Role of TRPC1 channel in skeletal muscle function

doi:10.1152/ajpcell.00241.2009 298:149-162, 2010. First published Oct 21, 2009;Am J Physiol Cell Physiol

Birnbaumer and Philippe Gailly Alexander Dietrich, Jean Lebacq, Urs Ruegg, Emmanuelle Roulet, LutzGallo, Monique Van Schoor, Isabelle Anguish, My Linh Cao, Olivier Schakman, Nadège Zanou, Georges Shapovalov, Magali Louis, Nicolas Tajeddine, ChiaraRole of TRPC1 channel in skeletal muscle function

You might find this additional information useful...

75 articles, 44 of which you can access free at: This article cites http://ajpcell.physiology.org/cgi/content/full/298/1/C149#BIBL

including high-resolution figures, can be found at: Updated information and services http://ajpcell.physiology.org/cgi/content/full/298/1/C149

can be found at: AJP - Cell Physiologyabout Additional material and information http://www.the-aps.org/publications/ajpcell

This information is current as of January 15, 2010 .

http://www.the-aps.org/.American Physiological Society. ISSN: 0363-6143, ESSN: 1522-1563. Visit our website at a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the

is dedicated to innovative approaches to the study of cell and molecular physiology. It is published 12 timesAJP - Cell Physiology

on January 15, 2010 ajpcell.physiology.org

Dow

nloaded from

http://ajpcell.physiology.org/cgi/content/full/298/1/C149#BIBL

http://ajpcell.physiology.org/cgi/content/full/298/1/C149

http://www.the-aps.org/publications/ajpcell

http://www.the-aps.org/

http://ajpcell.physiology.org

Role of TRPC1 channel in skeletal muscle function

Nadège Zanou,1* Georges Shapovalov,2* Magali Louis,1 Nicolas Tajeddine,1 Chiara Gallo,2

Monique Van Schoor,1 Isabelle Anguish,2 My Linh Cao,1 Olivier Schakman,1 Alexander Dietrich,3

Jean Lebacq,1 Urs Ruegg,2 Emmanuelle Roulet,2 Lutz Birnbaumer,4 and Philippe Gailly1

1Laboratory of Cell Physiology, Institute of Neuroscience, Université Catholique de Louvain, Brussels, Belgium; 2Laboratoryof Pharmacology, Geneva-Lausanne School of Pharmaceutical Sciences, University of Geneva, Geneva, Switzerland;3Institute for Pharmacology and Toxicology, School of Medicine, University of Marburg, Marburg, Germany;and 4Laboratory of Neurobiology, National Institute of Environmental Health Sciences, National Institutes of Health,Research Triangle Park, North Carolina

Submitted 3 June 2009; accepted in final form 19 October 2009

Zanou N, Shapovalov G, Louis M, Tajeddine N, Gallo C,Van Schoor M, Anguish I, Cao ML, Schakman O, Dietrich A,Lebacq J, Ruegg U, Roulet E, Birnbaumer L, Gailly P. Role ofTRPC1 channel in skeletal muscle function. Am J Physiol CellPhysiol 298: C149 –C162, 2010. First published October 21, 2009;doi:10.1152/ajpcell.00241.2009.—Skeletal muscle contraction is re-puted not to depend on extracellular Ca2�. Indeed, stricto sensu,excitation-contraction coupling does not necessitate entry of Ca2�.However, we previously observed that, during sustained activity(repeated contractions), entry of Ca2� is needed to maintain forceproduction. In the present study, we evaluated the possible involve-ment of the canonical transient receptor potential (TRPC)1 ion chan-nel in this entry of Ca2� and investigated its possible role in musclefunction. Patch-clamp experiments reveal the presence of a small-conductance channel (13 pS) that is completely lost in adult fibersfrom TRPC1�/� mice. The influx of Ca2� through TRPC1 channelsrepresents a minor part of the entry of Ca2� into muscle fibers at rest,and the activity of the channel is not store dependent. The lack ofTRPC1 does not affect intracellular Ca2� concentration ([Ca2�]i)transients reached during a single isometric contraction. However, theinvolvement of TRPC1-related Ca2� entry is clearly emphasized inmuscle fatigue. Indeed, muscles from TRPC1�/� mice stimulatedrepeatedly progressively display lower [Ca2�]i transients than thoseobserved in TRPC1�/� fibers, and they also present an accentuatedprogressive loss of force. Interestingly, muscles from TRPC1�/� micedisplay a smaller fiber cross-sectional area, generate less force percross-sectional area, and contain less myofibrillar proteins than theircontrols. They do not present other signs of myopathy. In agreementwith in vitro experiments, TRPC1�/� mice present an importantdecrease of endurance of physical activity. We conclude that TRPC1ion channels modulate the entry of Ca2� during repeated contractionsand help muscles to maintain their force during sustained repeatedcontractions.

calcium; canonical transient receptor potential 1; fatigue

IT IS WELL KNOWN that adult skeletal muscle fibers do notexchange much Ca2� with the extracellular medium duringcontraction. Their sarcoplasmic reticulum (SR) is rich in sar-co(endo)plasmic reticulum Ca2�-ATPase (SERCA) pumpsand has a high buffering capacity, mostly due to calsequestrin.Ca2� extrusion through the plasma membrane is very slow(reviewed in Ref. 54). Therefore, almost all the Ca2� releasedfrom the SR is rapidly restored after stimulation, and for that

reason muscle fibers can twitch for hours in the absence ofextracellular Ca2� (8). However, evaluations of Ca2� influxwith the 45Ca2� uptake technique indicate that each twitchcontraction induces a small increase of Ca2� entry (13).

In a previous study, we showed (24) that a decrease on theorder of 30% of the Ca2� content in the SR store is sufficientto induce an entry of Ca2� through the so-called store-operatedchannels. Interestingly, it has been found that a single actionpotential triggers the release of 0.2–0.3 mM Ca2� from the SRinto the cytoplasm (10), which corresponds to more than aquarter of the SR Ca2� content (27). In addition, electricallystimulated isotonic contractions of soleus muscle led to a30-fold increase of 45Ca2� uptake compared with restingmuscle (36). Thus it seems reasonable to assume that store-operated channels are indeed activated during physiologicalcontractions.

In previous work, we have shown that store-operated chan-nels are present in skeletal muscles and that their activity isabnormally increased in Duchenne muscular dystrophy (71), amyopathy due to the lack of dystrophin, a cytoskeletal protein,leading to a perturbation of Ca2� homeostasis (30–32, 34,58, 69).

Using a RNA antisense strategy targeted to the transientreceptor potential (TRP) box motif [EWKFAR motif found atthe COOH terminus, close to the last transmembrane domain incanonical TRP (TRPC) isoforms and modified in melastatinTRP (TRPM) and TRP vanilloid (TRPV) isoforms], we pro-posed that these channels, abnormally regulated in dystrophicfibers, might be constituted of TRP channel isoforms. Inparticular, TRPC1 was shown to be localized close to theplasma membrane and to interact with �1-syntrophin that mayanchor the store-operated channels to the dystrophin-associatedprotein complex (70, 71). The role of TRPC1 in Duchennemuscular dystrophy might also involve its interactions withcaveolin-3, Src kinase, and Homer proteins (Refs. 35, 67;reviewed in Ref. 1). Several reports propose that TRPC1channel might constitute a component of store-operated chan-nels (for review, see Refs. 6, 7, 11, 62), possibly associatedwith another channel called Orai1 (28, 44, 65), and withSTIM1, an intrareticular Ca2� sensor (7, 38, 47, 74, 75).However, this is challenged by different reports showing thatstore-operated entry of Ca2� is orchestrated essentially bySTIM and Orai1 functioning independently of TRPC channels(Refs. 21, 50; for review, see Ref. 19). In skeletal muscle, thisentry seems to occur essentially through the transverse tubulesystem, a situation that involves molecular agonists distributedthroughout junctional membranes (12, 45).

* N. Zanou and G. Shapovalov contributed equally to this work.Address for reprint requests and other correspondence: P. Gailly, Laboratory

of Cell Physiology, Inst. of Neuroscience, Université Catholique de Louvain,55/40 av. Hippocrate, 1200 Brussels, Belgium (e-mail: [email protected]).

Am J Physiol Cell Physiol 298: C149–C162, 2010.First published October 21, 2009; doi:10.1152/ajpcell.00241.2009.

http://www.ajpcell.org C149


Dow

nloaded from


Recently, Lyfenko and Dirksen (50) showed that a Ca2�

entry pathway distinct of the store-operated pathway exists inskeletal muscle (reviewed in Ref. 23). This entry is activatedby depolarization. The molecular players have not yet beenidentified, but this pathway does not involve STIM1 and Orai1.

In this paper, we present new evidence in order to try toevaluate the real importance of TRPC1 channel in the influx ofCa2� in skeletal muscle and to investigate its role in musclefunction. We thus characterized Ca2� currents and intracellularCa2� concentration ([Ca2�]i) transients as well as mechanicalfunction in vitro and in vivo in TRPC1�/� and TRPC1�/�

mice.

MATERIALS AND METHODS

TRPC1�/� and TRPC1�/� Mice

Generation of TRPC1�/� mice has been described previously (22).TRPC1�/� and TRPC1�/� were obtained from heterozygous ani-mals. TRPC1�/� were compared with their TRPC1�/� control sex-matched littermates. TRPC1�/� mice were viable and fertile, withnormal litter sizes compared with TRPC1�/� mice. They appeared tobe healthy, had a normal life span, and did not present any signs ofmajor neurological disorder or metabolic disease.

Expression of TRPC Channels

For mRNA quantification, tibialis anterior, extensor digitorumlongus (EDL), and soleus muscles were extracted with the Ribopurekit (Ambion) and reverse-transcribed with SuperScript II RNase H(Invitrogen). Gene-specific PCR primers were designed with Primer3(http://biotools.umassmed.edu/bioapps/primer3_www.cgi). To avoidamplification of genomic DNA, primers were chosen in differentexons. All primers (Table 1) were purchased from Eurogentec. Thecyclophilin D housekeeping gene and the genes of interest wereamplified in parallel. Real-time RT-PCR was performed with 5 �l ofcDNA, 12.5 �l of SYBR Green Mix (Bio-Rad), and each primer at300 nM in a total reaction volume of 25 �l. The reaction was initiatedat 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for10 s, annealing at 60°C for 1 min, and extension at 72°C for 10 s.

Data were recorded on a MyiQ Real-Time PCR Detection System(Bio-Rad), and cycle threshold (Ct) values for each reaction weredetermined with analytical software from the same manufacturer.Each cDNA was amplified in duplicate, and Ct values were averagedfor each duplicate. The average Ct value for cyclophilin D wassubtracted from the average Ct value for the gene of interest (Fig. 1). Muscle Mechanical Measurements

Ten- to sixteen-week old TRPC1�/� and TRPC1�/� mice weredeeply anesthetized by intraperitoneal injection of a solution contain-ing ketamine (10 mg/ml) and xylazine (1 mg/ml) in order to preservemuscle perfusion during dissection of both soleus and EDL muscles.Depth of anesthesia was assessed by the abolition of eyelid and pedalreflexes.

After dissection, the animals were killed by rapid neck dislocation.This protocol has been approved by the Animal Ethics Committee ofthe Catholic University of Louvain.

Soleus and EDL muscles were bathed in a 1-ml horizontal chambercontinuously superfused with HEPES-buffered Krebs solution (100%O2) containing (in mM) 135.5 NaCl, 5.9 KCl, 1 MgCl2, 2.5 CaCl2,11.6 HEPES sodium, and 11.5 glucose, maintained at a temperature of20 � 0.1°C. One end of the muscle was tied to an isometric forcetransducer and the other end to an electromagnetic motor and lengthtransducer (52). Stimulation was delivered through platinum elec-trodes running parallel to the muscles. Resting muscle length (L0) wascarefully adjusted for maximal isometric force with 100-ms (EDL) or300-ms (soleus) maximally fused tetani. Force was recorded on ahigh-speed pen recorder (Sanborn model 320) and digitalized at asampling rate of 1 KHz with a PCI 6023E i/o card (National Instru-

Table 1. Sequences of oligonucleotide primers

Gene GenBank Accession No. Primer 5=–3= Sequence

TRPC1 NM_011643 Fwd CAGCCTCAGACATTCCAGGTRev CTCCACAAGGCTGAGTTCCT

TRPC2 NM_011644 Fwd ACTTCCTGGACGTGGTCATCRev CTGAGCATGCTGGTGACAGT

TRPC3 NM_019510 Fwd TGGATTGCACCTTGTAGCAGRev ACGTGAACTGGGTGGTCTTC

TRPC4 NM_016984 Fwd AAGCCAAGTGGAGAGAAGCARev ATCCGAGCTGGAGACACACT

TRPC5 NM_009428 Fwd GCTGAAGGTGGCAATCAAATRev AAGGTTGCTTCTGGGTGAGA

TRPC6 NM_013838 Fwd CCTCCCTAATGAAACCAGCARev GATTGCCAGCATTCCAAAGT

TRPC7 NM_012035 Fwd CTGTGAAAACGACCGGAAATRev CCCTTCATTGCTTCATCGTT

Cyclophilin D BC019778 Fwd CGTCCAGATGAGGAGTCGGARev TAAGCATGATCGGGAGGGTT

TRPC, canonical transient receptor potential; Fwd, forward; Rev, reverse.

Fig. 1. Quantification of canonical transient receptor potential (TRPC) chan-nels expression in tibialis anterior (TA), extensor digitorum longus (EDL), andsoleus (Sol) muscles from TRPC1�/� and TRPC1�/� mice. A: TRPC1�/�

mice. Each cDNA was amplified in duplicate, and threshold cycle (Ct) valueswere averaged for each duplicate. The average Ct value for cyclophilin D wassubtracted from the average Ct value for the gene of interest, giving �Ct (n � 5 or6). Note that gene expression is inversely proportional to �Ct. B: TRPC1�/� mice.�Ct values were obtained from TRPC1�/� samples (n � 4–6). ND, not detected.

C150 ROLE OF TRPC1 IN SKELETAL MUSCLE

AJP-Cell Physiol • VOL 298 • JANUARY 2010 • www.ajpcell.org


Dow

nloaded from


ments). Normalized stress was expressed relative to cross-sectionalarea, obtained by multiplying absolute force by the quotient musclefiber length (mm)/muscle blotted weight (mg) and considering thefiber length equal to L0 for soleus and equal to 0.5 � L0 for EDL (15).

To investigate muscle fatigue, soleus muscles were subjected to50-Hz stimulation trains of 500-ms duration at 1-s intervals (50% dutycycle) over 2 min.

Adult Muscle Fiber Dissociation

Twelve- to sixteen week-old mice were killed by cervical disloca-tion. All procedures involving animals were performed in compliancewith the Swiss Federal Veterinary Office’s guidelines, based on theSwiss Federal Law on Animal Welfare, and were approved by theCantonal Veterinary Office and by the Animal Ethics Committee ofthe Catholic University of Louvain. Flexor digitorum brevis (FDB)muscles were removed and incubated for 36 min at 37°C in Krebssolution containing 0.2% collagenase type IV (Sigma). The muscleswere removed from this solution, washed twice in Krebs buffer, andsuspended in F-12/DMEM supplemented with 2% fetal bovine serumand 1% penicillin-streptomycin (Sigma). Single fibers were mechan-ically dissociated by passing the muscle repeatedly through fire-polished Pasteur pipettes. Dissociated fibers were plated onto tissueculture dishes coated with extracellular matrix basement membrane(Harbor Bio-products) and allowed to adhere to the bottom of the dishfor 2 h.

Muscle Protein Extraction

Muscle protein extraction was done as previously described (64).Briefly, whole EDL muscle was homogenized with Ultraturrax (IKA-Labortechnik, Staufen, Germany) in 500 �l of ice-cold lysis buffercontaining 50 mM Tris · HCl (pH 7.5), 1 mM EDTA, 0.5% NP-40, 1mM phenylmethylsulfonyl fluoride, 10 �g/ml aprotinin, and 10 �g/mlleupeptin. Homogenates were centrifuged 10 min at 10,000 rpm(Sorvall SS-34 rotor) to pellet myofibrillar proteins. These wereresuspended in 8 M urea-50 mM Tris · HCl, pH 7.5. The supernatantcontained soluble proteins. Myofibrillar and soluble muscle proteincontents were determined by using the Bradford protein assay (Bio-Rad, Munich, Germany).

Myosin Heavy Chain Isoform Distribution

Myosin heavy chain (MHC) isoforms were separated as describedpreviously (56) with only slight modifications. Muscles were frozen inliquid nitrogen, ground to powder, and homogenized in SDS solutioncontaining (in mM) 40 dithiothreitol, 5 EDTA, and 100 Tris · HCl (pH8) with 10% (wt/vol) SDS. Protease inhibitors (Complete, Roche)were added to homogenates. Samples were heated at 100°C for 3 min.For electrophoresis, the separating gel consisted of 30% (vol/vol)glycerol, 8% (wt/vol) acrylamide-N,N=-methylenebisacrylamide (Bis;99:1), 0.2 M Tris · HCl (pH 8.8), 0.1 M glycine, 0.4% (wt/vol) SDS,0.1% (wt/vol) ammonium persulfate, and 0.05% (vol/vol) N,N,N=,N=-tetramethylethylenediamine (TEMED). The stacking gel consisted of30% (vol/vol) glycerol, 4% (wt/vol) acrylamide-Bis (50:1), 70 mMTris · HCl (pH 6.7), 4 mM EDTA, 0.4% (wt/vol) SDS, 0.1% (wt/vol)ammonium persulfate, and 0.05% (vol/vol) TEMED. The lower run-ning buffer consisted of 0.05 M Tris (base), 75 mM glycine, and0.05% (wt/vol) SDS. The upper running buffer was at six times theconcentration of the lower buffer, but 0.12% (vol/vol) 2-mercapto-ethanol was added. Electrophoresis was performed at a constantvoltage of 60 V for 22 h, except for the first 40 min (stacking gelpenetration), when the current was limited to 10 mA. Bands werescanned and quantified by densitometry.

Histology

Three- and twelve week-old mice were chosen for histologicalinvestigations. Both soleus and EDL muscles were dissected, fixed in

10% formalin-PBS on ice for 4 h, embedded in paraffin, and sec-tioned. Sections were deparaffinated with xylol, rehydrated withalcohol, fixed in 1% acid alcohol (1% acetic acid in ethanol), and airdried. After incubation for 3 min with acidic hemalun, plates wererinsed, treated for 30 s with saturated lithium carbonate, rinsed, andcounterstained with 1% eosin. After dehydration with ethanol andxylol, sections were mounted with Entellan (Merck). The size ofmuscle fiber sections was measured with a homemade planimetryprogram.

Patch-Clamp Recordings

Cell-attached patch-clamp recordings were performed at roomtemperature on individual fibers isolated as described above. Fiberswere pretreated with 30 �M N-benzyl-p-toluene sulfonamide (BTS)for 10 min to inhibit contractions (18) and immersed in a high-K�

solution composed of (in mM) 10 NaCl, 142 KCl, 2 MgCl2, 0.2CaCl2, 5 glucose, 0.5 EGTA, and 10 HEPES (pH 7.3). Cells immersedin this solution had resting membrane potentials of 0 � 2 mV, asverified by measuring membrane potential with sharp electrodes asdescribed previously (n � 6) (40). Patch pipettes contained (in mM)110 CaCl2, 10 HEPES (pH 7.3) supplemented with 2 mM tetraethyl-ammonium (TEA), 20 �M 4,4=-diisothiocyanostilbene-2,2=-disulfo-nic acid (DIDS), and 1 �M nifedipine to inhibit K�, Cl�, and L-typeCa2� currents. When needed, 100 �M 2-aminoethoxydiphenyl borate(2-APB; Alexis, Lausen, Switzerland) was added to the solution.Pipettes were pulled with a horizontal puller P2000 (Sutter Instru-ment, Novato, CA) and had a resistance of 3–5 M. Electric currentswere acquired and low-pass filtered at 2 kHz with a Multiclamp 700Bamplifier and then digitized with a Digidata 1322 digitizer (MolecularDevices, Sunnyvale, CA) at 10 kHz.

Electrical properties of the channels were studied by measuringactivity at series of potentials from �60 to �40 mV in steps of 20mV, and single-channel currents at these potentials were measured byproducing all-point histograms in the regions of TRPC1 activity andperforming Gaussian fits to the established peaks. Store-dependentCa2� entry was studied by measuring currents at the holding potentialof �40 mV; first basal activity was acquired for 5 min, then bathsolution was replaced with equivalent high-K� solution containing 1�M thapsigargin, and the data acquisition was continued for anadditional 20 min. Acquired currents were analyzed with the help ofthe single-channel search algorithm of the Clampex-10 program withconductance levels set to correspond to typical single-channel currentsof TRPC1 or higher-conductance channel observed in patches (typi-cally 0.7 or 2 pA correspondingly at the holding potential of �40mV), yielding channel activity (NPo) values that were then used tocalculate average currents corresponding to a particular mode of Ca2�

entry. Mechanosensitive properties of TRPC1 channels were studiedin cell-attached patches held at �40 mV with the suction protocolconsisting of steps to suction levels varying from 0 to �100 mmHg insteps of 10 mmHg, applied for 0.5 s, followed by a period ofrelaxation of 2.5 s, with an HSPC-1 instrument (ALA ScientificInstruments, Westbury, NY) and analyzed similarly to store-depen-dent currents.

Measurements of [Ca2�]i and Influx of Ca2�

Muscle fibers were loaded for 1 h at room temperature with themembrane-permeant Ca2� indicator fura-PE3/AM (1 �M) and Plu-ronic F-127 (0.004%). Before electrical stimulation, they were incu-bated in the presence of BTS (30 �M) to prevent contraction (18).Cells were illuminated through an inverted Nikon microscope (�40magnification objective) alternatively at 340 and 380 nm, and thefluorescent light emitted at 510 nm was measured with a Deltascan spec-trofluorimeter (Photon Technology International). The ratio R340/380 ofthe fluorescence intensity emitted at the two excitation wavelengthswas calculated, and [Ca2�]i was determined with a previously de-scribed calibration (71).

C151ROLE OF TRPC1 IN SKELETAL MUSCLE



Dow

nloaded from


To measure the influx of Ca2� into muscle fibers, 1 mM MnCl2was added to the Krebs medium and the influx of Mn2� through Ca2�

channels was evaluated by the quenching of fura-PE3 fluorescenceexcited at 360 nm, i.e., at the isosbestic point. The rate of quenchingreflected the rate of Ca2� entry (33, 55). Simultaneously, the ratio offluorescence obtained with 340-nm and 360-nm excitation wave-lengths (R340/360) evaluated [Ca2�]i. Mn2� entry was first measured atrest and then after Ca2� was released from the stores with 20 mMcaffeine and 1 �M thapsigargin (14).

In Vivo Experiments

Running wheel. Each mouse was individually housed in a standardmouse cage containing a low-inertia running wheel. Wheel-runningdistances were measured during the active part of the day (from 6 PMto 6 AM).

Escape test. For these experiments, the method initially devised byCarlson and Makiejus (16) was applied. Briefly, 4-mo-old mice wereplaced in front of a tube, and a cuff was wrapped around the tail andconnected to a fixed force transducer. In response to gentle pinchingof the tail, the mice tried to escape into the tube; this was preventedby the attachment of the tail to the force transducer, and a short peakof force was recorded. The procedure was repeated at short intervalsover 2.5 min. The mean of the five highest peaks recorded wascalculated for each animal and divided by its body weight (“total bodyforce,” mN/g).

Forced treadmill exercise. The mice were placed on a homemadetreadmill to run with an uphill inclination of 30° at a speed of 5 m/minfor 5 min, followed by a progressive increase in speed of 1 m/minevery minute up to 17 m/min. The back of the treadmill was equippedwith a grid that discharged a mild electrical current, a stimulus aimedat motivating the animal to keep running on the treadmill. The test wasstopped when the mouse remained on the shocker plate for 20 swithout attempting to reengage the treadmill, and the time to exhaus-tion was determined.

Wire test protocol. In this test, animals were suspended by theirforelimbs from a 1.5-mm-thick, 60-cm-long metallic wire at 45 cmabove soft ground (59). The time until the mouse completely releasedits grasp and fell down was recorded. Three trials were performed persession, with a 30-s recovery period between trials. The maximumtime per trial was set to 180 s. For each mouse, the scores of the threetrials were averaged.

Statistics

Data are presented as means � SE. ANOVA and Student’s t-testsand 2, Pearson’s test were used to determine statistical significance.

RESULTS

Expression of TRPC1 and Ca2� Fluxes in Muscle Fibers

We previously reported (49) that in myoblasts TRPC1 is byfar the most widely expressed channel of the TRPC subfamily(at least 100 times more than other isoforms). In adult musclefibers, we observed that TRPC1, TRPC2, and TRPC3 were themost abundantly expressed TRPC isoforms. It is important tonote that in soleus muscle TRPC1 was the most expressedTRPC isoform, whereas this expression was a little bit weakerin EDL and tibialis anterior, where TRPC3 was the predomi-nant isoform. As shown previously, TRPC5 and TRPC7 iso-forms are less abundantly expressed (Fig. 1A) (71).

In several investigations, TRPC1 has been reported to beresponsible for store-operated Ca2� entry. In a recent study, weindeed confirmed that repression of TRPC1 in C2C12 myo-blasts reduced the store-operated Ca2� entry (49). Here, weinvestigated the role of TRPC1 by using TRPC1 knockout

mice. The abolition of TRPC1 expression was confirmed byPCR, which showed the absence of TRPC1 mRNA in skeletalmuscles of TRPC1 knockout mice. We found that in thesemuscles TRPC isoforms other than TRPC1 presented an ex-

Fig. 2. Store-operated entry of Ca2� in muscle fibers from TRPC1�/� andTRPC1�/� mice. A and B: Ca2� release from the stores was triggered bystimulation with 20 mM caffeine and 1 �M thapsigargin (Tg) in the presence of1 mM Mn2�. This induced an increase of intracellular Ca2� concentration([Ca2�]i) (reflected by an increase of the fluorescence ratio F340/F360; B) and anincrease of Ca2� entry (reflected by an increase of the quenching rate of fura-PE3by Mn2�; A). C: comparison of fura-PE3 quenching rates by Mn2� at rest (graybars) and after Ca2� release induced by caffeine and Tg stimulation (black barsrepresenting difference between fura-PE3 quenching rates after and before stim-ulation) in muscle fibers from TRPC1�/� (n � 13) and TRPC1�/� mice (n � 14).Results are means � SE.




Dow

nloaded from


pression pattern that was similar to that observed in musclesfrom TRPC1�/� mice (Fig. 1B). To study the role of TRPC1on Ca2� fluxes, we evaluated the entry of Ca2� by microspec-trofluorometry and measured Ca2� currents by the patch-clamptechnique in muscle fibers isolated from FDB muscles.

Ca2� influx was monitored by the Mn2� quenching offura-PE3 fluorescence. Mn2� entry was first measured at rest,and then the release of Ca2� from the reticulum was triggeredby stimulation with 20 mM caffeine and 1 �M thapsigargin(used to activate ryanodine receptors and to inhibit SERCApumps, respectively) (Fig. 2, A and B). We observed that therate of quenching of fura-PE3 was similar in muscle fibersfrom TRPC1�/� and TRPC1�/� mice at rest. Depletion of thestores by stimulation with thapsigargin significantly increasedthe quenching rate in both TRPC1�/� and TRPC1�/� fibers(2-way ANOVA, P � 0.05), but no difference was observedbetween TRPC1�/� and TRPC1�/� fibers (Fig. 2C), suggest-ing that TRPC1 is not indispensable for store-operated entry ofCa2� and does not play a major role in the basal influx of Ca2�

(at least through Mn2�-permeable Ca2� channels). In addition,we verified that FDB muscles from TRPC1�/� mice did notchange their expression of Stim1 and Orai1, two well-knownproteins involved in store-operated influx of Ca2� (data notshown).

For patch-clamp experiments, muscle fibers were immersedin the relaxing Ca2�-free solution utilized to emphasize cur-rents through store-operated channels (57), and currents wererecorded in cell-attached configuration at a series of potentials

from �60 to �40 mV in steps of 20 mV (Fig. 3). Toinvestigate store-operated responses, activity was recorded for5 min in cell-attached patches held at a constant potential of�40 mV. Fibers were then stimulated with 1 �M thapsigargin,and channel activity was recorded over an additional 20 min(Fig. 3C). Typically, patches exhibited Ca2� currents throughessentially two ion channel types, one of small conductanceand one of large conductance. Figure 3A shows an example ofthe small-conductance channel activity recorded at the series ofpotentials, as indicated on the right. The current-voltage rela-tionship showed a slope conductance of 13 � 1 pS (n � 7)(Fig. 3B), in agreement with previous reports of TRPC1 activ-ity in overexpression systems (9, 48, 63). Such activity wasunambiguously observed in 19% of patches from TRPC1�/�

fibers (11 of 52 patches), an occurrence frequency similar tothat observed in wild-type muscle fibers (6 of 31 patches fromC57BL/6J mice). However, it was completely absent inTRPC1�/� muscle fibers (0 of 45 patches), allowing us toidentify TRPC1 as the channel responsible for this smallconductance. As expected (62), it was also significantly inhib-ited in the presence of 100 �M 2-APB (occurrence fallingdown to 0%: no observation of TRPC1 activity in 16 patcheshaving a duration of 20 min or longer; P � 0.05, 2-test). Weobserved that the channel activity did not significantly increaseafter thapsigargin stimulation (mean current, in traces whereactivity was observed, measured at �40 mV over a period of4 min, of 15 � 8 fA before and 18 � 11 fA after thapsigarginstimulation, n � 7; paired Student’s t-test comparing values

Fig. 3. Ca2� currents in cell-attached patches.A: series of traces showing typical single-channel currents in TRPC1�/� cells in cell-attached configuration at indicated voltagesthat were not observed in TRPC1�/� cells.B: current-voltage relationship of TRPC1channel (n � 7). C: sample trace showingCa2� current evoked in response to sarcoplas-mic reticulum (SR) emptying by thapsigargin(Tg). Patch was held at �40 mV and firstbasal activity was acquired, followed by theapplication of thapsigargin-containing solu-tion, as indicated by vertical arrow.




Dow

nloaded from


before and after stimulation yields P � 0.85; when normalizedper all acquired traces mean currents become 3.2 � 1.5 fAbefore and 3.8 � 2 fA after thapsigargin), clearly showing thatTRPC1 activity is not store dependent. In all observed cases,TRPC1 gating was happening in bursts. Unfortunately, the lowfrequency of observation of such activity (only 3 of 11 patchescontained multiple bursts of TRPC1 activity) allowed us to putonly a lower boundary estimate on interburst interval at 590 �100 s with a mean burst duration of 29.5 � 10 s and in-burstNPo of 0.48 � 0.08.

To assess mechanosensitive properties of the TRPC1 chan-nel we performed measurements of Ca2� currents in cell-attached patches stimulated by application of suction rangingfrom 0 (no suction) to �100 (stress level often causing patchmembrane rupture) mmHg in steps of 10 mmHg. Activity ofstretch-activated channels (SAC) could often be evoked withsuch stimulation (see below); however, application of suction

did not cause appearance of additional TRPC1 activity. In 2cases out of 31 experiments, application of suction occurredwhen a burst of TRPC1 activity was ongoing. In both cases, theactivity stopped with application of suction without reappear-ing at higher suctions (data not shown). These observationslead us to conclude that TRPC1 channel is not activated bymechanical stimulation.

Membrane patches of TRPC1�/� fibers also exhibited cur-rents of larger amplitude, corresponding to a conductance of�50 pS and activity increasing on suction application. Thesecurrents could thus be associated with the activity of SAC withproperties similar to those described in the literature (61, 68).In our experimental conditions (holding potential of �40 mVand 110 mM CaCl2 in the pipette), this conductance wasobserved in 70% of patches (37 of 52 patches) and wasresponsible for a mean overall current of 23 � 6 fA (emptytraces included). From mean current and occurrence values, we

Fig. 4. Loss of TRPC1 induces a reduction of force production. A: maximal stress (force per cross-sectional area) developed during a 300-ms tetanus stimulated maximally (125Hz). *P � 0.05 vs. TRPC1�/�; **P � 0.01 vs. TRPC1�/� (Student’s t-test, n � 9). B and C: stress vs. stimulation frequency relationship in soleus muscles. *P � 0.05 vs.TRPC1�/� (Student’s t-test, n � 9). D: SDS-PAGE analysis of myosin heavy chain (MHC) isoforms of TA, soleus, and EDL muscles from TRPC1�/� (�) and TRPC1�/�

(�) mice.




Dow

nloaded from


calculated that this conductance therefore seems responsiblefor 88% of the entry of Ca2� in muscle fibers at rest, theother 12% being due to TRPC1. The activity of this channelincreased about twofold after thapsigargin-induced depletionof Ca2� stores, to a mean current of 40 � 10 fA (n � 28, P �0.06). In TRPC1�/� fibers, this conductance was observedwith a somewhat smaller occurrence (27 of 45 patches). Therelated mean current tended to be smaller than that observed inTRPC1�/� fibers, both at rest (14 � 6 fA, n � 23) and afterthapsigargin stimulation (29 � 11 fA, n � 23; P � 0.19),although the difference did not reach statistical significance (com-paring activity in TRPC1�/� and TRPC�/� cells before and afterthapsigargin application yields P � 0.31 and 0.47, respectively).

Morphology, Phenotype, and Force Production of Musclesof TRPC1�/� Mice

To evaluate muscle function and structure, we carried outmechanical and histological experiments. Isolated soleus andEDL muscles were maximally stimulated to obtain fusedtetani. Muscles from TRPC1�/� mice had a strictly normalweight but developed a significantly reduced maximal tetanicforce and stress compared with their controls (Fig. 4A andTable 2). Twitch parameters [time to peak (TTP) and half-relaxation time (½RT)] were not different between TRPC1�/�

and TRPC1�/� muscles (Table 2). Investigations of force-frequency relationships in soleus and EDL muscles highlightedthe lower stress produced by TRPC1�/� muscles (Fig. 4B), butwe could not detect any significant shift in sensitivity to thefrequency of stimulation in soleus muscle (Fig. 4C) or in EDL(data not shown), suggesting that the muscles did not changetheir fast or slow phenotype.

This was further examined by analyzing MHC isoforms intibialis anterior, soleus, and EDL muscles (Fig. 4D). Proteinscorresponding to MHC isoforms were separated by SDS-PAGE in glycerol-containing gels. We did not observe anysignificant change in isoform distribution between musclesfrom TRPC1�/� versus TRPC1�/� mice. Indeed, soleus mus-cles from TRPC1�/� and TRPC1�/� mice contained 44 �3.7% and 39 � 3.1%, respectively, of MHC2A, the rest beingMHC1 (n � 4 or 5). Tibialis anterior muscles contained 26 �5.2% and 33 � 3.3% of MHC2X, the rest being MHC2B, andEDL muscles contained 12 � 4.8% and 15 � 5.5% ofMHC2X, the rest being MHC2B (n � 3–5). Trace amounts ofMHC2A were detected in tibialis anterior and EDL musclesfrom both TRPC1�/� and TRPC1�/� mice, but their levels

were too low to be quantified, while no trace of MHC1A wasfound in EDL muscle.

Comparative analysis of histological sections of musclesfrom 3-mo-old TRPC1�/� and TRPC1�/� mice did notreveal any major differences (Fig. 5, A–D). In particular, wedid not observe any sign of myopathy such as necrosis,central nucleation, or fibrosis. Measurements of the cross-sectional area of the fibers were performed by planimetry.At least 100 fibers were measured in each EDL and 200fibers in each soleus muscle, in order to determine the meancross-sectional area of the fibers in a particular muscle. Thiswas repeated on seven different animals and revealed animportant decrease of fiber size in both EDL and soleusmuscles from TRPC1�/� mice compared with their controllittermates [EDL 1,195.7 � 72 and 939.9 � 42 �m2 (P �0.05 n � 7) and soleus 985.7 � 38 and 855.9 � 28 �m2

(P � 0.05, n � 7) in TRPC1�/� and TRPC1�/� muscles,respectively]. Distribution patterns of cross-sectional areas offibers from different animals were similar for a particularmuscle type (Fig. 5B) but clearly showed a shift of the curve ofcross-sectional area to smaller values in TRPC1�/� muscles(P � 0.01, 2, Pearson’s test).

Finally, we measured the contents of myofibrillar proteins inEDL muscles from TRPC1�/� and TRPC1�/� mice and ob-served a significant reduction in TRPC1�/� muscles [95.77 �4.28 �g/mg muscle in TRPC1�/� (n � 9) vs. 72.67 � 3.01�g/mg muscle in TRPC1�/� (n � 7); Student’s t-test, P �0.01].

In conclusion, TRPC1�/� muscles produce not only lesstotal force but also less force per cross-sectional area, and theirfibers are smaller and contain less myofibrillar proteins.

Muscle Fatigue in TRPC1�/� Mice

We next investigated the role of TRPC1 in muscle fatigue.Soleus muscles were first chosen because of their dependenceon oxidative metabolism, thus limiting the role of anaerobicprocesses in ionic changes and their contribution to musclefatigue. In these muscles, TRPC1 was the most abundantTRPC isoform. These muscles were subjected to 50-Hz stim-ulation trains of 500-ms duration at 1-s intervals (50% dutycycle). Under control conditions, maximal tetanic force pro-gressively declined and after 20–30 s relaxation became in-complete during the 0.5 s separating two successive stimula-tion periods (Fig. 6A). We previously showed the role of Ca2�

entry in this process. Indeed, in the absence of extracellular

Table 2. Muscle mechanics

EDL Soleus

TRPC1�/� TRPC1�/� TRPC1�/� TRPC1�/�

Body mass, g 28.09 � 1.31 29.67 � 0.99 28.64 � 0.87 29.09 � 1.58Muscle mass, mg 8.95 � 0.18 8.93 � 0.08 10.64 � 0.22 10.85 � 0.39L0, mm 12.28 � 0.12 12.04 � 0.23 11.76 � 0.17 11.65 � 0.16TTP, ms 19.11 � 0.80 20.56 � 0.60 35.25 � 1.73 34.38 � 2.411/2RT, ms 31.78 � 3.24 32.78 � 2.97 59.17 � 5.56 60.31 � 5.33F0, mN 374.13 � 16.35 310.11 � 18.21* 181.28 � 6.12 150.74 � 8.69*S0, mN/mm2 256.77 � 13.05 209.10 � 13.32* 201.69 � 7.82 163.17 � 9.70*n 14 14 22 18

Values are means � SE. EDL, extensor digitorum longus; L0, resting muscle length; TTP, time to peak; 1/2RT, half-relaxation time; F0, maximal force; S0, maximal stress(force/cross-sectional area). *P � 0.05.




Dow

nloaded from


Ca2�, the decline of maximal tetanic force was faster and therelaxation during the 0.5-s period separating two successivestimulations was complete (24), suggesting that the latter mightbe due to cytosolic Ca2� accumulation (3). Here, using thesame protocol, we compared the time course of muscle fatiguein soleus muscles from TRPC1�/� and TRPC1�/� mice. Asshown in Fig. 6, the decline of force was significantly faster inmuscles from TRPC1�/� mice than in controls, suggesting thatthe entry of Ca2� through TRPC1 channels is necessary forforce maintenance during repeated stimulations. Interestingly,in contrast to the situation observed in TRPC1�/� muscles, therelaxation of TRPC1�/� muscles during the 0.5-s period sep-arating two successive stimulations was complete (Fig. 6C).

We next studied muscle fatigue of EDL, a fast glycolyticmuscle. The protocol was adapted to avoid the possibility ofmetabolic changes masking the possible role of Ca2� entry

in the process. Muscles were subjected to 125-Hz stimula-tion trains of 100-ms duration at 2-s intervals. We observedthat maximal force declined faster in muscles fromTRPC1�/� than TRPC1�/�, similarly as described for so-leus muscles (Fig. 6D).

To further investigate the role of Ca2� entry and Ca2�

accumulation in the evolution of force during the protocol offatigue, we measured [Ca2�]i transients during fatigue ex-periments. For technical reasons we performed these mea-surements on isolated fibers from FDB muscles. FDB mus-cle contains IIA and IIX fibers and therefore presents anintermediate metabolism (oxidative and glycolytic); we pre-viously showed (60) that its contraction is much slower thanthat of EDL. We therefore used the same protocol ofstimulation as described for soleus. As shown in Fig. 7, Aand B, the amplitude of [Ca2�]i transients induced by

Fig. 5. Histological data. A–D: hematoxylin and eosin-stained cross sections of EDL (A and B) and soleus (C and D) muscles from 3-mo-old TRPC1�/� (A andC) and TRPC1�/� (B and D) mice. E and F: fiber area distribution in EDL (E) and soleus (F) muscles from TRPC1�/� and TRPC1�/� mice. The distributionsobserved in TRPC1�/� and TRPC1�/� were significantly different (P � 0.01, 2, Pearson’s test).




Dow

nloaded from


repetitive stimulations was maintained throughout the fa-tigue protocol in TRPC1�/� muscle fibers, indicating thatthe important loss of force observed under control condi-tions (Fig. 6) is not due to a decrease of Ca2� release fromthe SR. However, in TRPC1�/� muscle fibers, we observeda small and progressive decrease of the amplitude of [Ca2�]i

transients, which could explain the accentuated decline offorce observed in TRPC1�/� muscles. We also observedthat Ca2� progressively accumulated in fibers after repeti-tive stimulation (Fig. 7C). Indeed, [Ca2�]i measured at theend of the relaxation period (limited to 500 ms) was almost2.5 times higher at the end of the fatigue protocol than at thebeginning. Interestingly, this was not observed in musclefibers from TRPC1�/� mice, in which [Ca2�]i at the end ofthe relaxation period returned to baseline levels throughoutthe protocol. This fits with the complete relaxation observedin TRPC1�/� muscles (Fig. 6C) and suggests that the

incomplete relaxation observed in TRPC1�/� muscles isdue to an accumulation of [Ca2�]i in the cytoplasm.

TRPC1 Knockout Mice Present In Vivo Signs of Fatigue

To study the role of TRPC1 in skeletal muscle functions, weused four functional tests designed to investigate in vivo theability of the animal to perform voluntary exercise (running wheeltest and escape test) or endurance and forced exercise (treadmilltest and wire test). The running wheel test was used to evaluatespontaneous voluntary exercise during the active part of the day.We did not observe any difference in the running distance be-tween TRPC1�/� and TRPC1�/� mice (Fig. 8B). Likewise, theescape test used to evaluate the whole body force developed by amouse to escape in response to a stimulus (pinching of the tail)showed similar performances in TRPC1�/� and TRPC1�/� mice( 200 mN/g) (Fig. 8A).

Fig. 6. Involvement of TRPC1 in muscle fatigue: mechanical data. A: representative examples of force records in soleus muscles from TRPC1�/� and TRPC1�/�

mice: tetani of 500 ms every s during 2 min at 50-Hz stimulation frequency. B: quantification of the loss of force during the protocol of fatigue in soleus muscle(force measured every 10th tetanus). Results are expressed relative to the maximal force produced during 1st tetanus. Statistical analysis : *TRPC1�/� curve(n � 10) different from TRPC1�/� curve (n � 12), P � 0.05, 1-way repeated-measures ANOVA. C: quantification of the force at the end of the relaxation period(0.5 s). Results are expressed relative to the maximal force produced during 1st tetanus. Statistical analysis: *TRPC1�/� curve (n � 10) different from TRPC1�/�

curve (n � 12), P � 0.05, 1-way repeated-measures ANOVA. D: loss of force during the protocol of fatigue in EDL muscle. Statistical analysis: *TRPC1�/�

curve (n � 7) different from TRPC1�/� curve (n � 7), P � 0.05, 1-way repeated-measures ANOVA.




Dow

nloaded from


In contrast, TRPC1�/� and TRPC1�/� mice performed verydifferently in the two endurance tests. These two tests weredesigned to evaluate the resistance of the animal to enduranceexercise. As described in MATERIALS AND METHODS, treadmillexercise was performed in uphill inclination (30°). During thefirst 5 min mice were forced to run at 5 m/min, and then thespeed was increased by 1 m/min up to 17 m/min. TRPC1�/�

mice ran easily during the progressive increase of treadmillspeed and resisted beyond 45 min of the test. Interestingly,TRPC1�/� mice presented difficulties when speed was pro-gressively increased and ran only �20 min (n � 10). Theperformance of the TRPC1�/� mice in the treadmill test wastwo to three times lower than that observed in a controlpopulation (P � 0.001, Fig. 8C), suggesting a predisposition tomuscle fatigue. A similar result was obtained with the wire test,which also evaluates muscle force and resistance to fatigue. Inthis test, a mouse is suspended from a horizontal wire and thetime until the mouse releases its grasp and falls down isrecorded (test stopped after 180 s, 3 successive trials). Weobserved that TRPC1�/� mice rarely fell down before the endof each trial. However, TRPC1�/� mice were unable to resistso long [57 � 13 s (n � 11) in TRPC1�/� vs. 174 � 4s (n �10) in TRPC1�/� mice; Fig. 8D].

DISCUSSION

In this paper, we show that the influx of Ca2� throughTRPC1 channels represents a minor part of the entry of Ca2�

into muscle fibers at rest ( 12% of the total influx of Ca2�).We also clearly show that the activity of TRPC1 channels isnot store dependent. However, TRPC1-related Ca2� entry isdetectable in muscle fatigue experiments. Indeed, TRPC1channels modulate the entry of Ca2� during repeated musclecontractions and allow muscle to maintain force productionduring sustained stimulations. Finally, we show that musclesfrom TRPC1�/� mice display a smaller fiber cross-sectionalarea and generate less force than their controls and express lessmyofibrillar proteins.

Patch-clamp experiments performed on adult fibers fromTRPC1�/� mice revealed the presence of two ion channeltypes, one of large conductance exhibiting mechanosensitiveproperties and characteristics similar to those described in theliterature (24, 61, 68) and one of small conductance (13 pS).The small-conductance activity presented the characteristics ofTRPC1 measured in overexpression systems (9, 48, 63), wasinhibited by 2-APB, and was completely absent in TRPC1�/�

fibers, strongly suggesting that this current is carried byTRPC1 channels. We clearly show that in adult skeletal musclefibers TRPC1 is not store dependent. Although we cannot ruleout an effect of the lack of TRPC1 on the presence or theactivity of other (possibly unknown) channels, we show byfura-PE3 quenching experiments that, even if TRPC1 channelswere present in the T tubules (where they cannot be patched),they do not play an indispensable role in store-operated entryof Ca2�. These results support previous observations per-formed in smooth muscle (22) but appear contradictory to thesituation observed in myoblasts. Indeed, we previously showed(49) that in myoblasts a partial repression of TRPC1 [using ashort hairpin RNA (shRNA) strategy] decreased the store-operated entry of Ca2�. Two observations can be proposed toexplain this discrepancy. First, we showed that TRPC1 repres-

Fig. 7. Involvement of TRPC1 in muscle fatigue: [Ca2�]i transients. A: examples of[Ca2�]i transients measured in flexor digitorum brevis (FDB) fibers from TRPC1�/�

(top) and TRPC1�/� mice (bottom) submitted to the fatigue protocol described in Fig.6. B: quantification of maximal tetanic [Ca2�]i during the protocol of fatigue ([Ca2�]imeasured at 1st, 5th, and then every 10th tetanus). Results are expressed relative tomaximal [Ca2�]i obtained during 1st tetanus. C: quantification of the [Ca2�]i obtainedat the end of each relaxation period during the protocol of fatigue. ([Ca2�]i measuredat 1st, 5th, and then every 10th tetanus). Results are expressed relative to maximal[Ca2�]i obtained during 1st tetanus. Statistical analysis: *TRPC1�/� (n � 13) differentfrom TRPC1�/� (n � 22), P � 0.05, 1-way repeated-measures ANOVA followed byBonferroni multiple-comparison test.




Dow

nloaded from


sion slowed down myoblast migration and differentiation. Ithas been shown that store-operated Ca2� entry increases dur-ing differentiation (67). It is therefore possible that the differ-ence observed in the store-operated entry of Ca2� reflects thedifference in myoblast-myotube maturation. Alternatively, thisdifference between myoblasts and adult muscle fibers could bedue to the interaction of TRPC1 with myogenic factors. Indeed,TRPC1 has been shown to interact with the a-isoform of theinhibitor of myogenic family (I-mfa) (17, 51). I-mfa inhibitsstore-operated currents through the TRPC1 channel. However,the interaction between TRPC1 and I-mfa can be relieved bybinding of myogenic factors such as myogenin to I-mfa. I-mfahas therefore been proposed to function as a molecular switchto suppress the store dependence of TRPC1. The binding ofI-mfa to myogenic factors might explain our observations thatTRPC1 seems to be store dependent in myoblasts (49) but notin adult fibers.

To investigate the role of TRPC1 in skeletal muscle func-tion, we first compared the force produced by EDL and soleusmuscles of TRPC1�/� and TRPC1�/� mice. We observed asignificant decrease of force per cross-sectional area developedby muscles from TRPC1�/� mice, without any shift in thefrequency-response curve. The decrease of force did not seemto be related to the maximal [Ca2�]i reached during contrac-tion. Indeed, we did not observe a significant decrease of Ca2�

release in adult FDB fibers submitted to electrical stimulation(see Fig. 7A, 1st tetanus of experiment). Interestingly, similar

results were obtained in Homer 1�/� mice, in which theactivity of TRPC1 channel seemed to be increased (67). Inagreement with force measurements, we observed a decreaseof 24% in the contents of myofibrillar proteins. We did notobserve any major typical sign of myopathy such as necrosis,regeneration, central nuclei, or fibrosis. We did, however,observe a decrease of the mean cross-sectional area of fiberswithout any change in MHC isoform distribution (in particular,we did not observe any significant increase of type I fibers, which aresmaller). This particular phenotype (smaller fibers with de-creased content of myofibrillar proteins) might reflect a slowerdevelopment that could be due, as mentioned above, to theinteractions between TRPC1 and myogenic factors.

To unravel the possible role of TRPC1-related entry of Ca2�

in muscle function, we studied muscle fatigue in TRPC1�/�

and TRPC1�/� mice. Muscle fatigue consists of a progressivedecrease in relaxation speed and force production when mus-cles are stimulated maximally and repeatedly. It has beenclassically attributed to the accumulation of intracellular lacticacid (39) resulting in acidosis, but it is now clear that this effectcontributes little to muscle fatigue (2) and that intracellularionic changes play a major role in this process (2, 66).

In particular, a partial failure of the SR to release Ca2�

during tetanus has been proposed as a possible cause of fatigue(2, 5). This seems to be due to the accumulation of Ca2�

phosphate in the SR (25, 43). We hypothesized that the entryof Ca2� might also modulate the amount of releasable Ca2�

Fig. 8. In vivo testing. A: escape test: whole body force developed in response to a stimulus (gentle pinching of the tail). Procedure was repeated at short intervalsfor 2.5 min. Results are presented as means of the 5 highest peaks of force recorded, relative to body weight (mN/g) (n � 10 for each strain). B: running wheel:spontaneous running activity measured during the active part of the day (n � 11 for each strain). C: forced treadmill exercise: duration of exercise beforeexhaustion. ***P � 0.001 vs. TRPC1�/� (Student’s t-test, n � 10) D: wire test: mice were suspended from a horizontal metallic wire. Time until micecompletely released their grasp and fell down is shown; scores of the 3 trials were averaged. ***P � 0.001 vs. TRPC1�/� (Student’s t-test, n � 10).




Dow

nloaded from


from the SR. For example, fast twitch muscles intermittentlystimulated at 40 Hz for a total of 30 s show a net influxequivalent to 5–10% of the Ca2� already present in the SR (3).Similarly, we previously showed (24) that in the absence ofexternal Ca2� a faster decline of force is observed. Here, weobserved that the decline of force was faster in TRPC1�/� thanin TRPC1�/� muscles. We therefore compared Ca2� transientsduring all contractions of the fatigue protocol. In normalmuscle, we did not observe any decrease of the [Ca2�]i reachedduring successive tetani. This is probably due to the fact that,for technical reasons, all [Ca2�]i measurements were per-formed in the presence of BTS to avoid movement artifacts, asituation that minimizes ATP consumption and avoids Pi ac-cumulation (and thus accumulation of Ca2� phosphate in theSR). In contrast, the release of Ca2� progressively decreased inmuscle fibers from TRPC1�/� mice, emphasizing the need forCa2� entry through TRPC1-related channel to allow mainte-nance of a normal level of [Ca2�] in the SR and a normalproduction of force during repeated stimulations.

Soleus muscle fatigue was accompanied by a slowing ofrelaxation evidenced by an incomplete loss of force at the endof the 0.5-s period of relaxation between two contractions (Fig.6). The mechanisms inducing this slowing of relaxation arestill not completely understood (3). Some investigators haveshown that relaxation slowing might be due to a decrease ofSERCA pump activity. However, this effect might be partiallycounteracted by a progressive decrease of myofibrillar Ca2�

sensitivity (72, 73). Other studies have proposed a progressivealteration of cross-bridge function (42). Finally, metabolicchanges related to fatigue such as the progressive acidosis andthe accumulation of ADP and Pi exert their effect on myosinand on SERCA pump and may therefore also contribute toslowing of relaxation (4, 20, 26). Our experiments clearly showthat slowing of relaxation is related to an accumulation ofcytosolic Ca2�. Indeed, in the absence of TRPC1 channel, therelease of Ca2� from the SR decreases progressively and theaccumulation of cytosolic Ca2� at the end of the relaxationperiod observed in normal conditions disappears. The conse-quence is a complete relaxation during the whole experimentalprotocol of fatigue.

Finally, we investigated whether this susceptibility to fatiguehad some repercussions in vivo. Interestingly, we observed thatTRPC1�/� mice performed much worse than TRPC1�/� micein the wire test and in the forced treadmill test, two testsdesigned to evaluate the resistance of the animal to enduranceexercise. In contrast, these mice performed totally normally inthe running wheel test and in the escape test, two voluntaryexercises designed to grossly evaluate spontaneous activity andthe force of the animal. We therefore propose that the loss ofendurance observed in TRPC1�/� mice is due, at least par-tially, to the diminution of force production observed in vitroas well as to the accentuation of muscle fatigue. Obviously, thisdoes not exclude possible additional effects not related tomuscle fatigue.

In conclusion, our results emphasize the importance ofTRPC1-related entry of Ca2� in maintaining force productionduring sustained trains of contractions and the importance ofTRPC1 in the acquisition of adult muscle phenotype.

The gating mechanisms of TRPC1 are, however, still un-clear. It might be constitutively active, and because it isresponsible only for a small part of the total entry of Ca2� at

rest, its repression could be undetectable in FURA-PE3quenching studies but emphasized under conditions whereCa2� accumulates in the cytosol, as in fatigue experiments.Alternatively, TRPC1 channel might also be activated duringcontraction. However, we show that it is not store dependent.Launikonis and colleagues (46) recently described an excita-tion-induced Ca2� current from the transverse tubular mem-brane; this current activates following single action potentials,but its biophysical properties plead against TRPC1. Finally, theTRPC1 isoform has been proposed to form a stretch-activatedcation channel when artificially reconstituted in CHO cells(53). However, this issue is still controversial because, underphysiological conditions, mechanosensitive gating has notbeen reported for this channel (22, 37). Here, we show that inthe native environment of skeletal muscle fibers, the TRPC1channel does not exhibit mechanosensitive properties.

In a previous study, we reported (71) that some TRP channelisoforms had an abnormally increased activity in dystrophin-deficient muscle fibers. The channel involved seemed to bestore dependent and mechanosensitive but was insensitive to2-APB (24, 29). The results presented here therefore suggestthat the TRP channel detected in these dystrophic fibers wasnot TRPC1. In addition, another isoform (TRPV2) was recentlyimplicated in the physiopathology of the disease (41, 76).

GRANTS

This work was supported by the “Association française contre les myopa-thies” (AFM), the “Association belge contre les maladies neuro-musculaires”(ABMM), by grant ARC 05/10-328 from the General Direction of ScientificResearch of the French Community of Belgium, the “Programme d’excellenceMarshall” (DIANE convention) from the “Region Walonne,” by grants of theSwiss National Science Foundation (SNSF), the Swiss Foundation for Re-search on Muscular Diseases, and in part by the Intramural Research Programof the National Institutes of Health (project Z01-ES-101684 to L. Birnbaumer).

DISCLOSURES

No conflicts of interest are declared by the author(s).

REFERENCES

1. Abramowitz J, Birnbaumer L. Physiology and pathophysiology ofcanonical transient receptor potential channels. FASEB J 23: 297–328,2009.

2. Allen DG. Skeletal muscle function: role of ionic changes in fatigue,damage and disease. Clin Exp Pharmacol Physiol 31: 485–493, 2004.

3. Allen DG, Lamb GD, Westerblad H. Skeletal muscle fatigue: cellularmechanisms. Physiol Rev 88: 287–332, 2008.

4. Allen DG, Lannergren J, Westerblad H. Muscle cell function duringprolonged activity: cellular mechanisms of fatigue. Exp Physiol 80:497–527, 1995.

5. Allen DG, Westerblad H. Role of phosphate and calcium stores in musclefatigue. J Physiol 536: 657–665, 2001.

6. Ambudkar IS. TRPC1: a core component of store-operated calciumchannels. Biochem Soc Trans 35: 96–100, 2007.

7. Ambudkar IS, Ong HL, Liu X, Bandyopadhyay B, Cheng KT. TRPC1:the link between functionally distinct store-operated calcium channels.Cell Calcium 42: 213–223, 2007.

8. Armstrong CM, Bezanilla FM, Horowicz P. Twitches in the presence ofethylene glycol bis(beta-aminoethyl ether)-N,N=-tetracetic acid. BiochimBiophys Acta 267: 605–608, 1972.

9. Bai CX, Giamarchi A, Rodat-Despoix L, Padilla F, Downs T, TsiokasL, Delmas P. Formation of a new receptor-operated channel by hetero-meric assembly of TRPP2 and TRPC1 subunits. EMBO Rep 9: 472–479,2008.

10. Baylor SM, Chandler WK, Marshall MW. Sarcoplasmic reticulumcalcium release in frog skeletal muscle fibres estimated from Arsenazo IIIcalcium transients. J Physiol 344: 625–666, 1983.




Dow

nloaded from


11. Beech DJ, Xu SZ, McHugh D, Flemming R. TRPC1 store-operatedcationic channel subunit. Cell Calcium 33: 433–440, 2003.

12. Berbey C, Allard B. Electrically silent divalent cation entries in restingand active voltage-controlled muscle fibers. Biophys J 96: 2648–2657,2009.

13. Bianchi CP, Shanes AM. Calcium influx in skeletal muscle at rest, duringactivity, and during potassium contracture. J Gen Physiol 42: 803–815,1959.

14. Boittin FX, Gribi F, Serir K, Beny JL. Ca2�-independent PLA2 controlsendothelial store-operated Ca2� entry and vascular tone in intact aorta. AmJ Physiol Heart Circ Physiol 295: H2466–H2474, 2008.

15. Brooks SV, Faulkner JA. Contractile properties of skeletal muscles fromyoung, adult and aged mice. J Physiol 404: 71–82, 1988.

16. Carlson CG, Makiejus RV. A noninvasive procedure to detect muscleweakness in the mdx mouse. Muscle Nerve 13: 480–484, 1990.

17. Chen CM, Kraut N, Groudine M, Weintraub H. I-mf, a novel myo-genic repressor, interacts with members of the MyoD family. Cell 86:731–741, 1996.

18. Cheung A, Dantzig JA, Hollingworth S, Baylor SM, Goldman YE,Mitchison TJ, Straight AF. A small-molecule inhibitor of skeletalmuscle myosin II. Nat Cell Biol 4: 83–88, 2002.

19. Clapham DE. A STIMulus package puts orai calcium channels to work.Cell 136: 814–816, 2009.

20. Dawson MJ, Gadian DG, Wilkie DR. Mechanical relaxation rate andmetabolism studied in fatiguing muscle by phosphorus nuclear magneticresonance. J Physiol 299: 465–484, 1980.

21. DeHaven WI, Jones BF, Petranka JG, Smyth JT, Tomita T, Bird GS,Putney JW Jr. TRPC channels function independently of STIM1 andOrai1. J Physiol 587: 2275–2298, 2009.

22. Dietrich A, Kalwa H, Storch U, Mederos YSM, Salanova B, Pinken-burg O, Dubrovska G, Essin K, Gollasch M, Birnbaumer L, Guder-mann T. Pressure-induced and store-operated cation influx in vascularsmooth muscle cells is independent of TRPC1. Pflügers Arch 455: 465–477, 2007.

23. Dirksen RT. Checking your SOCCs and feet: the molecular mechanismsof Ca2� entry in skeletal muscle. J Physiol 587: 3149–3151, 2009.

24. Ducret T, Vandebrouck C, Cao ML, Lebacq J, Gailly P. Functionalrole of store-operated and stretch-activated channels in murine adultskeletal muscle fibres. J Physiol 575: 913–924, 2006.

25. Dutka TL, Cole L, Lamb GD. Calcium phosphate precipitation in thesarcoplasmic reticulum reduces action potential-mediated Ca2� release inmammalian skeletal muscle. Am J Physiol Cell Physiol 289: C1502–C1512, 2005.

26. Edwards RH, Hill DK, Jones DA. Metabolic changes associated with theslowing of relaxation in fatigued mouse muscle. J Physiol 251: 287–301,1975.

27. Endo M. Calcium release from the sarcoplasmic reticulum. Physiol Rev57: 71–108, 1977.

28. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B,Hogan PG, Lewis RS, Daly M, Rao A. A mutation in Orai1 causesimmune deficiency by abrogating CRAC channel function. Nature 441:179–185, 2006.

29. Franco-Obregon A Jr, Lansman JB. Mechanosensitive ion channels inskeletal muscle from normal and dystrophic mice. J Physiol 481: 299–309, 1994.

30. Gailly P. New aspects of calcium signaling in skeletal muscle cells:implications in Duchenne muscular dystrophy. Biochim Biophys Acta1600: 38–44, 2002.

31. Gailly P, Boland B, Himpens B, Casteels R, Gillis JM. Critical evalu-ation of cytosolic calcium determination in resting muscle fibres fromnormal and dystrophic (mdx) mice. Cell Calcium 14: 473–483, 1993.

32. Gailly P, De Backer F, Van Schoor M, Gillis JM. In situ measurementsof calpain activity in isolated muscle fibres from normal and dystrophin-lacking mdx mice. J Physiol 582: 1261–1275, 2007.

33. Gailly P, Hermans E, Gillis JM. Role of [Ca2�]i in “Ca2� storesdepletion-Ca2� entry coupling” in fibroblasts expressing the rat neuroten-sin receptor. J Physiol 491: 635–646, 1996.

34. Gailly P, Hermans E, Octave JN, Gillis JM. Specific increase of geneticexpression of parvalbumin in fast skeletal muscles of mdx mice. FEBSLett 326: 272–274, 1993.

35. Gervasio OL, Whitehead NP, Yeung EW, Phillips WD, Allen DG.TRPC1 binds to caveolin-3 and is regulated by Src kinase—role inDuchenne muscular dystrophy. J Cell Sci 121: 2246–2255, 2008.

36. Gissel H, Clausen T. Excitation-induced Ca2� uptake in rat skeletalmuscle. Am J Physiol Regul Integr Comp Physiol 276: R331–R339, 1999.

37. Gottlieb P, Folgering J, Maroto R, Raso A, Wood TG, Kurosky A,Bowman C, Bichet D, Patel A, Sachs F, Martinac B, Hamill OP,Honore E. Revisiting TRPC1 and TRPC6 mechanosensitivity. PflügersArch 455: 1097–1103, 2008.

38. Hewavitharana T, Deng X, Soboloff J, Gill DL. Role of STIM and Oraiproteins in the store-operated calcium signaling pathway. Cell Calcium 42:173–182, 2007.

39. Hill A, Kupalov P. Anaerobic and aerobic activity in isolated muscle.Proc R Soc Lond B 105: 313–322, 1929.

40. Hirn C, Shapovalov G, Petermann O, Roulet E, Ruegg UT. Nav1.4deregulation in dystrophic skeletal muscle leads to Na� overload andenhanced cell death. J Gen Physiol 132: 199–208, 2008.

41. Iwata Y, Katanosaka Y, Arai Y, Shigekawa M, Wakabayashi S.Dominant-negative inhibition of Ca2� influx via TRPV2 amelioratesmuscular dystrophy in animal models. Hum Mol Genet 18: 824–834,2009.

42. Jones DA, de Ruiter CJ, de Haan A. Change in contractile properties ofhuman muscle in relationship to the loss of power and slowing ofrelaxation seen with fatigue. J Physiol 576: 913–922, 2006.

43. Kabbara AA, Allen DG. The role of calcium stores in fatigue of isolatedsingle muscle fibres from the cane toad. J Physiol 519: 169–176, 1999.

44. Kim MS, Zeng W, Yuan JP, Shin DM, Worley PF, Muallem S. Nativestore-operated Ca2� influx requires the channel function of Orai1 andTRPC1. J Biol Chem 284: 9733–9741, 2009.

45. Launikonis BS, Rios E. Store-operated Ca2� entry during intracellularCa2� release in mammalian skeletal muscle. J Physiol 583: 81–97, 2007.

46. Launikonis BS, Stephenson DG, Friedrich O. Rapid Ca2� flux throughthe transverse tubular membrane, activated by individual action potentialsin mammalian skeletal muscle. J Physiol 587: 2299–2312, 2009.

47. Liao Y, Erxleben C, Abramowitz J, Flockerzi V, Zhu MX, ArmstrongDL, Birnbaumer L. Functional interactions among Orai1, TRPCs, andSTIM1 suggest a STIM-regulated heteromeric Orai/TRPC model forSOCE/Icrac channels. Proc Natl Acad Sci USA 105: 2895–2900, 2008.

48. Liu X, Singh BB, Ambudkar IS. TRPC1 is required for functionalstore-operated Ca2� channels. Role of acidic amino acid residues in theS5-S6 region. J Biol Chem 278: 11337–11343, 2003.

49. Louis M, Zanou N, Van Schoor M, Gailly P. TRPC1 regulates skeletalmyoblast migration and differentiation. J Cell Sci 121: 3951–3959, 2008.

50. Lyfenko AD, Dirksen RT. Differential dependence of store-operated andexcitation-coupled Ca2� entry in skeletal muscle on STIM1 and Orai1. JPhysiol 586: 4815–4824, 2008.

51. Ma R, Rundle D, Jacks J, Koch M, Downs T, Tsiokas L. Inhibitor ofmyogenic family, a novel suppressor of store-operated currents through aninteraction with TRPC1. J Biol Chem 278: 52763–52772, 2003.

52. Marechal G, Beckers-Bleukx G. Force-velocity relation and isomyosinsin soleus muscles from two strains of mice (C57 and NMRI). PflügersArch 424: 478–487, 1993.

53. Maroto R, Raso A, Wood TG, Kurosky A, Martinac B, Hamill OP.TRPC1 forms the stretch-activated cation channel in vertebrate cells. NatCell Biol 7: 179–185, 2005.

54. Martonosi AN, Pikula S. The network of calcium regulation in muscle.Acta Biochim Pol 50: 1–30, 2003.

55. Merritt JE, Jacob R, Hallam TJ. Use of manganese to discriminatebetween calcium influx and mobilization from internal stores in stimulatedhuman neutrophils. J Biol Chem 264: 1522–1527, 1989.

56. Mizunoya W, Wakamatsu J, Tatsumi R, Ikeuchi Y. Protocol forhigh-resolution separation of rodent myosin heavy chain isoforms in amini-gel electrophoresis system. Anal Biochem 377: 111–113, 2008.

57. Peel SE, Liu B, Hall IP. ORAI and store-operated calcium influx inhuman airway smooth muscle cells. Am J Respir Cell Mol Biol 38:744–749, 2008.

58. Pulido SM, Passaquin AC, Leijendekker WJ, Challet C, WallimannT, Ruegg UT. Creatine supplementation improves intracellular Ca2�

handling and survival in mdx skeletal muscle cells. FEBS Lett 439:357–362, 1998.

59. Raymackers JM, Debaix H, Colson-Van Schoor M, De Backer F,Tajeddine N, Schwaller B, Gailly P, Gillis JM. Consequence of parv-albumin deficiency in the mdx mouse: histological, biochemical andmechanical phenotype of a new double mutant. Neuromuscul Disord 13:376–387, 2003.

60. Raymackers JM, Gailly P, Schoor MC, Pette D, Schwaller B, Hun-ziker W, Celio MR, Gillis JM. Tetanus relaxation of fast skeletal muscles




Dow

nloaded from


of the mouse made parvalbumin deficient by gene inactivation. J Physiol527: 355–364, 2000.

61. Rolland JF, De Luca A, Burdi R, Andreetta F, Confalonieri P, ConteCamerino D. Overactivity of exercise-sensitive cation channels and theirimpaired modulation by IGF-1 in mdx native muscle fibers: beneficialeffect of pentoxifylline. Neurobiol Dis 24: 466–474, 2006.

62. Rychkov G, Barritt GJ. TRPC1 Ca2�-permeable channels in animalcells. Handb Exp Pharmacol: 23–52, 2007.

63. Saleh SN, Albert AP, Peppiatt CM, Large WA. Angiotensin II activatestwo cation conductances with distinct TRPC1 and TRPC6 channel prop-erties in rabbit mesenteric artery myocytes. J Physiol 577: 479–495, 2006.

64. Schakman O, Gilson H, de Coninck V, Lause P, Verniers J, HavauxX, Ketelslegers JM, Thissen JP. Insulin-like growth factor-I gene trans-fer by electroporation prevents skeletal muscle atrophy in glucocorticoid-treated rats. Endocrinology 146: 1789–1797, 2005.

65. Soboloff J, Spassova MA, Dziadek MA, Gill DL. Calcium signalsmediated by STIM and Orai proteins—a new paradigm in inter-organellecommunication. Biochim Biophys Acta 1763: 1161–1168, 2006.

66. Stephenson DG, Lamb GD, Stephenson GM. Events of the excitation-contraction-relaxation (E-C-R) cycle in fast- and slow-twitch mammalianmuscle fibres relevant to muscle fatigue. Acta Physiol Scand 162: 229–245, 1998.

67. Stiber JA, Zhang ZS, Burch J, Eu JP, Zhang S, Truskey GA, Seth M,Yamaguchi N, Meissner G, Shah R, Worley PF, Williams RS, Rosen-berg PB. Mice lacking Homer 1 exhibit a skeletal myopathy characterizedby abnormal transient receptor potential channel activity. Mol Cell Biol28: 2637–2647, 2008.

68. Suchyna TM, Sachs F. Mechanosensitive channel properties and membranemechanics in mouse dystrophic myotubes. J Physiol 581: 369–387, 2007.

69. Turner PR, Westwood T, Regen CM, Steinhardt RA. Increased proteindegradation results from elevated free calcium levels found in muscle frommdx mice. Nature 335: 735–738, 1988.

70. Vandebrouck A, Sabourin J, Rivet J, Balghi H, Sebille S, Kitzis A,Raymond G, Cognard C, Bourmeyster N, Constantin B. Regulation ofcapacitative calcium entries by alpha1-syntrophin: association of TRPC1with dystrophin complex and the PDZ domain of alpha1-syntrophin.FASEB J 21: 608–617, 2007.

71. Vandebrouck C, Martin D, Colson-Van Schoor M, Debaix H, GaillyP. Involvement of TRPC in the abnormal calcium influx observed indystrophic (mdx) mouse skeletal muscle fibers. J Cell Biol 158: 1089–1096, 2002.

72. Westerblad H, Allen DG. The contribution of [Ca2�]i to the slowing ofrelaxation in fatigued single fibres from mouse skeletal muscle. J Physiol468: 729–740, 1993.

73. Westerblad H, Lannergren J, Allen DG. Slowed relaxation in fatiguedskeletal muscle fibers of Xenopus and mouse. Contribution of [Ca2�]i andcross-bridges. J Gen Physiol 109: 385–399, 1997.

74. Worley PF, Zeng W, Huang GN, Yuan JP, Kim JY, Lee MG, MuallemS. TRPC channels as STIM1-regulated store-operated channels. CellCalcium 42: 205–211, 2007.

75. Yuan JP, Zeng W, Huang GN, Worley PF, Muallem S. STIM1heteromultimerizes TRPC channels to determine their function as store-operated channels. Nat Cell Biol 9: 636–645, 2007.

76. Zanou N, Iwata Y, Schakman O, Lebacq J, Wakabayashi S, Gailly P.Essential role of TRPV2 ion channel in the sensitivity of dystrophicmuscle to eccentric contractions. FEBS Lett (October 16, 2009). doi:10.1016/j.febslet.2009.10.033.




Dow

nloaded from


Role of TRPC1 channel in skeletal muscle function

Documents

Transcript of Role of TRPC1 channel in skeletal muscle function