Sensitivity of Helicoverpa armigera nucleopolyhedroviruspolyhedra to sodium dodecyl sulfate

Linda H.L. Lua,* Lars K. Nielsen, and Steven Reid

Department of Chemical Engineering, The University of Queensland, Brisbane, Qld. 4072, Australia

Received 5 February 2002; accepted 10 July 2002

Abstract

Sodium dodecyl sulfate (SDS) is commonly used to extract polyhedra from infected cells and diseased dead larval tissues. It was

found, however, that 80% of Helicoverpa armigera nucleopolyhedrovirus (HaSNPV) polyhedra produced via cell culture were

damaged after 30min of 0.5% SDS treatment whereas only 20% of in vivo produced polyhedra were damaged by the same

treatment. Transmission and scanning electron microscopy revealed that the damaged polyhedra had lost their polyhedron enve-

lopes and virions were dislodged from the polyhedrin matrix, leaving empty spaces that were previously occupied by the occluded

virions. Up to 20% in vitro produced polyhedra were resistant to SDS and remained intact, even after a 24 h exposure to SDS. This

sensitivity to SDS was observed across a range of cell culture media, including serum supplemented media. Electron microscopy also

revealed that the inferior polyhedron envelope of in vitro produced polyhedra is likely due to poor interaction between the poly-

hedron envelope, polyhedron envelope protein (PEP), and polyhedrin matrix. The PEP gene was cloned and sequenced and mu-

tations in this gene were ruled out as an explanation. In vitro produced polyhedra that were passed through insect larva once were

resistant to SDS, indicating that a critical component is lacking in insect cell culture medium used for producing HaSNPV or the

cells growing in culture are inefficient in some ways in relation to production of polyhedra.

� 2002 Elsevier Science (USA). All rights reserved.

Keywords: Helicoverpa armigera nucleopolyhedrovirus; Baculovirus; Biopesticide; Polyhedron envelope; Polyhedron envelope protein

1. Introduction

The success of a baculovirus biopesticide is highly

dependent on its reliable potency against its target pest.

The potency of polyhedra is determined by the effec-

tiveness of initiating an infection within the insect and

producing virus progeny, eventually leading to the death

of the insect. Every polyhedron is surrounded by anelectron-dense layer, known as the polyhedron envelope

(PE) (Harrap, 1972) or the calyx (Whitt and Manning,

1988). The PE is vital to the biological activity of a

polyhedron, as it ensures the retention of virions within

the polyhedron complex (Gross et al., 1994). The PE

structure must be physically robust and stable to with-

stand downstream processing, formulation, and field

spraying.

PE was first believed to be an electron microscopy ar-

tifact, resulting from a denaturing action of alkali on the

outermost layer of polyhedrin protein or from the accu-

mulation of osmium tetraoxide on the surface of poly-

hedra during fixation (Bergold, 1963). Further studies on

the ultrastructure and composition of the PE revealed

that the envelope is a true viral structure, with 15 nmholes

or hollows evenly distributed across the structure (Har-rap, 1972), and composed primarily of carbohydrates

(pentoses and hexoses), with lesser amounts of uronic

acid and hexosamine (Minion et al., 1979). The PE in-

tegrity is sensitive to protease activity (Russell and Ro-

hrmann, 1990) but not non-polar solvents (Minion et al.,

1979) suggesting that protein but not lipid is an integral

part of the PE in addition to carbohydrate.

A protein component of the PE of Autographa cali-

fornica multi-nucleocapsid nucleopolyhedrovirus (Ac-

MNPV) has been identified (Whitt and Manning, 1988)

and the gene (pp34 or PEP) encoding this protein

(polyhedron envelope protein, PEP) has been sequenced

Biological Control 26 (2003) 57–67

www.elsevier.com/locate/ybcon

*Corresponding author. Fax: +61-7-3365-4199.

E-mail address: lindal@cheque.uq.edu.au (L.H.L. Lua).

1049-9644/02/$ - see front matter � 2002 Elsevier Science (USA). All rights reserved.

PII: S1049-9644 (02 )00116-0

(Gombart et al., 1989). The 34 kDa PEP phosphopro-tein of AcMNPV is covalently linked to the PE by thiol

bonds (Whitt and Manning, 1988), as indicated by its

resistance to solubilization from the PE by sodium

dodecyl sulfate (SDS) treatment but readily released

after exposure to a reducing agent. A subpopulation of

polyhedrin protein is also connected to the PEP via thiol

linkages, which may anchor the PE structure to the

surface of the polyhedron. The interaction between PEPand polyhedrin protein may have an important role in

PE formation and attachment to the polyhedron com-

plex. The association of PEP with the PE could occur

via thiol–glycosidic linkages at cysteine residues, since

the PE is composed primarily of carbohydrate. Very late

in infection, the concentration of the PEP at the surface

of polyhedra may either form the envelope or provide

the substrate for the assembly of other envelope com-ponents such as carbohydrates (Russell and Rohrmann,

1990). The specific interaction between the PE, PEP, and

polyhedrin protein has not yet been determined.

Polyhedra in infected cells must be extracted for

analysis such as bioassay, electron microscopy and for

biochemistry studies on the polyhedra. Detergents such

as SDS, sodium deoxycholate, and Triton X are com-

monly used to extract polyhedra from insect tissues(King and Possee, 1992; Minion et al., 1979) and cell

culture samples (Gross et al., 1994; Williams et al.,

1989), and have not been reported to damage the

polyhedra during extraction. SDS was chosen for ex-

traction of Helicoverpa armigera single-nucleocapsid

nucleopolyhedrovirus (HaSNPV) polyhedra. Compared

to other detergents, SDS is more efficient in dissolving

cellular debris within a short incubation time, providingclean polyhedra samples. Initial electron microscopy

observations indicated damage of HaSNPV polyhedra

after SDS extraction. Thus, this paper investigates the

integrity of PE after extraction, either with sonication or

SDS, comparing polyhedra produced in vitro or in vivo.

Both transmission and scanning electron microscopy

were employed to observe the PE structure.

2. Materials and methods

2.1. Cell line and virus strain

The Helicoverpa zea cell line was isolated from pupal

ovarian tissue, strain BCIRL-HZ-AM1 (McIntosh and

Ignoffo, 1981), and was obtained from CSIRO (Divisionof Entomology, Canberra, Australia). The uncloned cell

line was gradually adapted to SF900II serum-free me-

dium (Life Technologies, Rockville, MD) in suspension

culture. Cultures are typically grown in 250-ml Erlen-

meyer flasks on an orbital shaker operated at 120 rpm,

inside an incubator at 28 �C. HaSNPV (uncloned) pas-

sage 1 stock was established in cells grown in SF900II

supplemented with 10% fetal bovine serum (FBS), withhemolymph collected from infected larvae, which were

obtained from the Queensland Department of Primary

Industries (QDPI, Brisbane, Australia) (Lua and Reid,

2000).

2.2. In vitro polyhedra

In cell culture, polyhedra were produced in three dif-ferent media; SF900II, SF900II supplemented with 10%

FBS, and LCM 1 (an in-house low-cost medium proto-

type). HaSNPV passage 2 virus was used to infectH. zea

cultures to produce passage 3 polyhedra. Fifty-milliliter

cultures were seeded at 3� 105 cells/ml, allowed to grow

to 1� 106 cells/ml, before being diluted back to

5� 105 cells/ml with addition of 50-ml fresh medium.

Cultures were infected at a multiplicity of infection(MOI) of 0.5 plaque forming unit (PFU)/cell. The in-

fected cells were harvested at 10 days post-infection (dpi)

and treated either with 0.5% SDS or sonication.

2.3. In vivo polyhedra

Formulated Gemstar, an in vivo produced H. zea

SNPV (HzSNPV), was obtained from Dr. Robert Tea-kle (QDPI, Australia). Formulation components were

removed by a series of washings with water. Purified

HaSNPV produced in H. armigera larvae were obtained

from Dr. Peter Christian (CSIRO Entomology, Canb-

erra, Australia). The polyhedra were purified from in-

fected larvae according to the methodology described in

King and Possee (1992), which involved the usage of

0.1% SDS.

2.4. SDS extraction and sonication

Polyhedra from in vivo samples and infected cells

from in vitro infection were treated with either 0.5%

SDS or sonication to determine the effect of the two

extraction methods on the polyhedra. Infected cell pel-

lets from in vitro samples and polyhedra from in vivosamples were treated with 0.5% SDS (prepared in water)

for different durations, at 28 �C, with agitation, before

being washed once with water. For sonication, polyhe-

dra or infected cell suspensions were sonicated for 1min

at a constant duty cycle (continuous processing time)

with the output control at 4 for the microtip, using a

Barnson Sonifier 250 (Barnson Ultrasonics, Danbury,

CT). The polyhedra pellets were fixed immediately andprocessed for transmission electron microscopy (TEM)

and scanning electron microscopy (SEM).

2.5. SEM and TEM

For SEM, polyhedra were first mounted onto a poly-

lysine coated coverslip before fixing with 3% glutaral-

58 L.H.L. Lua et al. / Biological Control 26 (2003) 57–67

dehyde in 0.1M cacodylate buffer, pH 6.8, for at least anhour at 4 �C. The coverslip, mounted with sample, was

washed three times with 0.1M cacodylate buffer, pH 6.8,

plus 0.15M sucrose at 4 �C, each for 10min. Sample was

fixed with 1% osmium tetroxide in 0.1M cacodylate

buffer at 4 �C for 1 h, before being washed once with

0.1M cacodylate buffer plus 0.15M sucrose at 4 �C for

10min and once with water at room temperature for

another 10min. The sample was dehydrated through aseries of ethanol rinses, once in 50, 70, and 90%, and

twice in 100%, for 5min at each step. Samples were

dried with 50% hexamethyldisilazane (HMDS, ProSci-

Tech, Queensland, Australia) in ethanol for 10min and

twice in 100% HMDS. Each coverslip was mounted

onto a pin type SEM stub (ProSciTech, Australia) be-

fore being sputter-coated with gold for 120 s, using the

SL502 SEM coating system (Bio-Rad, Hercules, CA).Each gold-coated stub was examined and photographed

under a JEOL 6300 Field Emission SEM. The protocol

for TEM is described in Lua and Reid (2000).

2.6. PCR amplification and sequencing of PEP gene

This work was conducted before the HaSNPV ge-

nome was published (Chen et al., 2001). DNA was pu-rified from budded virus (BV) and polyhedra using the

QIAamp DNA Blood Mini Kit (QIAGEN, Valenica,

CA) according to the protocol provided by the manu-

facturer. Oligonucleotides used to amplify the PEP gene

of HaSNPV were designed from the known sequence of

HzSNPV (GenBank Accession No. AF275264), a clo-

sely related nucleopolyhedrovirus. Oligonucleotides 50

ACAATTGTGTCAACGTTTCG 30 and 50 CCTCACGTACGGATTGTGAA 30 were used as upstream and

downstream primers, respectively, to amplify the PEP

gene in a PCR. Two other oligonucleotides, 50 AGAT

GTCGTCTCAACGAC 30 and 50 GTCAATGTCACT

GTGGTC 30, were designed from the preliminary se-

quence data, specifically just upstream and downstream

of the DNA repeats (found within the PEP gene), for

sequencing. Thirty amplification cycles consisting of 30 sdenaturation at 94 �C, annealing for 30 s at 60 �C and

extension for 2min, were employed. Sequencing was

performed directly from the amplicons using the PRISM

(Applied Biosystems, Foster City, CA) terminator

chemistry method according to manufacturer�s instruc-

tions. Reaction conditions (including amplification cy-

cle) and the removal of unincorporated reaction

components were performed according to manufac-turer�s recommendations. Sequence analysis was done

with Sequencher (Genecodes, Ann Arbor, MI). The

nucleotide sequences of both DNA strands were deter-

mined from at least two independently amplified tem-

plates. Consensus sequence data were obtained from

multiple determinations of the sequence to avoid errors

arising from Taq polymerase.

2.7. Statistical analysis of data

The percentage of damaged polyhedra was deter-

mined for each of the production and treatment condi-

tions tested by assessing m treated polyhedra under

TEM and scoring each polyhedron as either damaged or

undamaged. The number of damaged polyhedra for

each production/treatment condition, Yi, is assumed to

follow the binomial distribution, Yi �B(mi; pi). The lo-git of the underlying probability is assumed to be a

linear combination of the predictors

logitðpiÞ ¼ logpi

1� pi

� �¼ x0

ib ð1Þ

where x0i is a vector of covariates and b is the vector of

regression coefficients.

Choosing covariates and appropriate parameteriza-

tion, various data models were formulated as general-

ized linear models with a logit link and binomial errors

(logistic regression). The models were fitted using the

glm function in the free statistical software package R

(http://www.r-project.org/). Goodness of fit statistics

was based on the deviance statistics

D ¼ 2Xi

yi logyinip̂pi

þ ðni � yiÞ logni � yi

nið1� p̂piÞð2Þ

which is approximately v2 with (number of conditions

studied—number of parameters estimated) degrees of

freedom for large number of observations per group

(satisfied for all conditions tested here). Hypotheses

were tested using differences in deviances for nestedmodels, which corresponds to a likelihood ratio test.

3. Results and discussion

3.1. SDS damages in vitro produced polyhedra

SDS is commonly used to extract polyhedra from cellsor tissue. In this study, 0.5% SDS (Weiss et al., 1981)

instead of 0.1% SDS (King and Possee, 1992) was used to

extract polyhedra as the final purified polyhedra ex-

tracted with 0.5% SDS contained no cellular debris,

which is a requirement for most analytical techniques. It

also enables a more accurate enumeration of the poly-

hedra, as clumping is less likely. The effect of sonication

or SDS extraction on polyhedra produced via cell cultureor larva was investigated using both SEM and TEM.

A detailed SEM and TEM examination on 0.5% SDS

extracted polyhedra from cell culture materials revealed

that a majority of the polyhedra were badly damaged.

Damaged in vitro produced polyhedra displayed rough

and pitted surfaces (Figs. 1A and B) compared to the

smooth surfaces of undamaged in vivo produced poly-

hedra (Figs. 1C and D). Pits and empty spaces,presumably previously occupied by occluded virions

L.H.L. Lua et al. / Biological Control 26 (2003) 57–67 59

Fig. 1. SEM images of SDS-treated polyhedra. (A) and (B) HaSNPV polyhedra produced in SF900II medium extracted with 0.5% SDS. A majority

of the polyhedra were damaged. Empty spaces left by dislodged virions were clearly seen. (C) and (D) In vivo produced HaSNPV-treated with 0.5%

SDS. Most polyhedra have smooth surfaces. A few damaged polyhedra were observed (arrows).

60 L.H.L. Lua et al. / Biological Control 26 (2003) 57–67

(ODV), were observed on the surfaces of the damagedpolyhedra. TEM revealed similar results, with a major-

ity of in vivo produced polyhedra remaining intact after

SDS treatment (Figs. 2A and B), while in vitro produced

polyhedra were greatly affected (Fig. 2C). The PE was

either stripped or destroyed in the case of damaged

polyhedra. As a result of losing their PE, these damaged

polyhedra had lost their occluded virions, leaving empty

spaces that clearly had previously been occupied by theODV. Sonication of in vitro produced polyhedra also

caused some damage to the polyhedra but this was less

dramatic than that seen with SDS (Fig. 2D). Most of the

polyhedra were slightly damaged, losing their peripheral

ODV. Sonicated samples contained more cellular debris

and, thus, sonication cannot be recommended as an

alternative to extraction, where clean samples are re-

quired for analysis.The small fraction of cell culture polyhedra that were

resistant to SDS appeared to have a loose fitting PE, re-

vealing a space between the polyhedron complex and the

PE (Fig. 2E), a phenomenon that is normally not ob-

served with polyhedra before extraction (Fig. 2F). This

suggests that SDS weakens the interaction between the

polyhedrin matrix and the PE. �Stripped PE� separatedfrom damaged polyhedra were often observed and ap-peared to be intact, even after 24 h of exposure to SDS

(Fig. 2G). Similar residual bag-like structures were re-

ported by Harrap (1972) when extracting virions from

polyhedra by alkali dissolution. Both SEM and TEM

indicate that while PE is formed correctly in vitro, it is not

properly anchored to the polyhedra. This is supported

further by the fact that untreated in vitro produced

polyhedra that were released upon cell lysis were intactand had smooth surfaces when examined under SEM

(not shown). The main function of the PE is believed to

be as a protection coat to stabilize the polyhedron in the

environment (Whitt and Manning, 1988). Our observa-

tions confirm this function, indicating that PE is required

for the retention of virions within the polyhedron.

3.2. HaSNPV PEP gene nucleotide sequence

PEP has been implicated in anchoring the PE to the

polyhedron complex via thiol linkages (Whitt and

Manning, 1988). Mutant Orgyia pseudotsugata MNPV

(OpMNPV) polyhedra produced from virus lacking the

PEP gene have rough and pitted surfaces (Gross et al.,

1994), similar to the SEM observations made in this

study. Unlike the commonly reported ‘‘few polyhedra’’phenotype (Lua et al., 2002), the poor PE integrity of in

vitro produced polyhedra is observed both in early and

late passage number. Still, it was speculated that the

HaSNPV PEP gene might be mutated in vitro, resulting

in non-functional or truncated PEP, leading to the in-

stability of the PE. Hence, the PEP gene of HaSNPV

was identified and sequenced.

The PEP nucleotide gene sequence of HaSNPV ispresented in Fig. 3A. No nucleotide sequence difference

was detected between the in vivo derived polyhedra,

passage 2BV, and passage 6 BV samples. The PEP gene

of HaSNPV is 1023 bp, encoding 340 amino acids. There

is a 160 bp region within the gene that contains DNA

repeats, as illustrated in a dot matrix alignment of the

repeat region against itself (Fig. 3B). Initially, this region

was suspected to be highly susceptible to DNA mutationdue to the presence of DNA repeats. To ensure that the

DNA sequencing data obtained were of good quality and

representative, specific primers just upstream and

downstream of this DNA repeats region were designed

for sequencing. Consensus sequence data were obtained

from multiple determinations of the sequence to avoid

any errors. The comparison of predicted amino acid se-

quences of the PEP protein of seven nucleopolyhedrovi-ruses; AcMNPV (Ayres et al., 1994), Bombyx mori

MNPV (BmMNPV) (Gomi et al., 1999), Choristoneura

fumiferanaMNPV (CfMNPV) (GenBank Accession No.

AAB51373), HaSNPV, Lymantria dispar MNPV

(LdMNPV) (Bjornson and Rohrmann, 1992), OpMNPV

(Gombart et al., 1989), and Spodoptera exigua MNPV

(SeMNPV) (Ijkel et al., 1999) are illustrated in Fig. 4. The

PEP protein is not highly conserved among the nucleo-polyhedroviruses. Repeats rich in arginine (R) and serine

(S) were found in AcMNPV (16 RS repeats), BmMNPV

(12), and HaSNPV (17), while SeMNPV has four unique

SPRRRS repeats (where P stands for proline).Within the

repeats region, both HaSNPV and SeMNPV have the

same number of repetitive RRRS repeats. The large ar-

ginine- and serine-rich regions for these four nucleo-

polyhedroviruses may have a significant effect on thestructure and function of this protein such as interaction

and formation of bonds within the protein and with the

carbohydrates in the PE. The –OH group of serine

commonly attaches to sugar chains, whereas arginine

side chains can form up to five hydrogen bonds each and

so are able to interact simultaneously with phosphate

groups and other groups in a protein (Metzler, 1977).

Consistent with the absence of mutations, poor PEintegrity of in vitro produced polyhedra could be cor-

rected by a single passage through larvae. In vitro pro-

duced polyhedra were passed through larvae once and

the polyhedra from the diseased larvae were harvested.

Purification of the polyhedra from dead insect materials

required the use of SDS (King and Possee, 1992) and

these purified polyhedra were treated further with 0.5%

SDS for 30min. It was found that only 8% of the SDStreated polyhedra were damaged (131 polyhedra were

scored under TEM).

3.3. Effect of culture medium

The results indicate that the cell culture environment

somehow fails to mimic the assembly environment in

L.H.L. Lua et al. / Biological Control 26 (2003) 57–67 61

Fig. 2. TEM images of SDS-treated polyhedra. (A) In vivo produced polyhedra-treated with 0.5% SDS. Most polyhedra were intact, containing

occlusion derived virion (ODV) and have a polyhedron envelope (PE). (B) It appeared that there were holes (arrow) in the PE of an undamaged in

vivo produced polyhedron. (C)–(G) HaSNPV polyhedra produced in SF900II medium. (C) Polyhedra-treated with 0.5% SDS were damaged, with

empty spaces left by the lost ODV. (D) Polyhedra sonicated appeared less damaged than SDS-treated polyhedra as only peripheral ODVs were lost.

A sonicated sample contains cellular debris (arrows). (E) A space (arrowheads) was observed between the polyhedrin matrix and the PE after SDS

treatment. (F) An untreated free polyhedron showing that the PE closely surrounds the polyhedrin matrix. (G) A PE �stripped� from SDS-treated

polyhedra.

62 L.H.L. Lua et al. / Biological Control 26 (2003) 57–67

insects and that this results in poor anchorage of the PE.

Assembly could fail at a number of points: poor pack-

aging of polyhedrin, low expression and transport ofPEP to the assembly site, improper PE carbohydrate

composition, and inadequate thiol linkage between

polyhedron and PEP and thiol–glycosidic linkage be-

tween PEP and PE. We decided to test three different

media to—if possible—identify the missing component in

the cell culture environment (Table 1).Two control samples were included, in vivo produced

HaSNPV and the closely related, commercially available

in vivo HzSNPV product (Gemstar). Both in vivo

Fig. 3. (A) Nucleotide sequence of a 1534 bp region of HaSNPV genome, containing the polyhedron envelope protein (PEP) gene and the upstream

and downstream regions of the gene. The upstream region of the PEP gene contains the transcription initiation sequence motif ATAAG for ba-

culovirus late genes (underlined). Start and stop codons are indicated as double-underlined. The region containing the DNA repeats is shaded. (B) A

dot matrix display illustrating the DNA repeats region within the PEP gene. The 160bp region within the PEP gene contains DNA repeats which

resulted in a region rich in serine and arginine residues.

L.H.L. Lua et al. / Biological Control 26 (2003) 57–67 63

samples had been subjected to SDS extraction from

larvae prior to this experiment and for HaSNPV the

initial damage was assessed by TEM to be around 8%

(95% CI: 4–14%). In vitro material was generated in

three different media: a commercially available defined

medium (SF900II) with and without serum as well as

Fig. 4. Comparison of predicted amino acid sequences of polyhedron envelop protein (PEP) from various nucleopolyhedroviruses; AcMNPV (Ayres

et al., 1994), BmMNPV (Gomi et al., 1999), CfMNPV (GenBank Accession No. AAB51373), HaSNPV (GenBank Accession No. AF450082),

LdMNPV (Bjornson and Rohrmann, 1992), OpMNPV (Gombart et al., 1989), and SeMNPV (Ijkel et al., 1999). The shaded region of HaSNPV

denotes the region rich in arginine and serine. Similar arginine and serine rich regions in AcMNPV, BmMNPV, and SeMNPV are underlined. The

predicted number of amino acids of the PEP of each nucleopolyhedrovirus is stated at the end of each sequence.

64 L.H.L. Lua et al. / Biological Control 26 (2003) 57–67

our own complex medium (LCM1). Most experiments

were performed with passage 3 virus, but a single ex-

periment was performed with passage 2 virus (HaSNPV

P2). The samples were subjected either to SDS treatment

(30 or 60min) or sonication.

From Table 1, it is obvious that production and

treatment method had an impact on the observed

damage. In vivo produced material was less damagedcompared to in vitro produced polyhedra, while SDS

treatment was more severe than sonication. The PE

from 82 to 88% of in vitro produced polyhedra were

damaged by SDS, whereas only 20–23% of in vivo

produced polyhedra were affected. Sonication caused

damage to 12–14% of in vivo produced polyhedra and

to 33–40% of in vitro produced polyhedra. Logistic re-

gression was used to further analyze the data (see Sec-tion 2).

The saturated model for the data contains six prod-

ucts (indicated by spacing in table) and three treatments

(30min SDS, 60min SDS, and sonication). Inspection of

Table 1 suggests that any model must at least distinguish

between in vivo and in vitro produced material and two

treatments (there appears to be little difference between

30 and 60min SDS treatment). This model greatly re-duced the deviance from 898.47 for the constant-only

model (15 degrees of freedom) to 50.75 on 13 degrees of

freedom (Table 2). The residual deviance, however, re-

mained highly significant (p < 0:0005), suggesting that

additional terms were required.

Distinguishing between 30 and 60min SDS treatment

did not significantly reduce deviance (only 0.15 reduc-

tion on 1 degree of freedom). Similarly, distinguishing

between the two types of in vivo products (Gemstar andHaSNPV) or the four types of in vitro products (three

different media and a passage 2 product) did not sig-

nificantly reduce the deviance. In contrast, the intro-

duction of the interaction term greatly reduced residual

deviance. The residual deviance for the interactive

model, 17.66 on 12 degrees of freedom, is not significant

at test levels less than 12.6% and we accepted the model.

Thus, the conclusions are that: (a) the sensitivity to

Table 2

Deviances obtained from various formulated models

Model Deviance Degree of

freedom

Null (constant only) 898.47 15

Treatment+ production 50.75 13

Treatment2+production 50.60 12

Treatment+ production2 49.86 12

Treatment+ production3 46.35 10

Treatment+ production+

treatment:production

17.66 12

Note. Treatment: SDS, sonication; production: in vivo, in vitro;

treatment2: 30min SDS, 60min SDS, sonication; production2: in vivo

HaSNPV, in vivo GemStar, in vitro; production3: in vivo, in vitro

SF900II, in vitro SF900II+FBS, in vitro LCM1, in vitro LCM1

passage 2 virus; treatment:production represents interactions.

Table 1

Effect of sodium dodecyl sulfate (SDS) treatment (at 30 and 60min) and sonication on polyhedra harvested from different sources

Production method Treatment Damaged Scored % Damaged (CI)a

In vivo HaSNPV Untreated 12 136 8 (4–14)

1 In vivo HaSNPV SDS 30min 27 137 20 (13–27)

2 In vivo HaSNPV SDS 60min 34 149 23 (16–30)

3 In vivo HaSNPV Sonication 18 154 12 (7–18)

4 In vivo Gemstar SDS 30min 40 155 26 (19–33)

5 In vivo Gemstar SDS 60min 28 128 22 (15–30)

6 In vivo Gemstar Sonication 20 140 14 (9–21)

7 In vitro HaSNPV in SF900II SDS 30min 132 161 82 (75–88)

8 In vitro HaSNPV in SF900II SDS 60min 118 141 84 (77–89)

9 In vitro HaSNPV in SF900II Sonication 50 125 40 (31–49)

10 In vitro HaSNPV in SF900II+FBS SDS 30min 120 135 88 (81–93)

11 In vitro HaSNPV in SF900II+FBS SDS 60min 121 137 88 (82–93)

12 In vitro HaSNPV in SF900II+FBS Sonication 49 149 33 (25–41)

13 In vitro HaSNPV in LCM1 SDS 30min 115 135 85 (78–90)

14 In vitro HaSNPV in LCM1 SDS 60min 99 121 82 (74–88)

15 In vitro HaSNPV in LCM1 Sonication 49 128 38 (30–47)

16 In vitro passage 2 HaSNPV in LCM1 SDS 30min 147 194 76 (69–81)

Errors are quoted in 95% confidence intervals.a The confidence interval for % damaged assuming a binomial distribution is given by

xxþ ðm� xþ 1ÞF ð2m� 2xþ 2; 2xÞ1�a=2

;ðxþ 1ÞF ð2xþ 2; 2m� 2xÞ1�a=2

m� xþ ðxþ 1ÞF ð2xþ 2; 2m� 2xÞ1�a=2

" #

where x is the number of damaged and m is the total number of polyhedra scored (Taylor, 1997).

L.H.L. Lua et al. / Biological Control 26 (2003) 57–67 65

treatment depends on production method (in vivo pro-duced less sensitive than in vitro produced) but not on

virus type or medium used, (b) SDS causes more dam-

age than sonication and this effect is more pronounced

in in vitro produced material, and (c) there is no dif-

ference between 30 and 60min SDS treatment.

The final conclusion was investigated further. A new

in vitro sample of polyhedra was produced in SF900II

medium and the infected cell pellets containing polyhe-dra were treated with SDS for 5, 10, 15min, and 24 h.

Including the two datasets from Table 1 (SF900II), we

have the new dataset (Table 3). The response was ob-

viously non-linear and in the absence of a response

model, we regressed against the ordinal numbers for

time (i.e., 1–6). An initial test confirmed the validity of

combining the two experiments (not shown) and we

continued to fit the regression model:

logitðpiÞ ¼ g þ aoi;

where g is a constant response, a is the slope, andoi ¼ 1; . . . ; 6 is the ordinal time measure.

There is a weakly significant trend in data (Table

4). Introduction of a non-zero slope parameter pro-

duced a 2.83 reduction in deviance on one degree of

freedom (p¼ 0.093). The data, however, appear un-

derdispersed and even the null hypothesis (zero slope)

adequately describes data with a residual deviance of

2.99 on 5 degrees of freedom. It is not clear exactlywhat causes the under dispersion. A reasonable guess,

however, is that damage is not a true probabilistic

event; a small fraction ð� 16%Þ of polyhedra are to-

tally immune to SDS treatment and can be treated for

24 h with no damage, while the majority are extremely

sensitive and most are damaged within minutes of

SDS treatment.

4. Conclusions

This paper has confirmed that polyhedron envelope

integrity is vital to the biological activity of polyhedra,

as it ensures the retention of virions that would other-

wise be dislodged and lost. Regardless of media com-

position (including serum supplemented medium), in

vitro produced polyhedra were highly sensitive to SDS

treatment, with 80% of polyhedra damaged even after5min of treatment. In contrast, only 20% of in vivo

produced polyhedra showed evidence of SDS damage.

Electron microscopy suggests that a coherent polyhe-

dron envelope is formed in in vitro culture, but for un-

known reasons the envelope is not anchored properly to

the protein matrix. The change is evidently not due to

mutations: there are no mutations in PEP, the change

already occurred in passage 2 and it can be reversed by asingle passage through larvae. Further research is re-

quired to establish if the change is due to a change in the

expression profile of key viral genes or due to an inap-

propriate intracellular environment, e.g., availability of

key sugars for PE formation.

Acknowledgments

The research was supported by the Australian Re-

search Council and the Grains Research and Develop-

ment Corporation. We thank Dr. David Tribe and

Ashley Robertson (Department of Immunology and

Microbiology, The University of Melbourne) for giving

us the oligonucleotides used to amplify and sequencethe PEP gene, and also the staff in the Centre of Mi-

croscopy and Microanalysis (The University of

Queensland) for providing technical advice in electron

microscopy.

References

Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M., Possee,

R.D., 1994. The complete DNA sequence of Autographa californica

nuclear polyhedrosis virus. Virology 202, 586–605.

Bergold, G.H., 1963. The nature of nuclear polyhedrosis viruses. In:

Steinhaus, E.A. (Ed.), Insect Pathology: An Advance Treatise.

Academic Press, New York, pp. 413–455.

Bjornson, R.M., Rohrmann, G.F., 1992. Nucleotide sequence of the

polyhedron envelope protein gene region of the Lymantria dispar

nuclear polyhedrosis virus. J. Gen. Virol. 73, 1499–1504.

Chen, X., Ijkel, F.W.J., Tarchini, R., Sun, X., Sandbrink, H.,

Wang, H., Peters, S., Zuidema, D., Lankhorst, R.K., Vlak,

J.M., Hu, Z., 2001. The sequence of the Helicoverpa armigera

single nucleocapsid nucleopolyhedrovirus genome. J. Gen. Virol.

82, 241–257.

Gombart, A.F., Pearson, M.N., Rohrmann, G.F., Beaudreau, G.S.,

1989. A baculovirus polyhedral envelope-associated protein: ge-

netic location, nucleotide sequence, and immunocytochemical

characterisation. Virology 168, 182–193.

Table 4

Regression model for the duration of SDS treatment

Model Degree of freedom Deviance

logitðpiÞ ¼ g 5 2.99

logitðpiÞ ¼ g þ aoi 4 0.16

Table 3

Effect of incubation time with 0.5% SDS extraction

oi Time Experiment Damaged Scored % Damaged

(CI)

1 5min 2 120 154 78 (71–84)

2 10min 2 98 125 78 (70–85)

3 15min 2 92 113 81 (73–88)

4 30min 1 132 161 82 (75–88)

5 60min 1 118 141 84 (77–89)

6 24 h 2 124 148 84 (77–89)

Errors are quoted in 95% confidence intervals.

66 L.H.L. Lua et al. / Biological Control 26 (2003) 57–67

Gomi, S.,Majima,K.,Maeda, S., 1999. Sequence analysis of the genome

ofBombyxmori nucleopolyhedrovirus. J. Gen. Virol. 80, 1323–1337.

Gross, C.H., Russell, R.L.Q., Rohrmann, G.F., 1994. Orgyia pseu-

dotsugata baculovirus p10 and polyhedron envelope protein genes:

analysis of their relative expression levels and role in polyhedron

structure. J. Gen. Virol. 75, 1115–1123.

Harrap, K.A., 1972. The structure of nuclear polyhedrosis viruses. I.

The inclusion body. Virology 50, 114–123.

Ijkel, W.F.J., Van Strien, E.A., Heldens, J.G.M., Broer, R., Zuidema,

D., Goldbach, R.W., Vlak, J.M., 1999. Sequence and organisation

of the Spodoptera exigua multicapsid nucleopolyhedrovirus ge-

nome. J. Gen. Virol. 80, 3289–3304.

King, L.A., Possee, R.D., 1992. Propagation of baculoviruses in insect

larvae. In: King, L.A., Possee, R.D. (Eds.), The Baculovirus

Expression System—A Laboratory Guide. Chapman and Hall,

London, pp. 181–194.

Lua, L.H.L., Pedrini, M., Reid, S., Robertson, A., Tribe, D.E., 2002.

Phenotypic and genotypic analysis of Helicoverpa armigera nucle-

opolyhedrovirus serially passaged in cell culture. J. Gen. Virol. 83,

947–957.

Lua, L.H.L., Reid, S.R., 2000. Virus morphogenesis of Helicoverpa

armigera nucleopolyhedrovirus in Helicoverpa zea serum-free

suspension culture. J. Gen. Virol. 81, 2531–2543.

McIntosh, A.H., Ignoffo, C.M., 1981. Replication and infectivity of

the single-embedded nuclear polyhedrosis virus, baculovirus

Heliothis, in homologous cell line. J. Invertebr. Pathol. 37,

258–264.

Metzler, D.E., 1977. Biochemistry: The Chemical Reactions of Living

Cells. Academic Press, New York.

Minion, F.C., Coons, L.B., Broome, J.R., 1979. Characterisation of

the polyhedral envelope of nuclear polyhedrosis virus of Heliothis

virescens. J. Invertebr. Pathol. 34, 303–307.

Russell, R.L.Q., Rohrmann, G.F., 1990. A baculovirus polyhedron

envelope protein: immunogold location in infected cells and mature

polyhedra. Virology 174, 177–184.

Taylor, J.R., 1997. The binomial distribution. In: An Introduction to

error analysis: the study of uncertainties in physical measurements.

University Science Books, California, pp. 227–244.

Weiss, S.A., Smith, G.C., Kalter, S.S., Vaughn, J.L., Dougherty, E.,

1981. Improved replication of Autographa californica nuclear

polyhedrosis virus in roller bottles: characterisation of progeny

virus. Intervirology 15, 213–222.

Whitt, M.A., Manning, J.S., 1988. A phosphorylated 34-kDa protein

and a subpopulation of polyhedrin are thiol linked to carbohydrate

layer surrounding a baculovirus occlusion body. Virology 163, 33–

42.

Williams, G.V., Rohel, D.Z., Kuzio, J., Faulkner, P., 1989. A

cytopathological investigation of Autographa californica nuclear

polyhedrosis virus p10 gene function using insertion/deletion

mutants. J. Gen. Virol. 70, 187–202.

L.H.L. Lua et al. / Biological Control 26 (2003) 57–67 67