REGULAR ARTICLE

Steady-state level of epidermal growth factor (EGF) mRNAand effect of EGF on in vitro culture of caprine preantralfollicles

Juliana Jales H. Celestino & Jamily B. Bruno & Márcia Viviane A. Saraiva &

Rebeca M. P. Rocha & Ivina R. Brito & Ana Beatriz G. Duarte & Valdevane R. Araújo &

Cleidson M. G. Silva & Maria Helena T. Matos & Claudio C. Campello &

José Roberto V. Silva & José Ricardo Figueiredo

Received: 20 October 2010 /Accepted: 1 March 2011 /Published online: 20 April 2011# Springer-Verlag 2011

Abstract Our aim was to verify the steady-state level ofepidermal growth factor (EGF) mRNA in goat follicles atvarious developmental stages and to investigate theinfluence of EGF on the survival, antrum formation andgrowth of secondary follicles cultured for 6 days. Primor-dial, primary and secondary goat follicles and small andlarge antral follicles were obtained to quantify EGF mRNA

by real-time reverse transcription with the polymerase chainreaction. The influence of EGF and the presence or absenceof follicle-stimulating hormone (FSH) on the developmentof secondary follicles and on mRNA expression for EGFand FSH receptor (FSH-R) was determined after 6 days ofculture. Survival, antrum formation and follicular diameterwere evaluated every other day of culture. EGF mRNAlevels in secondary follicles were significantly higher thanthose in primordial follicles, whereas in small and largeantral follicles, EGF mRNA levels in cumulus–oocytecomplexes (COCs) were significantly higher than ingranulosa/theca cells. During culture, EGF in the presenceor absence of FSH increased the follicular daily growth rateof secondary follicles when compared with that in enrichedalpha minimal essential medium. FSH, EGF or bothreduced EGF mRNA levels, whereas EGF reduced FSH-RmRNA levels after follicle culture for 6 days. Thus, EGFmRNA levels are higher in secondary follicles than inearlier stages, with both FSH and EGF promoting thegrowth of goat secondary follicles. EGF and/or FSH reduceEGF mRNA levels, whereas EGF decreases FSH-R mRNAlevels, in cultured secondary follicles.

Keywords Epidermal growth factor . Secondary follicles .

Follicle-stimulating hormone receptor . Culture . Goat

Introduction

In various species, the preantral follicles are highlysusceptible to atresia. Thus, the development of a culturesystem that supports the in vitro growth of preantralfollicles to the stage at which the oocytes are capable of

This work was supported by CNPq, CAPES, FINEP and Ceara StateFoundation for the Support of Research (FUNCAP). Juliana Jales deHollanda Celestino is the recipient of a grant from FUNCAP (Brazil).

The authors declare no potential conflict of interest perceivable asprejudicing the impartiality of the research reported.

J. J. H. Celestino : J. B. Bruno :M. V. A. Saraiva :R. M. P. Rocha : I. R. Brito :A. B. G. Duarte :V. R. Araújo :C. M. G. Silva :C. C. Campello : J. R. FigueiredoFaculty of Veterinary Medicine, LAMOFOPA, PPGCV,State University of Ceara,Fortaleza-CE, Brazil

M. H. T. MatosNucleus of Biotechnology Applied to Ovarian FollicleDevelopment, Federal University of São Francisco Valley,Petrolina-PE, Brazil

J. R. V. SilvaBiotechnology Nucleus of Sobral (NUBIS),Federal University of Ceara,Sobral-CE, Brazil

J. J. H. Celestino (*)Programa de Pós-Graduação em Ciências Veterinárias (PPGCV)Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais(LAMOFOPA), Universidade Estadual do Ceará (UECE),Av. Paranjana, 1700, Campus do Itaperi,Fortaleza, CE, Brazil CEP: 60740–903e-mail: juliana_jales@yahoo.com.br

Cell Tissue Res (2011) 344:539–550DOI 10.1007/s00441-011-1162-1

being matured and fertilized in vitro is of interest. Theimplementation of this system could maximize the in vitroproduction of embryos by providing a large number ofoocytes that are homogeneous and meiotically competent forseveral biotechnologies such as in vitro fertilization, cloningand transgenesis. In the rodent, in vitro follicle growth withinseveral culture systems has resulted in live births (O’Brien etal. 2003; Xu et al. 2006) and efforts are also currently inprogress in nonhuman primates and in humans (Xu et al.2009a, b). In livestock animals, the in vitro growth anddevelopment of preantral follicles has been successful upuntil the embryonic stage (pig: Wu and Tian 2007; buffalo:Gupta et al. 2008; sheep: Arunakumari et al. 2010; caprine:Saraiva et al. 2010b). However, in all cases, the preantralfollicles used are at least 200 μm in diameter.

In goats, the isolated follicles contain some stromaltissue around them and several studies (Silva et al. 2010;Saraiva et al. 2010a, b; Magalhães et al. 2011; Duarte et al.2010) have shown that these follicles can successfully becultured directly on plastic. In this system, the vast majorityof follicles form an antral cavity after 6 days of culture andthe follicular diameter increases. Some studies (Saraiva etal. 2010a, b; Duarte et al. 2010) have shown the acquisitionof meiotic competence after 18 days of culture. Neverthe-less, the birth of live offspring from the preantral folliclesgrown in vitro in this species is still a great challenge. Inaddition, the maturation rates of oocytes obtained frompreantral follicles are low.

The duration of culture varies according to the objectivesof the study. When the purpose of the experiment is both toevaluate the effect of different substances and to producematured oocytes, long-term culture is recommended.Nevertheless, in this study, the effect of various substanceshas been evaluated during 6 days of culture.

Follicular development is the result of complex inter-actions between pituitary gonadotropins and numerousintra-ovarian factors that act as promoters of survival,stimulating the growth and differentiation of follicular cells(Fortune 2003; Miyoshi et al. 2010). Among these factors,the epidermal growth factor (EGF) has been highlighted; ithas emerged as an important substance capable of inducingfollicular development in vitro (Celestino et al. 2009). EGFis a protein belonging to the EGF family, which consists ofat least eight members (Riese and Stern 1998), and isconsidered a mitogenic factor, being involved in theregulation of several ovarian processes (Silva et al. 2006),including proliferation and cellular differentiation, inaddition to steroidogenesis (Saha et al. 2000; Wang et al.2007). The expression of protein and mRNA for EGF hasbeen demonstrated in the oocyte and granulosa cells ofearly and late-staged follicles (hamster: Roy and Greenwald1990; human: Maruo et al. 1993; Bennett et al. 1996; pig:Singh et al. 1995), whereas EGF mRNA has been described

only in oocyte and granulosa cells from pig antral follicles(Singh et al. 1995). In goats, the protein and mRNA forEGF are expressed in all developmental stages of ovarianfollicles and in the ovarian surface epithelium (Silva et al.2006). However, the quantification of the steady-state levelof EGF mRNA during the various stages of folliculardevelopment has not yet been performed. The action ofEGF in the ovary is mediated by a membrane receptor,EGF-R (ErbB1), which belongs to the ErbB superfamily(Riese and Stern 1998). EGF-R mRNA and protein havebeen identified in the oocyte and granulosa cells of early-and late-stage follicles (rat: Chabot et al. 1986; Feng et al.1987; human: Maruo et al. 1993; Bennett et al. 1996; Qu etal. 2000; pig: Singh et al. 1995; cattle: Lonergan et al.1996; mouse: Hill et al. 1999; hamster: Garnett et al. 2002;caprine: Gall et al. 2004; Silva et al. 2006). In hamsters, theexpression of the protein and mRNA for the EGF receptorhas been demonstrated to be positively regulated bygonadotropins and steroids (Garnett et al. 2002).

In vitro studies have shown that EGF promotes theproliferation of granulosa cells in the rodent, swine, caprineand human (Gospodarowicz and Bialecki 1979; Morbeck etal. 1993; Rajarajan et al. 2006), increases the folliculardiameter in the rodent, swine, bovine, caprine and human(Romano et al. 1994; Roy and Kole 1998; Gutierrez et al.2000; Silva et al. 2004a; Mao et al. 2004), reduces theatresia levels in bovine, swine and caprine (Gutierrez et al.2000; Mao et al. 2004; Zhou and Zhang 2005a, b; Celestinoet al. 2009) and promotes the activation and maintenance ofsurvival of ovine and caprine primordial follicles for6–7 days of culture (Andrade et al. 2005; Celestino et al.2009). Evidence has been presented that the regulation ofEGF activity in granulosa cells in vitro can occur bystimulation of follicle-stimulating hormone (FSH) receptor(FSH-R) expression (Luciano et al. 1994). When EGF andFSH have been tested on in vitro cultures of pig preantralfollicles, the vast majority of follicles grow to the antralstage, with high secretion of oestradiol, and the oocytesfrom these follicles can be matured and fertilized anddevelop until the blastocyst stage (Wu and Tian 2007). Incaprine, the interaction between EGF and FSH promotesfollicular survival, although it has no effect on growth(Zhou and Zhang 2005a, b).

Despite the above studies, little is known about the invitro effects of EGF in the presence or absence of FSH onthe development of isolated caprine secondary follicles.Moreover, the in vitro effects of EGF in the presence orabsence of FSH on the expression of EGF and FSH-R afterculture are still unknown. Therefore, the present study hasaimed (1) to verify the steady-state level of EGF mRNAduring various follicular stages in goat ovaries, (2) toinvestigate a possible influence of EGF on the survival,antral cavity formation and growth of secondary follicles

540 Cell Tissue Res (2011) 344:539–550

after culture for 6 days and (3) to evaluate the effects ofEGF and/or FSH on the mRNA levels of EGF and FSH-Rafter 6 days of culture.

Materials and methods

Chemicals

Unless mentioned otherwise, the culture media and otherchemicals used in the present study were purchased fromSigma Chemical (St. Louis, Mo., USA).

Steady-state level of EGF mRNA in goat ovarian follicles

To evaluate the steady-state level of mRNA, 30 ovariesfrom 15 goats (Capra hircus) were collected at a localslaughterhouse and rinsed in minimum essential medium(MEM) containing antibiotics (100 μg/ml penicillin,100 μg/ml streptomycin). Of these, 10 ovaries from fivegoats were utilized for the isolation of primordial, primaryand secondary follicles. The remaining ovaries were usedfor the collection of cumulus–oocyte complexes (COCs),mural granulosa cells and thecal cells from small and largeantral follicles. Primordial, primary and secondary follicleswere isolated by a previously described mechanicalprocedure (Lucci et al. 1999). After isolation, these follicleswere washed several times to remove the stromal and thecalcells completely and were then placed by category intoseparate Eppendorf tubes in groups of 10. This procedurewas completed within 2 h and all samples were storedat −80°C until the RNA was extracted. COCs aspiratedfrom small (1–3 mm) and large (3–6 mm) antral follicleswere recovered from a second group of ovaries (n=15).Compact COCs were selected from the follicle content asdescribed by van Tol and Bevers (1998). Thereafter, groupsof 10 COCs were stored at −80°C until RNA extraction. Tocollect mural granulosa and theca cell complexes, small(n=10) and large antral follicles (n=10) were isolated from

ovaries (n=5) and dissected free from stromal tissue withforceps as previously described (van Tol and Bevers 1998).The follicles were then bisected and the granulosa and thecacell complexes were collected and stored at −80°C.

The isolation of total RNAwas performed by using a Trizolplus purification kit (Invitrogen, São Paulo, Brazil). Accord-ing to the manufacturer’s instructions, 1 ml Trizol solutionwas added to each frozen sample, and the lysate was aspiratedthrough a 20-gauge needle before centrifugation at 10,000gfor 3 min at room temperature. Thereafter, all lysates werediluted 1:1 with 70% ethanol and subjected to a mini-columnseparation. After the binding of the RNA to the column,DNA digestion was performed by using RNAse-free DNAse(340 Kunitz units/ml) for 15 min at room temperature. Afterthe column had been washed three times, the RNA waseluted with 30 μl RNAse-free water.

Prior to reverse transcription (RT), the eluted RNAsamples were incubated for 5 min at 70°C and chilled onice. RT was then performed in a total volume of 20 μl,which comprised 10 μl sample RNA, 4 μl 5× reversetranscriptase buffer (Invitrogen), 8 U RNAseout, 150 USuperscript III reverse transcriptase, 0.036 U randomprimers (Invitrogen), 10 mM dithiothreitole, 0.5 mM eachdNTP. The mixture was incubated for 1 h at 42°C and thenfor 5 min at 80°C, followed by storage at −20°C. Negativecontrols were prepared under the same conditions butwithout the inclusion of the reverse transcriptase.

Quantification of the EGF mRNAwas performed by usingSYBR Green. Polymerase chain reactions (PCRs) wereundertaken with 1 μl cDNA as a template in 7.5 μl SYBRGreen Master Mix (PE Applied Biosystems, Foster City,Calif., USA), 5.5μl ultra-pure water, 0.5μMeach primer. Theprimers were designed for the amplification of EGF mRNA.Glyceraldehyde-2-phosphate dehydrogenase (GAPDH) andβ-actin were used as endogenous controls for the normaliza-tion of the steady-state level of mRNA of the genes (Table 1).The thermal cycling profile for the first round of PCR was:initial denaturation and activation of the polymerase for15 min at 94°C, followed by 40 cycles of 15 s at 94°C, 30 s

Table 1 Oligonucleotide primers used for the analysis of goat cells and tissues by the polymerase chain reaction (s sense, as antisense)

Target gene Primer sequence (5´→3´) Sense Position GenBank accession number

GAPDH (D-glyceraldehyde-3-phosphate dehydrogenase)

TGTTTGTGATGGGCGTGAACCA s 287-309 GI:27525390ATGGCGTGGACAGTGGTCATAA as 440-462

β-Actin ACCACTGGCATTGTCATGGACTCT s 187-211 GI:28628620TCCTTGATGTCACGGACGATTTCC as 386-410

Ubiquitin GAAGATGGCCGCACTCTTCTGAT s 607-631 GI:57163956ATCCTGGATCTTGGCCTTCACGTT as 756-780

EGF (epidermal growth factor) CCAGGTTCTCTTAAGTGC s 48-65 GI: 1706938ACCAAGAGCTGCTCTCTG as 151-168

FSH-R (follicle-stimulatinghormone receptor)

AGGCAAATGTGTTCTCCAACCTGC s 250-274 GI:95768228TGGAAGGCATCAGGGTCGATGTAT as 316-340

Cell Tissue Res (2011) 344:539–550 541

at 60°C, and 45 s at 72°C. The final extension was for10 min at 72°C. All reactions were performed in a real-timePCR Mastercycler (Eppendorf, Germany). The delta-delta-CT method was used to transform CT values into normalizedrelative steady-state levels of mRNA.

Effect of EGF on survival and growth of goat secondaryfollicles and expression of FSH-R and EGF

Isolation and selection of caprine preantral follicles

Ovaries (n=40) were collected at a local slaughterhousefrom 20 adult (1–3 years old) mixed-breed goats; we set upa total of four replicates (five goats/replicate). Immediatelypostmortem, the ovaries were washed in 70% alcohol,followed by two rinses in MEM supplemented with100 μg/ml penicillin and 100 μg/ml streptomycin. Theovaries were transported in MEM at 4°C within 1 h to thelaboratory (Chaves et al. 2008), where the surrounding fattissue and ligaments were stripped off. Ovarian corticalslices (1–2 mm in diameter) were cut from the ovariansurface by using a surgical blade under sterile conditions.Then, the ovarian cortex was placed in a fragmentationmedium, consisting of MEM plus HEPES. Secondaryfollicles of approximately 200 μm in diameter werevisualized under a stereomicroscope (SMZ 645 Nikon,Tokyo, Japan) and manually dissected from the strips ofovarian cortex by using 26 gauge (26 G) needles. Afterisolation, follicles were transferred to 100 μl dropscontaining fresh medium under mineral oil to evaluate thefollicular quality further. Follicles with a visible oocyte,surrounded by granulosa cells, an intact basement mem-brane and no antral cavity were selected for culture.

Caprine preantral follicles culture

For in vitro studies, selected follicles were individuallycultured in 100 μl drops of culture medium in Petri dishes(60×15 mm; Corning, USA) under mineral oil. Controlculture medium, called α-MEM+, consisted of α-MEM (pH7.2–7.4) supplemented with 3.0 mg/ml bovine serumalbumin (BSA), ITS (10 μg/ml insulin, 5.5 μg/ml transfer-rin, 5 ng/ml selenium), 2 mM glutamine, 2 mM hypoxan-thine and 50 μg/ml ascorbic acid under mineral oil.Incubation was conducted at 39°C, 5% CO2 in air for6 days. Fresh medium was prepared and incubated for 1 hprior to use. Preantral follicles obtained from each animalwere randomly distributed into the following treatmentgroups: α-MEM+ alone or supplemented with 100 ng/mlrecombinant bovine FSH (rbFSH: Nanocore, São Paulo, SP,Brazil), 10 ng/ml recombinant human EGF (rhEGF: CellSciences, Canton, Mass., USA) or both. These concen-trations of rbFSH and rhEGF were those that had promoted

the best results in the in vitro development of goat preantralfollicles in previous studies of our laboratory (Celestino etal. 2009; Saraiva et al. 2010a). Every other day, 60 μlculture medium was collected and replaced with freshmedium. The culture was replicated four times; a meannumber of 37 follicles were used per treatment.

Morphological evaluation of follicle development

Follicles were classified according to their morphologicalaspects; those showing morphological signs of degeneration,such as a darkness of oocytes and surrounding cumulus cellsor those with misshapen oocytes, were classified as degen-erated. Follicular diameter was measured only in healthyfollicles in the x and y dimensions (90o) by using an ocularmicrometer (100× magnification) inserted into a stereomi-croscope (SMZ 645 Nikon, Tokyo, Japan) every other day ofculture. Regarding the follicular growth, the mean dailyincrease in follicular diameter was calculated as follows: thediameter of viable follicles at day 6 minus the diameter offollicles at day 0 divided by the days of in vitro culture(6 days). In addition, the percentages of secondary folliclesthat reached antrum formation in vitro were determined.Antral cavity formation was defined as a visible translucentcavity within the granulosa cell layers.

Steady-state level of FSH-R and EGF mRNA in goatovarian follicles cultured in vitro

To evaluate the effect of EGF and/or FSH on FSH-R andEGF mRNA expression after a 6-day culture period, groupsof ten follicles, for each treatment, were collected at the endof the culture period and stored at −80°C until theextraction of total RNA. Quantification of mRNA wasperformed as described previously; the primers for EGFand FSH-R are shown in Table 1. β-Actin and ubiquitinwere used as endogenous controls for the normalization ofgene expression (Table 1).

Statistical analysis

Data for mRNA expression in primordial, primary andsecondary follicles were analysed with the Kruskal-Wallisnon-parametric test, whereas the t-test was used for pairedcomparisons of mRNA expression in small and large antralfollicles (significance at P<0.05). Data regarding follicularsurvival and antrum formation after in vitro culture for eachtreatment were compared by using the Chi-square test, and theresults were expressed as percentages. Follicular diameter andgrowth rate and mRNA levels for EGF and FSH-R afterculture showed no homoscedasticity, and these parameterswere analysed by using the Kruskal-Wallis non-parametrictest (SAS software 1999). The results were expressed as the

542 Cell Tissue Res (2011) 344:539–550

mean±standard error of the mean (SEM), and differenceswere considered to be significant when P<0.05.

Results

Steady-state level of EGF in goat ovarian follicles

Quantification of mRNA expression demonstrated thatsecondary follicles had significantly higher levels of EGFmRNA than primordial follicles, but the levels did not differ

significantly from that of primary follicles (P<0.05, Fig. 1a).When the EGF mRNA levels in the primordial and primaryfollicles were compared, no significant difference wasobserved (P>0.05, Fig. 1a). In addition, no significantdifference was observed between COCs collected from smalland large antral follicles (P>0.05, Fig. 1b). Similar resultswere observed for granulosa/theca cells from small and largeantral follicles (P>0.05, Fig. 1c). On the other hand, RT-PCRshowed that COCs either from small or from large antralfollicles had significantly higher EGF mRNA levels thantheir respective granulosa/theca cells (P<0.05, Fig. 1d, e).

Fig. 1 Expression of epidermal growth factor (EGF) mRNA in goatovarian follicles (means ± SEM). a Primordial, primary andsecondary follicles. b Cumulus–oocyte complexes (COC) fromsmall and large antral follicles. c Granulosa/theca cells from small

and large antral follicles. d COCs and granulosa/theca cells fromsmall antral follicles. e COCs and granulosa/theca cells from largeantral follicles (a,bP<0.05)

Cell Tissue Res (2011) 344:539–550 543

Effect of EGF on survival, antrum formation and growthof goat secondary follicles

Preantral follicles selected for culture had a centrallylocated oocyte and normal granulosa cells, which wereenclosed by an intact basal membrane (Fig. 2a, c). Folliclegrowth and antrum formation were observed after 6 days ofculture (Fig. 2b, d). Effects of EGF and/or FSH onfollicular survival, antral cavity formation, follicular diam-eter and daily growth rate were evaluated at 0, 2, 4 and6 days of culture and are shown in Table 2, Figs. 3, 4, 5,respectively.

After 6 days of culture, all treatments promoted a highrate of follicular survival, which exceeded 90%. However,no significant difference was apparent among treatmentsand culture periods (Table 2).

With regard to antrum cavity formation (Fig. 3) from day0 to day 2 of culture, a positive effect of all of thetreatments was observed (P<0.05) but the percentage ofantral follicles was significantly higher when EGF was usedalone in comparison to FSH alone or EGF associated withFSH. However, no significant difference was foundbetween EGF alone and α-MEM+ (P>0.05). In addition,from culture day 2 to day 4, the percentage of antrumformation increased (P<0.05) and remained constant fromday 4 to day 6 in all treatments (P>0.05), except when EGF+FSH treatment was used, in which a progressive increasein antrum formation was observed (P<0.05).

The presence of EGF alone or in combination with FSHcaused a significant increase in follicular diameter as theculture progressed starting on day 2 of culture (P<0.05). Acomparison of the different treatments on the same days ofculture revealed that, from day 4, the use of EGF alonepromoted a significant increase in follicular diameter whencompared with α-MEM+ (P<0.05). The addition of EGF tothe culture medium in the presence or absence of FSHpositively influenced the daily follicular growth ratecompared with α-MEM+ alone (higher than 20 μm/day;P<0.05). However, it did not differ from the mediumsupplemented only with FSH (P>0.05).

Expression of EGF and FSH-R in goat secondary follicles

Figure 6 shows that the presence of FSH, EGF or both inthe culture medium significantly reduced the EGF mRNAlevels. In addition, when EGF alone was present in theculture medium, a significant reduction in FSH-R mRNAlevels was observed after follicle culture for 6 days (Fig. 7).

Discussion

This study has shown, for the first time, that EGF mRNAlevels increase during development from primordial tosecondary follicles and that treatment with both FSH andEGF increases the secondary follicle diameter after 6 days

Fig. 2 Caprine preantral fol-licles at day 0 (a, c) and antralfollicles after 6 days of in vitroculture with EGF alone (b) orEGF+FSH (d)

544 Cell Tissue Res (2011) 344:539–550

of culture in goats. Furthermore, FSH, EGF or both reduceEGF mRNA levels, whereas EGF reduces FSH-R mRNAlevels after follicle culture for 6 days.

Goat secondary follicles have a higher EGF mRNAlevels than primordial follicles. This finding confirms theresults of previous studies showing that EGF acts on follicledevelopment by promoting the oocyte growth of goatprimary follicles in vitro and granulosa cell proliferationand differentiation (Saha et al. 2000; Silva et al. 2004a;Wang et al. 2007). Moreover, some studies have demon-strated that, although EGF is not essential for the activationof primordial follicles (Braw-Tal and Yossefi 1997; Fortuneet al. 1998; Wright et al. 1999), it is important for latefollicular development (Gutierrez et al. 2000; Nayudu et al.2002; Peng et al. 2010). According to Wu and Tian (2007),the production and activity of EGF are more important inthe granulosa cells of growing preantral follicles. In theantral follicles, COCs either from small or large antralfollicles have higher EGF mRNA levels than theirrespective granulosa/theca cells. In porcine ovarian fol-licles, EGF mRNA and protein have been detected in the

oocyte (Singh et al. 1995). In addition to its presence in pigoocytes, EGF has been detected in bovine and humanoocytes (Reeka et al. 1998; Glister et al. 2003). However, inother mammalian species, EGF has been shown to beexpressed both in granulosa and in theca cells (Singh et al.1995; Park et al. 2004; Sekiguchi et al. 2004; Shimada et al.2006). In goats, Gall et al. (2004) have demonstrated thatEGF can bind to its specific receptor located in thefollicular cells or directly in the oocyte, thus being animportant signal during the oocyte maturation process. Invitro studies with antral follicles have revealed that EGFstimulates oocyte maturation (rat: Dekel and Sherizly 1985;mouse: Smitz et al. 1998; De La Fuente et al. 1999; sheep:Guler et al. 2000; cattle: Lonergan et al. 1996; Sakaguchi etal. 2002; human: Goud et al. 1998; pig: Singh et al. 1997;Prochazka et al. 2000, 2003).

After 6 days of culture, a follicle survival rate exceeding90% has been observed following all treatments in thepresent experiments. Although other studies have demon-strated the importance of FSH and EGF for follicularsurvival, including in goat follicles (Matos et al. 2007;

Fig. 3 Percentage of antrum formation in goat secondary folliclescultured for 6 days (D) in control culture medium (α-MEM+) or α-MEM supplemented with follicle-stimulating hormone (FSH), EGF

(EGF10) or both. A,BDiffers among treatments (P<0.05). a,b,c,dDiffersamong days of culture (P<0.05)

Table 2 Percentage of survival of goat secondary follicles culturedfor 6 days in enriched alpha minimal essential medium supplementedwith follicle-stimulating hormone (FSH), epidermal growth factor

(EGF) or both (n number of follicles cultured for each treatment). Nostatistical differences were observed (P>0.05)

Days Treatments

Enriched alpha minimalessential medium (n=37)

FSH (n=37) EGF (n=37) EGF+FSH (n=38)

0 100 100 100 100

2 100 100 100 100

4 100 100 97.30 100

6 100 91.89 91.89 94.74

Cell Tissue Res (2011) 344:539–550 545

Celestino et al. 2009), we have seen no effects of thesesubstances when added to the culture medium. This isprobably attributable to the use of a rich culture medium,composed of amino acids, vitamins, antioxidants, inor-ganic salts and energetic substrates, which are able tosustain survival within short-term culture regardless of theaddition of hormones and/or growth factors. In addition tothe normal composition of this medium, we have supple-mented it with important substances such as hypoxanthine,pyruvate, glutamine and ITS; Silva et al. (2004b) haveshown that the addition of pyruvate, glutamine, hypoxan-thine and ITS to the culture medium (MEM) increases the

percentage of morphologically normal goat follicles after5 days of culture.

This study has demonstrated that EGF in the presence orabsence of FSH increases antrum formation and thediameter of caprine secondary follicles cultured in vitro,suggesting the considerable importance of both substancesto follicular development at this stage. In our laboratory,early formation of the antrum has been observed in otherexperiments (Duarte et al. 2010; Silva et al. 2010; Araújo etal. 2011). Furthermore, we have found that those folliclesthat do not present a good growth rate and/or slowingprocess of antrum formation almost always degenerate inthe first third of the culture period and that this event isunder the direct influence of the follicle size at thebeginning of culture. In our present experiments, folliculardiameter is approximately 200 μm, which might favour theformation of early antrum. Additionally, when removedfrom the ovarian environment, follicles do not experience theinhibition of factors from dominant follicles. Folliculargrowth in vitro is known to be the result of a rapidproliferation of granulosa cells associated with basementmembrane remodelling and the expansion of the antral cavity.These events are essential for oocyte development in thefollicular environment. Unfortunately, the data obtained inthis study do not provide evidence that the addition ofrecombinant EGF and/or FSH might only be stimulating thegranulosa cells to proliferate without a concomitant coordi-nated growth in the oocyte. However, both FSH and EGFhave been demonstrated to promote the growth of goatsecondary follicles and to encourage high survival rates. Anexamination of hormone production and oocyte maturationcertainly should be performed in future experiments, in whichthese follicles should be cultured for longer period.

The presence of mRNA for EGF and FSH receptors hasbeen observed in caprine secondary follicles (EGF-R: Silvaet al. 2006, FSH-R: Saraiva et al. 2010a), the binding of

Fig. 5 Daily growth rate of morphologically normal follicles duringin vitro culture for 6 days. Treatments as in Fig. 3. A,BDiffers amongtreatments (P<0.05)

Fig. 4 Diameter of morpholog-ically normal follicles after invitro culture for 6 days. Treat-ments as in Fig. 3. A,BDiffersamong treatments (P<0.05). a,b,c,dDiffers among days of culture(P<0.05)

546 Cell Tissue Res (2011) 344:539–550

FSH or EGF to their respective receptors possibly stimu-lating follicular growth. EGF is considered a mitogenicfactor for granulosa cells (Saha et al. 2000; Wang et al.2007). It has been implicated in the regulation (Roy 1993;Campbell 1999) and stimulation of in vitro preantral folliclegrowth in hamsters (Roy 1993), mice (Boland and Gosden1994), humans (Roy and Kole 1998), cows (Gutierrez et al.2000), sheep (Hemamalini et al. 2003) and goats (Silva etal. 2004a; Rajarajan et al. 2006; Celestino et al. 2009).EGF, when tested on in vitro cultures of pig preantralfollicles, not only promoted a suppression of apoptosis inthe granulosa cells, but also increased antrum formation(Mao et al. 2004). With regard to FSH, studies withpreantral follicles in the pig (Hirao et al. 1994; Wu et al.2001), cattle (Gutierrez et al. 2000; Itoh et al. 2002), mouse(Gao et al. 2007) and goats (Saraiva et al. 2010a, b) havedemonstrated its ability to induce growth and antrumformation. Furthermore, FSH is able induce folliculargrowth by interacting with various growth factors, partic-ularly EGF (Demeestere et al. 2005). In hamsters, EGF has

been shown to be a potent mitogen for cells of preantralfollicles and is able to mediate the mitogenic action of FSH(Roy and Greenwald 1991; Greenwald and Roy 1994). Incaprine, EGF alone or when associated with FSH stimulatesoocyte growth in vitro during the transition of primordial toprimary follicles (Silva et al. 2004a). More recently, theimportance of EGF and FSH has been demonstrated for thein vitro growth of ovine preantral follicles, especially forthe more advanced stages (Peng et al. 2010).

After the culture of caprine secondary follicles for6 days, EGF and FSH reduce EGF mRNA levels. Theself-reduced expression of EGF probably occurs because ofthe overstimulation of follicular cells by the addition ofexogenous EGF, triggering a primary regulatory mechanismthat leads to the reduction of its endogenous production, asreflected by reduced mRNA levels. Expression analysisafter culture has revealed that EGF and FSH exhibit nosynergistic effects on the pattern of mRNA expression forEGF and FSH-R. This suggests that the action of EGF isnot totally dependent on FSH and that the action of FSH is

Fig. 6 Steady-state level ofEGF mRNA in goat secondaryfollicles cultured for 6 days inα-MEM+ supplemented withFSH, EGF or both. a,bP<0.05

Fig. 7 Steady-state level ofFSH-R mRNA in goat second-ary follicles cultured for 6days in α-MEM+ supplementedwith FSH, EGF orboth. a,bP<0.05

Cell Tissue Res (2011) 344:539–550 547

strongly influenced by EGF. This reciprocal regulationbetween EGF and FSH has also been observed in studies ofhamster ovaries; these studies have found that the folliclecells express the EGF gene and that its expression iscontrolled by FSH, which in turn is partially influenced byEGF (Roy and Harris 1994).

EGF reduces the FSH-R mRNA expression in goatfollicles cultured in vitro. However, when EGF is associatedwith FSH, this reduction is inhibited. Evidence exists for theaction of EGF in regulating the activity of granulosa cells invitro (1) by inhibiting the expression of luteinizing hormonereceptor and the oestradiol production induced by FSH, (2) bystimulating the FSH-R expression and progesterone produc-tion induced by FSH or (3) by altering the binding affinity(Pulley andMarrone 1986; Tapanainen et al. 1987; May et al.1987; Hiramatsu et al. 1992; Luciano et al. 1994; Hattori etal. 1995). Some studies suggest that both EGF and FSH canactivate efficiently the cascade of mitogen-activated proteinkinase (MAPK) in granulosa cells (Maizels et al. 1998).However, increases in cAMP induced by FSH interfere withthe activation of the MAPK signaling pathway in response toEGF (Wu et al. 1993) and its mitogenic effects in ratfibroblasts (Cook and McCormick 1993).

In conclusion, the present study provides evidence thatEGF mRNA levels are higher in secondary follicles than inearlier stages and that both FSH and EGF promote thegrowth of goat secondary follicles. Furthermore, EGF andFSH reduce EGF mRNA levels, and EGF decreases FSH-RmRNA levels in cultured secondary follicles. The results ofthe steady-state level of EGF and FSH-R mRNA and theculture system established in this work should contribute tofuture investigations on the mechanisms and substancesinvolved in the regulation of follicular development.However, new studies are still necessary for a betterunderstanding of ovarian regulatory mechanisms.

Acknowledgments The authors thank Isadora Machado TeixeiraLima for the correction of the manuscript.

References

Andrade ER, Seneda MM, Alfieri AA, Oliveira JA, BracarenseAPFRL, Figueiredo JR, Toniolli R (2005) Interactions of índoleacetic acid with EGF and FSH in the culture of ovine preantralfollicles. Theriogenology 64:1104–1113

Araújo VR, Chaves RN, Duarte ABG, Celestino JJH, Silva GM,Fernandes DD, Matos MHT, Campello CC, Figueiredo JR (2011)Effect of culture medium replacement protocol on the in vitrodevelopment of isolated caprine secondary follicles. SmallRumin Res 95:139–143

Arunakumari G, Shanmugasundaram N, Rao VH (2010) Developmentof morulae from the oocytes of cultured sheep preantral follicles.Theriogenology 74:884–894

Bennett RA, Osathanondh R, Yeh J (1996) Immunohistochemicallocalization of transforming growth factor-α, epidermal growth

factor (EGF), and EGF receptor in the human fetal ovary. J ClinEndocrinol Metab 81:3073–3076

Boland NI, Gosden RG (1994) Effects of epidermal growth factor onthe growth and differentiation of cultured mouse ovarianfollicles. J Reprod Fertil 101:369–374

Braw-Tal R, Yossefi S (1997) Studies in vivo and in vitro on theinitiation of follicle growth in the bovine ovary. J Reprod Fertil109:165–171

Campbell BK (1999) The modulation of gonadotrophic hormoneaction on the ovary by paracrine and autocrine factors. AnatHistol Embryol 28:247–251

Celestino JJH, Bruno JB, Lima-Verde IB, Matos MHT, Saraiva MVA,Chaves RN, Martins FS, Lima LF, Name KPO, Campello CC,Silva JRV, Báo SN, Figueiredo JR (2009) Recombinant epider-mal growth factor maintains follicular ultrastructure and pro-motes the transition to primary follicles in caprine ovarian tissuecultured in vitro. Reprod Sci 16:239–246

Chabot JG, St-Arnaud R, Walker P, Pelletier G (1986) Distribution ofepidermal growth factor receptors in the rat ovary. Mol CellEndocrinol 44:99–108

Chaves RN, Martins FS, Saraiva MVA, Celestino JJH, Lopes CAP,Correia JC, Lima-Verde IB, Matos MHT, Báo SN, Name KPO,Campello CC, Silva JRV, Figueiredo JR (2008) Chilling ovarianfragments during transportation improves viability and growth ofgoat preantral follicles cultured in vitro. Reprod Fertil Dev20:640–647

Cook SJ, McCormick F (1993) Inhibition by cAMP of Ras-dependentactivation of Raf. Science 292:1069–1072

De La Fuente R, O’Brien MJ, Eppig JJ (1999) Epidermal growthfactor enhances preimplantation developmental competence ofmaturing mouse oocytes. Hum Reprod 14:3060–3068

Dekel N, Sherizly I (1985) Epidermal growth factor inducesmaturation of rat follicle-enclosed oocytes. Endocrinology116:406–409

Demeestere I, Centner J, Gervy Y, Delbaere A (2005) Impact ofvarious endocrine and paracrine factors on in vitro culture ofpreantral follicles in rodents. Reproduction 130:147–156

Duarte ABG, Chaves RN, Araújo VR, Celestino JJH, Silva GM,Lopes CAP, Tavares LMT, Campello CC, Figueiredo JR (2010)Follicular interactions affect the in vitro development of isolatedgoat preantral follicles. Zygote (in press)

Feng P, Knecht M, Catt K (1987) Hormonal control of epidermalgrowth factor receptors by gonadotropins during granulosa celldifferentiation. Endocrinology 120:1121–1126

Fortune JE (2003) The early stages of follicular development:activation of primordial follicles and growth of preantral follicles.Anim Reprod Sci 78:135–163

Fortune JE, Kito S, Wandji SA, Srsen V (1998) Activation of bovineand baboon primordial follicles in vitro. Theriogenology 49:441–449

Gall L, Chene N, Dahirel M, Ruffini S, Boulesteix C (2004)Expression of epidermal growth factor receptor in the goatcumulus-oocyte complex. Mol Reprod Dev 67:439–445

Gao MZ, Wang Y, Wu X (2007) In-vitro maturation of immatureoocytes from preantral follicles in prepuberal mice. J ReprodContracept 18:25–32

Garnett K, Wang J, Roy SK (2002) Spatiotemporal expression ofepidermal growth factor receptor messenger RNA and protein inthe hamster ovary: follicle stage specific differential modulationby follicle-stimulating hormone, luteinizing hormone, estradiol,and progesterone. Biol Reprod 67:1593–1604

Glister C, Groome NP, Knight PG (2003) Oocyte-mediated suppres-sion of follicle-stimulating hormone- and insulin-like growthfactor-induced secretion of steroids and inhibin-related proteinsby bovine granulosa cells in vitro: possible role of transforminggrowth factor alpha. Biol Reprod 68:758–765

548 Cell Tissue Res (2011) 344:539–550

Gospodarowicz D, Bialecki H (1979) Fibroblast and epidermal growthfactors are mitogenic agents for cultured granulose cells ofrodent, porcine and human origin. Endocrinology 104:757–764

Goud PT, Goud AP, Qian C, Laverge H, Van der Elst J, De Sutter P,Dhont M (1998) In vitro maturation of human germinal vesiclestage oocytes: role of cumulus cells and epidermal growth factorin the culture medium. Hum Reprod 13:1638–1644

Greenwald GS, Roy SK (1994) Follicular development and its control.In: Knobil E, Neill JD (eds) The physiology of reproduction.Raven, New York, pp 629–724

Guler A, Poulin N, Mermillod P, Terqui M, Cognie Y (2000) Effect ofgrowth factors, EGF and IGF-I, and estradiol on in vitromaturation of sheep oocytes. Theriogenology 54:209–218

Gupta PSP, Ramesh HS, Manjunatha BM, Nandi S, Ravindra JP(2008) Production of buffalo embryos using oocytes from in vitrogrown preantral follicles. Zygote 16:57–63

Gutierrez CG, Ralph JH, Telfer EE, Wilmut I, Webb R (2000) Growthand antrum formation of bovine preantral follicles in long-termculture in vitro. Biol Reprod 62:1322–1328

Hattori MA, Yoshino E, Shinohara Y, Horiuchi R, Kojima I (1995) Anovel action of epidermal growth factor in rat granulosa cells: itspotentiation of gonadotrophin action. J Mol Endocrinol 15:283–291

Hemamalini NC, Rao BS, Tamilmani G, Amarnath D, Vagdevi R,Naidu KS, Reddy KK, Rao VH (2003) Influence of transforminggrowth factor-α, insulin-like growth factor-II, epidermal growthfactor or follicle stimulating hormone on in vitro development ofpreantral follicles in sheep. Small Rumin Res 50:11–22

Hill JL, Hammar K, Smith PJ, Gross DJ (1999) Stage dependenteffects of epidermal growth factor on Ca2+ efflux in mouseoocytes. Mol Reprod Dev 53:244–253

Hiramatsu S, Maruo T, Matsuo H, Mochizuki M (1992) Effects ofepidermal growth factor on the proliferation and differentiation ofporcine granulosa cells cultured in vitro. Acta Obstet GynecolJpn 44:55–61

Hirao Y, Nagai T, Kubo M, Miyano T, Miyake M, Kato S (1994) Invitro growth and maturation of porcine oocytes. J Reprod Fertil100:333–339

Itoh T, Kacchi M, Abe H, Sendai Y, Hoshi H (2002) Growth, antrumformation, and estradiol production of bovine preantral folliclescultured in a serum-free medium. Biol Reprod 67:1099–1105

Lonergan P, Carolan C, Van Langendonckt A, Donnay I, Khatir H,Mermillod P (1996) Role of epidermal growth factor in bovineoocyte maturation and preimplantation embryo development invitro. Biol Reprod 54:1420–1429

Lucci CM, Amorim CA, Báo SN, Figueiredo JR, Rodrigues APR,Silva JRV, Goncalves PBD (1999) Effect of the interval of serialsections of ovarian in the tissue chopper on the number ofisolated caprine preantral follicles. Anim Reprod Sci 56:39–49

Luciano AM, Pappalardo A, Ray C, Peluso JJ (1994) Epidermalgrowth factor inhibits large granulose cell apoptosis by stimulat-ing progesterone synthesis and regulating the distribution ofintracellular free calcium. Biol Reprod 51:646–654

Magalhães DM, Fernandes DD, Mororó MBS, Silva CMG, RodriguesGQ, Bruno JB, Matos MHT, Campello CC, Figueiredo JR (2011)Effect of the medium replacement interval on the viability,growth and in vitro maturation of isolated caprine and ovine pre-antral follicles. Reprod Domest Anim 46:134–140

Maizels ET, Cottom J, Jones JC, Hunzicker-Dunn M (1998) Folliclestimulating hormone (FSH) activates the p38 mitogen-activatedprotein kinase pathway, inducing small heat shock proteinphosphorylation and cell rounding in immature rat ovariangranulose cells. Endocrinology 139:3353–3356

Mao J, Smith MF, Rucker EB, Wu GM, McCauley TC, Cantley TC,Prather RS, Didion BA, Day BN (2004) Effect of epidermalgrowth factor and insulin-like growth factor I on porcine

preantral follicular growth, antrum formation, and stimulationof granulosal cell proliferation and suppression of apoptosis invitro. J Anim Sci 82:1967–1975

Maruo T, Ladines-Llave CA, Samoto T, Matsuo H, Manalo AS, Ito H,Mochizuki M (1993) Expression of epidermal growth factor andits receptor in the human ovary during follicular growth andregression. Endocrinology 132:924–931

Matos MHT, Lima-Verde IB, Luque MCA, Maia JE Jr, Silva JRV,Celestino JJH, Martins FS, Báo SN, Lucci CM, Figueiredo JR(2007) Essential role of follicle stimulating hormone in themaintenance of caprine preantral follicle viability in vitro. Zygote15:173–182

May JV, Buck PA, Schomberg DW (1987) Epidermal growth factorenhances [125I]iodo-follicle-stimulating hormone binding bycultured porcine granulosa cells. Endocrinology 120:2413–2420

Miyoshi T, Otsuka F, Yamashita M, Inagaki K, Nakamura E,Tsukamoto N, Takeda M, Suzuki J, Makino H (2010) Functionalrelationship between fibroblast growth factor-8 and bone mor-phogenetic proteins in regulating steroidogenesis by rat granulosacells. Mol Cell Endocrinol 325:84–92

Morbeck DE, Flowers WL, Britt JH (1993) Response of porcinegranulosa cells isolated from primary and secondary follicles toFSH, 8-bromo-cAMP and epidermal growth factor in vitro. JReprod Fertil 99:577–584

Nayudu PL, Vitt UA, De Tomasi JB, Pancharatna K, Ulloa-Aguirre A(2002) Intact follicle culture: what it can tell us about the roles ofFSH glycoforms during follicle development. Reprod BiomedOnline 5:240–253

O’Brien MJ, Pendola JK, Eppig JJ (2003) A revised protocol for invitro development of mouse oocyte from primordial folliclesdramatically improves their development competence. BiolReprod 68:1682–1686

Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M (2004) EGF-likegrowth factors as mediators of LH action in the ovulatory follicle.Science 303:682–684

Peng X, Yang M, Wang L, Tong C, Guo Z (2010) In vitro culture ofsheep lamb ovarian cortical tissue in a sequential culturemedium. J Assist Reprod Genet 27:247–257

Prochazka R, Srsen V, Nagyova E, Miyano T, Flechon JE (2000)Developmental regulation of effect of epidermal growth factor onporcine oocyte-cumulus cell complexes: nuclear maturation,expansion, and F-actin remodeling. Mol Reprod Dev 56:63–73

Prochazka R, Kalab P, Nagyova E (2003) Epidermal growth factor-receptor tyrosine kinase activity regulates expansion of porcineoocyte–cumulus cell complexes in vitro. Biol Reprod 68:797–803

Pulley DD, Marrone BL (1986) Inhibitory action of epidermal growthfactor on progesterone biosynthesis in hen granulose cells duringshort term culture: two sites of action. Endocrinology 118:2284–2291

Qu JP, Godin PA, Nisolle M, Donnez J (2000) Distribution ofepidermal growth factor receptor expression of primordialfollicles in human ovarian tissue before and after cryopreserva-tion. Hum Reprod 15:302–310

Rajarajan K, Rao BS, Vagdevi R, Talmimani G, Arunakumari G,Sreenu M, Amarnath D, Naik BR, Rao VH (2006) Effect ofvarious growth factors on the in vitro development of goatpreantral follicles. Small Rumin Res 63:204–212

Reeka N, Berg FD, Brucer C (1998) Presence of transforming growthfactor alpha and epidermal growth factor in human ovarian tissueand follicular fluid. Hum Reprod 13:2199–2205

Riese DJ 2nd, Stern DF (1998) Specificity within the EGF family/ErbB receptor family signaling network. Bioessays 20:41–48

Romano M, Kraus ER, Boland CR, Coffey RJ (1994) Comparisonbetween transforming growth factor alpha and epidermal growthfactor in the protection of rat gastric mucosa against drug-induced injury. Ital J Gastroenterol 26:223–228

Cell Tissue Res (2011) 344:539–550 549

Roy SK (1993) Epidermal growth factor and transforming growthfactor-beta modulation of follicle-stimulating hormone-induceddeoxyribonucleic acid synthesis in hamster preantral and earlyantral follicles. Biol Reprod 48:552–557

Roy SK, Greenwald GS (1990) Immunohistochemical localisation ofepidermal growth factor-like activity in the hamster ovary with apolyclonal antibody. Endocrinology 126:1309–1317

Roy SK, Greenwald GS (1991) Mediation of follicle-stimulatinghormone action on follicular deoxyribonucleic acid synthesis byepidermal growth factor. Endocrinology 129:1903–1908

Roy SK, Harris SG (1994) Antisense epidermal growth factoroligodeoxynucleotides inhibit follicle-stimulating hormone-induced in vitro DNA and progesterone synthesis in hamsterpreantral follicles. Mol Endocrinol 8:1175–1181

Roy SK, Kole AR (1998) Ovarian transforming growth factor-beta(TGF-beta) receptors: in vitro effects of follicle stimulatinghormone, epidermal growth factor and TGFbeta on receptorexpression in human preantral follicles. Mol Hum Reprod 4:207–214

Saha S, Shimizu M, Geshi M, Izaike Y (2000) In vitro culture ofbovine preantral follicles. Anim Reprod Sci 63:27–39

Sakaguchi M, Dominko T, Yamauchi N, Leibfried-Rutledge ML,Nagai T, First NL (2002) Possible mechanism for acceleration ofmeiotic progression of bovine follicular oocytes by growthfactors in vitro. Reproduction 123:135–142

Saraiva MVA, Celestino JJH, Araújo VR, Chaves RN, Almeida AP,Lima-Verde IB, Duarte ABG, Silva GM, Martins FS, Bruno JB,Matos MHT, Campello CC, Silva JRV, Figueiredo JR (2010a)Expression of follicle-stimulating hormone receptor (FSH-R) ingoat ovarian follicles and the impact of sequencial culturemedium on in vitro development of caprine prentral follicles.Zygote (in press)

Saraiva MVA, Rossetto R, Brito IR, Celestino JJH, Silva CMG,Faustino LR, Almeida AP, Bruno JB, Magalhães DM, MatosMHT, Campello CC, Figueiredo JR (2010b) Dynamic mediumproduces caprine embryo from preantral follicles grown in vitro.Reprod Sci 17:1135–1143

Sekiguchi T, Mizutani T, Yamada K, Kajitani T, Yazawa T, YoshinoM, Miyamoto K (2004) Expression of epiregulin and amphir-egulin in the rat ovary. J Mol Endocrinol 33:281–291

Shimada M, Hernandez-Gonzalez I, Gonzalez-Robayana I, RichardsJS (2006) Paracrine and autocrine regulation of epidermal growthfactor-like factors in cumulus oocyte complexes and granulosacells: key roles for prostaglandin synthase 2 and progesteronereceptor. Mol Endocrinol 20:1352–1365

Silva JRV, Hurk R van den, Matos MHT, Santos RR, Pessoa C,Moraes MO, Figueiredo JR (2004a) Influences of FSH and EGFon primordial follicles during in vitro culture of caprine ovariancortical tissue. Theriogenology 61:1691–1704

Silva JRV, Hurk R van den, Costa SHF, Andrade ER, Nunes APA,Ferreira FVA, Lôbo RNB, Figueiredo JR (2004b) Survival andgrowth of goat primordial follicles after in vitro culture ofovarian cortical slices in media containing coconut water. AnimReprod Sci 81:273–286

Silva JRV, Hurk R van den, Figueiredo JR (2006) Expression ofmRNA and protein localization of epidermal growth factor andits receptor in goat ovaries. Zygote 14:107–117

Silva CMG, Matos MHT, Rodrigues GQ, Faustino LR, Pinto LC,Chaves RN, Araújo VR, Campello CC, Figueiredo JR (2010) Invitro survival and development of goat preantral follicles in twodifferent oxygen tensions. Anim Reprod Sci 117:83–89

Singh B, Rutledge JM, Armstrong DT (1995) Epidermal growth factorand its receptor gene expression and peptide localisation inporcine ovarian follicles. Mol Reprod Dev 40:391–399

Singh B, Meng L, Rutledge JM, Armstrong DT (1997) Effects ofepidermal growth factor and follicle-stimulating hormone duringin vitro maturation on cytoplasmic maturation of porcine oocytes.Mol Reprod Dev 46:401–407

Smitz J, Cortvrindt R, Hu Y (1998) Epidermal growth factorcombined with recombinant human chorionic gonadotrophinimproves meiotic progression in mouse follicle-enclosed oocyteculture. Hum Reprod 13:664–669

Tapanainen J, Leinonen PJ, Tapanainen P, Yamamoto M, Jaffee RB(1987) Regulation of human granulosa-luteal cell progesteroneproduction and proliferation by gonadotropins and growthfactors. Fertil Steril 48:576–579

Tol HT van, Bevers MM (1998) Theca cells and theca-cellconditioned medium inhibit the progression of FSH-inducedmeiosis of bovine oocytes surrounded by cumulus cellsconnected to membrane granulosa. Mol Reprod Dev 51:315–321

Wang Y, Li J, Wang CY, Kwok AHY, Leung FC (2007) Epidermalgrowth factor (EGF) receptor ligands in the chicken ovary. I.Evidence for heparin-binding EGF-like growth factor (HBEGF)as a potential oocyte-derived signal to control granulose cellproliferation and HB-EGF and kit ligand expression. Endocri-nology 148:3426–3440

Wright CS, Hovatta O, Margara R, Trew G, Winston RML, Franks S,Hardy K (1999) Effects of follicle-stimulating hormone andserum substitution on the in-vitro growth of human ovarianfollicles. Hum Reprod 14:1555–1562

Wu J, Tian Q (2007) Role of follicle stimulating hormone andepidermal growth factor in the development of porcine preantralfollicle in vitro. Zygote 15:233–240

Wu J, Dent P, Jelinek T, Wolfman A, Weber MJ, Sturgill TW (1993)Inhibition of the EGF-activated MAP kinase signaling pathwayby adenosine 3’,5’- monophosphate. Science 262:1065–1069

Wu J, Emery BR, Carrell DT (2001) In vitro growth, maturation,fertilization, and embryonic development of oocytes fromporcine preantral follicles. Biol Reprod 64:375–381

Xu M, Kreeger PK, Shea LD, Woodruff TK (2006) Tissue-engineeredfollicles produce live, fertile offspring. Tissue Eng 12:2739–2746

Xu M, West-Farrell ER, Stouffer RL, Shea LD, Woodruff TK, ZelinskMB (2009a) Encapsulated three-dimensional culture supportsdevelopment of nonhuman primate secondary follicle. BiolReprod 81:587–594

Xu M, Barrett SL, West-Farrell E, Kondapalli LA, Kiesewetter SE,Shea LD, Woodruff TK (2009b) In vitro grown human ovarianfollicles from cancer patients support oocyte growth. HumReprod 24:2531–2540

ZhouH, ZhangY (2005a) Effect of growth factors on in vitro developmentof caprine preantral follicle oocytes. Anim Reprod Sci 90:265–272

Zhou H, Zhang Y (2005b) Regulation of in vitro growth of preantralfollicles by growth factors in goats. Domest Anim Endocrinol28:235–242

550 Cell Tissue Res (2011) 344:539–550