FOODMICROBIOLOGY

Food Microbiology 22 (2005) 109–115

ARTICLE IN PRESS

*Correspondi

630373.

E-mail addre

0740-0020/$ - see

doi:10.1016/j.fm

www.elsevier.nl/locate/jnlabr/yfmic

Simultaneous detection of Listeria monocytogenes and Salmonella bymultiplex PCR in cooked ham

A. Jofrea, B. Martina, M. Garrigaa, M. Hugasa, M. Plab,D. Rodr!ıguez-L!azarob, T. Aymericha,*

aMeat Technology Center, Institute for Food Research and Technology (IRTA), Granja Camps i Armet, E-17121 Monells, Girona, Spainb Institute of Food and Agricultural Technology (INTEA), University of Girona, Campus Montilivi. E-17071, Girona, Spain

Received 25 January 2004; accepted 3 April 2004

Abstract

A multiplex PCR (m-PCR) assay with an internal amplification control (IAC) was developed for the simultaneous detection of

Salmonella spp. and Listeria monocytogenes through invA and prfA genes, respectively. To ensure the detection of the pathogens in

cooked ham, samples were enriched in both buffered peptone-water and Half Fraser broth. Subsequently, equal volumes of

enrichment broths were mixed and DNA purification was performed prior to m-PCR reaction, saving considerable time and effort.

The m-PCR also proved to be very useful as a simple and ready-to-go method for simultaneous confirmation of presumptive L.

monocytogenes and Salmonella spp. colonies directly from agar plates without any DNA extraction steps.

r 2004 Elsevier Ltd. All rights reserved.

1. Introduction

Salmonellosis and listeriosis are two of the mostcommon foodborne diseases (Mead et al., 1999;Anonymous, 2001) and early and sensitive detection isa critical issue in public health policy (Rijpens andHerman, 2002). Listeria monocytogenes is a pathogenthat causes severe illness, listeriosis, to populations atrisk. In the United States, listeriosis is responsible for3.8% of foodborne illness-related hospitalization and27.6% of foodborne disease-related deaths (Mead et al.,1999). Although its ‘‘infective dose’’ is not knownbecause it varies depending on the strain and suscept-ibility of the individuals, the International Commissionon Microbiological Specification for Foods (ICMSF)has concluded that 100 cfu of L. monocytogenes pergram of food at the time of consumption is acceptablefor non-risk consumers (Roberts et al., 1996). Incontrast, Salmonellosis is more frequent but less severe.It is responsible for 25.6% of foodborne illness-relatedhospitalization and 30.6% of foodborne disease-related

ng author. Tel.: +34-972-630052; fax: +34-972-

ss: teresa.aymerich@irta.es (T. Aymerich).

front matter r 2004 Elsevier Ltd. All rights reserved.

.2004.04.009

deaths (Mead et al., 1999), and according to theEuropean Union Directive (94/65/EC) for minced meatand meat preparations Salmonella spp. must be absentin 10 g.The process of isolation and final identification of

Salmonella spp. and L. monocytogenes with biochemicalstandard methods are laborious and time-consumingand can last up to 7–10 days (Anonymous, 1998;Anonymous, 2002). In recent years, PCR-based meth-ods have been reported as a rapid, specific and sensitivealternative, and have been increasingly used to identifyseveral bacterial species from food and clinical samples(Hoorfar and Cook, 2003a; Malorny et al., 2003b;Norton, 2002; Rijpens and Herman, 2002; Stone et al.,1994; Simon et al., 1996). m-PCR allows the simulta-neous amplification of more than one target sequence ina single PCR reaction, saving considerable time andeffort, and decreasing the number of reactions to beperformed in order to assess the possible presence offoodborne pathogens in a food sample (Elnifro et al.,2000). Since its introduction, m-PCR has been success-fully applied to many areas, including detection offoodborne pathogens (Bubert et al., 1992; Soumet et al.,1999; Vantarakis et al., 2000; Houf et al., 2000; Wanget al., 2002). However, some components of food and

ARTICLE IN PRESSA. Jofre et al. / Food Microbiology 22 (2005) 109–115110

chemicals required for selective enrichment of cells mayinfluence the effectiveness of the PCR and causeinhibitory effects (Rossen et al., 1992; Al-Soud andRadstrom, 2000, 2001; Lantz et al., 2000). Thus, theimplementation of PCR-based assays as routine micro-biology diagnostic tools, especially in testing labora-tories with quality assurance programs, requires propercontrols to verify the accuracy of the results obtained.An adequate strategy to assess the validity of the PCRresults is the use of an internal amplification control(IAC), a non-target DNA sequence which is co-amplified with the target sequence by the same set ofprimers (Ballagi–Pord!any and Bel!ak, 1996; Brightwellet al., 1998; Sachadyn and Kur, 1998; Abdulmawjoodet al., 2002; Hoorfar and Cook, 2003a; Hoorfar et al.,2003b).Many primer sets have been used for the PCR

detection of L. monocytogenes and Salmonella spp.,but they differ in sensitivity and accuracy. Recently, aspart of a European Commission-funded project(FOOD-PCR), PCR-based methods for the detectionand verification of Campylobacter spp., Escherichia coli

O157, Yersinia enterocolitica, L. monocytogenes andSalmonella spp. were evaluated and validated. In thiscollaborative study, four Salmonella-specific primer setswere compared and 139–141 set (Rahn et al., 1992) waschosen as the most selective and sensitive for thedetection of all Salmonella enterica and S. bongori

(Malorny et al., 2003a). This primer set demonstrated100% inclusivity (percentage of target DNA samplesthat gave a positive signal, Hoorfar and Cook, 2003a)for a wide range of Salmonella serotypes, including allsubspecies and 100% exclusivity (percentage of non-target samples that gave a negative signal, Hoorfar andCook, 2003a) for other species and genera (Malornyet al., 2003a). This set of primers amplifies the invA gene(Gal!an et al., 1992), located on pathogenicity island 1 ofSalmonella spp. and encoding proteins of the type IIIsecretion system, described as essential for the invasionof epithelial cells by Salmonella (Garcia del Portillo,2000). In L. monocytogenes, prfA gene (Leimeister-W.achter et al., 1990) is the central virulence generegulator, positively modulating the expression of anumber of virulence factors (V!azquez-Boland et al.,2001). Previous studies (Wernars et al., 1992) showedthe suitability of prfA-derived primers for the identifica-tion of L. monocytogenes and Simon et al. (1996)developed the primer set Lip1/Lip2 for the specificidentification of L. monocytogenes. The validation ofthis set of primers has been developed under the FOOD-PCR project (D’agostino et al., submitted for publica-tion).The aim of this work was to develop an m-PCR-based

method for the simultaneous identification of L.

monocytogenes and Salmonella spp. in cooked hamand directly from agar plate isolates. Despite requiring

separate enrichment of both pathogens, the method israpid and convenient.

2. Materials and methods

2.1. Bacterial species and culture conditions

Eleven L. monocytogenes strains, 8 Listeria spp., 3serotypes of S. enterica subsp. enterica and 10 non-Listeria species isolated from meat products were usedin this study (Table 2). All the strains used belong toCTC-IRTA, LTH or CECT collections. Pure cultures ofSalmonella were grown overnight at 37�C in bufferedpeptone-water (BPW) (Merck). Lactic acid bacteriawere grown overnight anaerobically at 30�C in Man,Rogosa and Sharpe (MRS) broth and Listeria spp. andother bacteria were grown overnight at 37�C inTryptone soya broth+0.6% yeast extract (TSBYE).

2.2. Cells and DNA purification

DNA purification was performed using the DNeasytissue kit (Qiagen) and DNA concentration wasdetermined by spectrophotometry using the GeneQuantII (Applied Biotech). When cells from pure cultures weredirectly subjected to PCR, they were centrifuged at10,000 rpm for 5min, rinsed with 0.1% peptone, 0.85%NaCl, resuspended in the same solution and quantifiedby the plate count method according to ISO 11290-2:1998 (Anonymous, 1998) for L. monocytogenes andISO 6579:2002 (Anonymous, 2002) for Salmonella.

2.3. Inoculation of cooked ham and pre-PCR treatment

Twenty-five grams of cooked ham were spiked with1 cfu/25 g, 1� 101 cfu/g and 1� 102 cfu/g of both L.

monocytogenes CTC1010 and S. London CTC1003 anddiluted (1:10) with both BPW or Half Fraser broth (HF)(Oxoid). Then, samples were homogenized for 1min instomacher bags with filter (Biochek) and incubated for48 h at 37�C. For m-PCR analysis, 2ml of BPWenrichment or 1ml of BPW enrichment plus 1ml ofHF enrichment were mixed and DNA was purified usinga Chelex resin-based method. Briefly, the solution wascentrifuged for 5min at 10,000 rpm, the resulting pelletwas resuspended in 200 ml of 6% Chelex-100s resin(BioRad), thoroughly mixed and incubated at 56�C for20min, mixed, boiled for 8min and cooled on ice. Thecell debris was pelleted by centrifugation at 14,000 rpmfor 5min and the supernatant was used in thesubsequent PCR reactions. For multiple colony con-firmation, L. monocytogenes and Salmonella spp.colonies were picked, mixed in 20 ml of water and useddirectly as the template in the m-PCR reaction.

ARTICLE IN PRESSA. Jofre et al. / Food Microbiology 22 (2005) 109–115 111

2.4. PCR conditions

Optimized assays were performed in a 20-ml reactionvolume using the previously described PCR conditions(Simon et al., 1996; Malorny et al., 2003a, b). ForSalmonella spp. the reaction conditions were: 2 ml ofDNA, 2 ml 10�PCR buffer (Invitrogen), 1.5mmMgCl2,200 mm each dNTP, 0.4 mm each primer (139 and 141),1mg/ml BSA, 100 copies of iacSalm and 1U ofPlatinum Taq DNA polymerase (Invitrogen), using thefollowing programme: 1min at 95�C and 38 cycles of30 s at 95�C, 30 s at 64�C, 30 s at 72�C and a finalextension of 4min at 72�C. For L. monocytogenes: 2 mlof DNA, 2 ml 10�PCR buffer (Invitrogen), 2.5mm

MgCl2, 150 mm each dNTP, 0.3 mm each primer (Lip1and Lip2), 1mg/ml BSA, 100 copies of iacList and 1Uof Platinum Taq DNA polymerase (Invitrogen) usingthe following programme: 2min at 94�C and 40 cyclesof 30 s at 94�C, 30 s at 55�C, 1min at 74�C and a finalextension of 5min at 74�C. For the multiplex reaction:2 ml target DNA or cells, 2 ml 10�PCR buffer (Invitro-gen), 1.5mm MgCl2, 150 mm each dNTP, 0.3 mm Lip1–Lip3 and 0.1 mm 139–141, 1mg/ml BSA, 100 copiesiacSalm and 0.75U Platinum Taq DNA polymerase(Invitrogen) using the following programme: 2min at94�C and 40 cycles of 30 s at 94�C, 30 s at 63�C, 1min at74�C and a final extension of 5min at 74�C. Theamplifications were carried out using the GeneAmp2700 Thermocycler (Applied Biosystems). PCR pro-ducts were electrophoresed (120V, 40min) in a 2%agarose gel stained with 0.1 mg/ml ethidium bromide.

2.5. Internal amplification controls (IACs)

The chimerical DNA consisted of a fragment of thecoding region of Brassica napus ACCg8 gene (accessionnumber X77576) flanked by the sequence of theSalmonella or L. monocytogenes-specific primers. Theywere designed in a two-step PCR. In the first PCR

Table 1

Target genes, sequences of PCR primers and product size

Target Primer Sense Sequence (50-30)

prfA Lip1 Forward gatacagaaacatcggttggc

Lip2 Reverse gtgtaacttgatgccatcagg

Lip3 Reverse tgaccgcaaatagagccaag

invA 139 Forward gtgaaattatcgccacgttcgg

141 Reverse tcatcgcaccgtcaaaggaacc

iac iacLip1 Forward acagaaacatcggttggcatct

iac iacLip2 Reverse taacttgatgccatcaggcctct

iac iac139 Forward atcgccacgttcgggcaatcta

iac iac141 Reverse tcgcaccgtcaaaggaacctct

Underlined text is homologous to B. napus ACCg8 gene.

reaction, 50 ng of B. napus DNA was amplified bychimerical oligonucleotides containing Salmonella spp.or L. monocytogenes primer sequences at the 30 end:iacLip1 (50 acagaaacatcggttggcatctattaacactgctgc 30) andiacLip2 (50 taacttgatgccatcaggcctctcagcttatcctg 30) forL. monocytogenes IAC, and iac139 (50 atcgccacgttcgggcaatctattaacactgctgc 30) and iac141 (50 tcgcaccgtcaaaggaacctctcagcttatcctg 30) for Salmonella IAC. Underlinedregions are homologous to the ACCg8 gene and theflanking sequences correspond to the specific primers.Reactions were amplified through the following pro-gramme: 2min at 94�C and 40 cycles of 40 s at 94�C,40 s at 55�C and 1min at 74�C, and a final terminalextension at 72�C for 5min. Subsequently, the ampli-cons were 10,000 fold diluted in double-distilled waterand used as a template in the second PCR reaction usingthe corresponding primers (139–141 or Lip1–Lip2) andPCR conditions described in Section 2.4. The resultingIACs were purified (QIAquick PCR purification kit,Qiagen) and quantified by optical density at 260 nmusing GeneQuant II (Pharmacia Biotech). Hundredcopies were used in the PCR reactions.

3. Results and discussion

3.1. Internal amplification controls (IACs)

Two chimerical DNA sequences (IAC-Lmono andIAC-Salm) were designed to be used as IACs for thedetection of Salmonella spp. or L. monocytogenes,respectively (Table 1). Both IACs were based on thecoding region of B. napus ACCg8 gene and containedthe target sequences for the invA- or prfA-specificprimers at both ends. The identical primer-binding sitesallowed co-amplification of the prfA or invA genefragment and the corresponding IAC. The differencein the amplicon size between the Salmonella invA or L.

monocytogenes prfA specific amplimers (285 and 215 bp,

Size (bp) Reference

274 (Lip1–Lip2) Simon et al. (1996)

215 (Lip1–Lip3) Simon et al. (1996)

This study

gcaa 284 Rahn et al. (1992)

Rahn et al. (1992)

attaacactgctgc 406 This study

cagcttatcctg This study

ttaacactgctgc 404 This study

cagcttatcctg This study

ARTICLE IN PRESSA. Jofre et al. / Food Microbiology 22 (2005) 109–115112

respectively) and the corresponding IAC (120 and132 bp, respectively) allowed easy discrimination in a2% agarose gel. Undoubtedly, the use of an IACfacilitates the interpretation of reactions that shownegative PCR results, since a control signal will alwaysbe produced when there is no target sequence present,and can thus reveal the failure of a PCR reaction.This is of special importance in PCR-based diagnosticmethods performed with complex samples, such as meatproducts.On the other hand, the initial number of IAC copies

in the PCR assay is a critical aspect (Malorny et al.,2003a), since small amounts of initial IAC lead tosubstantial variations in IAC amplification and highamounts could negatively affect the PCR sensitivity.Thus, the initial IAC copy number in the PCR must bereproducibly detected, but should be kept as low aspossible to avoid inhibition of the target specificreaction. In order to determine the optimal amount ofinitial copies of IAC, tenfold dilution series of thepurified IAC fragment were made and m-PCR wasassayed with the corresponding target DNA in theconditions described in the Materials and methodssection. Hundred IAC molecules for PCR reactioncould be used in the PCR without significantly affectingthe amplification of the target DNA. The competitiveeffect on the invA or prfA genes was small and onlydetectable when the number of genomic DNA moleculesper reaction was low (10 molecules) (Fig. 1). This initialnumber of IAC molecules is in accordance with therange (50–500 copies) recommended by Ballagi–Pord-!any and Bel!ak (1996). Furthermore, the number ofcopies is similar to some previously described PCRsystems, e.g. 100 (Rodr!ıguez-L!azaro et al., submitted),300 (Malorny et al., 2003a) or 1000 (Lambertz et al.,1998).

Fig. 1. Amplification of the target gene of (a) L. monocytogenes or (b)

Salmonella spp. with or without the corresponding IAC. Lanes 1–5

correspond to the amplification of 1� 105 to 1� 101 genomic DNAcopies without IAC. Lanes 6–10 correspond to 1� 105 to 1� 101

genomic DNA copies of L. monocytogenes (a) or Salmonella spp. (b)

together with 100 copies of IAC-Lmono DNA or IAC-Salm DNA,

respectively. N, negative control.

3.2. Specificity of the Lip1–Lip3 primers

The similarity between the size of the Salmonella invA

amplicon (284 bp) and L. monocytogenes prfA amplicon(274 bp) is not suitable for developing a m-PCR assay.Accordingly, prfA amplicon was shortened by designinga new reverse primer (Lip3) that generates an amplifica-tion product of 215 bp (Table 1), easily distinguishablefrom 139–141 amplicons in a 2% agarose gel. To checkthe specificity of Lip3, a set of PCRs was performedusing chromosomal DNA extracted from species phy-logenetically related with Listeria and several speciescommonly found in meat (Table 2). With the assayedconditions, Lip1–Lip3 primer pair was specific forL. monocytogenes as no cross-reaction with otherbacterial species could be detected (data not shown).Lip1–Lip2 primer pair also showed 100% inclusivityand 100% exclusivity (D’agostino et al., submitted). Inaddition, the sensitivity of both Lip1–Lip3 and Lip1–Lip2 systems was similar, i.e. down to 10 genomic DNAcopies per reaction (data not shown).

3.3. M-PCR optimization

Optimization of the m-PCR may require the adjust-ment of the relative ratio of the sets of primers due topreferential amplification of certain targets over another(Elnifro et al., 2000). Here, equal intensities of the PCRproducts were achieved using 300 nm of Lip1 and Lip3and 100 nm of 139 and 141. As shown in Fig. 2, usingthis 3:1 primer ratio, known and equal amounts of cellsor purified DNA from L. monocytogenes CTC1010 andS. London CTC1003 were equally detected in thepresence of 100 initial copies of iacSalm DNA. Thesensitivity of the developed m-PCR assay was deter-mined using a tenfold dilution series of genomic DNAfrom the above-mentioned strains corresponding toapproximately 1� 105, 1� 104, 1� 103, 1� 102, 1� 101

genomic DNA molecules (Fig. 2a). The PCR sensitivityof both L. monocytogenes CTC1010 and S. LondonCTC1003 target genes was down to 1� 101 molecules.In addition, the sensitivity of the m-PCR-based assaywas the same when cells instead of purified DNA wereused as a template (Fig. 2b). When unequal amounts ofcells of both pathogens were amplified, the systemallowed its detection even when a difference of 3 logunits is considered (i.e. 1� 109 and 1� 106 cfu/ml) (Fig2c). Taking into account that a 48 h enrichment culturereaches counts of 106–109 cfu/ml, this assay can be usedfor the simultaneous detection of both equal andunequal amounts of Salmonella and L.monocytogenes.As the primer sets used were specific for a wide range ofserotypes and species of the genera Salmonella (Malornyet al., 2003a) and serotypes belonging to divisions I,II and III of L. monocytogenes (Nadon et al., 2001)

ARTICLE IN PRESS

Table 2

Bacterial strains and Listeria spp. serotypes used for specificity analysis of Lip1–Lip3 PCR assay

Bacterial strains Serotype Lip1–Lip3 PCR Bacterial strains Lip1–Lip3 PCR

Listeria monocytogenes CTC1010 1/2c + Salmonella London CTC1003 �L. monocytogenes CTC1011 1/2c + S. Schwarzengrund CTC1015 �L. monocytogenes CTC1034 4b + S. Derby CTC1022 �L. monocytogenes CECT911 1/2c + Lactobacillus curvatus CTC243 �L. monocytogenes CECT932 1/2a + L. plantarum CTC300 �L. monocytogenes CECT933 3a + L. sakei CTC232 �L. monocytogenes CECT934 4a + S. carnosus LTH2102 �L. monocytogenes CECT935 4b + S. aureus CTC1502 �L. monocytogenes CECT936 1/2b + S. xylosus CTC3050 �L. monocytogenes CECT938 3c + Enterococcus faecium CTC496 �L. monocytogenes CECT4031 1/2a + E. faecalis CETC 481 �L. seeligeri CECT917 1/2b + Pediococcus acidilactici CTC771 �L. grayi CECT931 � � Bacillus pumilus CTC1541 �L. innocua CTC1014 � �L. innocua CECT910 6a �L. innocua CECT4030 � �L. welshimeri CECT919 6a �L. welshimeri CTC1013 � �L. ivanovii ssp. ivanovii CETC913 5 �

CTC: Meat Technology Center. Institute for Food Research and Technology (IRTA), 17121 Monells. Spain; CECT: Spanish Type Culture

Collection, University of Valencia, Valencia, Spain. LTH: Institut f .ur Lebensmitteltechnologie, Universit.at Hohenheim, Stuttgart, Germany.

Fig. 2. m-PCR detection of equal amounts of S. London and L.

monocytogenes genomic DNA molecules (a) and cells (b), and unequal

amounts of cells (c). Lanes 1–5 correspond to the amplification of a

mixture of 1� 105, 1� 104, 1� 103, 1� 102 and 1� 101 copies of eachgenome per reaction (a) or cells of each species per reaction (b),

respectively. Lanes 6–8 correspond to the amplification of 1� 106 cellsof L. monocytogenes together with 1� 105, 1� 104, 1� 103 cells of S.

London per reaction, respectively. Lanes 9–11 correspond to the

amplification of 1� 106 cells of S. London together with 1� 105,1� 104, 1� 103 cells of L. monocytogenes per reaction, respectively. N,

negative control. Note that 1� 106 cfu per reaction corresponds to a1� 109 cfu/ml sample.

A. Jofre et al. / Food Microbiology 22 (2005) 109–115 113

(Table 2), this assay could be used to detect the differentisolates that might be present in food samples.

3.4. M-PCR detection in meat samples

Basic differences in Salmonella and L. monocytogenes

make their simultaneous enrichment unreliable, especially

when the latter is in the minority. Enrichment of bothpathogens in a rich medium (TSBYE or BPW) leads to apredominance of Salmonella irrespective of the initialinoculum. In overnight cultures inoculated with differentamounts of a mixture of Salmonella (S. LondonCTC1003, S. Schwarzengrund CTC1015 and S. DerbyCTC1022) and L. monocytogenes (CTC1010, CTC1011and CTC1034) in proportions 1:1, 1:10, 1:100, 10:1 or100:1, the growth of Salmonella was in all cases, at least1 log more than L. monocytogenes (data not shown). Thisagrees with the results obtained by Bailey and Cox (1992)with the Universal Pre-enrichment (UP) broth, whichallowed simultaneous pre-enrichment of both Salmonella

and L. monocytogenes, but the growth of L. monocyto-

genes was reduced by up to 3 logs in the presence ofcompeting Salmonella, thus requiring a secondary selec-tive pre-enrichment. So, in order to assure a full recoveryof both L. monocytogenes and Salmonella spp. in the m-PCR, each cooked ham sample was separately enrichedin BPW and HF (to allow the recovery of Salmonella spp.and L. monocytogenes, respectively). Despite the separateenrichment, the method was convenient, as only a DNApurification and a single m-PCR reaction per sample wasneeded. As shown in Fig. 3, cooked ham was spiked withequal amounts of L. monocytogenes and Salmonella:1 cfu/25 g, 1� 101 cfu/g and 1� 102 cfu/g. Enrichment ofthe samples only in BPW produced a poor detection ofL. monocytogenes due to the major growth of Salmonella

in this broth (lanes 1–3, Fig. 3). In contrast, separateenrichment of the two bacteria in BPW and HF and itssubsequent mixture, prior to DNA extraction, renderedsimilar amounts of amplification products (lanes 4–6,

ARTICLE IN PRESS

Fig. 3. m-PCR detection of S. London and L. monocytogenes with

IAC in artificially contaminated cooked ham and direct colony

confirmation. Lanes 1–3: 48 h enriched BPW from cooked ham

contaminated with 1 cfu/25 g (1), 10 cfu/g (2) and 100 cfu/g (3) of both

S. London and L. monocytogenes. Lanes 4–6, 1:1 mixture of 48 h

enriched BPW and HF from cooked ham contaminated with 1 cfu/25 g

(1), 10 cfu/g (2) and 100 cfu/g (3) of both S. London and L.

monocytogenes. Lane 7 corresponds to a simultaneous confirmation of

L. monocytogenes and S. London isolates picked from an agar plate;

MW, 100 bp DNA ladder; N, negative control.

A. Jofre et al. / Food Microbiology 22 (2005) 109–115114

Fig. 3). Accordingly, the separate enrichment was moreadequate for the simultaneous detection of L. mono-

cytogenes and Salmonella in cooked ham. Furthermore,as the enrichments are independent from the subsequentsteps, other media can be used in combination with thism-PCR detection. One additional potential applicationfor this m-PCR-based method is the simultaneousconfirmation of Salmonella spp. and L. monocytogenes

directly from agar grown colonies (lane 7, Fig. 3). Thus,this developed assay could be a promising alternative tobiochemical confirmation.To sum up, we have developed a rapid, simple and

convenient m-PCR-based assay for the specific andsimultaneous detection of L. monocytogenes and Salmo-

nella spp. in cooked meat products. This methodrendered final results in 48 h, saving considerable timeand effort in comparison with biochemical methods thatrequire up to 7–10 days. In addition, the m-PCR assaycan be used to identify colonies from agar plates, being asimple and ready-to-go method requiring no previousnucleic acid isolation, which could be used as a rapidalternative to biochemical confirmation.

Acknowledgements

This work was supported by the Spanish Inter-Ministerial Commission of Science and Technology(CICYT AGL2002-03496).

References

Abdulmawjood, A., Roth, S., B .ulte, M., 2002. Two methods for

construction of internal amplification controls for the detection of

E. coli O157 by polymerase chain reaction. Mol. Cell. Probes 16,

335–339.

Al-Soud, W.A., Radstrom, P., 2000. Effects of amplification facil-

itators on diagnostic PCR in the presence of blood, feces, and meat.

J. Clin. Microbiol. 38, 4463–4470.

Al-Soud, W.A., Radstrom, P., 2001. Purification and characterization

of PCR-inhibitory components in blood cells. J. Clin. Microbiol.

39, 485–493.

Anonymous, 1998. Microbiology of food and animal feeding stuffs—

horizontal method for the detection and enumeration of Listeria

monocytogenes—Part 2: Enumeration method. ISO 11290-2, 1998.

International Organization for Standardization (ISO).

Anonymous, 2001. Report on trends and sources of zoonotic agents in

the European Union and Norway. European Food Safety

Authority (EFSA).

Anonymous, 2002. Microbiology of food and animal feeding stuffs—

horizontal method for the detection of Salmonella spp. ISO

6579:2002. International Organization for Standardization (ISO).

Ballagi-Pord!any, A., Bel!ak, S., 1996. The use of mimics as internal

standards to avoid false negatives in diagnostic PCR. Mol. Cell.

Probes 10, 159–164.

Bailey, J.S., Cox, N.A., 1992. Universal preenrichment broth for the

simultaneous detection of Salmonella and Listeria in Foods.

J. Food Protect. 55, 256–259.

Brightwell, G., Pearce, M., Leslie, D., 1998. Development of internal

controls for PCR detection of Bacillus anthracis. Mol. Cell. Probes

12, 367–377.

Bubert, A., Kohler, S., Goebel, W., 1992. The homologous and

heterologous regions within the iap gene allow genus- and species-

specific identification of Listeria spp. by polymerase chain reaction.

Appl. Environ. Microbiol. 58, 2625–2632.

D’agostino, M., Wagner, M., Vazquez-Boland, J.A., Hoorfar, J.,

Karpiskova, R., Novella, S., Ellison, J., Murray, A., Scortti, M.,

Nigel, C., 1998. A validated PCR assay for detection of Listeria

monocytogenes: towards an international standard. J. Food

Protect., submitted for publication.

Elnifro, E.M., Ashshi, A.M, Cooper, R.J., Klapper, P.E., 2000.

Multiple PCR: optimization and application in diagnostic virology.

Clin. Microbiol. Rev. 13, 559–570.

Gal!an, J.E., Ginocchio, C., Costeas, P., 1992. Molecular and

functional characterization of the Salmonella invasion gene invA:

homology of InvA to members of a new protein family. J. Bacteriol.

174, 4338–4349.

Garcia del Portillo, J.A., 2000. Molecular and cellular biology of

Salmonella pathogenesis. In: Cary, J.W., Linz, J.E., Bhatnagar, D.

(Eds.), Microbial Foodborne Diseases. Mechanisms of Pathogen-

esis and Toxin Synthesis. Technomic Publishing Company, Lan-

caster, PA, pp. 3–86.

Hoorfar, J., Cook, N., 2003a. Critical aspects in standardization of

PCR. In: Sachse, K., Frey, J. (Eds.), Methods in Molecular

Biology: PCR Detection of Microbial Pathogens. Humana Press,

Totowa, pp. 51–64.

Hoorfar, J., Cook, N., Malorny, B., Wagner, M., De Medici, D.,

Abdulmawjood, A., Fach, P., 2003b. Making internal amplification

control mandatory for diagnostic PCR. J. Clin. Microbiol. 41,

5835.

Houf, K., Tutenel, A., De Zutter, L., Van Hoof, J., Vandamme, P.,

2000. Development of a multiplex PCR assay for the simultaneous

detection and identification of Arcobacter butzleri, Arcobacter

cryaerophilus and Arcobacter skirrowii. FEMS Microbiol. Lett.

193, 89–94.

Lambertz, S.T., Ballagi-Pord!any, A., Lindqvist, R., 1998. A mimic as

internal standard to monitor PCR analysis of foodborne patho-

gens. Lett. Appl. Microbiol. 26, 9–11.

Lantz, P.G., Al-Soud W, .A., Knutsson, R., Hahn-Hagerdal, B.,

Radstrom, P., 2000. Biotechnical use of polymerase chain reaction

ARTICLE IN PRESSA. Jofre et al. / Food Microbiology 22 (2005) 109–115 115

for microbiological analysis of biological samples. Biotechnol.

Annu. Rev. 5, 87–130.

Leimeister-W.achter, M., Haffner, C., Domann, E., Goebel, W.,

Chakraborty, T., 1990. Identification of a gene that positively

regulates expression of listeriolysin, the major virulence factor of

Listeria monocytogenes. Proc. Natl. Acad. Sci. USA 87, 8336–8340.

Malorny, B., Hoorfar, J., Bunge, C., Helmuth, R., 2003a. Multicenter

validation of the analytical accuracy of Salmonella PCR: towards

an international standard. Appl. Environ. Microbiol. 69, 290–296.

Malorny, B., Tassios, P.T., Radstorm, P., Cook, N., Wagner, M.,

Hoorfar, J., 2003b. Standardization of diagnostic PCR for

the detection of foodborne pathogens. Int. J. Food Microbiol.

83, 39–48.

Mead, P.S., Slutsker, L., Dietz, V., McCraig, L.F., Bresee, S., Shapiro,

C., Griffin, P.M., Tauxe, R.V., 1999. Food-related illness and

death in the United States. Emerg. Infect. Dis. 5, 607–625.

Nadon, C.A., Woodward, D.L., Young, C., Rodgers, F.G.,

Wiedmann, M., 2001. Correlations between molecular subtyping

and serotyping of Listeria monocytogenes. J. Clin. Microbiol. 39,

2704–2707.

Norton, D.M., 2002. Polymerase chain reaction-based methods for

detection of Listeria monocytogenes: toward real-time screening for

food and environmental samples. J. AOAC Int. 85, 505–515.

Rahn, K., De Grandis, S.A., Clarke, R.C., McEwen, S.A., Galan, J.E.,

Ginocchio, C., Curtiss III, R., Gyles, C.L., 1992. Amplification of

an invA gene sequence of Salmonella typhimurium by polymerase

chain reaction as a specific method of detection of Salmonella. Mol.

Cell. Probes 6, 271–279.

Rijpens, N.P., Herman, L.M., 2002. Molecular methods for identifica-

tion and detection of bacterial food pathogens. J. AOAC Int. 85,

984–995.

Roberts, T.A., Baird-Parker, A.C., Tompkin, R.B., 1996. Listeria

monocytogenes, In: ICMSF Microorganisms in Foods 5. Char-

acteristics of Microbial Pathogens. Blackie Academic & Profes-

sional, London, pp. 141–182.

Rodr!ıguez-L!azaro, D., Scortti, M., V!azquez-Boland, J.A., Pla, M.,

1998. Assessment of quantitative detection of Listeria monocyto-

genes by real-time PCR: development and application of an

internal amplification control. J. Microbiol. Methods, submitted

for publication.

Rossen, L., Nøskov, P., Holmstrøm, K., Rasmussen, O.F., 1992.

Inhibition of PCR by components of food samples, microbial

diagnostic assays and DNA-extraction solution. Int. J. Food

Microbiol. 17, 37–45.

Sachadyn, P., Kur, J., 1998. The construction and use of a PCR

internal amplification control. Mol. Cell. Probes 12, 259–262.

Simon, C.M., Gray, D.I., Cook, N., 1996. DNA extraction and PCR

methods for the detection of Listeria monocytogenes in cold-

smoked salmon. Appl. Environ. Microbiol. 62, 822–824.

Soumet, C., Ermel, G., Rose, V., Rose, N., Drouin, P., Salvat, G.,

Colin, P., 1999. Identification by a multiplex PCR-based assay of

Salmonella typhimurium and Salmonella enteritidis strains from

environmental swabs of poultry houses. Lett. Appl. Microbiol. 29,

1–6.

Stone, G.G., Oberst, R.D., Hays, M.P., McVey, S., Chengappa, M.M.,

1994. Detection of Salmonella serovars from clinical samples by

enrichment broth cultivation-PCR procedure. J. Clin. Microbiol.

32, 1742–1749.

Vantarakis, A., Komninou, G., Venieri, D., Papapetropoulou, M.,

2000. Development of a multiplex PCR detection of Salmonella

spp. and Shigella spp. in mussels. Lett. Appl. Microbiol. 31,

105–109.

V!azquez-Boland, J.A., Kuhn, M., Berche, P., Chakraborty, T.,

Dom!ınguez-Bernal, G., Goebel, W., Gonz!alez-Zorn, B., Wehland,

J., Kreft, J., 2001. Listeria pathogenesis and molecular virulence

determinants. Clin. Microbiol. Rev. 14, 584–640.

Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price,

L., Woodward, D.L., Rodgers, F.G., 2002. Colony multiplex PCR

assay for identification and differentiation of Campylobacter

jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus.

J. Clin. Microbiol. 40, 4744–4747.

Wernars, K., Heuvelman, K., Notermans, S., Domann, E., Leimeister-

Wachter, M., Chakraborty, T., 1992. Suitability of the prfA gene,

which encodes a regulator of virulence genes in Listeria

monocytogenes, in the identification of pathogenic Listeria spp.

Appl. Environ. Microbiol. 58, 765–768.