984, Wendel et al. 1995). Therefore, the G.

arboreum species is important for agricultural production, genomic and evolution research in

cotton.

General belief that G. arboreum is low yielder but in fact it can grows under the poorest

cotton growing situations and low management. Due to inherent abiotic tolerance in G. arboreum,

the effect of environmental stresses is reflected less in reduction of its acreage and product as

compared to other species. Due to this the decrease in G. arboreum between normal and stressed is

25 per cent compare to over 75 per cent in G.hirsutum (Borole, 2000).

6

Recently, Pakistan’s agriculture is suffering a lot due to the severe shortage of irrigation

water. The data for actual surface water availability during the last few years presented in table 1,

shows the decline in the actual surface water availability for both Kharif and Rabi in the range of

5.9 percent (2003-04) to 20.6 percent (2004-05) (Economic survey of Pakistan 2007-08).

Table1. Actual Surface Water Availability (Million Acre Feet (MAF)

Period Kharif Rabi Total Normal (1977-01) 67.1 36.4 103.5

2000-01 59.7 21.4 81.1 2001-02 54.7 18.4 73.1 2002-03 62.8 25.0 87.8 2003-04 65.9 31.5 97.4 2004-05 59.1 23.1 82.2 2005-06 70.8 30.1 100.9 2006-07 63.1 31.2 94.3 2007-08 70.8 27.9 98.7

In this regards we need such cotton varieties that tolerate the drought condition. This

tolerance in cotton to drought can be achieved by manipulating the cotton plant with drought

resistant genes. The identification of drought resistant genes toward drought tolerant cotton is the

first step. There are various families of genes for drought tolerance like transcription factor,

antioxidant, heat shock proteins, ion transporters, LEA protein, Osmolyte (Wang et al. 2003), and

the epicuticular wax genes (Jenks et al. 1994).

2.2. BIOTIC AND ABIOTIC RESISTANCE

Asiatic G. arboreum L (Desi cotton.) has built-in desirable genes for drought tolerance and

resistance to insect pests like bollworms, aphids and diseases like black arm, root rot and reddening

of leaves.

7

Drought is a world-wide problem, limiting global crop production and quality seriously and

recent global climate change has made this situation more serious (Apel and Hirt 2004, Chen and

Gallie 2004, Chandler and Bartels 2003, Munnus 2002). The G. arboreum has the ability to tolerate

and cope from the adverse effects of the drought (Pundir, 1972, Borole, 2000).

Root rot caused by over-watering and fungal attack. Thielaviopsis basicola is the cause of

black root rot of cotton seedlings. Upland cotton did not show resistance to black root rot (Wang

and Davis, 1997). Wheeler et al. (1999) reported diploid cotton (Gossypium arboreum) with visible

high resistance to Thielaviopsis basicola. Hence Asiatic G. arboreum L. (Desi cotton) is suitable

for dry land conditions and low input technology.

The Asiatic G. arboreum is also resistant to the leaf curl disease. The cotton leaf curl disease

is a serious threat to subcontinent cotton (Mansoor et al. 2003). The cotton leaf curl disease is

caused by geminiviruses, single stranded DNA (SSDNA) viruses with circular genomes that are

grouped in the family Geminivirdae. The whitefly-transmitted geminivirus (genus Begomovirus) is

the most import group of geminiviruses. The Asiatic G. arboreum is resistant to this virus (Yusuf et

al. 2003).

The above discussions prove that the G. arboreum is more suitable for the identification of

stress resistant genes on the basis of its tolerance to biotic and abiotic stresses. The Gossypium

arboreum has also got importance in genomic studies by sharing it’s A genome to modern upland

cotton, G. hirsutum. Its diploid nature of genome made it right choice for identification of novel

genes in genus Gossypium and mutation studies (Udall et al. 2006).

8

2.3. WAX

2.3.1. EPICUTICULAR WAX

Plant surfaces are sheltered by an epicuticular wax layer which is highly variable depending

on species, cultivar or plant part. A chemical basis advance definition of plant surface wax is as a

polyester matrix of hydroxy- and hydroxy epoxy fatty acids C16 and C18 long (cutin) embedded

and overlaid with cuticular wax. For molecular genetic analysis of wax related genes, the wax has

been defined as the “lipids which are removed from plant surfaces after brief immersion in an

organic (nonpolar) solvent, like chloroform, hexane” (Post-Beittenmiller D, 1998).

The nonwoody surfaces of plants are protected from the environmental threats by the cuticle,

a layer composed of cutin and wax (Jetter et al. 2006). This wax is both impregnated in

(intracuticular) and exterior to (epicuticular) the cutin biopolymer. Epicuticular wax may exist as a

smooth film in some species, typically rendering their surfaces glossy, or it may be textured by

protruding wax crystals in other species (Jeffree, 2006).

Plant cuticular waxes consist of complex mixtures of very-long-chain aliphatics and cyclic

compounds. The aliphatics compounds are consist of fatty acids, aldehydes, primary and secondary

alcohols, ketones, and alkanes, with chain lengths ranging from C16 to C36 in homologous series.

Along with aliphatic compounds, cyclic compounds such as triterpenoids, tocopherols, and

aromatic compounds may be present in either large or small quantities, depending on the species

(Jetter et al. 2006).

In addition to epidermal cells, on which a waxy layer is present, the fatty acids are also

present on specialized cells of plant reproductive organs. Stigmatic papillae is an example of such

specialized cell, which as wax layer (Lolle and Pruitt 1999). Sporopollenin is a much stable

9

polymer containing long-chain fatty acids and phenylpropanoids which forms the external wall of

the pollen, or the exine (Guilford et al. 1988).

2.3.2. EPICUTICULAR WAX ROLE AND SIGNIFICANCE IN PLANTS

The plants are sessile, so they did not cope from the extreme biotic and abiotic stresses by

physical motion as the animals. They developed special features to face and tolerate these stresses.

Epicuticular wax is on of them, which acts as a first line of defense to prevent non-stomatal harmful

water loss, which is the primary function of the cuticle (Baur, 1998). Other secondary functions in

plant protection have been also suggested for epicuticular waxes, such as ultraviolet (UV) light

reflection (Reicosky & Hanover 1978, Kakani et al. 2003), first physical barrier faced by external

organisms, the wax likely plays a role in plant–insect (Müller 2006) and plant–pathogen

interactions (Carver & Gurr 2006).

The chemical components of epicuticular waxes are involved to form a continuous

hydrophobic water barrier, which obstructed water loss from plant organs. Reduced amounts of

epicuticular wax on plant surface have been shown to be associated with increased rates of

transpiration. Brushing waxes off the excised leaves significantly increased the rate of water loss

(Hall and Jones 1961). Similarly, leaves of rice (Oryza sativa), dipped for two seconds in

chloroform to remove epicuticular waxes, and exhibited more than a two fold increase in cuticular

conductance to water vapor compared to control leaves (O’Toole et al. 1979a). Leaf glaucousnees

(waxinees) is a characteristic that has been referred as a plant adaptation to drought (Johnoson et al.

1983). The leaf epicuticular wax layer thickness has been shown to increase by as much as 30-40%

with exposure to water deficit in various plant species (Oosterhuis et al. 1991a, Weete et al. 1978).

10

The epicuticular wax not only prevent non-stomatal water loss, sheltered plants against

ultraviolet radiation (Reicosky et al. 1978) and decreases water deposition on the surface of the

plant thus reducing retention of dust, pollen and air pollutants (Kerstiens G. 1996). In addition,

surface wax also plays important roles in plant tolerance against pathogens like bacteria and fungi

(Jenks et al. 1994) and resist in a variety of plant-insect interactions (Eigenbrode et al 1995).

The epicuticular wax layer of plants has been involved to manipulate the foraging success of

natural predators (Eigenbrode 2004). For example, on wax-deficient pea mutants, Aphidius ervi

spent more time actively foraging and a larger number of aphids were parasitised than on wild

plants (Chang et al. 2004). The accumulation of epicuticular waxes on the plant surfaces is helpful

in reducing the foraging success of predators or parasitoids by limitizing their attachment to plant

surface. Abridged wax loads regularly linked with better insect attachment to the plant surface

(Eigenbrode and Jetter 2002). For the evaluation of foraging success of natural enemies there

should be a consideration of potential effects of the wax layer on kairomone detectability alongwith

the attachment differences.The biological control of pests and efficiency of parasitoids can be

improved by the selection of crop plant varieties with higher wax contents on aerial parts (Rostás et

al. 2008).

2.3.3. EPICUTICULAR WAX GENES

Molecular biology advances in identification of plant epicuticular wax genes are linked

with thorough biochemical analysis of mutant phenotypes. Deficiencies in the wax layer are easily

visible because mutant plants have a glossy appearance. This glossy trait has become a precise

genetic marker, and several mutants affected in wax biosynthesis have been isolated and studied in

different plant species (Mariani et al. 2000).

11

The gene encoding an aldehyde decarbonylase, a key wax biosynthetic enzyme involved in

the conversion of aldehydes to alkanes was thought to be a reason in decreased intensity of alkanes,

secondary alcohols and ketones and high aldehyde levels on the surface of cer1 mutants (McNevin

et al. 1993), but the cloning of CER1 gene did not confirmed this prediction (Aarts et al. 1995).

Moreover, CER1 is the homologue of EPI-23, a Kleinia odora epidermis-specific protein

(Kolattukudy et al. 1996) and GLOSSY1 (GL1) protein of maize (Zea mays) (Hannoufa et al. 1993)

which have 5-7 predicted transmembrane domains. On this basis they may be considered as

membrane transporters engaged in wax secretion (Hansen et al. 1997).

The wax composition in cer2 suggested an obstructs in the elongation of fatty acids C26

(Hannoufa et al. 1993). When the CER2 gene was isolated (Xia et al. 1996, Negruk et al. 1996), the

resulted amino acid sequence had no homology to any previously known gene product, giving no

idea of its biochemical function. With the passage of time and advances in the nucleic acid and

protein databases, however, suggested that CER2 may be a member of a large family of coenzyme

A-dependent acyltransferases (St-Pierre et al. 1998) that act by a catalytic mechanism related to

chloramphenicol O-acyltransferase (CAT). This prediction is based on two highly conserved

consensus motifs, one of which is belong to the catalytic site of CAT.

Attempts to find out the biochemical function of CER3 were also not easy. The epicuticular

wax of the cer3 mutant showed an increase in the chain length of primary alcohols and alkanes, it

means a fault in the discharge of fatty acids from fatty acid elongation complexes (Hannoufa et al.

1993, Kolattukudy et al. 1996). When the CER3 gene is sequenced and in-siliko translated, it

showed no homology with proteins of known function, it has a putative nuclear localization

sequence (NLS) (Hannoufa et al. 1996). It had also two predicted phosphorylation sites, known to

be involved in transport of proteins to the nucleus (Lemieux et al. 1996). On the basis of NLS

12

sequence in CER3 gene and expression in all tissues, it is considered to encode a novel regulatory

protein. The bioinformatics analysis of in-situ translation of CER3 sequence shows its homology

with E3-ubiquitin ligases engaged in the N-end rule pathway (Kwon et al. 1998).

Similarly, seven fold increases in the levels of C24 acyl groups were observed in the CER6

wax mutant plants, over wild type levels. It is suggesting that the product of the CER6 gene has a

role in the elongation of acyl chains longer than 24 carbons (Millar et al. 1999). Cloning of the

CER6 gene (Millar et al. 1999, Fiebig et al. 2000) showed that CER6 encodes an elongase

condensing enzyme involved in the synthesis of very long chain fatty acid precursors for stem and

pollen epicuticular wax deposition.

A wide-ranging of mutant monitor for alteration in very long chain fatty acid composition in

Arabidopsis seeds resulted in identification of a single class of mutants with a defect in the gene

referred as fatty acid elongation1 (FAE1). The FAE1A mutation affected only seed VLCFA

composition, is a clue that FAE1 was particularly has a role in VLCFA elongation reactions in the

seed (Kunst et al. 1992). Cloning and following characterization of the FAE1 gene (Millar et al.

1997) showed that it code for only a condensing enzyme and not all four functions of the elongase.

Till now, three (3) similar enzymes: KCS1 (Tood et al. 1999), FIDDLEHEAD (FDH) (Yephremov

et al. 1999) and CER6 (Millar et al. 1999, Fiebig et al. 2000) have been finding out in the synthesis

of VLCFA precursors for wax production in plant shoots. The maize wax mutant, showing a

decreased level of wax ester components longer than C24, suggested a mutation at the GL8 locus

(Kunst et al. 2003). The GL8 gene was isolated by transposon tagging and suggested to encode a

reductase involved in fatty acid elongation (Xu et al. 1997). Beaudoin et al. (2002) confirmed that,

the maize GL8 functions as a b-ketoacyl-reductase of the FAE has a role in wax deposition.

13

2.3.4. EPICUTICULAR WAX AND COTTON

The upper and lower surfaces of the cotton leaf are sheltered with an amorphous layer of

cuticle with plentiful epicuticular wax ridges (Wullschleger and Oosterhuis 1989, Oosterhuis et al.

1991b). The leaf epicuticular wax layer thickness in cotton is about 30µm, and this thickness has

been found to increase by as much as 30% with treatment of dehydration (Oosterhuis et al. 1991a,

Weete et al. 1978). The water stress increases the wax deposition on the leaf; bract and boll of

cotton (Gossypium hirsutum) that act as barrier against non-stomatal water lose. The increase in the

wax concentration on the leaf was 68.57%, on bract 46.8% and on boll was 4.1% only (Bondada et

al. 1996).

According to Bondada et al. (1996) the long chain alkanes like, n-octacosane, n-nonacosane,

n-triacontane, dotricontane, and n-tetracontane were the chief constituents of the water stress leaf

epicuticular wax. Similarly, the bract wax contained n-octacosane and n-tricontane. n-octacosane,

n-nonacosane and n-tricontane were present as major constituents of long chain alkanes in boll.

Scanning electron microscopy showed that the leaf, bract and boll have similar wax morphology

under both water stressed and well watered condition. The cotton leaf epicuticular wax also

increased, when exposed to UV-B radiation (Kakani et al. 2003).

2.4. MUTATION

2.4.1. INDUCED MUTATION

Mutagenesis is described as the exposure or treatment of biological material to a mutagen, i.e.

a physical or chemical agent that raises the frequency of mutation above the spontaneous rate

(Rieger et al. 1991). Physical and chemical mutagens have been successfully used in plant breeding

programs to generate genetic variation for the development of new varieties with improved

14

characters such as increased yield, earliness, reduced plant height, and resistance to diseases

(Maluszynksi 2001). In recent year, mutation induction became also a powerful tool for

investigation of gene function and expression (Li et al. 2001).

Mutation is a random process at the single cell level. Therefore, the population size of the

M1 and M2 generation must be sufficient to manage with the working objective. This size depends

on the probability to generate the desired mutants and on the inheritance pattern of genes (Brock

1977). The increasing mutagen dose causes a reduction in germination or emergence, length of

root, seedling height, survival and fertility in M1 plants (Brunner 1995). Delayed germination may

be observed in mutagenized seeds as compared to control. When planting seeds in soil, emergence

is taken as the mutagenic criterion instead of germination. Germination is not a good indicator for

an effective dose, because in the initial stage of germination mainly performed organs are

developing, a process that is fairly insensitive to mutagenesis. Only in the phase of active cell

division the effects of mutation is shown (Mick et al. 1997).

Selection of mutants having desirable traits starts in M2 population or in the M3 on the

basis of segregating. Only dominant mutation, that is very rare, can be selected in M1. Alkylating

agent like diethylsulfate and ethyl methane sulphonate (DES and EMS) has been shown to be very

effective and efficient mutagen (Heslot et al. 1961) and has probably become the most popular

chemical mutagen. Alkylation’s of DNA leads to the development of unstable trimesters, which

discharge the alkyl group and interface with DNA replication. Sometimes the phosphate trimesters

are hydrolyzed to produce sugar and phosphate, which causes the breakage of the DNA backbone.

Alkylation’s of nitrogen bases occurs as well, as the reaction with guanine at the N-7 position is the

most frequent event followed by adenine at N-3 and cytosine at N-1. Alkalized guanine is assumed

to ionize differently than the normal guanine, and in such way that guanine can pair with thymine,

15

thus leading to base pair error. The alkalized guanine can be separated from the deoxyribose

leaving it depurinated. Depurination will leave a gap in the DNA template, thus after replication,

either a deletion will result, or any of the four bases may be inserted in the new strands opposite to

deletion (Siddique and Khan 1999).

Gamma rays are a kind of electromagnetic waves of very short wavelength and are

obtained by breakup of the radioisotopes Co-60 or Cs-137. Gamma rays source are suitable for seed

irradiation. Gamma rays produce a few ionizing radiations (Brunner, 1991). When these radiation

passes from biological material, physical processes such as ionizations (ejection of electrons from

molecules) and excitations (process of raising electron to a higher energy state) occur and lead to

damage the DNA. Secondary, chemical events are also take place that start with the formation of

activated molecules, called as free radicals (OH and H) (Van Harten 1998). In case of low LET

(linear energy transfer (LET), which is the transfer of energy along the ionizing track) radiation, the

formation of peroxyradicals is favored. In high LET radiation, the formation of hydrogen peroxide

(H2O2) by recombination of free radicals is favored that causes DNA adducts.

The physical and chemical mutagens were used for a number of plants to produce mutant

varieties (Odeigah et al. 1998, Parsad 1979, Henikoff et al. 2003).

2.4.2. WAX MUTANTS

The epicuticular wax genes identification through molecular biology approaches are coupled

with the analysis of wax mutant phenotypes. Most wax mutants have visual morphology similar to

wildtype, except for their glossy appearance.

Dellaert et al. (1979) identified the first epicuticular wax mutants in Arabidopsis and referred

them as eceriferum (cer), which in Latin is “without wax”. The first allelism studies were reported

16

by Koorneef et al, (1989). A common pleiotropic effect of wax mutations is reduced fertility in

water stressed condition that can be restored by providing high humidity environments, as observed

in cer1, cer2, cer3,cer6, cer8, cer9, cer10, cer22, cer25, ded, and wax1 (Koorneef et al. 1989).

Experiments on cer2 and cer6 showed that this infertility is male gamete specific and that the

mutant pollen coats didn't have certain waxes (Preuss et al. 1993).

Sixty percent reduction of wax contents in cer2, a wax deficient mutant Arabidopsis plant,

was noted by the analysis of waxes of several cer mutants in comparison to the wild plants

(Hannoufa et al. 1993), with a significant decrese in aldehydes, alkanes, secondary alcohols, and

ketones that was two or four carbons shorter than that in wild-type plants. The similar features were

also observed in cer6 mutants.

Wax-deficient mutants have been isolated in a number of plant species, including barley

(Hordeum vulgare), Arabidopsis, maize (Zea mays), and Brassica napus. The mutant loci in barley

and Arabidopsis are so-called eceriferum (cer), whereas loci identified in maize and B. napus are

termed as glossy.

Eighty five (85) cer loci were identified in Barley (Kunst 2003). In Arabidopsis, there are

currently 25 known cer mutants displaying varying degrees of waxlessness are reported. cer1 to

cer10 have very glossy appearance and cer 11- cer22 are displaying less glossy (Koornneef et al.

1989). Complex alterations in wax composition in the majority of wax-deficient mutants may be a

outcome of the visual displays engaged to identify lines with reduced wax loads. Only mutants with

considerable reduction in epicuticular wax deposition would be identified in such a screen, most

likely those with defects in regulatory genes, or genes affecting epidermal development. Mutants

17

affecting individual biosynthetic enzymes would be difficult to find due to their subtler biochemical

phenotypes.

The wax mutant varieties in Arabidopsis and maize were produced by chemical and physical

mutagens (Koorneef et al. 1989, Jenks et al. 1994). Sorghum bicolor wax mutant plants were

produced by induced mutagenesis through diethyl sulfate and ethylmethanesulfate (Jenks et al.

1994) and in Arabidopsis through ethylmethanesulfate (Koornneef et al. 1989).

2.4.3. MUTANTS AND GENES IDENTIFICATION

Mutagenesis is a powerful tool for gene identification in the field of forward genetics. A

number of mutants were used in plants and animals for understanding the functions of nucleic

acids. The metabolic, developmental and regulatory genes were identified in an Arabidopsis carbon

and light insensitive (cli) mutants that is specifically affected in the integration of both carbon and

light signals (Thum et al. 2008). Many genes of the autonomous floral-promotion pathway (AP)

were identified in Arabidopsis AP mutants (Veley and Michaels 2008).

The Arabidopsis wax mutants (cer) were used to understand the unrevealed genes involved in

the wax biosynthetic pathway. The fatty acid desaturases and alkane hydroxylase genes were

identified in the cer1 mutant. The cer2 mutants played role in identification of cuticular wax

accumulation genes. Similarly the fatty acid elongase (FAE1) related genes were identified in cer6

Arabidopsis mutant (Samuels et al. 2008).

2.5. MICROARRAY

In microarray-based technologies, hundreds to thousands of DNA (probe) spots immobilized

on the solid surface, like glass slide, can be simultaneously hybridized with two samples (targets)

labeled with different fluorescent dyes. The terms "probe" and "target" have been used to describe

18

immobilized DNA on slide and labeled cDNA or aRNA synthesized from an RNA sample,

respectively, by the group of developers (Shalon et al. 1996).

Microarray data offer an insight into the transcriptional responses of a genome to a particular

mutational event or environmental insult. The expression profile of thousands of genes can be

generated in a single experiment using Microarray-based technology. The concept of this

technology began with as an oligonucleotide array on a solid surface in the early 1990s (Fodor et al.

1991, 1993, Chetverin and Kramer 1993, Pease et al. 1994). Later, the complementary DNA

(cDNA) microarray was developed by Patrick O. Brown's group at Stanford University in 1995

(Schena et al. 1995). The technique is already applied for differentially expressed genes

identification in condition of cancer, tissue and organ development, abiotic and biotic stresses,

chemical and toxicity treated organisms, and in forward and reverse genetics (Paul et al. 2004,

Alignan et al. 2006, Yahyaoui et al. 2004, Wu et al. 2005, Brinker et al. 2004, Klok et al. 2002,

Seki et al. 2001, Seki et al. 2002, Beth et al. 2005).

2.5.1. TYPES OF DNA MICROARRAY

So for, there are two different kinds of microarray-based technologies on the basis of

immobilized nucleic acid components, i.e. the oligonucleotide array and the cDNA microarray. The

oligonucleotide array consists of oligonucleotide, generally less than 25 mer in length (Shoemaker

et al. 1996, Fambrough et al. 1999, Lipshutz et al. 1999), which are developed in-situ on a solid

surface by light-directed synthesis (GeneChip®, Affymetrix, Inc. Santa Clara, CA, USA) (Fodor et

al. 1991, Hacia et al. 1996). In contrast, the cDNA microarray is generated by the printing of PCR-

amplified cDNAs onto the solid surface. The advantages of the cDNA microarray compared with

19

the oligonucleotide array have been thought to include less susceptibility and higher specificity due

to the longer sequences of the targets (Bilban et al. 2000).

In cDNA microarrays, comparatively extended DNA molecules are spoted by high-speed

robots on a solid surface such as membranes, glass or silicon chips (Schena et al. 1995). The spoted

DNAs are amplified by the polymerase chain reaction (PCR) and usually are longer than 100

necleotides. This type of arrays is used mostly for large-scale screening and expression studies,

especially for those organisms whose genome is not sequenced. The oligonucleotide arrays are

printed either by in situ light-directed chemical synthesis or by conventional synthesis followed by

spoting on a glass substrate (Wallack 2001).

2.5.2. MICROARRAY AND MUTANTS

Microarray provides an enormous stage for the differentially expressed genes identification in

wild versus mutant plants and animals. Girgis et al. (2007) identified 36 novel genes in bacteria

responsible for the bacterial motion using mutant expressional studies through microarray.

Phytohormone genes were studied in light signaling mutants through DNA microarray (Michael et

al. 2008).

To obtain detailed information about gene expression during stamen development in

Arabidopsis (Arabidopsis thaliana), Alves-Ferreira et al. (2007) compared, by microarray analysis,

the gene expression profile of wild-type inflorescences to those of the floral mutants apetala3,

sporocyteless/nozzle, and male sterile1 (ms1), in which different aspects of stamen formation are

disrupted. These experiments led to the identification of groups of genes with predicted expression

at early, intermediate, and late stages of stamen development.

20

Similarly, Gibberellin (GA) deficient mutant (ga1-3), were used to find the DELLA target

genes during Arabidopsis flower development (Hou et al. 2008).

The expression profiling of Arabidopsis SIS7/NCED3/STO1 or SIS10/ABI3 mutants that are

tolerant to the inhibitory effects of icreased concentrations of exogenous glucose and sucrose,

depicted the downregulation of a significant number of genes in comparison to wild plants during

the seed germination. These downregulated genes are involved in auxin production or transport,

suggesting cross-talk between ABA and auxin response pathways (Huang et al. 2008).

Carrera et al. (2008) used the Arabidopsis thaliana mutants deficient in seed ABA production

or perception to understand the relationship between phytohormone, abscisic acid (ABA) and after-

ripening (AR). Although, the imbibed mutant seeds didn’t show dormancy, however, the

expression prolfiling showed remarkable up and down regulation in a set of genes as compared to

wild. A number of AR dependant and independent genes were resulted from this expressional

anaylsis of mutants.

2.5.3. MICROARRAY AND GENES IDENTIFICATION

For genes identification traditional techniques of crossing, mapping, PCR, northern and

southern blotting has limitations of few genes screening. Through microarray thousands of genes

can be screened and identified by comparison of control and experimental organism genes on

microarray chip.

Monghan et al. (2009) identified many new genes of wound healing, epigenetics, genome

stability, and nerve-dependent blastema formation in salamanders.

The expression profiling of B. cenocepacia, grown in CF sputum, revealed the pathogen

altered expression of 723 genes and its microarray analysis showed new genetic pathways involved

21

in responses to antimicrobial resistance, oxidative stress, and iron metabolism (Ian et al. 2008,

Drevinek et al. 2008). Similarly, 335 unique ESTs were identified with atleast 2 fold differential

expression through Microarray analysis of watermelon fruits during the early, ripening, or mature

stage when compared to leaf (Wechter et al. 2008).

Tommasini et al. (2008), identified 4153 barley genes responding to cold/drought stress.

Almost forty four percent genes (1,822 of 4,153) were differentially expressed under drought, while

only 3.8% (158 of 4,153) were cold responsive, 2.8% (119 of 4,153) freeze-thaw specific, and

34.1% responsive to freeze-thaw and drought.

Kloosterman et al. (2008) used a newly designed POCI (Potato Oligo Chip Initiative) array

to identify many genes involved in tuber initiation and growth in potato.

Fernandes et al. (2008), studied maize seedling transcriptome responses to six abiotic

stresses (heat, cold, darkness, desiccation, salt, ultraviolet-B). They identified that a total of 384

ESTs were expressed in all stresses and not present in light-grown seedlings, 146 ESTs were

present in light-grown seedlings and absent from all stress treatments.

Pavy et al. (2008) identified 360 xylem-preferential genes using White spruce transcript

profiling experiments that compared secondary xylem to phloem and needles. Several spruce genes

have not previously been linked to xylem differentiation (including genes encoding TUBBY-like

domain proteins (TLPs) and a gibberellin insensitive (gai) gene sequence) or were shown to encode

proteins of unknown function encompassing diverse conserved domains of unknown function.

From the above literature survey it is concluded that over production of the wax has potential

to increase plant tolerance against biotic and abiotic stresses. Wax mutants have crucial role in wax

genes identification. cDNA microarray is a reasonable approach in identification of differentially

22

expressed genes in wild and mutant plants. In the present study we have focused Gossypium

arboreum as a source for the identification of wax genes and according to the literature survey any

wax gene in G. arboreum is not reported todate.

CHAPTER: 3

MATERIALS

&

METHODS

23

3. MATERIALS AND METHODS

3.1. DEVELOPMENTS OF WAX MUTANTS

Pure inbred seeds of Desi-cotton (Gossypium arboreum) variety FDH-786 were obtained

from local germplasm center (AARI, Faisalabad). Concentrated H2SO4 was used for delinting of

seeds. Seeds were continuously stirred with the help of a spatula for 10-15 min until the surface of

seeds became shiny. Some water is added and stirred again; seeds were washed five times with tap

water to remove the acid completely. The seeds were removed, which floated at the surface of

water.

3.1.1 MUTATION INDUCTION

The chemical (ethyl methane sulphonate [EMS], diethyl sulfate [DES] and sodium azoid

[SA]) and physical mutagens (gamma rays) were used to induce the mutation in G. arboreum. The

seeds were irradiated with Gamma rays (source Co-60) at Pakistan Radiation Services (PARAS)

Lahore. The various combinations of chemical and physical mutagens with different pre-soaking

time (PST) were used as shown in the Table 2.

Table 2. Plant groups with mutagenic treatments and pre-soaking time.

Label (Plant Group) Radiation Dose (γ-rays)

Chemical mutagen (Conc:)

Pre-soaking time (PST, in hour, H)

A1 50GY ------- 0H A2 150GY ------- 0H A3 250GY ------- 0H A4 350GY ------- 0H A5 500GY ------- 0H B1 50GY 0.001M EMS 8H B2 150GY 0.001M EMS 8H B3 250GY 0.001M EMS 8H B4 350GY 0.001M EMS 8H B5 500GY 0.001M EMS 8H

24

C1 ------- 0.001M EMS 0H C2 ------- 0.001M EMS 8H C3 ------- 0.001M EMS 16H X1 ------- 0.01M EMS 0H X2 ------- 0.01M EMS 8H X3 ------- 0.01M EMS 16H D1 50GY 0.001M SA 0H D2 50GY 0.001M SA 8H D3 50GY 0.001M SA 16H E1 50GY 0.3% DES 8H E2 150GY 0.3% DES 8H E3 250GY 0.3% DES 8H E4 350GY 0.3% DES 8H E5 500GY 0.3% DES 8H G1 150GY 0.001M SA 0H G2 150GY 0.001M SA 8H G3 150GY 0.001M SA 16H H1 250GY 0.001M SA 0H H2 250GY 0.001M SA 8H H3 250GY 0.001M SA 16H I1 350GY 0.001M SA 0H I2 350GY 0.001M SA 8H I3 350GY 0.001M SA 16H J1 500GY 0.001M SA 0H J2 500GY 0.001M SA 8H J3 500GY 0.001M SA 16H K1 ------- 0.001M SA 0H K2 ------- 0.001M SA 8H K3 ------- 0.001M SA 16H L1 ------- 0.1M SA 0H L2 ------- 0.1M SA 8H L3 ------- 0.1M SA 16H M1 ------- 0.3% DES 0H M2 ------- 0.3% DES 8H M3 ------- 0.3% DES 16H N1 ------- 1% DES 0H N2 ------- 1% DES 8H N3 ------- 1% DES 16H R1 ------- 0.6% DES 0H R2 ------- 0.6% DES 8H R3 ------- 0.6% DES 16H Z ------- 0.3% DES+ 0.001M SA+

0.001M EMS 16H

CONTROL/WILD ------- ------- 16H

25

Seeds of each mutagenic treatment and wild plants were sown in a separately single tray with

dimensions (76.2cm×121.9cm×15.24cm), filled with composite soil (peat, sand, soil, 1:1:1) in

CEMB green house at temperature 25±2°C, and relative humidity near 50%. Metal halide

illumination lamps (400 W) were used to supplement natural radiation. Light radiation reached a

maximum of 1,500µmpl m2s-1 at the top of canopy at midday. The plants were regularly watered on

alternate day.

The following parameters were recorded for the mutagenic studies:

1. No. of germinated plants per treatment after 7 days. The germination percentage was

calculated as:

Germenation % = [No. of germinated plants / Total No. of sown seeds] ×100

2. The lethality percentage per treatment calculated as:

Lethality % = [Total No. of sown seeds- No. of survived plants / Total No. of sown seeds] ×

100

After initial growth the M1 plants were transferred to CEMB cotton field. Each flowering bud

were covered in paper envelop for self pollination to get homogenize plants in M2.

3.1.2. WAX MUTANT SELECTION

M2 seeds were sown in the same way as mentioned above. The M2 plants were screened and

initial potential candidates of wax mutants were selected on the basis of following traits, reported

for wax mutants:

1. Glossy leaves appearance, as a phenotypic genetic marker for wax mutants (Mariani

et al. 2000).

26

2. Infertility, a pleotropic marker for wax mutant in water stress condition (Koornneef

et al. 1989).

3. Curved/wrinkled leaves and flowers size were slightly smaller than wild type

(Aharoni et al. 2004).

4. Fusion of aerial parts in mutants plant (Chen at al. 2003).

5. Rapidly chlorophyll extraction in 80% ethanol (Kerstiens et al. 2006).

Further, the following analyses were done on the initial potential wax mutant candidates.

1. Gravimetric Wax analysis, extraction and quantification by immersing leaf in non-

polar solvent like hexane and comparing it to wild plant (Sturaro et al. 2005).

2. Increased stomatal indices, wax mutants possess greatly increased stomatal indices

(Holroyd et al. 2002).

The flowers of the selected initial potential wax mutant candidate plants were covered with

paper envelop for self pollination to get homogenize seeds.

M3 seeds of the selected lines were sown in the CEMB in the same pattern as mentioned

above. The final potential wax mutant candidates in M3 plants, showing the above mentioned wax

mutant’s traits were selected for further confirmation.

3.1.3. WAX MUTANT CONFIRMATION

The final potential wax mutant candidates, selected in M3 plants, were analyzed for

confirmation. The conformation was done by Scanning Electron Microscopy (SEM) and Gas-

Chromatography - Mass Spectrophotometer (GC-MS).

27

3.1.3.1. SCANNING ELECTRON MICROSCOPY (SEM)

The leaves of the wild and final potential wax mutant candidate plants were collected at

stage of 35 days after germination (just before flowering) and processed according to Jenk at al.

(1995). The excised leaves were air dried for seven (7) days in desiccators containing silica at room

temperature. Each sample was mounted on aluminum stubs and sputter coated with gold using 120-

s bursts at 40A, twice from the sputter coater (SPI MODULE). Coated surfaces were viewed using

a JEOL JSM-5910 scanning electron microscope (JEOL) equipped with a tungsten cathode at 10

KV.

3.1.3.2. GC-MS ANALYSIS

Leaves from final potential wax mutant candidate and wild plants were cut and immediately

immersed in hexane for 60 s at room temperature. The resulting solution of cuticular waxes was

concentrated by keeping at 40ºC, and compounds containing free hydroxyl and carboxyl groups

were converted into their trimethylsilyl ethers and esters, respectively, with bis-(N,N-

trimethylsilyl)-trifluoroacetamide (BSTFA) (Machery-Nagel) in pyridine for 40 min at 70°C before

GC-MS analysis. Wax constituents were identified by their electron-impact MS spectra (70 eV, m/z

50 to 700) after capillary GC (DB-5, 30 m × 0.35 mm, 0.1 μm [J&W]) on an Agilent 6890N gas

chromatograph combined with a mass-selective detector 5973N (Agilent Technologies). Samples

were injected into the column at 50°C, held at 50°C for 2 min, and then desorbed by increasing the

temperature according to the following profile: 40°C/min to 200°C, 2 min at 200°C, 3°C/min to

310°C, and 30 min at 310°C. The flow rate of Helium (carrier gas) was maintained at 2 mL/min.

Two microlitre of the solutions was analysed and quantified with respect to an internal standard

(10µg tetracosane), which was added to the wax samples before GC-MS. The quantitative

28

composition of the mixtures was studied by capillary GC (Agilent; 30 m HP-1, 0.32-mm i.d., df =

1µm) and flame ionization detection under the same GC conditions as above but Helium (carrier

gas) inlet pressure was programmed for 50 kPa at injection, held for 5 min, then raised with 3

kPa.min-1 to 150 kPa and held for 40 min at 150 kPa. Single compounds were quantified against the

internal standard by manually integrating peak areas (Aharoni et al. 2004). Components were

identified by the help of NIST library, 2005 (Wang et al. 2006). The extracted leaf area was

determined by scanning the leaves with the help of scanner (hp scanjet 8200) and freely available,

leaf area measuring software Compu Eye (Bakr. 2005).

3.2. CONSTRUCTION OF cDNA LIBRARY

3.2.1 TOTAL RNA ISOLATION

Forty days old seedlings of the wild plants were drought stressed for 15 days. Leaf samples

were collected from wild stressed plants in liquid N2. Jaakola et al. (2001) method with some

modifications was used for total RNA extraction.

The leaves were then pulverized to a fine powder in a pre cooled mortar and transferred to a

falcon tube (50ml). RNA extraction buffer (Appendix-I) was preheated to 70ºC. 15ml extraction

buffer was added to each 1g of grinded tissue and vortexed for two minute. Tubes were incubated

at 70ºC for 20 minutes, vortexed after every 5 min and centrifuged at 5,000g for 5 minutes at 4ºC.

The supernatant was shifted to eppendorf tubes (1.5ml) and centrifuged at 13,000 rpm for 20 min at

4ºC. Supernatant was transferred to new eppendorf tubes and extracted twice with an equal volume

of Chloroform: isoamyl alcohol [24:1]. Phases were separated at 13000rpm at room temperature.

To the aqueous phase supernatant 1/4 volume of 10M Lithium Chloride solution was added and

mixed gently. RNA was precipitated overnight at 4 ºC. The tubes were centrifuged at 13000rpm for

29

20 min at 4ºC. The pellet was washed with 500ul of 70% ice cold ethanol. After air drying the

pellet was dissolved in 100ul of SSTE buffer (Appendix-II). SSTE buffer was pre-warmed at 65 ºC.

Four tubes were combined in a single tube. The contents of tubes were extracted once with an

equal volume of acidic Phenol: Chloroform: isoamyl alcohol [25:24:1]. To the supernatant two

volume of ice cold absolute ethanol was added to precipitate RNA at -20 ºC overnight. The tubes

were centrifuged at 13000rpm for 20 min at 4ºC. The pellet was washed with 500ul of 70% ice cold

ethanol. The pellet was air dried and resuspended in DEPC treated deionized water.

3.2.2. AGAROSE GEL ELECTROPHORESIS

Agarose gel electrophoresis was used to check integrity of RNA. Agarose gel of 1% was

prepared in 0.5xTAE buffer (Appendix III). Ethidium bromide to a concentration of 0.5-1μg/ml

was added. Gel was run at 70-80V for 1-2 hours and visualized with the help of Gel documentation

system using program Grabit.

3.2.3. QUANTIFICATION OF TOTAL RNA

RNA conc. was measured with nanodrop, ND-1000 (NanoDrop Technologies, Inc),

spectrophotometer using the nucleic acid program. Two (2) μL DEPC treated deionized water was

taken to blank the spectrophotometer. Two (2) μL of RNA was measured and results were taken at

A260/280 and A260/230.

3.2.4. DNase TREATMENT

The DNA contamination from RNA was removed with the help of Ambion’s DNAfree™ Kit.

0.1 volume of 10X DNase 1 Buffer and 1 μl of DNase 1 (2 units) was added to the RNA and

incubated at 37°C for 30 min. 0.1 volume of DNase Inactivation Reagent was added to the sample

and incubated the tube for 2 min at room temp. The tube was flicked once more during the

30

incubation to re-disperse the DNase Inactivation Reagent. The tube was centrifuge at 10,000 x g for

~1 min to pellet the DNase Inactivation Reagent. The supernatant was taken in a new tube.

3.2.5. ISOLATION OF mRNA FROM TOTAL RNA

mRNA was isolated from total RNA using the oligotex mRNA mini kit (Qiagen). To isolate

mRNA from total RNA 0.50mg of total RNA was taken in an eppendorf tube and its volume was

made upto 500µl with RNase-free water. To completely homogenize the RNA, tube was heated for

3 min at 60°C followed by vortexing for 5 s and sharply flicking the tube. This process was

repeated twice. The tube was placed on ice and 500µl of Buffer OBB was added followed by the

addition of 30µl Oligotex Suspension kept at 37°C. Contents of the tube were thoroughly mixed by

gentle pipetting. The sample was incubated for 3 min at 70°C in a water bath to disrupt secondary

structures of RNA. After 3 min sample was removed from the water bath and placed at 30°C for 10

min to hybridize poly-A tail of the mRNA to oligo dT30 of the Oligotex particle. Oligotex-mRNA

complex was pellet down by centrifugation for 2 min at maximum speed (13,200 rpm), and the

supernatant was carefully removed by pipetting. Approximately 50 μl of the supernatant was left in

the microcentrifuge tube to avoid the loss of the Oligotex resin. Oligotex mRNA pellet was

resuspended in 400 μl Buffer OW2 by pipetting and loaded onto a small spin column placed in a

1.5 ml microcentrifuge tube. Column was centrifuged for 1 min at maximum speed. After

centrifugation the spin column was transferred to a new RNase-free 1.5 ml microcentrifuge tube

and washed with 400 μl Buffer OW2 for 1 min at maximum speed and the flow-through was

discarded. Spin column was transferred to a new RNase-free 1.5 ml microcentrifuge tube and 100

μl hot (70°C) Buffer OEB was loaded onto the column. The resin was resuspended 3 - 4 times by

pipetting and centrifuged for 1 min at maximum speed. To get maximal yield, elution with buffer

OEB was repeated once again. mRNA isolated was kept on ice, quantified with the help of

31

nanodrop, ND-1000 (NanoDrop Technologies, Inc), spectrophotometer and was used for the

construction of cDNA libraries.

3.2.6. PRECIPITATION OF mRNA:

mRNA isolated from total RNA was ethanol precipitated by adding 2.5 volume ethanol, 0.1

volume 3M sodium acetate (pH 6.0) and incubated overnight at -20oC. On the next day the tubes

were centrifuged at full speed (13,200 rpm) for 25 min at 4oC to pellet down mRNA followed by

washing with 70% ethanol for 5 min. The pellet was air dried at room temperature and resuspended

in 10 μl of RNase-free water. This mRNA was used for first strand cDNA synthesis.

3.2.7. DOUBLE STRAND cDNA CONSTRUCTION

For the construction of cDNA libraries “CloneMinerTM cDNA library Construction Kit”

(Invitrogen) was used with minor modifications. mRNA isolated in the previous step was used for

first strand cDNA synthesis as following:

mRNA + DEPC-treated water 11 μl

Biotin-attB2-Oligo(dT) Primer (30 pmol/μl) 1 μl

10 mM (each) dNTPs 1 μl

The contents were mixed gently by pipetting and centrifuged for 2 seconds to collect the

sample.

The mixture was incubated at 65°C for 5 minutes and cooled to 45°C for 2 minutes and the

following reagents were added in a fresh tube:

5X First Strand Buffer 4 μl

0.1 M DTT 2 μl

32

The contents were mixed gently by pipetting and centrifuged for 2 seconds to collect the

sample. After the priming reaction has cooled to 45°C for 2 minutes, the above mixture was added

to the priming reaction tube and, mixed gently and incubated at 45°C for 2 minutes. After 2 min

keeping the tube in thermal cycler 1 μl of SuperScript II RT (200 U/μl) was added and the whole

contents were incubated at 45°C for 60 minutes. After the completion of incubation the first strand

reaction was processed immediately for Second Strand synthesis. The tube containing first strand

cDNA was kept on ice and the following reagents were added:

DEPC-treated water 91 μl

5X Second Strand Buffer 30 μl

10 mM (each) dNTPs 3 μl

E. coli DNA Ligase (10 U/μl) 1 μl

E. coli DNA Polymerase I (10 U/μl) 4 μl

E. coli RNase H (2 U/μl) 1 μl

Total volume 150 μl

The contents were mixed gently by pipetting and centrifuged for 2 seconds to collect the

sample. The mixture was incubated at 16°C for 2 hours. After the completion incubation 2 μl of T4

DNA Polymerase was added to create blunt-ended cDNA. Contents were mixed gently by

pipetting, centrifuge for 2 seconds to collect the sample and incubated at 16°C for 5 minutes. After

5 minutes 10 μl of 0.5 M EDTA, pH 8.0 was added to stop the reaction and the reaction was

preceded to Phenol/Chloroform Extraction. 160 μl of phenol:chloroform:isoamyl alcohol (25:24:1)

was added, shake by hand thoroughly for approximately 30 seconds and centrifuged at room

temperature for 5 minutes at 14,000 rpm. Upper aqueous phase after transferring to a fresh 1.5 ml

tube was ethanol precipitated as following:

33

Glycogen (20 μg/μl) 1 μl

7.5 M NH4OAc 80 μl

100% ethanol 600 μl

The tube was inverted several times to mix the contents and incubated at -80 °C for 10

minutes. After 10 minutes the sample was centrifuged at +4°C for 25 minutes at 14,000 rpm

followed by washing with 70% ethanol for 5 minutes at 14,000 rpm. The cDNA palette was dried

in speedVac for 2 min and resuspended in 18 μl DEPC-treated water by pipetting up and down 30-

40 times. The tube was centrifuged for 2 seconds to collect the sample and place on ice to proceed

to attB1 adapter ligation.

3.2.8. LIGATING THE attB1 ADAPTER

The blunt ended double strand cDNA was kept on ice and the following reagents were added:

5X Adapter Buffer 10 μl

attB1 Adapter (1 μg/μl) 10 μl

0.1 M DTT 7 μl

T4 DNA Ligase (1 U/μl) 5 μl

Total volume 50 μl

The contents were gently mixed by pipetting and the mixture was incubated at 16°C for 24

hours.

3.2.9. cDNA SIZE SELECTION

The adapter ligated cDNA was subjected to size selection by gel electrophoresis. 1% agarose

gel was prepared in 0.5 X TAE buffer with the addition of ethidium bromide to a concentration of

0.5μg/ml. cDNA was loaded in the gel well with 1Kb ladder on both sides leaving one well empty.

Gel was run at 80 volts for 25 minutes. After running gel was visualized on UV transluminator and

34

gel slice containg cDNA ≥ 1000 bp (1kb) was excised. This excised gel slice was used to elute

cDNA from the gel.

3.2.10. GEL ELUTION

The dscDNA from the gel is eluted through Fermentas DNA Gel Extraction Kit, briefly, to 1

volume of excised gel slice 3 volumes of Binding solution were added and incubated for 5 minutes

at 55°C to dissolve agarose. Then resuspended silica powder suspension was added upto 2µl/1µg of

DNA and incubated for 5 minutes at 55°C and mixed by vortexing every 2min to keep silica

powder in suspension. After incubation silica powder/DNA complex was spin for 5 seconds to form

a pellet and supernatant was removed. The pellet was washed three times with 500 µl of ice cold

wash buffer. During each washing the pellet was resuspended completely. After the last washing

the pellet was air-dried for 10-15 min.

To elute DNA into water the pellet was resuspended in 20µl of sterile deionized water and

incubated the tube at 55°C for 5 minutes. After Spinning the tube supernatant was taken into a new

tube avoiding the pellet. The elution was repeated with another 20 µl of water. For the removal of

small amounts of the silica powder the tube was spin again for 30 sec at max. speed and the

supernatant was shifted into a new tube. The eluted cDNA was quantified using nanodrop, ND-

1000 (NanoDrop Technologies, Inc), and was used for BP recombinant reaction.

3.2.11. PERFORMING THE BP RECOMBINATION REACTION

For the BP recombination reaction 100 ng size selected cDNA was used in the following

reaction:

attB1-flanked cDNA + TE Buffer pH 8.0 7 μl pDONR 222 (250 ng/μl) 1 μl 5X BP Clonase Reaction Buffer 2 μl

35

BP Clonase enzyme mix was removed from -80°C, thawed on ice and vortexed briefly. 3μl of

BP Clonase enzyme was added to reaction mix and the mix was incubated at 25oC for 20 hours.

After the completion of incubation 2 μl of proteinase K was added to reaction mix to inactivate BP

Clonase and the reaction mix was incubated at 37oC for 15 minutes followed by 75oC for 10

minutes. To the tube added the following reagents:

Sterile water 90 μl

Glycogen (20 μg/μl) 1 μl

7.5 M NH4OAc 50 μl

100% ethanol 375 μl

The tube was inverted several times to mix the contents and incubated at -80 °C for 10

minutes. After 10 minutes the sample was centrifuged at +4°C for 25 minutes at 14,000 rpm

followed by washing with 70% ethanol for 5 minutes at 14,000 rpm. The cDNA palette was dried

in Vacuum concentrator for 2 min and resuspended in 9 μl TE buffer (Appendix III). Six aliquots of

the resuspended cDNA were made in six new 1.5 ml eppendorf tubes by adding 1.5 μl cDNA in

each tube and then 50 μl thawed ElectroMAX DH10B competent cells were added to each tube.

The contents were mixed gently by pipetting up and down two times keeping the care that no air

bubble gets introduced in the tubes. The entire contents of the tube were transferred to a cold

cuvette (0.1 cm). Distributed the contents evenly by gently tapping each side of the cuvette and

electroporated the samples under following conditions:

Voltage 2.0 kV

Resistance 200 Ω

Capacity 25 μF

36

Added 1 ml of S.O.C. medium to the cuvette containing electroporated cells and transfer the

entire solution to a 15 ml snap-cap tube with the help of a pipette. The same procedure of

electroporation was repeated to all the six aliquots. The electroporated cells were shaked for 1 hour

at 37°C at 225-250 rpm to allow expression of the kanamycin resistance marker. After the one hour

incubation at 37°C, all cells were pooled into a 15 ml snap-cap tube and an equal volume of sterile

freezing media (60% S.O.C. medium:40% glycerol) was added to it. Aliquots containing 200 μl of

the cDNA library were made and these aliquots were stored at -80°C. Five (5) and fifteen (15) μl

volume from cDNA library was speared on LB plates containing 50μg/ml Kanamycin. The plates

were incubated at 37ºC for overnight. The colonies on each plate were counted after overnight

incubation at 37ºC. The cfu/ml for the cDNA library was calculated according to the following

equation:

cfu/ml = colonies on plate × dilution factor

volume plated (ml)

Total cfu = average titer (cfu/ml) x total volume of cDNA library (ml)

3.3. PREPARATION OF cDNA MICROARRAY PLATFORM

3.3.1. CLONE PICKING AND CULTURING

For the picking of clones, aliquote of cDNA library containg ~1000-1500 clones was spread

on LB Agar plates (245 x 245 x 18 mm). Indivdual clones were picked and used to culture in 96

well culture plates containing LB-Kanamycin Broth. The plates after sealing were incubated over-

night at 37oC in an incubator shaker at 200 rpm.

37

3.3.2. PCR AMPLIFICATION OF INSERTS

5 µl of overnight grown culture was diluted in 50 µl water. Heat shock was given at 95C for

10 minutes and spin at 3000rpm for 5 minutes at 4C. PCR reactions were performed to amplify

insert within the clone with 5 µl of diluted culture as template DNA in 75 µl reaction mixture

containing 0.8 µl M-13 forward and 0.8 µl M-13 reverse primers (20 μM), 7.5 ul of 10X PCR

buffer (200mM Tris-Cl, pH 8.8, 100 mM (NH4)2SO4 ,100mM KCl, 20mM MgSO4, 1 mg/ml BSA

and 1% Triton), 0.75 µl of 10 mM dNTPs and 2 unit of Pfu DNA polymerase. The thermocycler

programme used for amplification is as:

2 µl of PCR amplified product was checked on 1.5% agarose gel in 0.5X TAE to confirm

insert amplification. Rest of the PCR product was ethanol precipitated by adding two volume

absolute ethanol and 0.1 volume 3M sodium acetate (pH 6.0) and this mixture was incubated

overnight at -20oC. The plates were centrifuged at 4000rpm for 30 min at 4ºC. The pellet was

washed with 170 µl of 70% ice cold ethanol. After air drying the pellet was dissolved in 10 µl low

HOLD 1 HOLD 3 HOLD 2 (40 Cycles) 95ºC 95ºC 72ºC 72ºC 03:00 00:45 52ºC

01:30 15:00 00:45 4 ºC

∞

Figure1. Thermocycling profile for the amplification of inserts by PCR

38

EC water. DNA was quantified using nanodrop, ND-1000 (NanoDrop Technologies, Inc), and

finally 500-600ng/µl DNA concentration was obtained in 50% DMSO (Dimethyl sulfoxide).

3.3.3. CLONE SEQUENCING

After amplification the PCR products of the inserts were used as a template for sequencing.

Almost 1000 clones, randomly selected, were sequenced with Dye terminator Chemistry on

Applied Biosystems Sequencer model 3100/3700. The following sequencing PCR program was

used:

The PCR products were ethanol precipitated and air dried in a close drawer. 15 µl

farmamide was added to each sample and then sequenced it on ABI3100 and ABI3700.

3.3.4. SPOTTING OF SLIDES

The amplified insert cDNA was spotted on a glass slide of ArrayIt® brand SuperAmine 2

using a microspotter (microGrid610) made by Genomic Solutions®. The spots were made by nano-

liters of volume in duplicate at an expected ratio of 9,264 spots per slide. Total four House keeping

HOLD 1 HOLD 3 HOLD 2 (35 Cycles) 96ºC 96ºC 60ºC 60ºC 00:20 00:20 50ºC

04:00 10:00 00:15 4 ºC

∞

Figure2. Thermocycling profile for the sequencing PCR

39

genes, founded in library, homologe to His3 (GE653512); His4 (GE653669), Actin (GE653433)

and GAPDH (GE653450) were used as internal controls for the normalization of data. The clones

were printed in a format of 14×14 sub-grids, leaving four (4) blank spots per sub-grid for

background correction. Total 12×4 sub-grids were printed per slide with the help of solid pins

(Genomic Solutions®). The slide printing conditions were 20±2oC and 45±2% humidity. The slides

were dried and stored for future use. The Platform has been deposited in NCBI's Gene Expression

Omnibus (Edgar et al. 2002) and are accessible through GEO Platform accession number

GPL8266.

3.4. HYBRIDIZATION OF TARGET WITH cDNA MICROARRAY PLATFORM

3.4.1. TARGET PREPARATION

3.4.1.1. AMINOALLYL LABELING

For the aminoallyl labeling of cDNA, 45 μg of total RNA, DNA free, was taken from wild

and wax mutant plant, and 2 μg of OligodT18 primer was added to it and final volume was made up

to 18.0 μL with RNase-free water. The contents were mixed well and incubated at 70oC for 10

minutes. After incubation the mixture was placed on ice for 30 seconds, centrifuged and following

contents were added:

5X First Strand buffer 6.0 μL 0.1 M DTT 3.0 μL 50X aminoallyl-dNTP mix 0.5 μL SuperScript III RT (200U/μL) 2.0 μL RNAse inhibitor 0.5 μL

The contents were mixed well, centrifuged briefly and incubated at 42oC for 3 hours. Then to

hydrolyze RNA, 2U of RNAse H were added, mixed and incubated at 37oC for 15 minutes and to

the mix 25μL of 1M Tris (pH 6.8) was added to nutrilize pH.

40

3.4.1.2 REMOVAL OF UNINCORPORATED aa-dUTP AND FREE AMINES

cDNA synthesized was mixed with 300 μL (5X reaction volume) buffer PB (Qiagen

supplied) and transferred to QIAquick column placed in a 2ml collection tube (Qiagen supplied),

centrifuged at 13,000 rpm for 1 minute and flow through was discarded. 750μL phosphate wash

buffer was added to the column, centrifuged at 13,000 rpm for 1 minute, flow through was

discarded and repeated the wash step. Column was placed in new collection tube and centrifuged

for 1 minute at maximum speed. Column was transferred to a new 1.5 mL microfuge tube, 30 μL

phosphate elution buffers was applied to the center of the column membrane and incubate for 1

minute at room temperature. cDNA was eluted by centrifugation at 13,000 rpm for 1 minute.

Second elution was done in the same way and sample was dried in a speed vac.

3.4.1.3. COUPLING aa-cDNA TO CYANINE DYE ESTER

Single foil pack of dye cyanine (Cy) 3/cyanine (Cy) 5 (Amersham- PA23001) was re-

suspended in 40µl DMSO. Dry cDNA was dissolved in 5µl 0.1M sodium carbonate (pH 9.0) and 5

µl Cy3/Cy5 dye was added to sample and mixed. The reaction was incubated for 1 hour in the dark

at room temperature.

3.4.1.4 REMOVAL OF UNCOUPLED DYE

Dye coupled cDNA was mixed with 250 μL (5X reaction volume) buffer PB (Qiagen

supplied) and transferred to QIAquick column placed in a 2ml collection tube (Qiagen supplied),

centrifuged at 13,000 rpm for 1 minute and flow through was discarded. 750μL phosphate wash

buffer was added to the column, centrifuged at 13,000 rpm for 1 minute, flow through was

discarded and repeated the wash step. Column was placed in new collection tube and centrifuged

for 1 minute at maximum speed. Column was transferred to a new 1.5 mL microfuge tube, 40 μL

41

elution buffer (EB) was applied to the center of the column membrane and incubate for 1 minute at

room temperature. cDNA was eluted by centrifugation at 13,000 rpm for 1 minute. Second elution

was done in the same way. The concentration and the dye incorporation of labeled cDNA were

measured by Nano Drop (NanoDrop Technologies, Inc), using program “Microarrays”.

3.4.2 HYBRIDIZATION

3.4.2.1. PRE-HYBRIDIZATION

Spotted slide was rehydrated by array facing down on water at 40oC. The slide was cross

linked in a Stratagene® UV linker twice at 1600 µJ x 100. Slide was placed in pre-heated prehyb

(Appendix VI) buffer in 42oC water bath and incubated for 45 min with occasional shaking. Slide

was washed in millipore water for two times, once in isopropanol and then spin dried by keeping

slide in 50 ml tube with kimwipe stuffed in the bottom in a swing bucket rotor at 2000 rpm for

1min.

3.4.2.2. HYBRIDIZATION

Equal concentrations of Cy3 and Cy5 probes (300 pmole each) in terms of dye pmoles were

taken and mixed in the 2X hybridization buffer (Appendix VII). The target was heated to 95oC for

three minutes and then immediately put on ice. Slide was placed in chamber of hybstation

(Genomic Solutions®) with array side up. Target was injected to slide in chamber at 65oC and then

slide was incubated at 42oC for 24 hours.

3.4.2.3. SLIDE WASHING

Slide was removed from hybstation and washed in solution containing 1X SSC, 0.2% SDS at

42oC for 2 min with agitation. Then, slide was shifted to second wash solution containing 0.1X

42

SSC, 0.2% SDS at room temperature and incubated for 2 min with agitation. After 2 min slide was

moved to third wash solution containing 0.1X SSC and kept for 2 min with agitation. Slide was

spin dried immediately by keeping slide in 50 ml tube with kimwipe stuffed in the bottom in a

swing bucket rotor at 2000rpm for 1min and preceded for slide scan.

3.5. SLIDE SCANNING

Slides were scanned in Cy3 and Cy5 channels with the help of scanner UC 4X4 (Genomic

solution®). The 16-bit tiff images of Cy3 and Cy5 channels were saved.

3.5.1 IMAGES PROCESSING AND RAW DATA GENERATION

The 16-bit scanned tiff images of Cy3 and Cy5 were initially analysed with the help of

TIGER SPOTFINDER software available freely on line from the TM4 website (Saeed et al. 2003).

Poor-quality spots (sum of median <500) were filtered from the raw data before analysis.

Background was subtracted and the signal ratio between Cy3 and Cy5 was calculated. The

initial/raw data were saved as mev file.

3.6. DATA NORMALIZATION AND ANALYSIS

3.6.1. DATA NORMALIZATION

The data normalization and analysis was done by the help of freely available software

Microarray Data Analysis Software (MIDAS) and Microarray Experiment Viewer (MEV) from the

TM4 website (Saeed et al. 2003). Data normalization methods proceed from the assumption that

only a relatively small proportion of the genes change significantly in expression level between the

two hybridized mRNA samples. The house keeping genes were used for the normalization of spot

signal intensities within the slide. The signal intensity was calculated as the mean intensities of the

43

two replicates minus the background signal. The MIDAS component of TM4 provides a number of

data normalization methods and filters and supports applying them in a pipelined fashion.

3.6.2. THE MIDAS PROJECT

A MIDAS project was applied consisting of total intensity normalization, lowess

normalization, standard deviation regularization, and low intensity filtering to microarray data.

MIDAS default parameters were used throughout, the default low intensity filter cut-off is RiGi <

10,000/1000.

3.6.3. TM4 MEV ANALYSIS

The Multi Experiment Viewer (MEV) component of TM4 provides a number of statistical

analyses and clustering algorithms to identify differentially expressed genes. We report results from

the one-class t-test analysis applied to output of the MIDAS pipeline. This test assumes that the

paired distribution of treated and control groups is normally distributed. Since the intensities

measured from the same spot are correlated, we can apply the one-class t-test for the two-group

comparison. The spot showing signal intensities ≥/≤ 1.5-fold were considered differentially

expressed transcripts with p ≤ 0.05 was defined as the threshold for significant differential

expression.

3.7. SEQUENCING OF DIFFERENTIALLY EXPRESSED TRANSCRIPTS

After microarray analyses, the plasmids containing the differentially expressed transcripts,

were isolated and sequenced with dye terminator chemistry on Applied Biosystems Sequencer

model 3100/3700 as mention above.

44

3.8. VALIDATION STUDIES BY QUANTITATIVE REAL-TIME PCR

Real-time PCR reactions were carried out to validate the results of microarray data in an iQ5

cycler (BIO-RAD) with a 96-well plate (Bio-Rad) and using the iQTM SYBR Green Super mix

(Bio-Rad). Twelve down-regulating clones in microarray data were randomly selected to confirm

the microarray results. The sequences of primers used in real-time PCR with clone ID are given in

Table 3. The product size ranges from 80bp-110bp. Different concentrations in serial dilution of the

PCR product containing GE654076 were used as standard to validate the iQ5 Cycler reaction and to

determine the quantification range (Standard curve). The cotton Glyceraldehyde-3-phosphate

dehydrogenase (GAPDH) was used as house-keeping control. 100ng of cDNA was used in each

reaction. Each sample was used in triplicate pattern. A melting curve analysis was carried out by

continuously monitoring fluorescence between 60°C and 95°C with 0.5°C increments every 30s.

Thermal cycling conditions were:

Statistical analysis of the real-time results was performed using iQ5 software (Bio-Rad)

version 1.0 on the basis of CT values of the gene in different samples converted to their linear form

HOLD 1 HOLD 3 HOLD 2 (40 Cycles)

95ºC 94ºC 72ºC 72ºC 03:00 00:30 60ºC 00:30 10:00 00:30 4 ºC

∞

Figure3. Thermocycling profile for validation of microarray results by Real Time-PCR

45

using the mathematical term 2∆∆CT (Livak and Schmittgen, 2001) normalized with GAPDH

gene. Analysis of variance (ANOVA) was performed to analyze significant difference in transcript

expression in leaves of wild and wax mutant plants.

Table 3: Sequences of the primers used in Real-time PCR with their GenBank Acc_No.

and product sizes.

GENBANK ACC_NO

Forward Primer Reverse Primer PRODUCT SIZE

GE654064 CCGAGTTTTTCCACGACA TTATAGGCTCCACTGCAACAA 85 GE654065 GCAGCAACAATGGGAATG GATAAAAACAGTAACCGGCACA 95 GE654066 GCGTGGAACCGATGTTTT GCCAGCTTATCCTTCAGCA 100 GE654076 GCGGGGATACTGTTGCTT TCCATACCCCAATTCACAAA 93 GE654078 AATCGAGAGGGGGCAAA GCATTTTGGCAGTGGTGA 80 GE654079 GAAGGTGAAGGTGAACGTGA TTGCTGGAGACAAAGGTGAA 95 GE654085 GAGAGGACGTGCGACAAA AAACAAAGCGGGCAACA 90 GE654105 GAGACCTGTGCAACGTGAA TTGCCGATCTTCCCTCTAA 98 GE654072 CTTGAGAGGCAGTGGTGCT CGGTCTGGTGTTGTTTGG 92 GE654099 AATGAGGGGCGAGTAACCT AATGAGGGGCGAGTAACCT 93 GE654122 CGACGTGATGGAACCAAG TTTTGATTTGCCCCCAGT 109 GE654074 CAAGTGGAAGCCTCAGCA AGTGAACCTTGCTTGTGGAA 80

3.9. BIOINFORMATIC STUDIES

3.9.1. BLAST SEARCH

Raw EST sequences data were edited to remove vector and poor quality sequences. The

ESTs were subjected to BlastX analysis against the non-redundant database with E-value < 1, and

BlastN analysis against the non-redundant (nr) and EST databases with E-value < 1.0e-7, at NCBI

GenBank to search for similarity.

46

3.9.2. GENE ONTOLOGY (GO) AND FUNCTIONAL ANNOTATION

The gene code names (Atg) of Arabidopsis orthologs, identified by similarity search, were

subjected to GO functional categorization at TAIR web sit

(http://Arabidopsis.org/tools/bulk/go/index.jsp), (Berardini et al. 2004) on the basis of cellular

components, molecular functions and biological processes. The genes annotation list and pie charts

were saved.

3.9.3. GENE INVESTIGATOR BY RESPONSE VIEWER

Arabidopsis orthologs of differentially expressed ESTs, identified by similarity search, were

subjected to gene investigator expressional analysis response viewer (Zimmermann et al. 2004), to

find their expression in biotic, abiotic and UV stresses. The log2 ratios of Arabidopsis orthologs

under biotic, abiotic and UV stressed and their differentially expressed potential wax candidate

ESTs were subjected to Multi Experiment Viewer (MEV) component of TM4 for gene expression

profile clustering and correlation analysis.

CHAPTER: 4

RESULTS

47

4. RESULTS

4.1. CHEMICAL AND PHYSICAL MUTAGENESIS

The chemical and physical mutagens effectiveness was measured in term of dose responsible

for 50% seeds germination (50% SG Dose). The germination percentage was calculated by

germinating 25 seeds per mutagenic treatment and wild (non-treated) on filter paper. The 50% seed

germination dose was calculated by plotting mutagen dose on X-axis and germination percentage

on Y-axis, as shown in Figures 4, 5, 6, 7, 8, 9 and 10. The germinated seeds in wild (non-mutagen

treated) were taken as hundred percent (100%) germination. The 50% seeds germination dose, in

chemical and physical mutagens and their combination was tabulated in Table 4.

Table 4. 50% seed germination doses of the physical, chemical mutagens and their

combinations.

Mutagen 50% Seed Germination Dose (50%SGD)

Gamma rays 173 Gy

Sodium azoid 10-2M

Gamma rays + Sodium azoid 125Gy+10-3M

Diethyl Sulfate 0.44%

Gamma rays + Diethyl sulfate 70Gy +0.3%

Ethyl methane sulphonate 10-2M

Gamma rays + Ethyl methane sulphonate 105Gy + 10-3M

48

Figure4. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with gamma rays, by plotting germination percentage on Y-axis and Gamma rays Doses on X-axis

50%SGD=173Gy

Figure5. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Sodium Azoid (SA), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50%SGD=10-2M

49

Figure6. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays +Sodium Azoid (SA), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50GY+10-3M 150GY+10-3M 250GY+10-3M 350GY+10-3M 500GY+10-3M

50%SGD=125Gy+10-3M

Figure7. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Di-Ethyl Sulfate (DES), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50%SGD=0.44%DES

50

Figure8. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays+Di-Ethyl Sulfate (DES), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50%SGD=70Gy+0.3%

Figure9. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Ethyl Methane Sulphonate (EMS), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50%SGD=10-2M

51

Figure10. Detrmination of 50% SGD (Dose responsible for the 50% seed germination) treated with Gamma rays + Ethyl Methane Sulphonate (EMS), by plotting germination percentage on Y-axis and mutagen Doses on X-axis

50%SGD=105Gy+10-3M

52

4.2. WAX MUTANTS

4.2.1. WAX MUTANTS SELECTION

Total forty nine (49) wax mutant lines on the basis of aerial fusion, glossy leaves,

curved/wrinkle leaves, rapidly chlorophyll extraction, water stress infertility, small flower size,

increased stomatal indices and gravimetric epicuticular wax analysis, as shown in Figures 11, 12,

13, 14, 15, 16, 17 and 18, were selected in the M2 plants. They are tabulated in Table5.

Table5. Selected wax mutant Lines with traits of selection and No: of plants in M2.

Traits No: of plants Lines

Aerial Fusion 9 A3-7, B1-4, L1-5, H1-7, H1-9, H1-10, K1-7,

K3-2, K3-6

Glossy leaves 7 N1-1, A3-6, B1-4, L1-5, A5-1, K2-3, A2-1

Curved/wrinkled

leaves 7 A3-6, N1-1, N1-5, H1-4, A4-1, K1-3, K1-4

Rapidly chlorophyll

ext: 7 A3-6, N1-1, N1-5, H1-4, A4-1, K1-3, K1-4

Water stress infertility 5 A3-2, B1-4, A5-1, A4-1

Small flower size 3 A3-5, H1-9, A4-1

Increased stomatal

indices 4 H1-2, A5-1, H1-10, K1-1

Gravimetric wax

analysis 7 H1-3, K3-5, L1-2, N1-1, H1-2, N1-5, H1-7

B

FigWilmu

Fepa

gure11. Wald plant, sh

utant's trait

Figure12. Wextraction iplant, wax appearance

ax mutant howing nont.

Wax mutanin 80% Ethmutant sh

e.

selection i

n-glossy lea

nt selectionhanol for 1owed rapid

in M2 geneaves. (B) M

n in M2 gen1 h from led chloroph

eration on M2 mutant p

neration oneaves. (A) Whyll leachin

the basis plant with

n the basisWild plantng in 80%

of glossy lglossy leav

s of rapid ct and (B) MEthanol b

leaves (A) ves; a wax

chlorophylM2 mutantby greenish

53

l t h

Figuplana w

FigNomu

ure14. Waxnt without ax mutant'

gure13. Wormal floweutant's trai

x mutant seaerial fusio's trait.

ax mutanter size in wt.

election in on. (B). Aer

A t selection wild plant.

A

M2 generarial fusion,

in M2 gen. (B) Small

ation on theindicated b

neration onl flower siz

e basis of aeby arrows,

n the basize in M2 m

erial fusion in M2 mut

s of flowermutant pla

n. (A) Wild tant plant,

Br size (A)

ant, a wax

B

54

Figur(A). Wwrink

FigComu

re15. Wax Wild plant kled margi

gure16. Waomparison utants show

0

5

10

15

20

25

K

STO

ATAL

INDE

X

mutant selleaf, showi

ins, indicati

ax mutant of wild (co

wed increas

ST

K1-1 H1-1

ection in Ming smoothing by arro

selection inont) and Msed stomata

TOMATAL

10 A5 . 1

PLA

M2 generatih margins, (ows, a wax

n M2 geneM2 mutant p

al indices c

L INDICES

A4 . 1 C

ANTS (LABE

ion on the b(B). M2 mumutant's t

eration on tplants stomompare to

S COMPAR

CONT N1

EL)

basis of wriutant plantrait.

the basis omatal indic

wild.

ARISON

-1 H1-2

inkled leavt leaf, with

of stomatal es measure

ADAXABAX

ves

indices. ed. Wax

XIAL SIXIAL SI

55

Figana(co

gure17. Waalysis. Gr

ont) and M2

ax mutant savimetric 2 mutant p

selection inanalysis anlants. Wax

n M2 genernd comparx mutants h

ration on thrison in ephave less wa

he basis oficuticular ax load com

f wax Gravwax load

mpared to w

imetric of wild wild.

56

57

4.2.2. WAX MUTANTS CONFIRMATION

The initial potential wax mutant plants in M2 were covered with paper envelope to get more

homogenize seeds in M3. Almost 3000 seeds of M3 were sown and screened for wax mutant's

traits. Eighteen (18) plants in M3 have shown wax mutant traits. Triplicate of All eighteen (18),

final wax candidates were analyzed by scanning electron microscopy (SEM) and Gas

chromatography-mass spectrophotometer (GC-MS) for confirmation as wax mutants.

Three (3) out of eighteen (18) plants in M3 were confirmed as wax deficient mutants by

SEM and GC-MS.

4.2.2.1. EPICUTICULAR WAX MORPHOLOGY

No studies of desi cotton (G. arboreum) leaf epicuticular wax have been reported. For this

reason, a hexane treated (epicuticular wax removed), leaf (adaxial) was visualized by SEM as

reference, (Figure18), to better understand the desi cotton (G. arboreum) leaf epicuticular wax

deposition pattern and morphology. In wild plant the leaf epicuticular wax appear as smooth stripy

layers, (Figure 19). The absence of these stripy layers in hexane treated leaf, confirmed them as an

epicuticular wax. In fact it is less stripy than layers. The wild leaf epicuticular wax stripy layers are

sharp and shiny under SEM.

In all the three wax mutants, these sharp, shiny and stripy layers are absent and modified in a

new morphological pattern. The first cotton (G. arboreum) wax mutant, designated as GaWM1,

(Gossypium arboreum Wax Mutant 1) shows epicuticular wax morphological pattern as embedded

dull thick fibers (Figure 20). These embedded dull thick fibers are much less in density than the

wild stripy layers.

The second cotton (G. arboreum) wax mutant, designated as GaWM2, (Gossypium

arboreum Wax Mutant 2) shows epicuticular wax morphology as irregular dispersed patches

(Figure

GaWM

Wax M

much le

in these

Fiin

21). These

M1 embedded

The third c

Mutant 3) di

ess dense th

e thin layers

igure18. Hendicating st

patches are

d thick fibe

cotton (G. a

isplays epic

han GaWM

s of wax.

exane treattoma. Bar=

e less shiny

rs. The patc

rboreum) w

cuticular wa

1, GaWM2

ted wild pla=5µm

than the wi

ches are also

wax mutant,

ax morphol

2 and wild t

ant leaf (ad

ild type wax

o less in den

, designated

ogy as thin

type plant. L

daxial), sho

x stripy laye

nsity.

d as GaWM

n layers, (Fi

Little glossy

owing no w

ers but more

M3, (Gossyp

igure 22). T

y appearanc

ax depositi

e than the

ium arbore

The layers

ce can be se

ion. Arrow

58

um

are

een

Figur5µm

Figuin w

re19. Wild

ure20. Cottwax deposit

plant (ada

ton (G. arbotion (dull th

xial) leaf sh

oreum) waxhick embed

howing wax

x mutant 1dded fiber l

x stripy lay

1 (GaWM1)like, indica

yers (indica

) leaf (adaxated by arro

ated by arr

xial) showinows). Bar=

rows). Bar=

ng alteratio5µm

59

=

on

Figalte

Figualter

gure22. Coteration in w

ure21. Cottoration in wa

tton (G. arbwax deposi

on (G. arboax depositi

boreum) Wition (thin l

oreum) waxion (irregul

Wax mutantlayers, indi

x mutant 2lar patches

3 (GaWMicated by ar

(GaWM2)s, indicated

M3) leaf (adarrows). Bar

leaf (adaxid by arrows

axial) showr=5µm

ial), showins). Bar=5µm

wing

ng m

60

61

4.2.2.2. GAS CHROMATOGRAPHY AND MASS SPECTROPHOTOMETER (GC-MS)

ANALYSES

GC-MS is a very crucial platform to validate the epicuticular wax mutants. The hexane

extracted epicuticular waxes of wild and mutant plants, analyzed by GC-MS, validate the scanning

electron microscopy (SEM) results.

The total ion current (TIC) of wild cotton (G. arboreum) plant leaf epicuticular wax clearly

showed an increased number and height of peaks (Figure 23), confirming the SEM visualization.

The total ion current (TIC) of cotton (G. arboreum) wax mutant plant leaves, GaWM1 (Figure 24),

GaWM2 (Figure 25) and GaWM3 (Figure 26), showing comparatively low concentration of

epicuticular wax, in the form of peaks height and number. These results clearly demonstrated that

the number and height of peaks is more in wild plant leaf epicuticular wax than the mutants,

suggested more wax deposition and concentration in wild as compared to the mutants.

The total wax loads (Figure 27), determined from the GC-MS analyses of leaves epicuticular

waxes, are 183.7±8.72 µgcm-2, 122.7±6.45 µgcm-2, 109.31±7.38 µgcm-2 and 90.54±5.89 µgcm-2 in

cotton (G. arboreum) wild, wax mutants, GaWM1, GaWM2 and GaWM3 respectively.

FigureGC-Mtype in

Figur(total

e24. A portiMS TIC (tota

n the form o

re23. A porion curren

ion of the cal ion currof peaks.

rtion of the nt trace), sh

cotton (G. aent trace),

cotton (G. howing mor

arboreum) wshowing le

arboreum)re wax con

wax mutaness wax con

wild plantncentration

nt 1 (GaWMncentration

t leaf total ws in the for

M1) leaf tots compare

wax GC-Mrm of peaks

tal wax to wild

MS TIC s.

62

FigurGC-Mwild t

FigureGC-Mtype in

re25. A porMS TIC (totype in the

e26. A portMS TIC (tot

n the form

rtion of the otal ion cur

form of pe

tion of the ctal ion currof peaks.

cotton (G. rent trace)

eaks.

cotton (G. arent trace),

arboreum), showing l

arboreum) wshowing le

) wax mutaless wax co

wax mutaness wax con

ant 2 (GaWncentration

nt 3 (GaWMncentration

WM2) leaf tons as comp

M3) leaf totns compare

otal wax pare to

tal wax to wild

63

Figwamu

gure27. Cx mutant

utants hav

omparisot plants (Gve less wa

on of leaf GaWM1, ax load as

total waxGaWM2,compare

GaWM1

x load in c, GaWM3

e to wild.

1 GaW

cotton (G.3). The th

WM2

arboreumhree wax d

GaWM

m) wild andeficient

M3

64

nd

65

4.2.3. COMPOSITION OF EPICUTICULAR WAX

The wild cotton (G. arboreum) leaf epicuticular wax components were identified from the

mass spectra of the individual peaks by comparison with the NIST mass spectra library, 2005

(Wang et al. 2006). In this way, forty (40) components were identified. These components with

their retention time (Rt) are shown in the Table6.

Table6. Wild cotton (G. arboreum) leaf epicuticular wax components and their retention

time (Rt).

Wax components Retention time (Rt) (min)

Valeric acid, 4-(2,5-xylyl)-, methyl ester 6.86 4-acetyl-2,2,3-trimethyl-3-cyclopentene carboxylic acid 7.04 Benzeneacetic, alpha-(acetyloxy)-alpha-methyl-methyl ester 7.17 2-(1,1-di methyl ethyl)Phenol 7.28 1,2-diethyl ethylene bis (p-phenylene) di acetate 7.41 Tricyclo undecane-3-carboxylix acid, methyl ester 7.61 n-Hexadecanoic acid 9.41 5-(prop-2enyl-1-dene)-10-oxa10,11-di-hydro-5H-dibenzo-cyclo-heptene 10.67 Heneicosane 11.37 Trans-1,1,dibenzoindanyl-1-dene 11.65 Octadeca-9-enoic acid 12.30 Docosane 13.03 Tetracosane 16.92 Pentacosane 19.03 1,2-benzene-di-carboxylic acid, mono (2-ethyl hexyl)ester 19.53 Hexacosane 21.21 2-methyl hexa decane 23.41 Eicosane 25.60 Nonacosane 27.77 Heptadecane 7.16 Octadecane 34.03Hexa decane 6.62 Hexanoic Acid -4-tetra decyl ester 8.61 Triacontane 29.91 Octacosnae 25.61 Heptacosane 23.40 7-hexyl-eicosane 14.89 9-octyltetracosane 31.97

66

4-hydroxyphenyl pyrolidinylthione 36.72 l-2,6-ditert-butyl-4-2,3,4,5,6-pentflurobenzyl Pheno 18.76 9-octyl-heptadecane 17.91 2,4-bis (dimethylbenzyl)-6-t-butyl phenol 17.46 l-2,4-bis (1-methyl-1-phenyl ethyl)Pheno 17.10 Tricosane 14.88 2-(p-tolyl)-2H-phenanthrol (9,10-d)triazole 6.91 Nonadecane 11.36 Pentadecanoic acid 12.28 1,2,3,4,4,9,10,10a-octahydro-1,4a-dimethyl-7-(1-methyl ethyl)-[15-

(1.α,4a. α,10a.β)1-phenanthrene carboxylic acid 17.34

3,7-nona-di-ene-2-ol-4,8-di-methyl 7.04 4-ethyl benzoic acid, allyl ester 6.85

The GC-MS data analyses, revealed that the dominated wax class is alkane and component is

1,2-benzene-di-carboxylic acid, mono (2-ethyl hexyl) ester following by docosane, heneicosane,

hexacosane, octadecane and eicosane of the n-alkane family in desi cotton (G .arboreum) total leaf

epicuticular wax. Other major wax classes are acids, esters, and alcohols respectively (Figure 28).

More alkane concentration (136.7±8.98) is observed in the wild plant. Wax mutant (GaWM2)

shows dominancy in Acid (9.7±2.43) and Ester (3.4± O.3). Aldehyde, alcohol and unidentified

classes have shown more wax concentration in wild cotton (G. arboreum) plant (Table7).

These results clearly show that the cotton wax deficient mutant (GaWM3) has most reduced

epicuticular wax deposition. So, GaWM3 is selected for further down stream studies of microarray.

Table7

(GaWM

Cotton (G. arbo

W

G

G

G

Fw

. Leaf epi

M1, GaWM

oreum)

WILD 13GaWM1 9GaWM2 9GaWM3 70

Figure28. Cwild and wa

icuticular

M2, GaWM

Alkane

36.7±8.98

5.7±6.83

0.3±9.32

0.2±10.32

Comparisonax mutant (

wax class

M3)

Wax c

Acid

6.4±2.76

7.4±1.87

9.7±2.43

2.4±0.30

n of cotton (GaWM1, G

es in cott

classes and

Ester

1.2±0.1

2.2±0.4

3.4± O.3

0.2±0.07

(G. arboreGaWM2, G

ton (G. ar

d their conc

Aldehyd

0.2±0.0

0.2±0.0

0.1±0.0

0.1±0.0

eum) leaf eGaWM3) pl

rboreum) w

centrations

de Alc

04 3.5±

07 0.5±

03 3.2±

01 0.35

picuticularlant.

wild and w

(µgcm-2)

cohol U

±1.21 3

±0.35 1

±1.08 1

±0.02 17

r wax class

wax mutan

Unknown

35.7±4.35

16.7±3.87

12.6±8.23

7.39±10.12

ses in

67

nts

68

4.2.4. COMPARISON OF COTTON (G. arboreum) WILD AND WAX MUTANT PLANTS MORPHOLOGY

The three (3) confirmed cotton (G. arboreum) wax mutant plants leaves showed a little glossy

appearance, compared to wild plant (Figure 29). The wax mutant plant stem, at vegetative growth

stage, show more dense hair-like trichomes than the wild plant stem. The hair-like trichomes

density is observed in inverse proportional to the wax deposition. More hair-like trichomes is

observed in wax mutants (GaWM3, GaWM2 and GaWM1), while showing less wax deposition

respectively (Figure 30).

Figure29. The three w

W

G. arboreuwax mutan

t

m wild (Wnts showing

G

Wt) and waxg little gloss

GaWM

x deficient siness as co

M1

mutants (Gompare to w

GaW

GaWM1, Gwild (Wt) p

WM2

GaWM2, &plant.

Ga

& GaWM3)

aWM3

69

) plants.

70

4.3. cDNA LIBRARY

4.3.1 TOTAL RNA

Total RNA quality and integrity is a crucial requirement for the construction of cDNA library

and microarray experiments. The cotton plant (G. arboreum) contains carbohydrates and phenolic

compounds that cause hurdles in nucleic acid (DNA and RNA) isolation by forming quinines and

conjugating with nucleic acid. It is never easy to get good quality and quantity RNA from such

plant. No commercial kit is suitable for RNA extraction from cotton (G. arboreum) plant. Jakola et

al. (2001), method with little modification is used to get good quality and quantity RNA from

M3

Figure30. Comparison of hair-like trichomes (indicated by arrows) in cotton (G. arboreum) wild and wax mutant plants. Wax deficient mutants have showed more hairy trichomes than wild.

Wild GaWM1 GaWM2 GaWM3

71

cotton (G. arboreum). The gel photograph (Figure 31), clearly shows two distinct and intact

ribosomal RNA (rRNA) bands with messenger RNA (mRNA) smear. The Nanodrop plots (Figure

32), showing single sharp peak at 260nm, are the evidence of good quality and quantity total RNA.

Both 260/280 and 260/230 ratios are two (2.0), confirming the RNA purity, with good

concentration (800 plus ng/µl).

Figure32. Nanodrop plots showing cotton (G. arboreum) total RNA, the single peak is the evidence of purity.

Figure31. Total RNA from cotton (G. arboreum) plant, showing two intact rRNA bands with mRNA smears

72

Selection of ds cDNA ≥ 1Kb

Figure33. dscDNA synthesized for cDNA library construction resolved by gel electrophoresis for the size selection ≥ 1000 bp (1kb). M= 1Kb DNA ladder

4.3.2. SIZE SELECTION

The double strand (ds) cDNA is made from the purified mRNA of total RNA extracted from

the wild cotton plant (G. arboreum) leaves. The dscDNA size ranges from 200bp to onward. Its

appearance as smear on 1% agrose gel is a proof of good quality dscDNA. The cDNA smear equal

and more to one kilobases (1kb) on the gel (Figure 33) is selected and cut for cDNA library

construction. The eluted double strand cDNA was ligatted in pDONRTM222 and transformed to

RLECTROMAXTM DH10BTM cells.

M ds cDNA M

73

4.3.3. cDNA LIBRARY CFU

Five (5) and fifteen (15) μl volume from cDNA library was spread on LB medium containing

Kanamycine (50mg/l). Almost 975 and 3168 colonies were counted in five and fifteen micro-liter

(μl) plated cDNA library. Total 1.22×106 cfu/ml was calculated in six (6) aliquots.

4.3.4. PCR AMPLIFICATION

Almost ten thousands (10,000) clones from cDNA library were randomly selected. The

inserts were exponentially amplified through PCR. Two µl of the PCR products, resolved on 1.5%

agrose gel, showed well distinct sharp bands (Figure 34). Ninety four percent (94%) wells, in

ninety six (96) wells PCR plates, show amplification. Similarly ninety six percent (96%) bands

clearly show insert size from 1 to 1.5 kb. The remaining four percent (4%) insert size ranges

between 400-750bp. The PCR amplification confirms the quality of the cDNA library.

74

M 1 2 3 4 5 6 7 8 9 1011 1213 1415 1617 18 19 20 21 22 23 24 25 26 272829

M 30 31 32 33 34 35 36 37 38 39 40 41 42 4344 45 46 47 48 49 50 51 52 5354 55 56 57 58

M 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77

M 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96

Figure34. Confirmation of clones by PCR amplification Lane 1-96, PCR amplified cDNA clones M = 1Kb DNA Ladder

75

4.3.5. cDNA LIBRARY CLONE SEQUENCING

Clones sequencing is a crucial step of cDNA library validation. It not only confirms cDNA

library quality but also provide an insight in the organism genome response in that particular

condition. Randomly selected eight hundred sixty four (864) clones were sequenced using dye

terminator chemistry by ABI 3100 and 3700 sequencer with M13 forward primer. Raw EST

sequences are subjected to edit, remove vector and poor quality sequences. After filtering ninety

percent (90%=778) clones showed quality sequences (Figure. 35) with no redundancy. These ESTs

were submitted to Genbank with the accession number GE653350-GE654127.

Fig----. Illustration of clone sequence quality.

Figure35. A single sequenced clone from G. arboreum cDNA library, showing quality of sequence.

4.3.6.

4.3.6.1.

Se

using B

percent

percent

= 51 se

sequenc

Fida

BIOINFOR

. HO

even hundr

BLASTN an

(78% = 60

(11% = 84

equences) sh

ces) have si

igure36. cDatabase (us

RMATIC A

OMOLOGY

red seventy

nalyses agai

05 sequence

clones) sho

howed sign

gnificant ho

DNA librarsing BLAST

ANALYSE

Y SEARCH

y eight (778

nst the non-

es) clones se

ow significa

nificant hom

omology wi

y sequenceTN program

ES OF cDNA

H

8) sequence

-redundant

equences (E

ant homolog

mology with

ith other pla

es homologym)

A LIBRAR

es (ESTs) w

(nr)-databa

ESTs) didn't

gy with Ara

h Gossypium

ant species (

y search re

RY SEQUE

were subjec

ase in NCBI

t show sign

abidopsis se

m species an

(Figure. 36)

esult agains

ENCED CL

cted to hom

I GenBank.

nificant hom

equences, si

nd five perc

).

st non-redu

LONES

mology sear

Seventy eig

mology, elev

ix percent (6

cent (5% =

undant

76

rch

ght

ven

6%

38

77

4.3.6.2. GENE ONTOLOGY (GO) AND FUNCTIONAL ANNOTATION

The Arabidopsis homologs of cotton (G. arboreum) are further categrized on the basis of

molecular functions, cellular components and biological processes by annotation through gene

ontology (GO). The GO molecular function reveals that the majority of the ESTs are engaged in

other enzyme activity (22.727%), following by other binding (13.636%), structural molecule

activity (10.227%), protein binding (9.091%), kinase activity (7.955%), other molecular funtions

(7.955%), transferase activity (6.818%), unknown molecular functions (6.818%), transporter

activity (5.682%), DNA or RNA binding (4.545%), hydrolase activity (2.273%) and nucleotide

binding (2.273%) (Figure 37).

The GO categorization for cellular components by annotation showed that mostly ESTs are

involved in other intracellular components (25.352%), following by chloroplast (18.712%), other

cytoplasmic components (18.31%), plastid (12.676%), other membranes (8.451%), ribosome

(3.219%), nucleus (2.817%), extracellular (2.616%), cytosol (2.414%), plasma membrane

(2.414%), mitochondria (1.408%), cell wall (0.805%) and unknown cellular components (0.805%)

(Figure 38).

The GO biological process annotation categorized the greater part of cotton (G. arboreum)

homologs in other cellular processes (28.75%), following by other metabolic processes (27.5%),

protein metabolism (8.333%), response to stress (8.333%), response to abiotic and biotic stimulus

(6.667%), other biological processes (4.583%), developmental processes (3.75%), cell organization

and biogenesis (3.75%), electron transport or energy pathway (3.75%), transport (2.083%),

unknown biological processes (1.25%), signal transduction (0.833%) and transcription (0.417%)

(Figure 39).

78

Figure38. GO Cellular components categorization by annotation.

Figure39. GO Cellular processes categorization by annotation.

Figure37. GO Molecular Functional categorization by annotation.

79

Some important ESTs in cotton (G. arboreum) cDNA library, involved in various biotic and

abiotic stresses are listed in Table8. These stress responsive ESTs are clustered as, Seven (7) in

reactive oxygen species (ROS) scavenger, four (4) in osmoprotectants, two (2) in each

transmembrane proteins, defense related proteins, salt responsive, late embryo-abundant protein,

transcription factor, heat shock, lipocalin and miscellaneous.

Table8. Cotton (G. arboreum) biotic and abiotic stress responsive ESTs, their annotations and E-values

Genbank _acc# Annotation e-value

ROS Scavengers

GE653421 Metallothionein-like protein 4e-110

GE653602 Gamma-tocopherol methyltransferase 8e-43

GE654005 Metallothionein-like protein (met-1) 4e-72

GE654017 Metallothionein-like protein MT2A 1e-61

GE653440 Catalase

GE654123 Copper/Zinc super oxide dismutase

GE653373 Thioredoxin 5e-28 Transmembrane protein

GE653432 Aquaporine PIP1 protein 5e-70 GE654065 Na+/H+ antiporter 1e-64

Defense Related GE653410 Cyclophilin protein 4e-17

GE653418 Rosa roxburghii clone C5 defense-related 6e-05

Osmoprotectants GE653776 Sorbitol related enzyme 2e-51

GE653841 Glutamine synthetase (GS) 1e-21

GE654075 Betaine aldehyde dehydrogenase 1e-65

GE654075 Putative betaine aldehyde dehydrogenase 1e-65

Genbank _acc# Annotation e-value

salt responsive GE653998 salt tolerance protein 6 2e-41

GE653487 Salt Overly Sensitive (SOS4) 3e-140

Late Embryo-abundant protein

GE653439 Late embryogenesis-

abundant protein (Lea5-A)

2e-46

GE653992 Late embryogenesis-

abundant protein (Lea5-D)

1e-80

Transcription factor GE653510 Zinc finger 7e-46

GE654100 RNA polymerase II transcription factor 2e-50

Heat shock GE653474 Heat shock protein 70 2e-37 GE653491 DnaJ-like protein 7e-89

Lipocalin GE654013 zeaxanthin epoxidase 1e-113

GE653653 Temperature-induced lipocalin 5e-53

Miscellaneous GE653741 Stress-induced cysteine

proteinase 4e-125

GE653602 Gamma-tocopherol methyltransferase 8e-43

80

4.4. cDNA MICROARRAY

4.4.1. cDNA LABELING / TARGET PREPARATION

Total RNA isolated from wild and wax deficient mutant leaf samples was indirectly

labeled with fluorochromes cyanine-3 (Cy3) (PA23001, Amersham) and cyanine-5 (Cy5)

(PA25001, Amersham), respectively and reciprocally. The quality and quantity of labeled

cDNA (Target) was confirmed by Nanodrop (ND-1000) using the program "microarray"

(Figure 40).

Figure40. Qualitative and quantitative confirmation of microarray target by Nanodrop (ND-1000)

81

4.4.2 HYBRIDIZATION AND SCANNING

The labeled cDNAs (targets) were hybridized with the cotton (G. arboreum) cDNA

microarray platform. The hybridized cDNA chips were washed and scanned in UC4×4

(Genomic solution) scanner. The tiff image (Figure 41) clearly shows the grids, good

quality of the spots, space between spots and sub-grids and spot morphology for most of

the spots. The tiff image also confirms the equal expression of the duplicate spotted

cDNAs.

Figure 41: Microarray image showing hybridization of wild and wax deficient mutant (M3) labeled cDNAs on cotton (G. arboreum) cDNA platform.

82

4.4.3. DATA NORMALIZATION

The house keeping genes, His3 (GE653512), His4 (GE653669), Actin (GE653433)

and GAPDH (GE653450) along with lowess normalization were used to normalize the

spot signals with in the array and total intensity with combination of lowess

normalization was applied to normalize the data between the arrays. The data after

normalization show equal intensities of Cy3 and Cy5 for most of the spots resulting very

low potential false ratio. The R-I plot (log2 [/(b)/(a)] against log10[/(a)-/(b)], where a and

b are the median intensities of two dyes (Cy5 and Cy3), for normalized data demonstrate

that most spots are in a range of -1 to +1 log ratios, an evidence of good quality data

showing equal expression for the most spots between wild and mutant plant (Figure. 42).

The data discussed in this thesis have been deposited in NCBI's Gene Expression

Omnibus (Edgar et al. 2002) and are accessible through GEO Series accession number

GSE15279(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=htcrvyqkcmcskfa&acc

=GSE15279).

Figure42. R-I plot for Raw Data on left and normalized data on right.

83

4.4.4. MICROARRAY DATA ANALYSIS

After the data analysis of microarray experiment, a total of 40 clones showed

significant (P ≤ 0.05) > mean expression ratio (log2) 1.5 fold expression differences in

wild plant. These forty (40) clones showing down-regulation in wax deficient mutant are

the strong potential candidates for wax genes in cotton (G. arboreum). The EST

sequences of potential candidates for wax genes were BLAST to NCBI GenBank for

their homology search against nucleotide, EST and protein data bases, using BLASTX

and BLASTN. Out of forty, ten (10) ESTs were novel (didn’t showed any homology) to

NCBI GenBank nucleotide, EST and protein data bases. Eighteen (18) have shown

homology in all the three databases. Ten (10) have shown homology to only EST data

base, one (1) to EST and protein data bases and one (1) to nucleotide and protein data

bases (Figure. 43).

Functionally annotation clustered, forty (40) wax potential candidate ESTs into

novel (10), functionally unknown (10), involve in signaling pathway (5), lipid associated

(4) and miscellaneous (11). In ten (10) functionally unknown, nine (9) have homology

with Gossypium hirsutum and one to Loa loa (Table9).

10 NOVELS

ESTs NTDs

PROTIEN

10 00

1

18

1

0

Figure43. BLAST results for forty (40), wax potential candidate ESTs, against protein, nucleotide and EST databases.

84

Table9. Cotton (G. arboreum) wax potential candidates ESTs, their accession numbers, mean expression ratios (log2), p values and homology with NCBI GenBank against nucleotide, EST and protein data bases.

GenBank_Accn

Mean expression ratio (log2)

p value Nucleotides Blast EST blast Protein blast

Novel GE654071 1.71489 0.0063 Novel Novel Novel GE654091 2.83467 0.0012 Novel Novel Novel GE654060 2.01319 0.0011 Novel Novel Novel GE654078 1.68186 0.002 Novel Novel Novel GE654079 1.91067 0.0015 Novel Novel Novel GE654088 7.10382 0.0013 Novel Novel Novel GE654089 8.02132 0.0031 Novel Novel Novel GE653765 1.98269 0.0021 Novel Novel Novel GE653856 1.89059 0.0013 Novel Novel Novel GE653865 2.07818 0.0061 Novel Novel Novel Functionally Unknown

GE653507 2.13101 0.0013 Novel L loa GE638241.1 (7e-40) Novel

GE654105 4.39653 0.0013 Novel Gh ES812808.1 (4e-20) Novel GE653641 2.83321 0.0081 Novel Gh DW236465.1(1e-09) Novel GE653684 4.30186 0.0071 Novel Gh DW226416.1( 4e-20) Novel GE654099 1.89723 0.0012 Novel Gh BF272363.1( 5e-47) Novel GE654101 7.05319 0.0017 Novel Gh ES843309.1 ( 2e-09) Novel GE654085 9.12342 0.0017 Novel Gh ES799513.1 ( 4e-08) Novel GE654122 1.92021 0.0049 Novel Gh DW515448.1 (0.0) Novel GE654098 2.39163 0.0021 Novel Gh DT558848.1( 3e-08) Novel GE654094 6.19034 0.0023 Novel Gh ES839639.1 ( 5e-13) Novel Expressed proteins GE654116 3.50721 0.0012 Novel GhDN804013.1(1e-127) intercellular

adhesion molecule(4e-06)

GE654074 3.17672 0.0056 Novel G. DT457342.1 ( 4e-90)

Ath expressed protein l 7e-09

Signaling

GE653379 2.90198 0.0042 AT1G62400 (4e-36) Novel Serine/threonine-protein(8e-34)

GE653948 4.01123 0.0041 Gh calcium-binding

protein (1e-79) Gr CO092169.1(4e-161)

Photosystem II protein(5e-22)

85

GE654125 2.87159 0.0031 P.vulgaris protein kinase, (5e-20)

GaBM359757.1 (1e-98)

CBL-interacting protein kinase ( 7e-13)

GE654093 3.14572 0.0015 AT4G02080(4e-22) ASAR1

Gh. BF277532.1 ( 2e-52) Vvi unnamed protein (7e-16)

GE653625 5.16729 0.0038 At5g15080 kinase (9e-57)

Gh DW493202.1 ( 9e-140) Vvi unnamed protein (2e-25)

Lipid Associated GE654072 3.81016 0.0045 Gh LTP-2 (6e-12) Ga BQ408051.1 (9e-17)

Vvi unnamed protein (0.70)

GE653362

5.01631 0.002 Vitis plastid lipid-associated protein, (7e-90)

Gh DW231361.1 (0.0)

Plastid lipid-associated protein

(2e-43) GE653455 6.34201 0.0032 GhLTP-3 (0.0) GA BQ406176.1 (0.0) Gh. lipid transfer

protein 3 (8e-38) GE654038 2.28198 0.0031 AT1G61680 terpene

3e-25 Gh ES850387.1 ( 2e-175)

Vvi unnamed protein (1e-41)

Miscellaneous GE654052 3.01329 0.0045 Actinidia deliciosa

cysteine protease 4e-59

Gh DW238268.1(7e-158) Os hypothetical protein (8e-29)

GE653633 4.49012 0.0031 AT1G77930 DNAJ heat shock (9e-31)

Gh DT543083.1 ( 3e-75) DNAJ protein (9e-12)

GE654115 1.80385 0.0121 G.h Al-induced protein ( 8e-24)

Gh DW483906.1 ( 1e-61)

Gh Al-induced protein (2e-06)

GE653951

1.83432 0.0071 Gly thiamin biosynthetic enzyme (4e-35)

Gh.ES804801.1 (3e-94)

Picrorhiza thiamine biosynthetic enzyme (5e-14)

GE654076 4.01321 0.0013 AT1G04690 (2e-95) KAB1

Gh. DW239577.1 ( 0.0) Ptr unknown protein (6e-61)

GE654065 4.16721 0.0132 Aegiceras Na+/H+ antiporter (3e-84)

Gh. DW506541.1 ( 4e-148) Na+/H+ antiporter (1e-36)

GE654066 3.10952 0.0091 Glycine GOX (2e-83)

Gh DN800277.1 (7e-165) Vvi unnamed protein (3e-38)

GE654064 3.18321 0.0051 AT5G49940 NFU2 protein 7e-68

Gh. ES838813.1 ( 1e-115) Vvi unnamed protein (2e-42)

GE654059 2.31455 0.0064 Gh phosphoethanolamine N-methyltransferase

Gh. EV487740.1 (2e-41) Gh.phosphoethanolamine N-methyltransferase (2e-17)

86

Figure44: Relative fold expression of Wax potential candidate ESTs in leaves of wild andwax mutant cotton plants through Real-time PCR. Solid bars represent FAM(carboxyfluorescein) signals during the reaction.

4.4.5. MICROARRAY RESULTS VALIDATION STUDIES

The cotton (G. arboreum) wax potential candidates ESTs, resulted from microarray

data are further confirmed by quantitative Real Time PCR to eliminate any false positive

results. The twelve transcripts were selected randomly for real-time RT-PCR and

GAPDH gene was used as the reference gene to normalize the expression levels. All

transcripts showed different level of down-expression in wax mutant (GaWM3) as

compared to wild plant and these results were the confirmation of microarray data. There

is 8.5 fold down expression of GE654079, 8 fold of GE654085, GE654105, GE654066, 7

fold of GE654122, GE654074, 6 fold of GE654078, GE654060, 5.5 fold of GE654065, 5

fold of 654072, 654099 and 4 fold of 654076 observed in wax mutant plant (Figure. 44).

87

4.4.6. WAX POTENTIAL CANDIDATE ESTS FUNCTIONAL

CATEGORIZATION BY GO (GENE ONTOLOGY) ANNOTATION

The Arabidopsis homologs of cotton (G. arboreum) wax potential candidates ESTs

are subjected to Gene Ontology for their functional categorization on the basis of cellular

components, molecular functions and biological processes.

The GO cellular component categrorization for the wax potential candidate ESTs

showed that 22.4% genes belong to chloroplast, 20.7% to other intracellular components,

17.2% to other cytoplasmic components, 13.8% to plastid, 12.1% to other membranes,

5.1% to plasma membrane, 1.7% to extracellular, cytosol, ribosome, nucleus, and

mitochondria (Figure 45).

The GO molecular function categorization revealed that cotton (G. arboreum) wax

potential candidate ESTs are mostly involved in other binding, transport and other

enzymes activity (20% each), following by protein binding (13.3%), kinase activity,

transferase activity, nucleotide binding, and structural molecule activity (6.7%) (Figure

46).

The GO biological processes annotation showed that the mostly cotton (G.

arboreum) wax potential candidate ESTs are engaged in other metabolic processes

(33.3%), following by, other cellular processes (27.3%), protein metabolism (12.1%),

transport (9.1%), response to stress and biotic, abiotic stresses (6.1, in each), signal

transduction (3.1%), cell organization and biogenesis (3.0%) (Figure 47).

88

Figure45. Cotton (G .arboreum) wax potential candidate ESTs Cellular component categorization by GO annotation.

Figure46. Cotton (G .arboreum) wax potential candidate ESTs Molecular Functional categorization by GO annotation.

Figure47. Cotton (G .arboreum) wax potential candidate ESTs Biological Process categorization by GO annotation.

89

4.4.7. GENE INVESTIGATOR EXPRESSIONAL ANALYSIS BY RESPONSE

VIEWER

Arabidopsis orthologs of cotton (G. arboreum) wax potential candidate ESTs,

subjected to gene investigator expressional analysis response viewer (Zimmermann et al.

2004), to find their expression in biotic, abiotic and UV stresses. The log2 ratios of

Arabidopsis orthologs under biotic, abiotic and UV stressed and their cotton (G.

arboreum) potential wax candidate ESTs showed similar pattern of gene expression,

when subjected to Multi Experiment Viewer (MEV) analysis. No down regulation is

found in this expressional analysis (Figure. 48).

90

Arabidopsis orthologs Gene codes

G. arboreum Wax Potential Candidate GenBank Accn_numbers

AT1G73600AT1G62400AT5G60360AT5G15080AT1G61680AT1G72640AT3G14420AT5G49940AT1G04690AT1G44575AT1G77930AT4G02080

WAX POT. CANDIDATE

BIOTIC

UV

ABIOTIC

GE654059 GE653379 GE654052 GE653625 GE654038 GE654074 GE654066 GE654064 GE654076 GE653948 GE653633 GE654093

Figure48. The expressional profile of wax potential candidate ESTs and their Arabidopsis orthologs (under biotic, abiotic & UV stresses), validating and strengthening of their candidateship.

CHAPTER: 5

DISCUSSION

&

REFERENCES

91

5. DISCUSSION

Presently no studies of leaf epicuticular wax composition, morphology and genes

in Asiatic diploid cotton (G. arboreum) reported. The aim of the present study is to better

understand and reveal the G. arboreum leaf epicuticular wax composition, morphology

and genes involve in their production and deposition. Forward genetic screens based on

plant phenotypes are very powerful toll to find the cotton (G. arboreum) wax genes

because the approach does not depend on prior knowledge. To find the potential wax

candidate genes in Asiatic diploid cotton (G. arboreum), known for its tolerance against

biotic and abiotic stresses (Mansoor et al. 2003), a strategy of wax mutant development

and its differential expression studies on cDNA microarray platform of wild cotton (G.

arboreum) plant has been adopted. Similar approach has been reported for the profiling

candidate genes in wax biosynthesis in Arabidopsis thaliana (Costaglioli et al. 2005) and

in other mutants (Garbay et al. 2007, Huang et al. 2008).

Wax mutants have important role in the identification of genes involved in wax

biosynthetic pathway (Kunst et al. 2003). A number of wax-deficient mutants were

developed and confirmed by various physical and chemical mutagens in various plant

species like, Arabidopsis (Koornneef et al. 1989), sorghum bicolor (Jenks et al. 1994),

barley (Hordeum vulgare) (von Wettstein-Knowles 1987), and maize (Zea mays)(

Bianchi et al. 1978). The most loci involved in wax biosynthetic pathway were identified

in barley, which are 85. Next is Arabidopsis, with total 25 known wax mutants showing

different degrees of waxlessness is reported.

92

In the present study physical mutagen (Gamma rays) and chemical mutagens like,

ethyl methane sulphonate (EMS), diethyl sulfate (DES) and sodium azoid (SA), in

combination and separately with various pre-soaking time is used to develop the wax

mutants in Asiatic diploid cotton (G. arboreum). Total three wax deficient mutants were

confirmed by scanning electron microscopy (SEM) and GC-MS. All the three mutants

are resulted from the chemical mutagens. Two are developed by EMS and one is by DES.

Koornef et al. (1982) developed a number of wax deficient mutants in Arabidopsis

thaliana by EMS. The wax mutant varieties in sorghum bicolor (L.) were produced by

mutagens diethyl sulfate (DES) and ethyl methane sulphonate (EMS) (Jenks et al. 1994).

The developed cotton (G. arboreum) wax mutants show glossy leaves as compared

to wild. The Arabidopsis, wax (cer) mutants showing varying degrees of glossiness as,

cer1- cer10 are very glossy and cer 11- cer22 are less so (Koornneef et al. 1989). The

wax mutants identified in several plant species due to its glossy appearance, termed as

glossy mutants like, the dicots rape (Brassica napus), cabbage (Brassica oleracea), pea

(Pisum sativum), and Arabidopsis thaliana, and the monocots barley (Hordeum vulgare),

sorghum (Sorghum bicolor), and maize (Zea mays) (e.g. Holloway et al. 1977, Lundqvist

& Lundqvist 1988, Eigenbrode et al. 1991, Schnable et al. 1994, Jianguo etal. 1995,

Jenkset al. 1996). Eighteen (18) glossy loci have been identified by the help of mutants in

maize (Hansen et al. 1997).

The wax mutant plant stem, at vegetative growth stage, showed more dense hair-

like trichomes than the wild plant stem. The hair-like trichomes density is observed in

inverse proportional to the wax deposition. More hair-like trichomes is observed in wax

mutants (GaWM3, GaWM2 and GaWM1), while showing less wax deposition

93

respectively. The observation of more dense hair-like trichomes, in wax deficient mutant

plants suggest, it may be an alternate adaptation of plant to compensate the lesions of wax

reduction.

The epicuticular wax appears as smooth stripy layers in wild cotton plant adaxial

leaf under scanning electron microscope. The similar finding was observed in

Arabidopsis leaf (Jenks et al. 1995). Jenk et al. (1996) reported crystal less smooth

epicuticular wax in wild-type Arabidopsis adaxial and abaxial leaf surfaces. The G.

hirsutum leaf epicuticular wax shows fine, selender striations morphology in SEM

(Bondada et al. 2000). It suggests a variation in epicuticular wax morphology among

species within a genus. As G. arboreum is more water stressed tolerant than G. hirsutum

so, it suggest, smooth waxy layer may have role in sufficient protection of plant from

dehydration by preventing non-stomatal water evaporation. The Arabidopsis stem shows

epicuticular wax as crystalline tubules instead of smooth layers. The maize leaf

epicuticular wax appears as membraneous platelets crystals (Beattie et al. 2002). The

GaWM1, GaWM2 and GaWM3 cotton wax mutant have altered wax morphology from

smooth strips to embedded tubules/fibers, irregular patches and non-stripy smooth layers

respectively.

The total wax load on wild cotton plant is 183.7 ±8.72 µgcm-2. It is almost six

fold to the Arabidopsis stem total wax load that is 32 µgcm-2 (Suh et al. 2005). As G.

arboreum show more tolerant to biotic and abiotic stress, as compare to Arabidopsis, so

it may be due to the over wax deposition on the leaves of G. arboreum. Bondada et al.

(1996) reported 154.60µgcm-2 total wax load in G. hirsutum leaf epicuticular wax.

Similarly total wax load on tobacco tree leaves is 10-26 µg cm-2 (Cameron et al. 2006).

94

The carnauba palm (Copernicia cerifera) has most total wax load on leaf cuticles among

plant species. It has the total leaf wax load in the range of 300–1000 µg /cm2 on leaves

(Tulloch, 1976), following by cotton (Gossypium hirsutum) and sorghum leaf epicuticular

wax loads which is in the range of 100 - 300 µg/cm2 (Premachandra et al. 1994, Bondada

et al. 1996). Arabidopsis thaliana, rice (Oryza sativa), willow (Salix spp.), poplar hybrid

(Populus spp.), and oat (Avena sativa) have total wax load ≤ to 25 µg cm -2 on leaves

(Bengtson et al. 1978, O’Toole et al. 1979b, Hietala et al. 1995, Jenks et al. 1995,

Cameron et al. 2002).

The total wax load is 66.79% on GaWM1, 59.50% on GaWM2 and 49.29% on

GaWM3 as compared to wild. Its means there is 33.21%, 40.50% and 50.71% reduction

in total wax load respectively. The Arabidopsis cer mutants have total wax load reduction

in a range of 10 -90% to wild. The Cer1, Cer2, Cer3 and Cer6 have only 13%, 25%, 20%

and 10% total wax load as compared to wild (Aarts et al. 1995, Fiebig et al. 2000, Negruk

et al. 1996, Rowland et al. 2007). Cer4 and WSD1 Arabidopsis wax mutants have similar

wax load to wild type but reduced primary alcohols and wax esters (Rowland et al. 2006,

Samuels et al. 2008).

The epicuticular wax chemical composition and their percentage to total wax load

varies among plant not only in plant species but even also within plant organs. The

chemical wax composition depends on plant species and genotypes. This variation in wax

chemical composition and concentration bring resistance to various biotic and abiotic

stresses in plants (Eigenbrod et al. 1995, Jetter et al. 2006, Eltz 2006, Wilms and Eltz

2008). In the present study, cotton (G. arboreum) leaf epicuticular wax chemical

composition consists of alkanes, acids, esters, aldehyds alcohols and unknown classes.

95

The dominant wax class found in G. arboreum is alkane following by acids, esters,

aldehyds and alcohols. The alkane is 74% to total wax load in wild cotton plant. The

alkane is also dominant wax component class on the leaves and stem epicuticular waxes

of Arabidopsis and G. hirsutum with 58% and 42.65% to total wax load respectively. The

alcohol is the second dominant class with 24% following alkane in Arabidopsis leaf

epicuticular wax (Jenks et al. 1996). (Bondada et al. 1996) Cameron et al. (2006)

observed alkane as a dominant wax chemical compositional class with 80±2 % following

by 4% alcohol to total wax load in tobacco tree (Nicotiana glauca L.) leaves. The barley

(Hordeum vulgare) and maize (zea maize) juvenile epicuticular waxes have primary

alcohols as dominant wax compositional class with 63% and 75-89% concentrations to

total wax load respectively (Bianchi et al. 1978, Giese 1975, Rostás et al. 2008). The

adult leaves have esters (42%) as dominant wax class (Avato et al. 1990).

One or more components of aliphatic or cyclic mixture of epicuticular wax are

dominated in various plant species. These used as a chemo-taxanomic marker for plant

classification. It also used to correlate the nature and chemical composition of wax, with

the susceptibility of the plant to insect attack (Gracia et al. 1995). In present study 1,2-

Benzenedicarboxalic acid, mono (2-ethyl hexyl) ester is found as the major dominated

wax component following by docosane, heneicosane, hexacosane, octadecane and

eicosane of the n-alkane family in asiatic diploid cotton (G. arboreum) leaf epicuticular

wax. Similar wax component was identified in Digitaria sanguinalis epicuticular wax

(Wang et al. 2006). A similar wax component (1,2-Benzene-dicarboxylic acid dihexyl

ester) showed strong antifungal activity in Pyrus bretschneideri (Li et al. 2008). The C29

and C31 alkane members are the major constituents of the Arabidopsis stem and leaf

96

epicuticular wax (Jenks et al. 1996, Suh et al. 2005). Similarly C33 member of alkane is

the dominant component in the leaves of Ligustrum vulgare wax (Buschhaus et al. 2007).

Hexacosanol (C26) was identified as dominated single compound in maize leaf

epicuticular wax. Similarly the most dominant components were nonacosan-10-ol,

nonacosane-4, 10-diol and nonacosane-5,10-diol in Taxus baccata leaves wax (Wen et al.

2006). The Wollemia nobilis leaves have nonacosan-10-ol as the prominant constituent

of the epicuticular wax following by members of n-alkanes (C31, C33, and C35)

(Dragota and Riederer 2007).

A cDNA library is the collection of expressed transcripts. It is a blue print of the

expressed genome of an organism at particular condition/developmental stage. cDNA

library is a best approach to reveal the response of the genome toward internal and

external environmental changes and any mutational lesion in the genome. It offers

molecular resources for analysis of genes involved in the biology of a plant, genes

responsible for the development, survival, pathogenicity and virulence. In order to studies

wax production and deposition genes, on genome basis, gene expression of G. arboreum

under drought stress cDNA library is constructed from leaves of wild plant. The drought

stressed cDNA library development approach is adopted because the epicuticular wax

production and deposition responsible genes showed enhanced expression by increasing

epicuticular wax load 40-60% in cotton and other (Bondada et al. 1996).

The EST analysis is a valuable source for the identification of genes that play

important roles during certain conditions and developmental stages, for which cDNA

library has been constructed. In the present study, total seven hundred seventy eight (778)

EST sequences generated from the drought stressed wild cotton plant. Seventy eight

97

percent (78%) sequences did not show significant homology to NCBI GenBank

nucleotide data base. It indicates the potential of cotton genome for novel genes

discovery in plant Kingdom. As the basic aim of this study is to find the wax genes in

cotton (G. arboreum), a class of stress tolerant genes that can be utilize for the

improvement of crops tolerance against biotic and abiotic stresses, so the following biotic

and abiotic responsive ESTs in the cDNA library, on homology basis, are also candidates

for plants stress resistance enhancer.

The EST (GE653510) shows significant homology with zinc finger protein of

Arabidopsis thaliana. Zinc finger proteins (ZFPs) mostly present in eukaryotic cells, and

it has vital function in plant to cop from stresses. Zinc finger proteins act as a regulatory

element of gene expression by interrelating with DNA, RNA and other regulatory

elements. The genes coding for zinc finger proteins are involved in plant stress resistance

and in hormone signal transduction, were reported in Arabidopsis thaliana (Sakamoto et

al. 2000, Ciftci-Yilmaz et al. 2007), alfalfa (Bastola et al. 1998) and rice (Mukhopadhyay

et al. 2004, Liu et al. 2007). Zinc-finger transgenic tobacco demonstrates tolerance to

dehydration stress. Zinc-finger proteins, "OSISAP1" in rice act as transcription activators

during different abiotic stresses. Transgenic tobacco, over expressing these genes confirm

tolerance to freezing temperature, water and salinity stress (Mukhopadhyay et al. 2004)

and petunia ZPT2-3, over expression confirm drought resistance (Sugano et al. 2003).

The EST (GE654100) is homologs to the Arabidopsis thaliana RNA polymerase II

transcription factor. RNA polymerase II (RNAP II) is a multi-subunit enzyme involved in

mRNA synthesis, and the C-terminal domain (CTD) of its largest subunit contains

tandemly repeated heptapeptides with a consensus sequence of Y1S2P3T4S5P6S7 (Corden

98

et al. 1985). Phosphorylation position of the CTD plays a significant role in regulating

transcription cycles and mRNA maturation processes (Dahmus et al. 1996, Ahn et al.

2004, Ho et al. 1999). During the transcription cycle, the phosphorylation of C-terminal

domain take place predominantly at amino acid Ser at position 2 or -5 within its

heptapeptide repeats (Lu et al. 1992, Komarnitsky et al. 2000), and before a new round of

transcription, the CTD is dephosphorylated (Corden et al. 1990, Kang et al. 1993). FCP1

is the first known CTD-specific phosphatase whose function is reliant on TFIIF

(Chambers et al. 1994, Schroeder et al. 2000). Transcription factors TFIIF controls the

regulation of FCP1 activity. The Arabidopsis CTD phosphatases are responsible for the

regulation of stress inducible transcription of RNAP II CTD phosphorylation that leads to

stress tolerance. Several mutants defective in RNA metabolism proteins have abnormal

osmotic stress and ABA responses (Xiong et al. 2001, Hugouvieux et al. 2001).

The EST (GE653991) shows significant homology with Arabidopsis SALT

OVERLY SENSITIVE 4 (SOS4) gene. SOS genes are mainly involved in ion

homeostasis during sodium salt toxicity in Arabidopsis (Zhu, 2001). Shi et al. (2002)

demonstrated that sos4 mutant plants are oversensitive to sodium, lithium, and potassium

ions. In salt hassle, sos4 mutant plants hoard additional sodium and maintain less

potassium than do wild-type plants. These results suggest that SOS4 is vital for sodium

and potassium homeostasis in plants.

Seven ESTs (GE654123, GE653855, GE653421, GE653602, GE654005,

GE653373 and GE654017) have significant homology with copper/zinc superoxide

dismutase 3 (CSD3), Catalase, metallothionein-like protein, gamma-tocopherol

methyltransferase, metallothionein-like protein (met-1), thioredoxin and metallothionein-

99

like protein MT2A genes respectively. The products of these genes act as antioxidant

enzymes playing an important role in conferring abiotic and biotic stress tolerance by

scavenging Reactive oxidative species (ROS). Reactive oxidative species (ROS), can

cause cell death due to their highly reactive and toxic nature by demaging cellular

proteins, lipids, carbohydrates and DNA (Mittler et al. 2004). Several abiotic stresses like

dehydration, salinity, high temperature, cold, nutrient deficiency and intense light are

responsible for increased production of ROS (Malan et al. 1990, Prasad et al. 1994,

Tsugane et al.1999, Desikan et al. 2001, Mittler, 2002). Some biotic stresses, such has

pathogen infection and wounding, also trigger an ROS burst (Chen and Schopfer, 1999,

Orozco-Cardenas and Ryan 1999, Torres et al. 2002). Superoxide dismutase (SOD) is the

first enzyme in the enzymatic antioxidative pathway. Some abiotic stresses like,

dehydration, salinity, freezing and heat disturbing the oxidation metabolism in plant cells

by the inhibition of superoxide dismutase (SOD) and other endogenous active oxygen

species eliminators. Production of reactive oxygen species such as O-2, OH-2, OH-1, and

H2O2 is hurtful to proteins, membranes lipid, DNA and other cell components. As a

result, several physiological and biochemical processes and normal growth and

development of plants are seriously affected (Du et al. 2001, Pastori et al. 2000,

Prasad,1997, Shen et al. 1995, Zhu and Scandalios, 1994). Many plants have shown

improved abiotic stress tolerance by transforming with superoxide dismutase (SOD)

gene. The transgenic clover plants, transformed with superoxide dismutase, demonstrated

a considerable increase in growth vitality and yield under dehydration (Bowler et al.

1994). The resistance to ROS, in the water stressed condition, also shown to considerably

enhance within transgenic tobacco, over expressing a copper/zinc superoxide dismutase

100

gene (Cu/ZnSOD) (Simontacchi et al. 1993). Zhang, et al. (2008) found that CuZnSOD

gene in wheat (Triticum aestivum L.) was significantly stimulated under the dehydration,

salinity, freezing and heat conditions, suggesting that SOD could be a useful target gene

in improvement the plant injury which caused by adverse environmental and other

oxidative stresses. The hydrogen per oxide and Methyl viologen (MV) treatment induced

enhance in oxidation in Arabidopsis. In the presence of MV, the expression intensities for

catalase 3, ascorbate peroxidase and superoxide dismutase also increased (Xiong et al.

2007).

Metallothioneins (MTs) have been reported in animals, plants, fungi, and

cyanobacteria. All MTs belong to plants are placed in Class II (Robinson et al. 1993,

Palmiter 1998, Cobbett and Goldsbrough, 2002). In animals, MTs involved in regulation

of metal homeostasis and the response to ROS (Mattie and Freedman, 2004, Zatta et al.

2005, Stankovic et al. 2007). Similarly fungal MTs are also engaged in the response to

metal toxicity (Lanfranco et al. 2002, Tucker et al. 2004). In recent years, growing

numbers of reports have showed that plant Metallothioneins may have vital roles as they

perform in animals and fungi (Adams et al. 2002, Cobbett and Goldsbrough, 2002,

Chiang et al. 2006, Zhigang et al. 2006). The Arabidopsis MTs show significant utility in

sustenance the homoeostasis of vital metals, detoxification of toxic metals, and protection

against ROS stress (Robinson et al. 1996, Murphy et al.1997, Garcia-Hernandez et al.

1998, Miller et al. 1999, Kiddle et al. 2003, Lee et al. 2004). Xue et al. (2008)

demonstrated that the mRNA level of GhMT3a in cotton (G. hirsutum) seedlings was

increased by many environmental stresses like, salt, drought, and low temperature.

Transgenic tobacco and yeast that over expressing cotton MT3a, showed more tolerance

101

to abiotic stresses. It shows GhMT3a function in response to environmental stresses by

regulating the ROS balance as a ROS scavenger in plants.

Vitamin E is also involved in the ROS scavenging (Dat et al. 2000, Alscher and

Heath, 2002). Eight (8) tocochromanols are commonly considered as vitamin E, namely

tocopherols and tocotrienols. The, Alpha-tocopherol has been engaged to take part in the

removal of ROS along with the glutathione and ascorbate (Foyer and Noctor, 2003).

Based on inhibitor studies it has been shown that tocopherol acts as singlet oxygen

scavenger in PSII of Chlamydomonas reinhardtii (Trebst et al. 2002, Kruk et al. 2005).

Abbasi et al. (2007) demonstrated that the knockdown of gamma-tocopherol

methyltransferase in transgenic plants showed increased sensitivity under various

stresses.

Two ESTs (GE654075 and GE653776) show significant homology with

Arabidopsis thaliana putative betaine aldehyde dehydrogenase involves in the production

of glycine betaine and sorbitol related enzyme respectively. Plants have the ability to

tolerate stress by a mechanism called as osmotic regulation. In this process, cellular

osmotic potential is decreased by the addition of solutes. Many metabolic pathways are

involved in the production of these osmo-regulators under the various stresses. The

increased solute concentration in the cytoplasm, helped in the maintenance of leaf turgor.

These solutes are termed as osmoprotectants like, proline, sucrose, sorbitol, raffinose, and

glycine betaine. These osmoprotectants accumulate in the cells at elevated concentration

during osmotic stress without affecting the normal cellular metabolism (Chen and Murata

2000) and may have a basic function in maintaining turgor, alleviating proteins and cell

structures (Yancey et al. 1982), and scavenging ROS (Chen and Murata 2000). The

102

Genes related to sucrose, raffinose, and glycine betaine were also induced by low

temperature and water stress in barely (Tommasini et al. 2008).

The ESTs (GE653633 and GE653474) are homologous to Arabidopsis thaliana

DNAJ and heat shock protein 70. Heat-shock proteins (Hsps) showed increased

expression under various stresses such as, salinity, extreme temperature and dehydration.

These proteins have been demonstrated to be engaged in cellular protection during the

stress (Vierling and Kimpel 1992, Boston et al. 1996, Ingram and Bartels 1996, Waters et

al. 1996, Thomashow 1998). Heat-shock proteins (Hsps) are produced when abiotic

stresses perturb an organism’s whole physiological system to such an extent that results

in misfolding of proteins. These Hsps function as molecular chaperones, playing

important role in protein synthesis, maturation, degradation, and targeting in a broad

array of normal cellular processes. Furthermore, molecular chaperones are responsible for

stabilization of proteins and membranes, as well as they help in refolding of protein under

stress conditions (Vierling 1991, Hendrick and Hartl 1993, Boston et al. 1996, Hartl

1996, Waters et al. 1996, Torok et al. 2001, Hartl and Hayer-Hartl, 2002). Increase in

level of Hsp in different plant species under abiotic stress conditions has been studied

extensively by proteomics and functional genomics (Sun et al. 2002, Wang and Luthe

2003). From various studies it has been demonstrated that plant Hsps are not only

produced in response to high temperature but also under oxidative, salinity, drought, and

at freezing temperature stress (Almoguera et al. 1993, Alamillo et al. 1995, Sabehat et al.

1998, Hamilton and Heckathorn, 2001). Gazanchian et al. (2007) identified two small

heat shock proteins (sHsps) that were expressed in tall wheat grass (Elymus elongatum)

shoots after progressive water stress. These proteins have shown engagement in

103

protecting macromolecules like nucleic acids, lipids, enzymes, and mRNAs from

dehydration (Yamaguchi-Shinozaki et al. 2002). DnaJ-like proteins are believed to act as

chaperone or co-chaperone proteins. DnaJ-like proteins have a conserved "J" region of

approximately 73 amino acids. DnaJ induction has been reported to be coupled with salt

and drought tolerance in plants. Nguyuen et al. (2004) developed a marker for mapping

of quantitative trait loci (QTL) regions for drought tolerance in rice, which is similar to

Zea mays DnaJ-related protein (ZMDJl), that expressed by high temprature stress

(Baszczynski et al. 1997).

Two ESTs (GE653439 and GE653992) are homologus to late embryogenesis-

abundant protein (Lea5-A) and late embryogenesis-abundant protein (Lea5-D). Late

embryogenesis abundant (LEA) or (DHNs) proteins are generated in response to

dehydration, freezing temperature and salt stresses. DHNs are intracellular regulators,

functioning upon targets, present in the nucleus and cytoplasm (Close 1996, 1997,

Svensson et al. 2002, Koag et al. 2003). These proteins have tremendously hydrophilic

property as well as the timing for accumulation, suggesting that they may act a vital role

in protecting cells from water stress (Baker et al. 1988, Dure et al.1989). Along with the

accumulation in the embryo, dehydrins are also produced in vegetative tissues by osmotic

stress, as well as salinity, desiccation, and external abscisic acid (Skriver and Mundy

1990, Chandler and Robertson 1994). The role of overexpressed LEA proteins in

enhancement of tolerance against drought and salinity has been reported in yeast and

bacteria (Swire-Clark et al. 1999, Liu and Zheng 2005). The transgenic plants showing

increased production of LEA proteins confirmed an enhanced tolerance to environmental

stresses (Xu et al. 1996, Borrell et al. 2002, Puhakainen et al. 2004).

104

Two ESTs (GE653432 and GE654065) share significant homology with aquaporine

PIP1 protein and Na+/H+ antiporter respectively. Aquaporins are transmembrane channel

proteins that are selectively permeable to water (Froger et al. 1998). Aquaporins are

present in the plasma membranes of nearly all organisms from bacteria to plants and

animals. These special proteins consist of four units (monomers), forming a tetramer that

are formed from six transmembrane domains, with two highly conserved amino acid

sequences like, asparagine, proline, and alanine (NPA) that mirror one another in the

center of the channel (deGroot et al. 2003, Heymann and Engel, 1999, Weig et al. 1997).

Cell membrane intrinsic proteins (PIPs), a class of aquaporine are found fixed within the

cell membranes of most cell types and are involved in water movement in and out of the

cell (Chaumontet al. 2000). Their expressions depend on the environmental stresses, pH,

divalent cations, and even the existence of other aquaporins (Aroca et al. 2005). The

regulation of aquaporins can be controlled at transcription, translationand and post-

translation levels (Aroca et al. 2005, Vera-Estrella et al. 2004). The plant aquaporins,

PIPs, TIPs, and NIPs are regulated at post-translational level through phosphorylation at

single or multiple sites (Johansson et al. 1998, Maurel et al. 1995, Lee et al. 1995). The

induced phosphorylation of aquaporins by biotic and abiotic stresses; like drought,

salinity, high light, pathogens and various harmones in plants suggested their role in

stresses (Aroca et al. 2005).

The ESTs (GE654013 and GE653653) are homologus to zeaxanthin epoxidase

(ZE) and temperature-induced lipocalin (TIL). Plant lipocalins can be categorized into

two classes, temperature induced lipocalins (TILs) and chloroplastic lipocalins (CHLs).

In addition, violaxanthin de-epoxidases (VDEs) and zeaxanthine epoxidases (ZEPs) are

105

also grouped as lipocalin-like proteins. TILs analyses showed that the proteins are present

at the cell membrane. Expression studies by quantitative real-time PCR revealed that

expression of the wheat lipocalins and lipocalin-like proteins is involved with

environmental stress response and is associated with the plant’s capacity to create low

temperature tolerance (Frenette Charron et al. 2002). The absorbed light by plant

consume by the photosynthetic electron transport pathway, the excess light energy, which

is not properly quenched, can decrease the photosynthetic efficiency and cause in photo

oxidative damage (Foyer et al. 1994, Pastenes et al. 2005, Telfer et al. 1994). Photo

oxidative damage can disturb the role of the D1 protein of PSII reaction center, result by

reducing the rate of photosynthesis (Jiao et al. 2004, Powles 1984). When the rate of

injury of PSII go over the rate of repair, the photosynthetic ability and the quantum yield

of photosynthesis turn down, which has been referred as photoinhibition (Aro et al. 1993,

Powles 1984). Photoinhibition happens, when the plants encounterd to stress of high light

(Long et al. 1994). Chronic photoinhibition of Photo System II may be induced by the

combination of cold stress with radiation (Bertamini et al.2006, Boese and Huner 1992,

Long et al. 1994). Xanthophyll-cycle-dependent thermal energy dissipation is a

mechanism of higher plants to avoid severe photoinhibition ((Latowski et al. 2004). The

cycle depends mainly on two enzymes, violaxanthin de-epoxidase (VDE) and zeaxanthin

epoxidase (ZE). ZE belongs to the lipocalin group (Bugos et al.1998), which is a

monooxygenase epoxidizing 3-hydroxy b-ionone ring of xanthophylls in the 5,6position

(Buch et al. 1995). The ZE have also role in ABA production during dehydration stress

and seed development. It also shows relationship with photosynthesis by studying a

mutant lacking ZE activity (Audran et al. 1998, Hurry et al. 1997, Rock and Zeevaart

106

1991, Tardy and Havaux1996, Thompson et al. 2000). Wang et al. (2008) suggested that

overexpression of LeZE impaired the function of the xanthophyll cycle and aggravated

PSII photoinhibition in tomato under high light and low temperature stress.

The EST (GE653410) has significant homology to cyclophilin protein (CyP). Plant

cyclophilins are ubiquitous and constitutively expressed. However, they are also stress-

responsive proteins, and up-regulated gene expression have been reported in response to

environmental stresses such as high temperature, chilling, salinity, wounding, as well as

virus infection and during chemically induced defense (Marivet et al. 1992, 1994, Luan et

al. 1994, Droual et al. 1997). Dubery (2007) suggested that CyPs play an important role

in plant stress responses by founding higher expression of potato CyP mRNA in response

to salicylic acid, P. infestans elicitor and P. infestansinfection.

The EST (GE653741) shows significant homology to stress-induced cysteine

proteinase (LtCyp1). Proteases have role in the elimination of misfolded proteins.

Misfolding proteins are continuously generated by a variety of mechanisms such as,

mutation, biosynthesis errors, spontaneous denaturation, ROS damage, biotic and abiotic

stresses and disease (Vierstra 1993). Correspondingly, cysteine proteases are induced

when tissues are exposed to different abiotic stresses such as dehydration or salinity in

Arabidopsis leaves (Koizumi et al. 1993) and by low temperature in tomato (Schaffer and

Fisher 1988). Usui et al. (2007) found that cysteine protease is up-regulated in response

to oxidative stress and plays a role in the maintenance of cell metabolism under oxidative

stress conditions in Chlamydomonas species.

107

As the sequencing is an expensive option, many gene discovery experiments are

performed using anonymous cDNA microarrays. Although there are certain limitations,

but these arrays are easier and cost effective as compared to unigene and oligo arrays. By

randomly picking EST clones from the G. arboreum wild plant, drought stressed library,

we constructed a Gossypium specific cDNA microarray. A similar approach has been

applied successfully by Maguire et al. (2002) to identify a novel genes expressed in

soybean (Glycine max), Yan et al. (2001) in mouse oocytes, Yao et al. (2004) in bovine

oocyte and Kuballa et al. (2007) in Portunus pelagicus.

In the present study over all 40 ESTs were identified as wax potential candidates,

over expressed in wild and down-regulated in wax deficient mutant (M3). Out of which

10 ESTs didn’t show any homology to the NCBI GenBank and were considered as novel.

These ESTs are the strong candidates as the new genes.

Ten clones (GE653507, GE654105, GE653641, GE653684, GE654099,

GE654101, GE654085, GE654122, GE654098 and GE654094) were homolog the known

ESTs in Genbank EST-database, but functionally unknown, belonging to different plant

species and these can be categorized to have some role in leaf wax production or/and

deposition.

In the present study, among the ESTs identified as wax potential candidates, four

have significant homology to signaling pathway. The three candidates (GE653379,

GE654125 and GE653625) show significant homology to serine/threonine protein

kinases. The candidate EST (GE653948) has significant homology with G. hirsutum

calcium binding protein. Various physiological functions like protein phosphorylation

108

and/or dephosphorylation, phospholipid metabolism, calcium sensing, protein

degradation are triggered through signal transduction under biotic and abiotic stress

responses (Boudsocq and Lauriere, 2005). Although the complete signaling pathways are

not yet fully known but many genes encoding signaling factors that have role in biotic

and envoirenmental stress responses have been reported (Chinnusamy et al. 2004,

Shinozaki et al. 2003). Several signaling factors are engaged in a wide range of

downstream procedures, which results in greater tolerance for various aspects. The

calcium (Ca2+) caused increase expression of the potato lipid transfer protein (Gao et al.

2009). Plant stress response, growth and development are regulated by Mitogen-activated

protein kinase (MAPK) cascades (Tena et al. 2001, Zhang and Klessig, 2001, Nakagami

et al. 2005, Pedley and Martin, 2005). Ca2+ plays an important role in almost each

biological process in eukaryotic organisms (Berridge et al. 1998). Calcium acts as a vital

messenger in several adaptation and developmental processes. Calcium-binding proteins

act as sensor molecules for the calcium detection and transmission during various cellular

signaling processes (Batistic et al. 2008). Various cellular functions are regulated by

calcium by functioning as a stimulus-response mediator (Allen et al. 2001, Berridge et al.

2000). The calcium binding proteins play vital role in downstream cascades. In addition,

the intracellular Ca2+ concentration has been regulated in different cell types by

physiological responses like; environmental stresses, high light, pathogens and hormones,

(Harper et al. 2001, Knight et al. 2000). Calcium binding proteins regulate vast and

diverse range of target proteins that belong to various protein classes such as transporters,

cell structure proteins, metabolic enzymes, signaling proteins and transcription factors

(Reddy et al. 2004). Plants have developed particular klinds of calcium binding proteins,

109

such as Calcium-dependent protein kinases (CDPKs) (Harper et al. 2004) and

calcineurin-B like (CBL) proteins (Batistic et al. 2004). The above four wax candidates

showing homology with signaling pathway are found down regulated in wax deficient

mutant. This result implies that these four ESTs may be involved in cotton (G. arboreum)

epicuticular wax production or deposition. It also shows the involvement of signaling

cascades in wax production and deposition.

Small GTP-binding proteins are molecular switches that are “activated” by GTP

and “inactivated” by the hydrolysis of GTP to GDP. The resulting cycles of binding and

hydrolysis of GTP by small GTP-binding proteins represents a ubiquitous regulatory

mechanism in eukaryotic cells. Members of this class of proteins are among the largest

families of signaling proteins in eukaryotic cells. Their importance in cellular signaling

processes is underscored by their conservation throughout evolution of eukaryotic

organisms and by the presence of homologs that perform related functions in cells of

yeasts, humans, and plants. Small GTP-binding proteins are engaged in regulation of

multiple eukaryotic cellular functions, like, cell propagation, cytoskeletal assembly and

organization, and intracellular membrane trafficking (Barbacid, 1987, Boguski and

McCormick, 1993, Takai et al. 2001). This large super family consists of five distinct

families such as Ras, Rab, Rho, Arf, and Ran on the basis of their structural and

functional similarities (Kahn et al. 1992). The Rab and Arf GTPase classes serve in

diverse steps of membrane trafficking. Twenty one Arf GTPase proteins are known in

Arabidopsis genome (Vernoud et al. 2003). Arf/Sar GTPases act to recruit cytosolic coat

proteins to sites of vesicle budding. AtSARA1a expression was correlated to levels of

secretion activity from ER membranes in plant cells, because blockage of transport from

110

the ER resulted in up-regulation of mRNA levels for AtSARA1a (Bar-Peled et al. 1995).

Arf GTPases mainly function during the lipid modification in yeast and animals and it

also activate phosphatidylinositol4-phosphate, 5-kinases (Honda et al.1999, Walch-

Solimena and Novick, 1999). The cotton (G. arboreum) wax candidate EST (GE654093)

is homolog to Arabidopsis ARF GTPase. It suggests that the plant ARF family may have

role in epicuticular wax production.

Terpenoids are the major group of plant natural products (Trapp and Croteau, 2001)

and more than 30,000 terpenoid compounds have been identified (Buckingham, 1998).

The vital role of terpenes and their derivatives is broadly known in plant defense system.

Many terpenes have role in various biotechnological applications. For example, terpenes

can be produced by plants after being attacked by herbivorous mites and insects, which in

turn serve as chemical attractants for predatory arthropods (Degenhardt et al. 2003).

According to Zwenger and Basu (2007), the Arabidopsis terpene synthase gene was over

expressed in response to various stressors, including low temperature, dehydration,

osmotic stress, nutrient, ozone and mechanical stress. The EST (GE654038) in wax

potential candidates shows significant homology with Arabidopsis terpene synthase gene.

The down regulation of this EST in wax mutant suggested it may have role in plant

epicuticular wax.

Lipid transfer proteins (LTPs) are constitutively expressed plant lipid binding

proteins that have been correlated with several developmental and stress responses. LTPs

typically bind fatty acids and fatty acid derivatives in a non-covalent way. LTPs have role

in the transport of seed storage lipids (Edqvist and Farbos, 2002), in the development of

cuticles (Sterk et al. 1991, Hollenbach et al. 1997), in pollen tube adhesion (Mollet et al.

111

2000, Park et al. 2000), in endosperm programmed cell death (Eklund et al. 2003), and in

cell wall loosening (Nieuwland et al. 2005). Regarding plant defense against biotic and

environmental stress, it has been observed that LTPs are correlated with low temperature

and hurtful stress (Serrano et al. 2003, Pearce et al. 1998), are induced by microbial

pathogens (Molina et al. 1993), and can inhibit fungal growth in vitro (Garcia et al. 1998,

Broekaert et al. 1997). A mutant of Arabidopsis thaliana disrupted in an LTP2 gene was

incapable to develop systemic acquired resistance (Maldonado et al. 2002) suggests that,

in plant, LTPs are possibly engaged in the signaling of plant defense systems rather than

in a direct inhibitory activity on microbial pathogens. Lipid transfer proteins (LTPs) have

long been important candidates for wax transport across the cell wall (Kader, 1996),

because they are plentifully produced in the epidermis, are released into the apoplast

(Thoma et al. 1993), are small enough to pass through the pores of the cell wall, and have

a hydrophobic pocket that binds long-chain fatty acids in vitro (Zachowski et al. 1998).

The potato LTPa7 gene was found up-regulated by infection with R. solanacearum (Gao

et al. 2009) A published microarray data show that a number of type 1 and type 5 LTPs

are greatly expressed in the epidermis (Suh et al. 2005). Among the potential wax

candidates ESTs, two ESTs (GE654072 and GE653455) have showed strong homology

with G. hirsutum LTPs, GhfLTP-2 and GhLTP-3 respectively. The down regulation of

these LTPs in wax deficient mutant reveals a link between LTPs with epicuticular wax

accumulation in cotton (G. arboreum).

The down regulated EST (GE653362) in wax deficient mutant shows homology

with Vitis plastid lipid-associated protein. Plastid lipid-associated proteins (PAPs) are the

homologs of carotenoid-associated protein that are engaged in the translation of plastids

112

to chromoplasts in plants (Pruvot et al. 1996, Kessler et al. 1999, Kim et al.2001 Murphy,

2004). They have been reported in various plant systems, as well as in plastids other than

chromoplasts. The presence of PAPs in nonchromoplastogenic tissues may suggest their

involvment not only in the accumulation of carotenoids but also in the general

sequestration of hydrophobic molecules like lipids. The storage of PAPs in plastids as

well as the generation of structures that sequester hydrophobic compounds is enhanced

by different stresses (Murphy, 2004). Various osmotic and oxidative stresses induced the

mRNA expression and protein accumulation of the Solanum tuberosum PAP homolog

CDSP34 in leaf tissues (Pruvot et al. 1996, Gillet et al. 1998, Langenkamper et al. 2001).

In addition, Rey et al. (2000) has demonstrated that up-regulation Fib (PAP's homolog) in

tobacco (Nicotiana tabacum) develops plant tolerance under stress conditions. It suggests

an additional role for the plant PAPs along an important general role in the sequestration

of hydrophobic molecules, a route that may be crucial for plant survival under stress.

Dagan et al. (2006) demonstrated that the transgenic PAP-suppressed plants were

considerably more susceptible to Botrytis cinerea infection. In the present study, the PAP

homolog down regulation in cotton (G. arboreum) wax deficient mutant suggested its

role in epicuticular wax deposition.

Protein breakdown and recycling, which depend on the levels of proteolytic

enzymes, are an essential part of the plant response to environmental stress (Hieng et al.

2004). The proteases play crucial role in the breakdown of misfolded and harmful protein

that can damage the cell. The wax candidate EST (GE654052) is homolog to cysteine

protease. This suggests the role of cysteine protease in maintaining of proper proteins for

the production of plant epicuticular wax.

113

Voltage-dependent (Kv) potassium channels regulate an inward K+ current (IKin) at

the cell membrane of plant cells. IKin has role in several functions like; regulating

membrane voltage, nutrient absorption, and osmotic regulation. In guard cells onset of

this current typically leads to K+ accumulation triggering stomatal opening (Schroeder et

al. 1984, MacRobbie 1998, Thiel, Wolf 1997). In the present study the EST (GE654076)

homolog to Arabidopsis potassium channel, is down regulated in wax deficient mutant,

suggesting it may be involve in the controlling of cotton (G. arboreum) leaf epicuticular

wax deposition.

The cotton (G. arboreum) wax candidate EST (GE654064) shares significant

homology with Arabidopsis NFU2 protein. Nfu proteins are candidates to serve as

scaffold protein in vivo for iron-sulphur cluster production. The Arabidopsis genome has

five genes for the production of Nfu proteins (Leon et al. 2003). Nfu proteins are engaged

in Iron-sulphur clusters (Fe-S) assembly and have an NFU domain of 60 amino acids

which contains highly conserved cysteine residues (Lezhneva et al. 2004). Touraine et al.

(2004) have explored the in vivo function of AtNfu2 gene using a reverse genetic

approach. Studies of Arabidopsis T-DNA insertion lines defected for the Nfu2gene

showed that Nfu2 protein is vital for plant photosynthesis and growth through its function

in iron-sulphur cluster production in plastids. The NFU homologs presence in cotton wax

potential candidates, suggest it may have involvement in leaf wax deposition.

Peroxisomes are omnipresent cell organelles that involve mainly in oxidative

metabolic reactions. A distinctive feature of peroxisomes is their metabolic plasticity

because their enzymatic components vary depending on the organism, the kind of tissue,

and the environmental conditions (Beevers, 1979, Hayashi and Nishimura, 2006). From

114

the recent studies, it is concluded that peroxisomes have additional vital role in specific

defense mechanisms conferring tolerance against pathogen attack (Taler et al. 2004, Koh

et al. 2005, Lipka et al. 2005). The important role of leaf peroxisomes is in glycolate

recycling, the enzymes involved in the photorespiratory C2 cycle, both isoforms of

glycolate oxidase (GOX), GOX1 and GOX2, are engage in this cycle.GOX3 is a till

unidentified isoform that has 85% homology with GOX1/2 but is mostly produced in non

photosynthetic tissue and most probably plays a role exterior to photorespiration

(Kamada et al. 2003, Reumann et al. 2004). The wax candidate EST (GE654066) is

Glycine GOX homolog. Its means, the oxidizing property of GOX may be involve in

epicuticular wax deposition on cotton leaf.

Aluminum (Al) toxicity in plants causes oxidative stress and a reduction in root and

shoot elongation has been observed as a primary symbol of Al damage. In Al-treated

seedlings enhance in hydrogen peroxide (H2O2) concentration is accompanied by a

reduction in catalase activity (Yamamoto et al. 2001, Boscolo et al. 2003, Panda et al.

2003). The increased ROS production due to aluminum causes lipids destruction that

leads to the cell death (Ikegawa et al. 2000). Symplastic transport and communication in

higher plants can be blocked by the accumulation of Al-induced callose at

plasmodesmata (Sivaguru et al. 2000). Sivaguru et al. (2003) in Arabidopsis reported the

aluminum induced organ-specific expression of a cell wall-linked receptor kinase1

(WAK1) gene and cell type-specific localization of WAK proteins. Low concentrations

of Aluminum ions triger both phospholipase C (PLC) and phospholipase D (PLD)

signaling processes leading to the generation of reactive oxygen species (ROS) followed

by cell death through caspase-like proteases (Yakimova et al. 2007). All this discussion

115

reveals that versatile genes induction caused by Aluminum stress. In the present study the

wax candidate EST (GE654115), a homolog of Al-induced protein, suggest there may be

a common component in the epicuticular wax deposition and Al responding pathways.

Thiamine (vitamin B1) functions as a precursor of thiamine diphosphate (TDP)

which serves as a coenzyme in a number of the major metabolic pathways, including

acetyl-CoAsynthesis, the tricarboxylic acid cycle, anaerobic ethanolic fermentation, the

oxidative pentose phosphate pathway, the Calvin cycle, the branched–chain amino acid

pathway, and plant pigment biosynthesis (Friedrich, 1987). Animals can only produce

TDP from external thiamine sources but bacteria, yeasts, and higher plants produce it

from simple universal precursors (Begley et al. 1999, Nosaka, 2006, Roje, 2007).

Thiazole and pyrimidine are the products of thiamine biosynthetic pathways. Rapala-

Kozik et al. (2008), suggested a role of thiamine metabolism in the plant response to

abiotic stress by finding a reasonable enhance in the activity of trans ketolase, one of the

major TDP-dependent enzymes, under conditions of salinity and oxidative stress. The

presence of thiamin biosynthetic enzyme homolog (GE653951) in the wax candidate

ESTs, suggests it may have role in cotton (G. arboreum) leaf epicuticular wax

production.

Choline (Cho) is a crucial metabolite in plants because it is required to produce the

major membrane lipid phosphatidylcholine (PC), which shares for 40 to 60% of lipids in

non plastid plant membranes (Moore, 1990, Bolognese and McGraw, 2000). Freezing

tolerance is associated with changes in the amount and degree of poly unsaturation of PC

(Sikorska and Kacperska-Palacz, 1980, Kinney et al. 1987). In addition, it has been

shown that salinity stress induces an increase in the expression of PC in Arabidopsis

116

suspension-cultured cells (Pical et al. 1999), suggesting that PC also may play a vital role

in plant responses to salt and other environmental stresses. Cho biosynthesis has been

identified in various plants. Three parallel, interconnected pathways were identified in the

choline biosynthesis, involved in sequential methylations of an ethanolamine moiety at

the free base levels (Rhodes and Hanson, 1993, McNeil et al. 2000). The three

methylation steps at the free base level from phosphoethanolamine to phosphocholine are

catalyzed by the cytosolic enzyme phosphoethanolamineN-methyltransferase (PEAMT)

(Datko and Mudd, 1988a, 1988b, Nuccio etal. 2000, McNeil et al. 2001). The activity of

PEAMT is over expressed in response to salinity stress and light (Mudd and Datko,

1989a, Summers and Weretilnyk, 1993, Weretilnyk et al. 1995). In the present study, wax

potential candidate EST (GE654059) shows significant homology to PEAMT, suggesting

it may be involve in leaf epicuticular wax.

In the present study wax candidate EST (GE654065) is homologs to Na+/H+

antiporter gene. Na+/H+ antiporters are plasma and other membrane proteins function in

the cellular pH and sodium homeostasis. They are engaged in transfer of sodium out of

the cytosol into the vacuole and the apoplast. For more than twenty years ago the activity

of Na+/H+ antiporters has been identified (Blumwald , Poole 1985, Garbarino , DuPont

1989).The induction of a vacuolar Na+/H+ antiporter gene in improving salinity

resistance has been demonstrated in Arabidopsis. Similar findings were reported in

tomato and Brassica napus (Zhang et al. 2001), rice (Ohta et al. 2002) and wheat (Xue et

al. 2004). The EST (GE654065) of wax candidate showing homology to Na+/H+

antiporter suggested it may have direct or indirect role in leaf wax deposition.

117

The wax candidate EST (GE653633) is sharing significant homology with

Arabidopsis DNAJ heat shock protein. DnaJ-like proteins serve as chaperone or co-

chaperone proteins, helping in the proper folding, maintaining and functioning of cellular

proteins. The stresses cause disruption of cellular life by misfolding of vital cellular

proteins. The accumulations of such redundant proteins are dangerous to organism. The

chaperone helps in chopping of these perilous proteins in stress (Sabehat et al. 1998). The

DnaJ homologs down regulated in wax deficient mutant suggests it may be involved in

the cotton leaf epicuticular wax maintenance.

The wax candidate EST (GE654116) is homolog of intercellular adhesion molecule

(ICAM-2). No ICAM, for the best of my knowledge, is reported in plants. ICAM plays a

critical role in leukocyte function in animals (Huang et al. 2006). The presence of ICAM

homologs in wax potential candidate ESTs reaveled that it may have some role in

epicuticular wax deposition.

As the leaf epicuticular wax shows more deposition in biotic, abiotic and UV

stresses (Baur, 1998, Kakani et al. 2003, Müller, 2006), the Arabidopsis homologs of

potential wax candidate genes, identified in the present study, were subjected to gene

investigator response viewer (Zimmermann et al. 2004), to find their expression in biotic,

abiotic and UV stresses. According to gene investigator response viewer, the majority of

Arabidopsis homologs show up-regulation in biotic, abiotic and UV stresses as shown in

Figure 48. No down regulation of these Arabidopsis orthologs suggests the involvement

of wax potential candidate ESTs in biotic, abiotic and UV stresses.

118

The above discussions strengthen all the identified down-regulated ESTs in wax

deficient mutant as strong potential wax candidates in cotton (G. arboreum).

As biotic and abiotic stresses is becoming the major problem for the whole world

and especially the developing countries like Pakistan. So it is need of time to produce

stress tolerant crops which have the ability to give better yields under biotic and abiotic

stresses. The present study reports identification of forty (40) wax potential candidate

transcripts through microarray in cotton (G. arboreum). These novel findings will help to

develop stress resistant crop varieties in Pakistan.

119

REFRENCES

Aarts MGM, Keijzer CJ, Stiekema WJ, Pereira A. (1995) Molecular characterization of

the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen

fertility. Plant Cell 7: 2115–27.

Abbasi AR, Hajirezaei M, Hofius D, Sonnewald U, and Voll L M. (2007) Specific Roles

of a- and g-Tocopherol in Abiotic Stress Responses of Transgenic Tobacco. Plant

Physiol 143: 1720–1738.

Adams TK, Saydam N, Steiner F, Schaffner W, Freedman JH. (2002) Activation of gene

expression by metal-responsive signal transduction pathways. Environ Health

Perspectives 110, Supplement 5, 813–817.

Aharoni A, Dixit S, Jetter R, Thoenes E, Van Arkel G, Pereira A. (2004) The SHINE

clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle

properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant

Cell 16: 2463-2480.

Ahn SH, Kim M, Buratowski S. (2004) Phosphorylation of serine 2 within the RNA

polymerase II C-terminal domain couples transcription and 30 end processing,

Mol. Cell 13: 67–76.

Alamillo J, Almogura C, Bartels D, Jordano J. (1995) Constitutive expression of small

heat shock proteins in vegetative tissues of the resurrection plant Craterostigma

plantagineum. Plant Mol Biol 29: 1093-1099.

Alignan M, Hewezi T, Petitprez M, Dechamp-Guillaume G, Gentzbittel L. (2006) A

cDNA microarray approach to decipher sunflower (Helianthus annuus) responses

to the necrotrophic fungus Phoma macdonaldii. New Phytol. 170(3): 523-536.

Allen GJ, Schroeder JI. (2001) Combining genetics and cell biology to crack the code of

plant cell calcium signaling. Sci. STKE 1,RE13.

Almoguera C, Coca MA, Jordano J. (1993) Tissue-specific expression of sunflower heat

shock proteins in response to water stress. Plant J 4: 947–958.

120

Alscher RGEN, Heath LS. (2002) Role of superoxide dismutases (SODs) in controlling

oxidative stress in plants. J Exp Bot 53: 1331–1341

Alves-Ferreira M, Wellmer F, Banhara A, Kumar V, Riechmann J L, Meyerowitz EM.

(2007) Global Expression Profiling Applied to the Analysis of Arabidopsis Stamen

Development. Plant Physiol. 145: 747–762.

Apel K, Hirt H. (2004) Reactive oxygen species: metabolism, oxidative 613 stress, and

signal transduction, Annu. Rev. Plant Biol., 55: 373–399.

Aro EM, Virgin I, Andersson B. (1993) Photoinhibition of photosystem II: inactivation,

protein damage and turnover. Biochim Biophys Acta 1143: 113–134.

Aroca R., Amodeo G, Fernandez-Illescas S, Herman EM, Chaumont F, Chrispeels MJ.

(2005) The role of aquaporins and membrane damage in chilling and hydrogen

peroxide induced changes in the hydraulic conductance of maize roots. Plant

Physiology 137: 341-353.

Audran C, Borel C, Frey A, Sotta B, Meyer C, Simonneau T, Marion-Poll A. (1998)

Expression studies of the zeaxanthin epoxidase gene in Nicotiana plumbaginifolia.

Plant Physiol 118: 1021–1028.

Avato P, Bianchi G, Pogna N. (1990) Chemosystematics of surface lipids from maize and

some related species. Phytochemistry 29: 1571–1576.

Baker J, Steele C, Dure L III. (1988) Sequence and characterization of 6 lea proteins and

their genes from cotton. Plant Mol Biol 11:277–291.

Bakr EM. (2005) A new software for measuring leaf area, and area damaged by

Tetranychus urticae Koch. Journal of Applied Entomology 129 (3), 173-175.

Barbacid M. (1987) Ras genes. Annu Rev Biochem 56: 779–827.

Bar-Peled U, Maltz E, Bruckental I, Folman Y, Kali Y, Gacitua H, Lehrer AR, Knight

CH, Robinzon B, Voet H et al. (1995) Relationship between frequent milking or

suckling in early lactation and milk production of high producing dairy cows. J

Dairy Sci 78: 2726–2736.

121

Bastola DR, Pethe VV, Winicov I. (1998) Alfin1, a novel zinc-finger protein in alfalfa

roots that binds to promoter elements in the saltinducible MsPRP2 gene. Plant Mol.

Biol. 38: 1123–1135.

Baszczynski CL, Barbour E, Zeka BL, Maddock SE, Swenson JL. (1997)

Characterization of a genomic clone for a maize DnaJ-related gene, ZmdJ1, and

expression analysis of its promoter in transgenic plants. Maydica 42: 189-201.

Batistic O, Kudla J, (2004) Integration and channeling of calcium signaling through the

CBL calcium sensor/CIPK protein kinase network, Planta 219 915–924.

Batistič O, Kudla J. (2008). Plant calcineurin B-like proteins and their interacting protein

kinases. Biochimica et Biophysica Acta. doi:10.1016/j.bbamcr.2008.10.006.

Baur P. (1998) Mechanistic aspects of foliar penetration of agrochemicals and the effect

of adjuvants. Recent Res. Dev. Agric. Food Chem. 2,809–837.

Beattie, G. A. and L. M. Marcell. (2002) Effect of alterations in cuticular wax

biosynthesis on the physicochemical properties and topography of maize leaf

surfaces. Plant Cell and Environment 25: 1-16

Beaudoin F, Gable K, Sayanova O, Dunn T, Napier JA. (2002). A Saccharomyces

cerevisiae gene required for heterologous fatty acid elongase activity encodes a

microsomal β-ketoreductase. J. Biol. Chem. 277: 11481–88.

Beevers H. (1979). Microbodies in higher plants. Annu. Rev. Plant Physiol. 30: 159–193.

Begley T., Downs D, Ealick S, McLafferty F, Van Loon D, Taylor S, Campobasso N,

Chiu J, Kinsland C, Reddick J, Xi J. (1999) Thiamin biosynthesis in prokaryotes.

Arch. Microbiol. 171: 293-300.

Bengtson C, Larsson S, Liljenberg C (1978) Effects of water stress on cuticular

transpiration rate and amount and composition of epicuticular wax in seedlings of

six oat varieties. Physiol Plant 44: 319–324.

Berardini TZ, Mundodi S, Reiser R, Huala E, Garcia-Hernandez M, Zhang P, Mueller

LM, Yoon J, Doyle A, Lander G, Moseyko N, Yoo D, Xu I, Zoeckler B, Montoya

122

M, Miller N, Weems D, Rhee SY. (2004) Functional annotation of the Arabidopsis

genome using controlled vocabularies. Plant Physiol. 135(2):1-11.

Berridge MJ et al. (2000) The versatility and universality of calcium signalling. Nat. Rev.

Mol. Cell Biol. 1, 11–21.

Berridge MJ, Bootman MD, Lipp P. (1998) Calcium, a life and death signal, Nat 395:

645–648.

Bertamini M, Muthuchelian K, Rubinigg M, Zorer R, Velasco R, Nedunchezhian N.

(2006) Low-night temperature increased the photoinhibition of photosynthesis in

grapevine (Vitis vinifera L. cv. Riesling) leaves. Environ Exp Bot 57: 25–31.

Beth L. Fatland, Basil J. Nikolau, Eve Syrkin Wurtele. (2005) Reverse Genetic

Characterization of Cytosolic Acetyl-CoA Generation by ATP-Citrate Lyase in

Arabidopsis. Plant Cell 17(1): 182–203

Bianchi G, Avato P, Salamini F. (1978) Glossy mutants of maize. VIII. Accumulation of

fatty aldehydes in surface waxes of gl5 maize seedling. Biochem. Genet. 16:1015–

21.

Bilban M, Head S, Desoye G, Quaranta V. (2000) DNA microarrays: a novel approach to

investigate genomics in trophoblast invasion—a review. Placenta 21(Suppl A):S99-

S105.

Blumwald E, Poole RJ. (1985) Na+/H+ antiport in isolated tonoplast vesicles from

storage tissue of Beta vulgaris, Plant Physiol. 78: 163–167.

Boese SR, Huner NPA. (1992) Developmental history affects the susceptibility of

spinach leaves to in vivo low temperature photoinhibition. Physiol Plant 99: 1141–

1145.

Boguski MS, McCormick F. (1993) Proteins regulating Ras and its relatives. Nat 366:

643–654.

Bolognese, C.P, McGraw P. (2000) The isolation and characterization in yeast of a gene

for Arabidopsis S-adenosyl methionine: phospho-ethanolamine N-

methyltransferase. Plant Physiol.124: 1800–1813.

123

Bondada B.R., Oosterhuis DM, Murphy JB, Kims KS. (1996) Effect of water stress on

the epicuticular wax composition and ultrastructure of cotton (Gossypium hirsutum

L.) leaf, bract and boll. Environ Exp. Bot. 36: 61-69.

Bondada, B.R, Oosterhuis D.M.. (2000). Comparative epidermal ultrastructure of cotton

(Gossypium hirsutum L.) leaf, bract and stomatal occurrence. Ann. Bot. 86:1143–

1152.

Borole, V. K. (2000). Embryo culture studies in interspecific crosses between Gossypium

arboreum and Gossypium hirsutum cotton. Ind J of Gen and Plant Breed. 60(1):

105-110.

Borrell A, Cutanda MC, Lumbreras V, Pujal J, Goday A, Culianez-Macia FA, Pages M.

(2002) Arabidopsis thaliana Atrab28: a nuclear targeted protein related to

germination and toxic cation tolerance. Plant Mol Biol 50:249–259.

Boscolo PRS, Menossi M, Jorge RA. (2003) Aluminum-induced oxidative stress in

maize. Phytochem 62:181–9.

Boston RS, Viitanen PV, Vierling E. (1996) Molecular chaperones and protein folding in

plants. Plant Mol Biol 32:191–222.

Boudsocq M, Laurière C. (2005) Osmotic signaling in plants. Multiple pathways

mediated by emerging kinase families. Plant Physiol. 138(3): 1185–1194.

Bowler C, Van Camp W, Van Montagu M, Inze´ D (1994). Superoxide dismutase in

plants. Crit Rev Plant Sci, 13: 199–218.

Brinker M, Van Zyl L, Liu W, Craig D, Sederoff RR, Clapham DH, Von Arnold S.

(2004) Microarray analyses of gene expression during adventitious root

development in Pinus contorta. Plant Physiol 135: 1526–1539

Brock RD. (1977) When to use mutation ion plant breeding, in Manual on mutation

Breeding. IAEA Technical Reports Series, No. 119, 2nd ed., pp, 213-219.

Broekaert WF, Cammue BPA, DeBolle M FC, Thevissen K, DeSamblanx GW, Osborn

RW. (1997) CRC Crit. Rev. Plant Sci. 16: 297–323.

124

Brunner H. (1991) Methods of induction of mutations, in Advances in Plant Breeding,

Vol. 1. (Mandal, A.K., Ganguli, P.K., and Banerjee, S.P., eds). CBS publishers,

Dehli, pp. 187-252)

Brunner H. (1995) Radiation induced mutation for plant selection. Appl. Radiant. Isot.

46: 589-594

Bu¨ch K, Stransky H, Hager A. (1995) FAD is a further essential cofactor of the

NAD(P)H and O2-dependent zeaxanthin-epoxidase. FEBS Lett 376: 45–48.

Buckingham J. Dictionary of natural products on CD-ROM, version 6.1. London:

Chapman and Hall, 1998.

Bugos RC, Hieber D, Yamamoto HY. (1998) Xanthophyll cycle enzymes are members of

the lipcolin finity, the first identified from plants. J Biol Chem 273: 15321–15324.

Buschhaus C., Herz H. and Jetter R. (2007). Chemical composition of the epicuticular

and intracuticular wax layers on the adaxial side of Ligustrum vulgare leaves. New

Phytologist176: 311–316.

Cameron K D, Teece M A, Bevilacqua E, Smart L B (2002) Diversity of cuticular wax

among Salix species and Populus species hybrids. Phytochemistry 60: 715–725.

Cameron K D, Teece MA, Smart L B. (2006) Increased Accumulation of Cuticular Wax

and Expression of Lipid Transfer Protein in Response to Periodic Drying Plant

Physiol 140: 176–183.

Carrera E, Holman T, Medhurst A, Dietrich D, Footitt S, Frederica L, Theodoulou MJ,

Holdsworth. (2008) Seed after-ripening is a discrete developmental pathway

associated with specific gene networks in Arabidopsis. The Plant Jou 53: 214–224.

Carver TLW, Gurr SJ. (2006) Filamentous fungi on plant surfaces. In MRiederer, C Mu¨

ller, eds, Annual Plant Reviews 23: Biology of the PlantCuticle. Blackwell, Oxford,

pp 368–397.

Chachar1 QI, Solangil AG, Verhoef A. (2008) Influence of sodium chloride on seed

germinationa nd seedling root growth of cotton (Gossypium Hirsutum L.) Pak. J.

Bot. 40(1): 183-197.

125

Chambers RS, Dahmus ME. (1994) Purification and characterization of a phosphatase

from HeLa cells which dephosphorylates the C-terminal domain of RNA

polymerase II, J. Biol. Chem. 269: 26243–26248.

Chandler PM, Robertson M. (1994) Gene expression regulated by abscisic acid and its

relation to stress tolerance. Annu Rev Plant Physiol Plant Mol Biol 45:113–141.

Chandler, J.W. and Bartels, D. (2003) Drought avoidance and drought adaptation.

Encyclopedia of Water Sci. 163–165.

Chang GC, Neufeld J, Durr D, Duetting PS, Eigenbrode SD (2004) Waxy bloom in peas

influences the performance and behavior of Aphidius ervi, a parasitoid of the pea

aphid. Entomol Exp Appl110:257–265.

Chaumont, F., F. Barrieu, R. Jung, and M.J. Chrispeels. (2000) Plasma membrane MIP

proteins from maize cluster in two sequence subgroups with differential aquaporin

activity. Plant Physiol 122:1025-1034.

Chen SX, Schopfer P (1999) Hydroxyl-radical production in physiological reactions. A

novel function of peroxidase. Eur J Biochem 260: 726-735.

Chen THH, Murata N. (2000) Enhancement of tolerance of abiotic stress by metabolic

engineering of betaines and other com-patible solutes. Curr. Opin. Plant Biol 5:

250–257.

Chen XB, Goodwin SM, Boroff VL, Liu XL, Jenks MA. (2003) Cloning and

characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane

and wax production. The Plant Cell 15: 1170–1185.

Chen Z, Gallie DR. (2004) The ascorbic acid redox state controls guard cell signaling and

stomatal movement. Plant Cell 16 (5): 1143–1162.

Chetverin AB, Kramer FR. (1993) Sequencing of pools of nucleic acids on

oligonucleotide arrays. Biosystems 30:215–231

Chiang HC, Lo JC, Yeh KC. (2006) Genes associated with heavy metal tolerance and

accumulation in Zn/Cd hyperaccumulator Arabidopsis halleri: a genomic survey

with cDNA microarray. Environ Sci and Tech 40: 6792–6798.

126

Chinnusamy V, Schumaker K, Zhu JK (2004) Molecular genetic perspectives on cross-

talk and specificity in abiotic stress signaling in plants. J Exp Bot 55: 225-236.

Ciftci-Yilmaz ., Mors, MR, Song L, Coutu A, Krizek BA, Lewis MW, Warren D,

Cushman J, Connolly EL, Mittler R. (2007) The EAR-motif of the Cys2/His2-type

Zinc Finger Protein Zat7 Plays a Key Role in the Defense Response of Arabidopsis

to Salinity Stress J. Biol. Chem. 282: 9260-9268.

Close TJ. (1996) Dehydrins: emergence of a biochemical role of a family of plant

dehydration proteins. Physiol Plant 97: 795–803.

Close TJ. (1997) Dehydrins: a commonalty in the response of plants to dehydration and

low temperature. Physiol Plant 100: 291–296.

Cobbett C, Goldsbrough P. (2002) Phytochelatins and metallothioneins: roles in heavy

metal detoxification and homeostasis. An Rev of Plant Bio 53: 159–182.

Corden JL, Cadena DL, Ahearn JM, Dahmus ME, (1985) A unique structure at the

carboxyl terminus of the largest subunit of eukaryotic RNA polymerase II, Proc.

Natl. Acad. Sci. USA 82: 7934–7938.

Corden JL. (1990) Tails of RNA polymerase II, Trends Biochem. Sci. 15: 383–387.

Costaglioli P, Joubes J, Garcia C, Stef M, Arveiler B, Lessire R, Garbay B. (2005)

Profiling candidate genes involved in wax biosynthesis in Arabidopsis thaliana by

microarray analysis, Biochem. Biophys. Acta 1734: 247–258.

Dagan YL, Ovadis M, Shklarman E, Elad Y, David DR, Vainstein A. (2006) Expression

and Functional Analyses of the Plastid Lipid-Associated Protein CHRC Suggest Its

Rolein Chromoplastogenesis and Stress. Plant Physiol 142: 233–244.

Dahmus ME. (1996) Reversible phosphorylation of the C-terminal domain of RNA

polymerase II, J. Biol. Chem. 271: 19009–19012.

Dat JVS, Vranova E, Van Montagu M, Inze´ D, Van Breusegem F. (2000) Dual action of

the active oxygen species during plant stress responses. Cell Mol Life Sci 57: 779–

795.

127

Datko AH, Mudd SH. (1988a). Enzymes of phosphatidylcholine synthesis in Lemna,

soybean and carrot. Plant Physiol. 88: 1338–1348.

Datko AH, Mudd SH. (1988b) Phosphatidylcholine synthesis. Plant Physiol. 88: 854–

861.

Degenhardt J, Gershenzon J, Baldwin IT, Kessler A. (2003) Attracting friends to feast on

foes; engineering terpene emission to make crop plants more attractive to herbivore

enemies. Curr Opin Biotechnol 14:169-76.

deGroot BL, Frigato T, Helms V, Grubmuller H. (2003) The mechanism of proton

exclusion in the aquaporin-1 water channel. J of Mol Bio 333: 279-293.

Dellaert LMW. (1979) Eceriferum mutants in Arabidopsis thaliana (L.) Heynh. II.

Phenotypic and genetic analysis. Arabid. Inf. Serv. 16: 10-26.

Desikan R, A-H Mackerness S, Hancock JT, Neill SJ. (2001) Regulation of the

Arabidopsis transcriptome by oxidative stress. Plant Physiol 127: 159-172.

Dragota S, Riederer M. (2007), Epicuticular Wax Crystals of Wollemia nobilis:

Morphology and Chemical Composition. Ann of Botan 100: 225–231.

Drevinek P, Matthew TG H, Zhaoping Ge, Andrew M J, El Y F, Kuster H, Ben Amor B,

Hohnjec N, Puhler A, Becker A, Gouzy J, Vernie T, Gough C, Niebel A. (2004)

Expression profiling in Medicago truncatula identifies more than 750 genes

differentially expressed during nodulation, including many potential regulators of

the symbiotic program. Plant Physiol 136: 3159–3176

Droual AM., Maaroufi H, Creche J, Chenieux JC, Rideau M, Hamadi S. (1997) Changes

in the accumulation of cytosolic cyclophilin transcripts in cultured periwinkle cells

following hormonal and stress treatments. J. Plant Physiol 151: 142-150.

Du X M, Yin W X, Zhao Y X, Zhang H. (2001) The production and scavenging of

reactive oxygen species in plants. Chin J Biotech, 17: 121–125.

Dubery IA. (2007). An elicitor- and pathogen-induced cDNA from potato encodes a

stress-responsive cyclophilin. Biologia Plantarum 51 (2): 327-332, 2007.

128

Dure L III, Crouch M, Harada J, Ho T-HD, Mundy J, Quatrano R, Thomas T, Sung R

(1989) Common amino acid sequence demains among the LEA proteins of higher

plants. Plant Mol Biol 12: 475–486.

Economic Survey of Pakistan 2007-2008. http://www.finance.gov.pk/survey/chapters/02-

Agriculture.PDF

Edgar R, Domrachev M, Lash AE. (2002) Gene Expression Omnibus: NCBI gene

expression and hybridization array data repository. Nucl Acids Res. 1; 30(1): 207-

10

Edqvist J, Farbos I. (2002) Characterization of germination-specific lipid transfer proteins

from Euphorbia lagascae. Planta 215: 41–50

Eigenbrode S D, Moodie S, Castagnola T. (1995) Generalist predators mediate resistance

to a phytophagous pest in cabbage with glossy leaf wax. Entomol. Exp. Applic, 77:

335-342.

Eigenbrode SD, Espelie KE. (1995) Effects of plant epicuticular lipids on insect

herbivores. Ann. Rev. Entomol. 40: 171–194.

Eigenbrode SD, Jetter R. (2002) Attachment to plant surface waxes by an insect predator.

Integr Comp Biol 42: 1091–1099.

Eigenbrode SD, Stoner KA, Shelton AM, Kain WC. (1991) Characteristics of glossy leaf

waxes associated with resistance to diamondback moth (Lepidoptera: Plutellidae) in

Brassica oleracea. J of Econ Ent 84: 1609–1618.

Eigenbrode SD. (2004) The effects of plant epicuticular waxy bloomson attachment and

effectiveness of predatory insects. ArthropodStruct Dev 33: 91–102.

Eklund DM, Edqvist J. (2003). Localization of Nonspecific Lipid Transfer Proteins

Correlate with Programmed Cell Death Responses during Endosperm Degradation

in Euphorbia lagascae Seedlings. Plant Physiol 132: 1249–1259.

Eltz T. (2006) Tracing pollinator footprints on natural flowers. J Chem Ecol 32: 907–915

129

Endrizzi J E, Turcotte E L, Kohel RJ. (1985) Genetics, cytology and evolution of

Gossypium. Adv in Gen 23: 271–375.

Endrizzi JE, Turcotte EL, Kohel RJ, (1984) ualitative genetics,cytology, and

cytogenetics, in Cotton, R. J. Kohel andC. F. Lewis, Eds., pp. 81–129, American

Society of Agronomy, Madison, Wis, USA,.

Fambrough D, McClure K, Kazlauskas A, Lander E. (1999) Diverse signaling pathways

activated by growth factor receptors induce broadly overlapping, rather than

independent, sets of genes. Cell 97: 727–741

Fernandes J, Morrow DJ, Casati P, Walbot V. (2008) Distinctive transcriptome responses

to adverse environmental conditions in Zea mays L. Plant Biotechnol J. 6(8): 782-

98.

Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D. (2000) Alterations in

CER6, a gene identical to CUT1, differentially affect long-chain lipid content on

the surface of pollen and stems. Plant Cell 12: 2001–8

Fodor SPA, Rava RP, Huang XC, Pease AC, Holmes CP, Adams CL. (1993) Multiplexed

biochemical assays with biological chips. Nat 364: 555–556.

Fodor SPA, Read JL, Pirrung MC, Stryer L, Lu AT, Solus D. (1991) Light-directed,

spartially addressable parallel chemical synthesis. Science 251:767–773

Foyer CH, Lelandais M, Kunert KJ. (1994) Photooxidative stress in plants. Physiol Plant

92: 696–717.

Foyer CH, Noctor G. (2003) Redox sensing and signalling associated with reactive

oxygen in chloroplasts, peroxisomes and mitochondria. Physiol Plant 119: 355–

364.

Frenette Charron JB, Breton G, Badawi M, Sarhan F. (2002) Molecular and structural

analyses of a novel temperature stress-induced lipocalin from wheat and

Arabidopsis. FEBS Lett 517: 129–132.

Friedrich W. (1987) Thiamin (Vitamin B1, aneurin). in: Hanbuch der Vitamine, Urban &

Schwarzenberg, München, Vien, Baltimore, , 240-258.

130

Froger A, Tallur B, Thomas D, Delamarche C. (1998) Prediction of functional residues in

water channels and related proteins. Protein Science 7: 1458-1468.

Gao G, Jin LP, XIE KY, Qu DY. (2009) The potatoStLTPa7gene displays a complex

Ca2+-associated patternof expression during the early stage of potato–Ralstonia

solanacearum interaction. Mol P Pathol 10 ( 1 ): 15–27.

Garbarino J, DuPont FM. (1989) Rapid induction of Na+/H+ exchange activity in barley

root tonoplast, Plant Physiol 89: 1–4.

Garbay B, Tautu MT, Costaglioli P. (2007) Low level of pathogenesis-related protein 1

mRNA expression in 15-day-old Arabidopsis cer6-2 and cer2 eceriferum mutants.

Plant Science 172: 299–305.

García S, Heinzen H, Hubbuch C, Martínez R, DeVries JX, Moyna P. (1995) Triterpene

methyl ethers from Palmae epicuticular waxes. Phytochem 39: 1381-1382

Garcia-Hernandez M, Murphy A, Taiz L. (1998). Metallothioneins 1 and 2 have distinct

but overlapping expression patterns in Arabidopsis. Plant Physiol 118: 387–397.

Garcia-Olmedo F, Molina A, Alamillo J M, Rodriguez-Palenzuela P. (1998) Plant

defense peptides. Biopolymers 47: 479–491

Gazanchian A, Hajheidari M, Sima NK, Salekdeh GH. (2007) Proteome response of

Elymus elongatum to severe water stress and recovery. J Exp Bot 58 (2): 291–300.

Giese BN. (1975). Effects of light and temperature on the composition of epicuticular

wax of barley leaves. Phytochemistry 14: 921–929.

Gillet B, Beyly A, Peltier G, Rey P. (1998) Molecular characterization ofCDSP 34, a

chloroplastic protein induced by water deficit in Solanumtuberosum L. plants, and

regulation of CDSP 34 expression by ABA andhigh illumination. Plant J 16: 257–

262.

Girgis HS, Liu Y, Ryu WS, Tavazoie S. (2007) A Comprehensive Genetic

Characterization of Bacterial Motility. PLoS Genetics. 3 (9): e154.

131

Gloria M Coruzzi (2008). An integrated genetic, genomic and systems approach defines

gene networks regulated by the interaction of light and carbon signaling pathways

in Arabidopsis. BMC Sys Bio 2:31.

Guilford WJ, Schneider DM, Labovitz J, Opella SJ. (1988) High resolution solid state

13C NMR spectroscopy of sporopollenins from different plant taxa. Plant Physiol.

86: 134-136.

Hacia JG, Brody LC, Chee MS, Fodor SPA, Collins FS. (1996) Detection of

heterozygous mutations in BRCA1 using high density oligonucleotide arrays and

two-color fluorescence analysis. Nat Genet 14: 441-447.

Hall DM, Jones R.L. (1961) physiological significance of surface wax on leaves. Nature

191: 95-96.

Hamilton EW, Heckathorn SA. (2001) Mitochondrial adaptations to NaCl. Complex I is

protected by anti-oxidants and small heat shock proteins, whereas complex II is

protected by proline and betaine. Plant Physiol 126: 1266–1274.

Hannoufa A, McNevin J, Lemieux B. (1993). Epicuticular waxes of eceriferum mutants

of Arabidopsis thaliana. Phytochemistry 33: 851–55.

Hannoufa A, Negruk V, Eisner G, Lemieux B. (1996) The CER3 gene of Arabidopsis

thaliana is expressed in leaves, stems, roots, flowers and apical meristems. Plant J

10: 459–467.

Hansen JD, Pyee J, Xia Y, Wen TJ, Robertson DS, Kolattukudy PE, Nikolau BJ,

Schnable PS. (1997) The glossy1 locus of maize and an epidermis-specific cDNA

from Kleinia odora define a class of receptor-like proteins required for the normal

accumulation of cuticular waxes. Plant Physiol 113: 1091–1100.

Harper JF, Breton G, Harmon A. (2004) Decoding Ca(2+) signals through plant protein

kinases, Annu. Rev. Plant Biol. 55: 263–288.

Harper JF. (2001) Dissecting calcium oscillators in plant cells. Trends Plant Sci. 6: 395–

397.

132

Hartl FU, Hayer-Hartl M. (2002) Molecular chaperones in the cytosol: from nascent

chain to folded protein. Sci 295: 1852–1858.

Hartl FU. (1996) Molecular chaperones in cellular protein folding. Nature 381: 571-580.

Hayashi M, Nishimura M. (2006). Arabidopsis thaliana – A model organism to study

plant peroxisomes. Biochim. Biophys. Acta 1763: 1382–1391.

Hendrick JP, Hartl FU. (1993) Molecular chaperone functions of heat-shock proteins.

Annu Rev Biochem 62: 349-384.

Henikoff S, Comai L. (2003) Single-nucleotide mutations for plant functional genomics.

Annu. Rev. Plant Biol. 54: 375–401.

Heslot H, Ferrary R, Levy R, Monard C. (1961) Induction de mutations chezjorge.

Effecacite relatives des rayons gamma, desulfated ethyl, dumethanesulfonate

d’ethyl et de quelques autres substances. Effects of ionizing radiation on seeds

(Proc.Conf. Karlsruhe, 1960), IAEA, Vienna. 243-250

Heymann JB, Engel A. (1999). Aquaporins: Phylogeny, Structure, and Physiology of

Water Channels. NIPS 14: 187-194.

Hieng B, Ugrinovi´c K, Jelka SV, Marjetka K. (2004) Different classes of proteases are

involved in the response to drought of Phaseolus vulgaris L. cultivars differing in

sensitivity. J. Plant Physiol. 161: 519–530.

Hietala T, Laakso S, Rosenqvist H. (1995) Epicuticular waxes of Salix species in relation

to their overwintering survival and biomass productivity. Phytochemistry 40: 23–

27.

Ho CK, Shuman S. (1999) Distinct roles for CTD ser-2 and ser-5 phosphorylation in the

recruitment and allosteric activation of mammalian mRNA capping enzyme, Mol.

Cell 3: 405–411.

Hollenbach B, Schreiber L, Hartung W, Dietz KJ. (1997) Cadmium leads to stimulated

expression of a lipid transfer protein (ltp) in barley: Implications for the

involvement of LTP in wax assembly. Planta 203: 9–19.

133

Holloway PJ, Hunt GM, Baker EA, Macey MJK. (1977) Chemical composition and

ultrastructure of the epicuticular wax in four mutants of Pisum sativum (L.). Chem

and Phy of Lipids 20: 141–155.

Holroyd GH, Hetherington AM, Gray JE. (2002) A role for the cuticular waxes in the

environmental control of stomatal development. New Phytol 153: 433–439.

Honda A, Nogami M, Yokozeki T, Yamazaki M, Nakamura H, Watanabe H, Kawamoto

K, Nakayama K, Morris AJ, Frohman MA et al. (1999) Phosphatidylinositol 4-

phosphate 5-kinase alpha is a downstream effector of the small G protein ARF6 in

membrane ruffle formation. Cell 99: 521–532.

Hou M, Wen-Wei Hu2, Lisha Shen, Li Yen Candy Lee, Zhen Tao, Jin-Hua Han, Hao Yu.

(2008) Global Identification of DELLA Target Genes during Arabidopsis Flower

Development. Plant Physiol 147(3): 1126–1142.

http://www.ers.usda.gov/ Briefing/Cotton/trade.htm

http://www.fao.org.

Huang Y, Chun Yao Li, Kelly D Biddle, Susan, Gibson. (2008) Identification, cloning

and characterization of sis7 and sis10 sugar-insensitive mutants of Arabidopsis.

BMC P Bio 8: 104.

Hughes TR, Shoemaker DD. (2001) DNA microarrays for expression profiling. Curr

Opinion Chem Biol. 5: 21-25.

Hugouvieux V, Kwak JM, Schroeder JI. (2001) An mRNA cap binding protein, ABH1,

modulates early abscisic acid signal transduction in Arabidopsis. Cell 106: 477-

487.

Hurry V, Andersson JM, Chow WS, Osmond CB. (1997) Accumulation of zeaxanthin in

abscisic acid-deficient mutants of Arabidopsis does not affect chlorophyll

quenching or sensitivity to photoinhibition in vivo. Plant Physiol 113: 639–648.

Ian K, Ryan T G, Eshwar M. (2008) Gene expression changes linked to antimicrobial

resistance,oxidative stress, iron depletion and retained motility are observed when

Burkholderia cenocepacia grows in cystic fibrosis sputum BMC Infec Dis 8: 121.

134

Ikegawa H, Yamamoto Y, Matsumoto H. (2000) Responses to aluminum of suspension

cultured tobacco cells in a simple calcium solution. Soil Sci Plant Nutr 46: 503–14.

Ingram J, Bartels D. (1996) The molecular basis of dehydration tolerance in plants. Annu.

Rev. Plant Physiol. and Plant Mol. Biol. 47: 377–403.

International Cotton Advisory Committee (ICAC).

http://www.icac.org/cotton_info/publications/samples/cotton_facts/cotton_facts_p1

7.pdf.

Jakola L, Anna MP, Minna H, Anja H. (2001) Isolation of high quality RNA from

Bilberry (Vaccinum myrtillus l.) fruit. Mol Bio 19: 201-203.

Jeffree CE. (2006) The fine structure of the plant cuticle. In M Riederer, CMu¨ ller, eds,

Annual Plant Reviews 23: Biology of the Plant Cuticle.Blackwell, Oxford, pp 11–

125.

Jenks MA, Joly RJ, Peters PJ, Rich PJ, Axtell JD, Ashworth EA. (1994) Chemically-

induced cuticle mutation affecting epidermal conductance to water vapor and

disease susceptibility in Sorghum bicolor (L.) Moench. Plant Physiol 105:1239-

1245.

Jenks MA, Rashotte AM, Tuttle HA. Feldmann KA. (1996) Mutants in Arabidopsis

thaliana altered in epicuticular wax and leaf morphology. Plant Physiol 110: 377–

385.

Jenks MA, Rich PJ, Ashworth EN. (1994). Involvement of cork cells in the secretion of

epicuticular wax filaments on Sorghum bicolor (L) Moench. Int. J. Plant Sci. 155:

506–18.

Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA. (1995) Leaf epicuticular waxes of

the eceriferum mutants in Arabidopsis. Plant Physiol. 108: 369–377.

Jetter R, Kunst L, Samuels AL. (2006) Composition of plant cuticular waxes. In M

Riederer, C Mu¨ller, eds, Annual Plant Reviews 23: Biologyof the Plant Cuticle.

Blackwell, Oxford, pp 145–181.

135

Jiang C, Wright RJ, El-Zik KM, Paterson AH. (1998) Polyploid formation created unique

avenues for response to selection in Gossypium.Proc Natl Acad Sci USA, 95: 4419-

4424.

Jianguo M, Wanqu L, Qin Y, Bodnaryk RP. (1995) Inheritance of the waxless character

of Brassia napus Nilla glossy. Canad J of Plant Sci 75: 893–894.

Jiao S, Emmanuel H, Guikema JA. (2004) High light stress inducing photoinhibition and

protein degradation of photosystem I in Brassica rapa. Plant Sci 167: 733–741.

Johansson I, Karlsson M, Shukla VK, Chrispeels MJ, Larsson C, Kjellbom P. (1998)

Water transport activity of the plasma membrane aquaporin PM28A is regulated by

phosphorylation. The Plant Cell 10: 451-459.

Johnson DA, Richards RA, Turner N C. (1983) Yield, water relations, gas exchange, and

surface reflectances of near isogenic wheat lines differing in glaucousnees. Crop

Sci. 23: 318-325.

Kader JC. (1996) Lipid-transfer proteins in plants. Annu. Rev. Plant Physiol. Plant Mol.

Biol. 47: 627–54.

Kahn RA, Der CJ, Bokoch GM. (1992) The ras superfamily of GTP-binding proteins:

guidelines on nomenclature. FASEB J 6: 2512–2513.

Kakani VG, Reddy JR, Zhaq D, Mohammad AR. (2003) Effect of ultraviolet-B radiation

on cotton (Gossypium hirsutum L.) morphology and anatomy. Annals of Botany 91:

817-826.

Kamada T, Nito K, Hayashi H, Mano S, Hayashi M, Nishimura M. (2003) Functional

differentiation of peroxisomes revealed by expression profiles of peroxisomal genes

in Arabidopsis thaliana. Plant Cell Physiol. 44: 1275–1289.

Kang ME, Dahmus ME. (1993) RNA polymerases IIA and IIO have distinct roles during

transcription from the TATA-less murine dihydrofolate reductase promoter, J. Biol.

Chem. 268: 25033–25040.

Kerstiens G, Schreiber L, Lendzian KJ. (2006) Quantification of cuticular permeability in

genetically modified plants. J of Exp Bot 57: 2547–2552.

136

Kerstiens G. (1996) Signaling across the divide: A wider perspective of cuticular

structure-function relationship. Trends Plant Sci 1: 125-129.

Kessler F, Schnell D, Blobel G. (1999) Identification of proteins associated with

plastoglobules isolated from pea (Pisum sativum L.) chloroplasts. Planta 208: 107–

113.

Kiddle G, Pastori GM, Bernard S, Pignocchi C, Antoniw J, Verrier PJ, Foyer CH. (2003)

Effects of leaf ascorbate content on defense and photosynthesis gene expression in

Arabidopsis thaliana. Antioxidant Redox Signal 5: 23–32.

Kim HU, Wu SH, Ratnayake C, Huang AHC. (2001) Brassica rapa has three genes that

encode proteins associated with different neutral lipids in plastids of specific

tissues. Plant Physiol 126: 330–341.

Kinney AJ, Clarkson DT, Loughman BC. (1987) The regulation of phosphatidylcholine

biosynthesis in rye (Secale cereale) roots: Stimulation of the nucleotide pathway by

low temperature. Biochem. J. 242: 755–759.

Kira MV, Michaels SD. (2008) Functional redundancy and new roles for genes of the

autonomous floral-promotion pathway. Plant Physiol 147: 682–695.

Klok EJ, Wilson IW, Wilson D, Chapman SC, Ewing RM, Somerville SC, Peacock WJ,

Dolferus R, Dennis ES. (2002) Expression profile analysis of the low-oxygen

response in Arabidopsis root cultures. Plant Cell 14: 2481–2494

Kloosterman B, De Koeyer D, Griffiths R, Flinn B, Steuernagel B, Scholz U, Sonnewald

S, Sonnewald U, Bryan GJ, Prat S, Bánfalvi Z, Hammond JP, Geigenberger P,

Nielsen KL, Visser RG, Bachem CW. (2008) Genes driving potato tuber initiation

and growth: identification based on transcriptional changes using the POCI array.

Funct Integr Genomics. 8(4):329-40.

Knight H. (2000) Calcium signaling during abiotic stress in plants. Int. Rev. Cytol. 195:

269–324.

Koag MC, Fenton RD, Wilkens S, Timothy JC. (2003) The binding of maize DHN1 to

lipid vesicles. Gain of structure and lipid specificity. Plant Physiol 131: 309–316.

137

Koh S, Andre A, Edwards H, Ehrhardt D, Somerville S. (2005). Arabidopsis thaliana

subcellular responses to compatible Erysiphe cichoracearum infections. Plant J. 44:

516–529.

Koizumi M, Yamaguchi-Shinozaki K, Tsuji K, Shinozaki K. (1993) Structure and

expression of two genes that encode distinct drought-inducible cysteine proteases in

Arabidopsis thaliana. Gene 129: 175–182.

Kolattukudy PE. (1996). Biosynthetic pathways of cutin and waxes, and their sensitivity

to environmental stresses. In: Kerstiens G, editor. Plant cuticles. Oxford: BIOS

Scientific Publishers; pp. 83–108.

Komarnitsky P, Cho EJ, Buratowski S. (2000) Different phosphorylated forms of RNA

polymerase II and associated mRNA processing factors during transcription, Genes

Dev. 14: 2452–2460.

Koornneef M, Dellaert LMW, Van der Veen JH. (1982) EMS- and radiation-induced

mutation frequencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat

Res 93:109-123.

Koornneef M, Hanhart CJ, Thiel F. (1989) A genetic and phenotypic description of

eceriferum (cer) mutants in Arabidopsis thaliana. J. Hered. 80: 118–122

Kruk J, Holla¨nder-Czytko H, Oettmeier W, Trebst A. (2005) Tocopherol as singlet

oxygen scavenger in photosystem II. J Plant Physiol 162: 749–757

Kuballa AV, Merritt DJ, Elizur A. (2007) Gene expression profiling of cuticular proteins

across the moult cycle of the crab Portunus pelagicus. BMC Biol. 5(45): 1-26.

Kunst L, Samuels AL. (2003) Biosynthesis and secretion of plant cuticular wax. Progr.

Lipid Res. 42:51-80.

Kunst L, Taylor DC, Underhill EW. (1992) Fatty acid elongation in developing seeds of

Arabidopsis. Plant Physiol Biochem 30: 425–434.

Kwon YT, Reiss Y, Fried VA, Hershko A, Yoon JK, Gonda DK, et al. (1998) Proc Natl

Acad Sci USA, 95: 7898–903.

138

Lanfranco L, Bolchi A, Ros EC, Ottonello S, Bonfante P. (2002) Differential expression

of a metallothionein gene during the presymbiotic versus the symbiotic phase of an

arbuscular mycorrhizal fungus. Plant Physiol 130: 58–67.

Langen-kamper G, Manac’h N, Broin M, Cuine S, Becuwe N, Kuntz M, Rey P. (2001)

Accumulation of plastid lipid-associated proteins (fibrillin/CDSP34) upon oxidative

stress, ageing and biotic stress in Solanaceaeand in response to drought in other

species. J Exp Bot 52: 1545–1554.

Latowski D, Grzyb J, Strzalka K. (2004) The xanthophyll cycle – molecular mechanism

and physiological significance. Acta Physiol Plant 26: 197–212.

Lee J, Shim D, Song WY, Hwang I, Lee Y. (2004) Arabidopsis metallothioneins 2a and 3

enhance resistance to cadmium when expressed in Vicia faba guard cells. Plant

Molecular Biology 54: 805–815.

Lee JW, Zhang Y, Weaver CD, Shomer NH, Louis CF, Roberts DM. (1995)

Phosphorylation of nodulin 26 on serine 262 affects its voltage sensitive channel

activity in planar lipid bilayers. J of Bio Chem 270: 27051-27057.

Lemieux B. (1996) Molecular genetics of epicuticular wax biosynthesis. Trends Plant Sci

1: 312–8.

Leon S, Touraine B, Ribot C, Briat JF, Lobreaux S. (2003) Iron-sulphur cluster assembly

in plants: distinct NFU proteins in mitochondria and plastids from Arabidopsis

thaliana. Biochem. J.371: 823–830.

Lezhneva L, Amann K, Meurer J. (2004) The universallyconserved HCF101 protein is

involved in assembly of [4Fe-4S]-cluster-containing complexes in Arabidopsis

thaliana chloroplasts. Plant J. 37: 174–185.

Li X, Song Y, Century K, et al., (2001) A fast neutron deletion mutagenesis based reverse

genetics system for plants. Plant J. 27: 235-242

Li YC, An LZ, Ge1 YH, Li Y, Bi1 Y. (2008). Detection and Isolation of Preformed

Antifungal Compounds from the Peel of Pyrus bretschneideri Rehd. cv. Pingguoli

at Different Stages of Maturity. J. Phytopathol 156: 115–119.

139

Lipka, V., et al. (2005) Pre- and postinvasion defenses both contribute to non host

resistance in Arabidopsis. Science 310: 1180–1183.

Lipshutz RJ, Fodor SPA, Gingeras TR, Lockhart DJ. (1999) High density synthetic

oligonucleotide arrays. Nat. Genet. 21(1): 20-24.

Liu K, Wang L, Xu Y, Chen N, Ma Q, Li F, Chong K. (2007) Overexpression of

OsCOIN, a putative cold inducible zinc finger protein, increased tolerance to

chilling, salt and drought, and enhanced proline level in rice. Planta 226: 1007–

1116.

Liu Y, Zheng Y. (2005) PM2, a group 3 LEA protein from soybean, and its 22-mer

repeating region confer salt tolerance in Escherichia coli. Biochem Biophys Res

Commun 331: 325–332.

Livak KJ and Schmittgen TD. (2001) Analysis of relative gene expression data using

real-time quantitative PCR and the 2-∆∆CT method. Methods 25: 402 – 408.

Lolle S, Pruitt RE. (1999) Epidermal cell interactions: A case for local talk. Trends Plant

Sci. 4: 14-20.

Long SP, Humphries S, Falkowski PG. (1994) Photoinhibition of photosynthesis in

nature. Annu Rev Plant Physiol Plant Mol Biol 45: 633–662.

Lu H, Zawel L, Fisher L, Egly JMD. (1992) Reinberg, Human general transcription

factor IIH phosphorylates the C-terminal domain of RNA polymerase II, Nat 358:

641–645.

Luan S, Lane WS, Schreiber SL. (1994) pCyP B: a chloroplastlocalized, heat shock-

responsive cyclophilin from fava bean. Plant Cell 6: 885-892.

Lundqvist U, Lundqvist A. (1988) Mutagen specificity in barley for 1580 eceriferum

mutants localized to 79 loci. Hereditas 108: 1–12.

MacRobbie EA, Philos Trans, Soc R, London B Biol. (1998) Signal transduction and ion

channels in guard. cells. Sci. 1374: 1475–1488.

140

Maguire TL, Grimmond S, Forrest A, Iturbe-Ormaetxe I, Meksem K, Gresshoff P.

(2002) Tissue-specific gene expression in soybean (Glycine max) detected by

cDNA microarray analysis. J. Plant Physiol 159: 1361–1374.

Malan C, Gregling MM, Gressel J. (1990) Correlation between CuZn superoxide

dismutase and glutathione reductase and environmental and xenobiotic stress

tolerance in maize inbreds. Plant Sci 69: 157-166.

Maldonado AM, Doerner P, Dixon RA, Lamb CJ, Cameron RK. (2002) A putative lipid

transfer protein involved in systemic resistance signalling in Arabidopsis. Nat 419:

399–403.

Maluszynksi M. (2001) Officially released mutant varieties-The FAO/IAEA Database.

Plant Cell Tissue Organ Cult. 65: 175-177

Mansoor S, Briddon RW, Zafar Y, Stanley J. (2003) Geninivirus disease complexes: an

emerging threat. Tren in P Sci 8: 128- 134.

Mariani C. (2000) In this issue: Complex Waxes The Plant Cell 12: 1795-1798.

Marivet J, Frendo P, Bukard G. (1992) Effects of abiotic stresses on cyclophilin gene

expression in maize and bean and sequence analysis of bean cyclophilin cDNA.

Plant Sci 84: 171-178.

Marivet J, Margis-Pinheiro M, Frendo P, Bukhard G. (1994) Bean cyclophilin gene

expression during plant development and stress conditions. Plant mol. Biol 26:

1181-1189.

Mattie MD, Freedman JH. (2004). Copper-inducible transcription: regulation by metal-

and oxidative stress-responsive pathways. Amer J of Physiol and Cell Physiol 286:

C293–301.

Maurel C, Kado RT, Guern J, Chrispeels MJ. (1995). Phosphorylation regulates the water

channel activity of the seed-specific aquaporin α-TIP. The EMBO Journal 14:

3028-3035.

141

Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM, Cattivelli L. (2008)

Abiotic stress response in plants: When post-transcriptional and post-translational

regulations control transcription. Plant Sci 174: 420–431

McNeil SD, Nuccio ML, Rhodes D, Shachar-Hill Y, Hanson AD. (2000) Radiotracer and

computer modeling evidence that phospho-base methylation is the main route of

cholines synthesis in tobacco. Plant Physiol. 123: 371–380.

McNeil SD, Nuccio ML, Ziemak, M.J, Hanson AD. (2001). Enhanced synthesis of

choline and glycine betaine in transgenic tobacco plants that overexpress

phosphoethanolamine N-methyltransferase. Proc. Natl. Acad. Sci. USA 98: 10001–

10005.

McNevin JP, Woodward W, Hannoufa A, Feldmann KA, Lemieux B. (1993). Isolation

and characterization of eceriferum (cer) mutants induced by T-DNA insertions in

Arabidopsis thaliana. Genome 36: 610–18.

Michael TP, Breton G, Hazen SP, Priest H, Mockler TC, Kay SA, Chory J. (2008) A

Morning-Specific Phytohormone Gene Expression Program underlying Rhythmic

Plant Growth. PLoS Biology 6 (9): e225.

Mick A. (1997) Mutation and induzierte Mutationen in der Zuchtung, in Biogische

Grundlagen der Pflanzenzuchtung (Odenbach, W., ed.), Parey Buchverlag, Berlin,

pp. 218-239

Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L. (1999) CUT1, an

Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility,

encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11: 825–838.

Millar AA, Kunst L. (1997). Very-long-chain fatty acid biosynthesis is controlled through

the expression and specificity of the condensing enzyme. Plant J 12: 121–31.

Miller JD, Arteca RN, Pell EJ. (1999) Senescence-associated gene expression during

ozone-induced leaf senescence in Arabidopsis. Plant Physiol 120: 1015–1024.

Mittler R, Vanderauwera S, Gollery M, Breusegem F. (2004) Reactive oxygen gene

network of plants. Trends Plant Sci 9: 490-498

142

Mittler R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:

405-410.

Molina A, Segura A, Garcia-Olmedo F. (1993) Lipid transfer proteins (nsLTPs) from

barley and maize leaves are potent inhibitors of bacterial and fungal plant

pathogens. FEBS Lett. 316: 119–122.

Mollet JC, Park SY, Nothnagel EA, Lord EM. (2000) A lily stylar pectin is necessary for

pollen tube adhesion to an in vitro stylar matrix. Plant Cell 12: 1737–1750.

Monaghan JR, Leonard GE, Srikrishna P, Robert BP, Walker JA , Beachy CK , Zhu W,

Pao GM , Verma IM, Hunter T, Bryant SV , Gardiner DM , Harkins TT, Voss SR.

(2009) Microarray and cDNA sequence analysis of transcription during nerve-

dependent limb regeneration . BMC Bio 7:1

Moore TS. (1990) Biosynthesis of phosphatidylinositol. Inositol Metab. Plant 9: 107–

112.

Mu¨ller C. (2006) Plant-insect interactions on cuticular surfaces. In MRiederer, C Mu¨

ller, eds, Annual Plant Reviews 23: Biology of the Plant Cuticle. Blackwell,

Oxford, pp 398–422.

Mudd SH, Datko AH. (1989) Synthesis of EA and its regulation in Lemna paucicostata.

Plant Physiol. 91: 587–597.

Mukhopadhyay, A., Vij, S. and Tyagi, A. K. (2004) Overexpression of a zinc finger

protein gene from rice confers tolerance to cold, dehydration, and salt stress in

transgenic tobacco. Proc. Natl. Acad. Sci. USA 101: 6309–6314.

Munnus, R. (2002) Comparative physiology of salt and water stress, Plant 616 Cell

Environ. 25 (2): 239-250.

Murphy A, Zhou J, Goldsbrough PB, Taiz L. (1997) Purification and immunological

identification of metallothioneins 1 and 2 from Arabidopsis thaliana. Plant Physiol

113: 1293–1301.

Murphy DJ. (2004) The roles of lipid bodies and lipid-body proteins in the assembly and

trafficking of lipids in plant cells. In Proceedings of the16th International Plant

143

Lipid Symposium. Hungarian Scientific Societyfor Food Industry and Budapest

University of Economic Sciences and Public Administration Faculty of Food

Science Budapest, Budapest, pp 55–62.

Nakagami H, Pitzschke A, Hirt H. (2005). Emerging MAP kinase pathways in plant

stress signalling. Trends Plant Sci. 10: 339–346.

Negruk V, Yang P, Subramanian M, McNevin JP, Lemieux B. (1996). Molecular cloning

and characterization of the CER2 gene of Arabidopsis thaliana. Plant J. 9:137–45.

Nguyen TTT, Klueva N, Chamareck V, Aarti A, Magpantay G, Millena ACM, Pathan

MS and Nguyen HT. (2004) Saturation mapping of QTL regions and identification

of putative candidate genes for drought tolerance in rice. Mol. Gen. and Genomics,

272: 35-46.

Nieuwland J, Feron R, Huisman BA, Fasolino A, Hilbers CW, Derksen J, Mariani C.

(2005) Lipid transfer proteins enhance cell wall extension in tobacco. Plant Cell 17:

2009–2019.

Nosaka K. (2006) Recent progress in understanding thiamin biosynthesis and its genetic

regulation in Saccharomyces cerevisiae. Appl. Microbiol.Biotechnol. 72: 30-40.

Nuccio ML, Ziemak MJ, Henry SA, Weretilnyk EA, Hanson AD. (2000) cDNA cloning

of phosphoethanolamine N-methyltransferase from spinach by complementation in

Schizosaccharomyces pombe and characterization of the recombinant enzyme. J.

Biol. Chem. 275, 14095–14101.

Odeigah PGC, Osanyinpeju AO. (1998) Induced mutations in cowpea, Vigna unguiculata

(Leguminosae). Revista de Biologia Tropical. 46(3): 579-586.

Ohta M, Hayashi Y, Nakashima A, Hamada A, Tanaka A, Nakamura T, Hayakawa T.

(2002) Introduction of a Na+/H+ antiporter genefrom Atriplex gmelini confers salt

tolerance to rice, FEBS Lett. 532 279–282.

Oosterhuis DM, Hampton R E, Wullschleger SD. (1991a) Water deficit effects on cotton

leaf cuticule and the efficiency of defoliants. J. Agron. Prod. 4: 260-265

144

Oosterhuis DM, Hampton RE, Wullschleger SD, Kim KS. (1991b) Characteristics of the

cotton leaf cuticle. Arkansas Farm Res. 40 (5): 12-13

Orozco-Cardenas ML, Ryan C. (1999) Hydrogen peroxide is generated systemically in

plant leaves by wounding and system in via the octadecanoid pathway. Proc Natl

Acad Sci USA 96: 6553-6557.

O'Toole JC, Chang TT. (1979a) Drought resistance in cereals-rice: a case study. In H

Mussell, RC Staples, eds, Physiology of Crop Plants. John Wiley & Sons, New

York, pp 374–405.

O'Toole JC, Cruz RT, Seiber JN. (1979b) Epicuticular wax and cuticular resistance in

rice. Physiol Plant 47: 239–244.

Palmiter RD. (1998). The elusive function of metallothioneins. Proc of the Nat Acad of

Sci, USA 95: 8428–8430.

Panda SK, Singha LB, Khan MH. (2003) Does aluminum phytotoxicity induce oxidative

stress in green gram (Vignaradiata) Bulg J Plant Physiol 29:77–86.

Park SY, Jauh GY, Mollet JC, Eckard KJ, Nothnagel EA, Walling LL, Lord EM. (2000)

A Lipid Transfer–like Protein Is Necessary for Lily Pollen Tube Adhesion to an in

Vitro Stylar Matrix. Plant Cell 12: 151–164.

Parsad G. (1987) Increased Frequency and Wider Spectrum of Mutation Induced By

Presoaking and Combined Mutagen Treatments in Barley. Barley Genetics

Newsletter 17:71-73

Pastenes C, Pimentel P, Lillo J. (2005) Leaf movements and photoinhibition in relation to

water stress in field-grown beans. J Exp Bot 56: 425–433.

Pastori G, Foyer CH, Mullineaux P. (2000) Low temperature induced changes in the

distribution of H2O2 and antioxidants between the bundle sheath and mesophyll

cells of maize leaves. J Exp Bot 51: 107–113.

Paul SM, Timothy FC, Stanley FN. (2004) DNA-microarray analysis of brain cancer:

molecular classification for therapy Nature Reviews Neuroscience 5: 782-792.

145

Pavy N, Boyle B, Nelson C, Paule C, Giguère I, Caron S, Parsons LS, Dallaire N, Bedon

F, Bérubé H, Cooke J, Mackay J. (2008) Identification of conserved core xylem

gene sets: conifer cDNA microarray development, transcript profiling and

computational analyses. New Phytol. 180: 766-786.

Pearce RS, Houlston CE, Atherton KM, Rixon JE, Harrison P, Hughes MA, Alison Dunn

M. (1998) Localization of expression of three cold-induced genes, blt101, blt4.9,

and blt14, in different tissues of the crown and developing leaves of cold-

acclimated cultivated barley. Plant Physiol. 117: 787–795.

Pease AC, Solas D, Sullivan EJ, Cronin MT, Holmes CP, Fodor SP. (1994) Light-

generated oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad

Sci USA 91:5022–5026.

Pedley KF, Martin GB. (2005) Role of mitogen-activated protein kinases in plant

immunity. Curr. Opin. Plant Biol. 8: 541–547.

Pical C, Westergren T, Dove SK, Larsson C, Sommarin M. (1999) Salinity and

hyperosmotic stress induce rapid increases in phosphatidylinositol 4,5-

bisphosphate, diacylglycerol pyrophosphate, and phosphatidylcholine in

Arabidopsis thaliana cells. J.Biol. Chem. 274: 38232–38240.

Post-Beittenmiller D. (1998) The cloned Eceriferum genes of Arabidopsis and the

corresponding Glossy genes in maize Plant Physiol Biochem 1998; 36:157–66.

Powles SB. (1984) Photoinhibition of photosynthesis induced by visible light. Annu Rev

Plant Physiol 35: 15–44.

Prasad T K. (1997) Role of catalase in inducing chilling tolerance in pre-emergent maize

seedlings. Plant Physiol 114: 1369–1376.

Prasad TK, Anderson MD, Martin BA, Stewart CR. (1994) Evidence for chilling-

inducedoxidative stress in maize seedlings and a regulatory role for hydrogen

peroxide. Plant Cell 6: 65-74.

146

Premachandra GS, Hahn DT, Axtell JD, Joly RJ. (1994) Epicuticular wax load and

water-use efficiency in bloomless and sparse-bloom mutants of Sorghum bicolor L.

Environ Exp Bot 34: 293–301.

Preuss D, Lemieux B, Yen G, Davis RW. (1993) A conditional sterile mutation

eliminates surface components from Arabidopsis pollen and disrupts cell signaling

during fertilization. Genes Develop. 7:974-985

Pruvot G, Cuine S, Peltier G, Rey P. (1996) Characterization of a novel drought-induced

34-kDa protein located in the thylakoids of Solanum tuberosum L. plants. Planta

198: 471–479

Puhakainen T, Hess MW, Makela P, Svensson J, Heino P, Palva ET. (2004)

Overexpression of multiple dehydrin genes enhances tolerance to freezing stress in

Arabidopsis. Plant Mol Biol 54:743–753.

Pundir NS. (1972) Experimental embryology of Gossypium arboreum L. and G. hirsutum

L. and their reciprocal crosses. Bot. Gaz. 133: 7–26.

Rapala-Kozik M, Kowalska E, Ostrowska K. (2008) Modulation of thiamine metabolism

in Zea mays seedlings under conditions of abiotic stress. J. of Exp Bot 59: (15)

4133–4143.

Reddy VS, Reddy AS. (2004) Proteomics of calcium-signaling components in plants,

Phytochem 65: 1745–1776.

Reicosky DA, Hanover JW. (1978) Physiological effects of surfacewaxes I. Light

reflectance for glaucous and nonglaucous Picea pungens. Plant Physiol. 62: 101–

104.

Reumann S, Ma C, Lemke S, Babujee L. (2004) AraPerox. A database of putative

Arabidopsis proteins from plant peroxisomes. Plant Physiol. 136: 2587–2608.

Rey P, Gillet B, Romer S, Eymery F, Massimino J, Peltier G, Kuntz M. (2000) Over-

expression of a pepper plastid lipid-associated protein intobacco leads to changes in

plastid ultrastructure and plant developmentupon stress. Plant J 21: 483–494.

147

Rhodes D, Hanson AD. (1993) Quaternary ammonium and tertiary sulfonium compounds

in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44: 357–384.

Rieger R, Michaelies A, Green M. (1976) Glossary of genetics and cytogenetics. Springer

Verlag, New York.

Robinson NJ, Tommey AM, Kuske C, Jackson PJ. (1993) Plant metallothioneins.

Biochem J 295: 1–10.

Rock CD, Zeevaart JAD. (1991) The aba mutant of Arabidopsis thaliana is impaired in

epoxy-carotenoid biosynthesis. Proc Natl Acad Sci USA 88: 7496–7499.

Roje S. (2007) Vitamin B biosynthesis in plants. Phytochem 68: 1904–1921.

Rostás M, Ruf D, Zabka V, Hildebrandt U. (2008) Plant surface wax affects parasitoid’s

response to host footprints. Naturwissenschaften 95: 997–1002.

Rowland O, Lee R, Franke R, Schreiber L, Kunst L. (2007). The CER3 wax biosynthetic

gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. FEBS Lett. 581:

3538–44.

Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L. (2006). CER4 encodes an

alcohol-forming fatty acyl-Coenzyme A reductase involved in cuticular wax

production in Arabidopsis. Plant Physiol. 142: 866–77.

Sabehat A, Lurie S, Weiss D. (1998) Expression of small heat-shock proteins at low

temperatures. Plant Physiol.117: 651–658.

Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier

T, Thiagarajan M, Sturn A, Snuffin M, Rezantsev A, Popov D, Ryltsov A,

Kostukovich E, Borisovsky I, Liu Z, Vinsavich A, Trush V, Quackenbush J. (2003)

TM4: a free, open-source system for microarray data management and analysis.

Biotech 34(2): 374-8.

Sakamoto H, Araki T, Meshi T, Iwabuchi M. (2000) Expression of a subset of the

Arabidopsis Cys(2)/His(2)-type zinc-finger protein gene family under water stress.

Gene 248: 23–32.

148

Sakhanokho HF, Zipf A, Rajesekaram K, Saha S, Sharma GC, Chee PW. (2004) Somatic

embryo initiation and germination in diploid cotton (Gossypium arborium L.). In

Vitro Cell. Dev. Biol. 40:177-181.

Samuels L, Kunst L, Jetter R. (2008) Sealing Plant Surfaces: CuticularWax Formation by

Epidermal Cells. ANRV 342: 59-27.

Schaffer MA, Fisher RL. (1988) Analysis of mRNAs that accumulate in response to low

temperature identifies a thiol protease gene in tomato. Plant Physiol 87: 431–436.

Schena M, Shalon D, Davis RW, Brown PO. (1995) Quantitative monitoring of gene

expression patterns with a complementary DNA microarray. Sci. 270: 467-470.

Schnable PS, Stinard PS, Wen TJ, Heinen S, Weber D, Schneerman M, Zhang L, Hansen

JD, Nikolau BJ. (1994) The genetics of cuticular wax biosynthesis. Maydica 39:

279–287.

Schroeder JI, Hedrich R, Fernandez JM. (1984) Cytosolic calcium regulates ion channels

in the plasma membrane of Vicia faba guard cells. Nature 338: 427–430.

Schroeder SC, Schwer B, Shuman S, Bentley D. (2000) Dynamic association of capping

enzymes with transcribing RNA polymerase II, Genes Dev. 14: 2435–2440.

Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P,

Hayashizaki Y, Shinozaki K. (2001) Monitoring the expression pattern of 1300

Arabidopsis genes under drought and cold stresses by using a full-length cDNA

microarray. The Plant Cell 13(1): 61-72.

Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju

A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P,

Kawai J, Hayashizaki Y, Shinozaki K. (2002)

Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold,

and high-salinity stresses using a full-length cDNA microarray.

Plant J. 31: 279-292.

149

Serrano YEM, MoyanoE, Medina-Escobar N, Munoz-Blanco J, Caballero JL. (2003)

Identification of a strawberry gene encoding a non-specific lipid transfer protein

that responds to ABA, wounding and cold stress. J. Exp. Bot. 54: 1865–1877.

Shalon D, Smith SJ, Brown PO. (1996) A DNA microarray system for analyzing

complex DNA samples using two-color fluorescent probe hybridization. Genome

Res 6: 639-645.

Shen XY, Xu SC, Dai JY. (1995) Effects of drought on the activities of SOD, CAT and

acid phosphatase in maize leaves. Plant Physiol Commun 31: 183–186.

Shi H, Quintero FJ, Pardo JM, Zhu JK (2002) The putative plasma membrane

Na(+)/H(+) antiporter SOS1 controls long distance Na(+) transport in plants. Plant

Cell. 14: 465–477.

Shinozaki K, Dennis ES. (2003) Cell signaling and gene regulation global analyses of

signal transduction and gene expression profiles. Curr Opin Plant Biol 6(5): 405-

409.

Shoemaker DD, Lashkari DA, Morris D, Mittmann M, Davis RW. (1996) Quantitative

phenotypic analysis of yeast deletion mutations using a highly parallel molecular

bar-coding strategy. Nat Genet 14: 450-456.

Siddique BA Khan S. (1999) Mutagenesis: tools and techniques- a practical view, in

Breeding in Crop Plants: Mutations and In Vitro Mutations Breeding. Kalyani

Publishers, Ludhiana, New Delhi. pp. 20-32.

Sikorska E, Kacperska-Palacz A. (1980) Frost-induced phospholipid changes in cold-

acclimated and non acclimate drape leaves. Physiol. Plant. 48: 201–206.

Simontacchi M, Caro A, Fraga CG, Puntarulo S. (1993) Oxidative stress affects a-

tocopherol content in soybean embryonic axes upon inhibition and following

germination. Plant Physiol, 103: 949–953.

Sivaguru M, Ezaki B, He ZH, Tong H, Osawa H, Balusˇka F, Volkmann D, Matsumoto

H. (2003) Aluminum-Induced Gene Expression and Protein Localization of a Cell

Wall-Associated Receptor Kinase in Arabidopsis. Plant Physiol 132: 2256–2266.

150

Sivaguru M, Fujiwara T, Amaj J, Balusˇka Yang Z, Osawa H, Maeda T, Mori T,

Volkmann D, Matsumoto H. (2000) Aluminum-induced 1–3-d-glucan inhibits cell-

to-cell trafficking of molecules through plasmodesmata: A new mechanism of Al

toxicity in plants. Plant Physiol 124:991–1018.

Skriver K, Mundy J. (1990) Gene expression in response to abscisic acid and osmotic

stress. Plant Cell 2: 503–512

Stankovic RK, Chung RS, Penkowa M. (2007) Metallothioneins I and II: neuroprotective

significance during CNS pathology. Int J of Biochem and Cell Bio 39: 484–489.

Sterk P, Booij H, Schellekens GA, Van Kammen A, De Vries SC. (1991) Cell-specific

expression of the carrot EP2 lipid transfer protein gene. Plant Cell 3: 907–921.

St-Pierre B, Laflamme P, Alarco AM, De Luca V. (1998) The terminal O-

acetyltransferase involved in vindoline biosynthesis defines a new class of proteins

responsible for coenzyme A-dependent acyl transfer. Plant J 14:703–13.

Sturaro M, Hartings H, Schmelzer E, Velasco R, Salamini F, Motto M. (2005) Cloning

and characterization of GLOSSY1, a maize gene involved in cuticle membrane and

wax production. Plant Physiol 138: 478–489.

Sugano S, Kaminaka H, Rybka Z. (2003) Stress-responsive zinc finger gene ZPT2-3

plays a role in drought tolerance in petunia. Plant J. 36: 830–841.

Suh MC, Samuels AL, Jetter R, Kunst L, Pollard M, et al. (2005) Cuticular lipid

composition, surface structure, and gene expression in Arabidopsis stem epidermis.

Plant Physiol. 139: 1649–65.

Summers P, Weretilnyk EA. (1993) Choline synthesis in spinach in relation to salt stress.

Plant Physiol. 103: 1269–1276.

Sun W, Van-Montagu M, Verbruggen N. (2002) Small heat shock proteins and stress

tolerance in plants. Biochim Biophys Acta 1577: 1-9.

Susan VB, David MG, Tim TH, Voss SR. (2009) Microarray and cDNA sequence

analysis of transcription during nerve-dependent limb regeneration BMC Bio 7:1

151

Svensson J, Ismail AM, Palva ET, Close TJ. (2002) Dehydrins. In: Storey KB, Storey JM

(eds) Sensing, signaling and cell adaptation. Elsevier, Amsterdam.

Swire-Clark GA, Marcotte WR. (1999) The wheat LEA protein Em functions as an

osmoprotective molecule in Saccharomyces cerevisiae. Plant Mol Biol 39: 117–

128.

Takai Y, Sasaki T, Matozaki T. (2001) Small GTP-binding proteins. Physiol Rev 81:

153–208.

Taler D, Galperin M, Benjamin I, Cohen Y, Kenigsbuch D. (2004) Plant eR genes that

encode photorespiratory enzymes confer resistance against disease. Plant Cell 16:

172–184.

Tardy F, Havaux M. (1996) Photosynthesis, chlorophyll fluorescence, light-harvesting

system and photoinhibition resistance of a zeaxanthin-accumulating mutant of

Arabidopsis thaliana. J Photochem Photobiol B 34: 87–94.

Telfer A, Dhami S, Bishop SM, Phillips D, Barber J. (1994) Beta-carotene quenches

singlet oxygen formed by isolated photosystem II reaction centers. Biochem 33:

14469–14474.

Tena G, Asai T, Chiu WL, Sheen J. (2001) Plant mitogen activated protein kinase

signaling cascades. Curr. Opin. Plant Biol. 4: 392–400.

Thiel G, Wolf AH. (1997) Operation of K+-channels in stomatal movement. Trends Plant

Sci. 2: 339–345

Thoma S, Kaneko Y, Somerville C. (1993) A nonspecific lipid transfer protein from

Arabidopsis is a cell wall protein. Plant J. 3: 427–36.

Thomashow MF. (1998) Role of cold-responsive genes in plant freezing tolerance. Plant

Physiol 118: 1–7.

Thompson AJ, Jackson AC, Parker RA, Morpeth DR, Burbidge A, Taylor IB. (2000)

Abscisic acid biosynthesis in tomato: regulation of zeaxanthin epoxidase and 9-cis-

epoxycarotenoid dioxygenase mRNAs by light/dark cycles, water stress and

abscisic acid. Plant Mol Biol 42: 833–845.

152

Thum KE, Shin MJ, Gutiérrez RA, Mukherjee I, Katari MS, Nero D, Shasha D, Coruzzi

GM. (2008) An integrated genetic, genomic and systems approach defines gene

networks regulated by the interaction of light and carbon signaling pathways in

Arabidopsis. BMC Sys Bio 2:31.

Todd J, Post-Beittenmiller D, Jaworski JG. (1999) KCS1 encodes a fatty acid elongase 3

ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana. Plant J.

17: 119–130.

Tommasini L, Svensson JT, Rodriguez EM, Wahid A, Malatrasi M, Kato K, Wanamaker

S, Resnik J, Close TJ. (2008) Dehydrin gene expression provides an indicator of

low temperature and drought stress: transcriptome-based analysis of Barley

(Hordeum vulgare L.). Function & integr genomics 8(4):387.

Torok Z, Goloubinoff P, Horvath I, Tsvetkova NM, Glatz A, Balogh G, Varvasovszki V,

Los DA, Vierling E, Crowe JH, Vıgh L. (2001) Synechocystis HSP17 is an

amphitropic protein that stabilizes heat-stressed membranes and binds denatured

proteins for subsequent chaperone-mediated refolding. Proc Natl Acad Sci USA 98:

3098–3103.

Torres MA, Dangl JL, Jones JDG. (2002) Arabidopsis gp91phox homologues AtrbohD and

AtrbohF are required for accumulation of reactive oxygen intermediates in the plant

defense response. Proc Natl Acad Sci USA 99: 517-522.

Touraine B, Boutin JP, Poll AM, Briat JF, Peltier G, Lobre´aux S. (2004) Nfu2: a

scaffold protein required for [4Fe-4S] and ferredoxin iron-sulphur cluster assembly

in Arabidopsis chloroplasts. The Plant J 40: 101–111.

Trapp SC, Croteau RB. (2001) Genomic organization of plant terpene synthases and

molecular evolutionary implications. Genetics 158: 811–832.

Trebst A, Depka B, Holla¨nder-Czytko H. (2002) A specific role for tocopherol and of

chemical singlet oxygen quenchers in the maintenance of photosystem II structure

and function in Chlamydomonas reinhardtii. FEBS Lett 516: 156–160.

153

Tsugane K, Kobayashi K, Niwa Y, Ohba Y, Wada K, Kobayashi H. (1999) A recessive

Arabidopsis mutant that grows photoautotrophically under salt stress shows

enhanced active oxygen detoxification. Plant Cell 11: 1195-1206.

Tucker SL, Thornton CR, Tasker K, Jacob C, Giles G, Egan M, Talbot NJ. (2004) A

fungal metallothionein is required for pathogenicity of Magnaporthe grisea. The

Plant Cell 16: 1575– 1588.

Tulloch AP. (1976) Chemistry of waxes of higher plants. In Chemistry and Biochemistry

of Natural Waxes (Kolattukudy, P.E., ed.). Amsterdam: Elsevier, pp. 235–287.

Udall JA, Swanson JM, Haller K, Rapp RA, Sparks ME, Hatfield J, Yu Y, Wu Y, Dowd

C, Arpat AB, et al. (2006) A global assembly of cotton ESTs. Genome Res 16:

441–450.

Usui M, Tanaka S, Miyasaka H, Suzuki Y, Shioi Y. (2007). Characterization of cysteine

protease induced by oxidative stress in cells of Chlamydomonas sp. strain W80.

Physiologia Plantarum 131: 519–526.

Van Harten, AM. (1998) Mutation Breeding Theory and Practical Applications.

Cambridge University Press, Cambridge.

Vera-Estrella R, Barkla BJ, Bohnert HJ, Pantoja O. (2004) Novel regulation of

aquaporins during osmotic stress. Plant Physiol 135: 2318-2329.

Vernoud V, Horton AC, Yang Z, Nielsen E. (2003) Analysis of the Small GTPase Gene

Superfamily of Arabidopsis. Plant Physiol 131: 1191–1208.

Vierling E. (1991) The roles of heat shock proteins in plants. Annu Rev Plant Physiol

Plant Mol Biol 42: 579–620.

Vierling E. Kimpel JA. (1992) Plant responses to environmental stress. Curr Opin

Biotechnol 3: 164–170.

Vierstra RD. (1993) Protein degradation in plants. Annu Rev Plant Physiol Plant Mol

Biol 44: 385–410.

154

von Wettstein-Knowles P. (1987) Barley raincoats: Biosynthesis and genetics. In: Plant

molecular biology. (Von Wettstein D, and Chua NH, eds). New York: Plenum;

305-314.

Walch-Solimena C, Novick P. (1999) The yeast phosphatidylinositol-4-OH kinase pik1

regulates secretion at the Golgi. Nat Cell Biol 1: 523–525.

Walker CKB, Wei Z, Gerald M P, Inder M V, Tony H, Wechter WP, Amnon L, Karen R

H, Angela RD, Zhangjun F, Nurit Kr, James J G, Ayelet SM, Alvaro H, Jyothi T,

Yaakov T, Vitaly P, Tova T. (2008) Gene expression in developing watermelon

fruit. BMC Gen 9:275.

Wallack D. (2001) Genomics and microarrays in an undergraduate research class. Cur. Q.

21: 126–129.

Wang D Luthe DS. (2003) Heat sensitivity in a bentgrass variant. Failure to accumulate a

chloroplast heat shock protein isoform implicated in heat tolerance. Plant Physiol

133: 319-327.

Wang F, Zhang P, Qiang S, Xu LL. (2006). Interaction of Plant Epicuticular Waxes and

Extracellular Esterases of Curvularia eragrostidis during Infection of Digitaria

sanguinalis and Festuca arundinacea by the Fungus. Int. J. Mol. Sci., 7: 346-357.

Wang H, Davis RM. (1997). Susceptibility of selected cotton cultivars to seedling disease

pathogens and benefits of chemical seed treatments. Plant Dis. 81:1085-1088.

Wang N, Fang W, Han H, Sui N, Li B, Meng QW. (2008) Overexpression of zeaxanthin

epoxidase gene enhances the sensitivity of tomato PSII photoinhibition to high light

and chilling stress. Physiol Plant 132: 384-396.

Wang WX, Vinocur B, Altman A. (2003) Plant Responses to Drought, Salinity and

Extreme Temperatures: Towards Genetic Engineering for Stress Tolerance. Planta

218: 1–14.

Waters ER, Lee GJ, Vierling E. (1996) Evolution, structure and function of the small heat

shock proteins in plants. J Exp Bot 47: 325–338.

155

Weete JD, Leek GL, Peterson CM, Currie HE, Branch WD. (1978) Lipid and surface

wax synthesis in water stressed cotton leaves. Plant Physiol. 62: 675-677.

Weig A, Deswarte C, Chrispeels M.J. (1997) The Major Intrinsic Protein Family of

Arabidopsis has 23 members that form three distinct groups with functional

aquaporins in each group. Plant Physiol 114: 1347-1357.

Wen M, Buschhaus C, Jetter R. (2006) Nanotubules on plant surfaces: Chemical

composition of epicuticular wax crystals on needles of Taxus baccata L.

Phytochem 67: 1808–1817.

Wendel AS, Seelanan T. (1995) Bi-directional interlocus concerted evolution following

allopolyploid speciation in cotton (Gossypium), PNAS 92: (1) 280–284.

Wendel JF, Cronn RC. (2003) Polyploidy and the evolutionaryhistory of cotton, Adv in

Agron 78: 139–186,.

Weretilnyk EA, Smith DD, Wilch GA, Summers PS. (1995). Enzymes of Cho synthesis

in spinach: Response of P-base N-methyltransferase activities to light and salinity.

Plant Physiol. 109: 1085–1091.

Wheeler TA, Gannaway JR, Keating K. (1999) Identification of Resistance to

Thielaviopsis basicola in Diploid Cotton J.plant diseases, 83: 831-833.

Wilms J, Eltz T. (2008) Foraging scent marks of bumblebees: footprint cues rather than

pheromone signals. Naturwissenschaften 95:149–153.

Wu MS, Yi SL, Yu TC, Chia TS, Ming TL, Jaw TL. (2005) Gene expression profiling of

gastric cancer by microarray combined with laser capture microdissection; World J

Gastroenterol 21;11(47): 7405-7412

Wullschleger SD, Oosterhuis DM. (1989) The occurrence of an internal cuticle in cotton

(Gossypium hirsutum) leaf stomataes. J. Environ. Exp. Bot. 29: 229-235.

Xia Y, Nikolau BJ, Schnable PS. (1996) Cloning and characterization of CER2, an

Arabidopsis gene that affects cuticular wax accumulation. Plant Cell 8:1291–304.

156

Xiong L, Gong Z, Rock CD, Subramanian S, Guo Y, Xu W, Galbraith D, Zhu JK. (2001)

Modulation of abscisic acid signal transduction and biosynthesis by an Sm-like

protein in Arabidopsis. Dev. Cell 1: 771-781.

Xiong Y, Anthony L, Contento1, Nguyen PQ, Bassham DC. (2007). Degradation of

oxidized proteins by autophagy during oxidative stress in Arabidopsis. Plant

Physiol 143: 291-299.

Xu D, Duan X, Wang B, Hong B, Ho T, Wu R. (1996). Expression of a late

embryogenesis abundant protein gene, HVA1, from barley confers tolerance to

water deficit and salt stress in transgenic rice. Plant Physiol 110:249–257.

Xu X, Dietrich CR, Delledonne M, Xia Y, Wen TJ. (1997) Sequence analysis of the

cloned glossy 8 gene of maize suggests that it may code for a β-ketoacyl reductase

required for the biosynthesis of cuticular waxes. Plant Physiol. 115: 501–10.

Xue T, Li X, Zhu W, Wu C, Yang G and Zheng C, (2008). Cotton metallothionein

GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic

stress in transgenic tobacco and yeast.

Xue ZY, Zhi DY, Xue GP, Zhang H, Zhao YX, Xia GM. (2004) Enhanced salt tolerance

of transgenic wheat (Triticum aestivum L.) expressing a vacuolar Na+/H+

antiporter gene with improved grain yields in saline soils in the field and a reduced

level of leaf Na+, Plant Sci. 167: 849–859.

Yahyaoui El F, Kuster H, Ben Amor B, Hohnjec N, Puhler A, Becker A, Gouzy J, Vernie

T, Gough C, Niebel A, et al. (2004) Expression profiling in Medicago truncatula

identifies more than 750 genes differentially expressed during nodulation, including

many potential regulators of the symbiotic program. Plant Physiol 136: 3159–3176.

Yakimova E T, Toteva VMK, Woltering EJ. (2007) Signal transduction events in

aluminum-induced cell death in tomato suspension cells. J of Plant Physiol 164:

702-708.

157

Yamaguchi-Shinozaki K, Kasuga M, Liu Q, Nakashima K, Sakuma Y, Abe H, Shinwari

ZK, Seki M, Shinozaki K. (2002) Biological mechanisms of drought stress

response. JIRCAS Working Report.

Yamamoto Y, Kobayashi Y, Matsumoto H. (2001) Lipid peroxidationas an early

symptom triggered by alluminum, but not the primary cause of elongation

inhibition in pea roots. Plant Physiol 125:199–208.

Yan C, Pendola FL, Jacob R., Lau AL, Eppig JJ, Matzuk MM. (2001) Oosp1 encodes a

novel mouse oocyte-secreted protein. Genesis 31: 105-110.

Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN (1982) Living with water

stress: evolution of osmolyte systems. Sci 217: 1214–1222.

Yao J, Ren X, Ireland JJ, Coussens PM, Smith TPL, Smith GW. (2004) Generation of a

bovine oocyte cDNA library and microarray: resources for identification of genes

important for follicular development and early embryogenesis. Physiol Genomics

19: 84–92.

Yephremov A, Wisman E, Huijser P, Huijser C, Wellesen K, Saedler H. (1999)

Characterization of the FIDDLEHEAD gene of Arabidopsis reveals a link between

adhesion response and cell differentiation in the epidermis. Plant Cell 11: 2187–

202.

Yusuf Z, Shahid M, Shaheen A, Rob B, Idrees M, Waheed SK, Peter M, Judith KB

Kauser AM. (2003) Genome Characterization of Whitefly-transmitted Geminivirus

of Cotton and Development of Virus resistant Plants Through Genetic Engineering

and Conventional Breeding. ICAC 12-16.

Zachowski A, Guerbette F, Grosbois M, Jolliot-Croquin A, Kader JC. (1998)

Characterisation of acyl binding by a plant lipid-transfer protein. Eur. J. Biochem.

257: 443–48.

Zatta P, Raso M, Zambenedetti P, Wittkowski W, Messori L, Piccioli F, Mauri PL,

Beltramini M. (2005) Copper and zinc dismetabolism in the mouse brain upon

chronic cuprizone treatment. Cell and Molecular Life Science 62: 1502–1513.

158

Zhang H, GUO C, LI C, XIAO K. (2008) Cloning, characterization and expression

analysis of two superoxide dismutase (SOD) genes in wheat (Triticum aestivum L.)

Front. Agric. China. 2(2): 141–149.

Zhang HX, Blumwald E. (2001) Transgenic salt-tolerant tomato plants accumulate salt in

foliage but not in fruit, Nat. Biotech. 19: 765–768.

Zhang, S., and Klessig, D.F. (2001). MAPK cascades in plant defense signaling. Trends

Plant Sci. 6: 520–527.

Zhigang A, Cuijie L, Yuangang Z, Yejie D, Wachter A, Gromes R, Rausch T. (2006)

Expression of BjMT2, a metallothionein 2 from Brassica juncea, increases copper

and cadmium tolerance in Escherichia coli and Arabidopsis thaliana, but inhibits

root elongation in Arabidopsis thaliana seedlings. J of Exp Bot 57: 3575–3582.

Zhu D, Scandalios JG. (1994) Differential accumulation of manganese-superoxide

dismutase transcripts in maize in response to absicisic acid and high osmoticum.

Plant Physiol 106: 173–178.

Zhu, JK. (2001) Plant salt tolerance. Trends Plant Sci. 6: 66–71.

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. (2004)

GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Tool box.

Plant Physiol. 136: 2621-2632.

Zwenger S, Basu C. (2007) In silico analysis of terpene synthase genes in Arabidopsis

thaliana. EXCLI Journal 6:203-211.

159

APPENDICES

APPENDIX-I RNA extraction buffer

Hexadecyltrimethylammonium bromide (CTAB) 2%

Polyvinylpyrrolidone (PVP) 2%

Tris HCl (pH8) 100 mM

EDTA 25mM

Spermidine . 5g/L

Mercaptoethanol 2%

NaCl 2M

APPENDIX II

SSTE buffer

NaCl 1M

SDS 0.5%

Tris HCl (pH: 8) 10mM

EDTA (pH: 8) 1mM

APPENDIX III

TAE buffer (50X)

Tris base 242g

Glacial acetic acid 57.1ml

O.5M EDTA (pH: 8) 100ml

160

APPENDIX IV

S.O.C Medium

SOC Medium (100ml)

2M Mg++ 2ml

2M Glucos 2ml

SOB Medium 96ml

2M Mg++ STOCK (100ml)

MgCl2.6H2O 20.33g

MgSO4.7H2O 24.65g

APPENDIX V

T.E. Buffer

10mM Tris-HCl

1.0mM EDTA

APPENDIX VI

Prehyb buffer (100 ml).

5 X SSC 25 ml 20 X SSC

0.1% SDS 1 ml 10% SDS

1% BSA 1 g BSA (Sigma A-9647)

fill to 100 ml.

161

APPENDIX VII

2X Hybridization buffer:

50% Formamide 5 ml

10X SSC 5 ml 20X SSC

0.2% SDS 200 ul 10% SDS