B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

BRES-42115; No. of pages: 12; 4C: 2, 3, 4, 7

Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te /b ra i n res

Research Report

Role of selected mutations in the Q/N rich region of TDP-43 inEGFP-12xQ/N-induced aggregate formation

Mauricio Budini, Valentina Romano, S. Eréndira Avendaño-Vázquez, Sara Bembich,Emanuele Buratti, Francisco E. Baralle⁎

International Centre for Genetic Engineering and Biotechnology (ICGEB) 34012 Trieste, Italy

A R T I C L E I N F O

⁎ Corresponding author at: ICGEB, PadricianoE-mail address: baralle@icgeb.org (F.E. Ba

0006-8993/$ – see front matter © 2012 Elseviedoi:10.1016/j.brainres.2012.02.031

Please cite this article as: Budini, M., et alaggregate formation, Brain Res. (2012), d

A B S T R A C T

Article history:Accepted 3 February 2012

The overview of TDP 43 functions immediately disclose a number of open questions regardingits pathological role. The formation of TDP-43 aggregates is one of the major distinguishingfeatures of TDP-43 proteinopathies, especially in patients affected by Amyotrophic LateralSclerosis (ALS) and Frontotemporal Lobar degeneration (FTLD). At the moment, however,very little is known regarding the biological processes that underlie TDP-43 aggregation and,most importantly, its potential consequences on cellular metabolism. For these reasons, it isparticularly important to further investigate this process in order to gain a better understand-ing of the pathology and to develop novel therapeutic effectors. In this report, we focus on aseries of missense mutations associated with disease in the 342–366 region of this protein toexamine their ability to affect RNA splicing regulation and to induce aggregate formation. Inparticular, aggregate formation was assessed in a novel system capable of inducing TDP-43aggregation in experimental cell lines and primary neuronal cultures. The results of this anal-ysis showed that the presence of two of these missense mutations in the 342–366 region(G348V and N352S) could differentially affect the levels and appearance of TDP-43 aggregationwith respect to the wild-type protein.This article is part of a Special Issue entitled RNA-Binding Proteins.

© 2012 Elsevier B.V. All rights reserved.

Keywords:TDP-43AggregationQ/N regionsPolyglutamineAutoregulationDisease mutationsSplicing

1. An introduction to TDP-43 and its openquestions

Nuclear factor TDP-43 became a focus of attention in the neuro-biology field 5 years ago when two groups independentlyreported its presence in the neuronal aggregates of patientsaffected by Amyotrophic Lateral Sclerosis (ALS) and Frontotem-poral Lobar Degeneration (FTLD) (Arai et al., 2006; Neumann,2009; Neumann et al., 2006). Since then, TDP-43 aggregationhas been described to occur in the brain of patients affected byseveral other neurodegenerative diseases that are now collec-tively described as TDP-43 proteinopathies (Geser et al., 2009).

99, I-34149, Trieste, Italy.ralle).

r B.V. All rights reserved.

., Role of selectedmutatioi:10.1016/j.brainres.201

At themoment, the significance of these aggregateswith regardto the pathology is unclear, and several possibilities are stilldebated as to whether they may be directly or indirectly toxicfor neuronal cells, just an epiphenomenon correlating withdisease, or even have a neuroprotective effect by sequesteringaberrantly folded proteins (Baloh, 2011). Regarding these issues,it is important to keep in mind that TDP-43 has been shown toplay a great variety of roles in the cellular metabolism mainlyin RNA splicing (Buratti et al., 2001; Passoni et al., 2012) butcovering awide range of gene expression stages from transcrip-tion to translation and stress granule formation (Buratti andBaralle, 2008, 2010; Fiesel and Kahle, 2011). The current under-

Fax: +39 040 3757361.

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

2 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

standing is summarized in Fig. 1. This array of potentialfunctions has led to the proposal of several disease pathwaysthat have been summarized as “loss-of-function” and “gain-of-function” (Buratti and Baralle, 2009; Lee et al., 2011).

Briefly, the “loss-of-function” model is based on thehypothesis that the cytoplasmic aggregates act as a “TDP43sink” and determine the clearance of this protein from thenucleus. This would lead to the disruption of most of the pro-cesses controlled by TDP-43 in this nuclear compartment, in-cluding the recently described TDP-43 autoregulation process(Ayala et al., 2011) that is schematically reported in Fig. 2A. Asshown in this figure, in fact, expression of a TDP-43 wild-typetransgene (TG) following Tet induction (+ lane) causes thedownregulation of the endogenous gene. This autoregulationprocess following the production of the transgene, also ob-served in several mice models (Igaz et al., 2011; Wegorzewskaet al., 2009; Xu et al., 2010), can be duplicated using a reporterconstruct that contains the 3′UTR region of TDP 43 pre-mRNAand expresses the GFP fusion protein (GFP-3′UTRwt) but is abol-ished following the deletion of the TDPBR region that containsseveral non-UG binding sites for the TDP-43 protein itself (con-struct Δ669). Interestingly, loss of autoregulation can also beachieved if we abolish the ability to splice of intron 7, construct×7 Δgt-ag (Fig. 2A and unpublished data from our laboratory).

On the other hand, a “gain of function” mechanism is basedon potential aberrant roles of TDP-43 when localized in the

RRM1 RRM2

NLS

N

NE

RRM domainsN-terminal tail

miRNA processing

au

pre-mRNAsplicing

Transcriptionalregulation

1

Fig. 1 – Schematic diagram of TDP-43 basic protein architecture (eukaryotic cell. Possible causes of aggregate formation are also i

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

cytoplasm, increased degradation to yield toxic fragments, orby the potentially toxic properties of the aggregates themselves.Of course, bothmodels arenotmutually exclusive andmayactu-ally act at the same time to determine disease onset andprogression.

Although evidence has been gathered that supports bothmechanisms, the development of various animal models inrecent years has provided compelling results with regard tothe observation that depletion of TDP-43 can yield phenotypiceffects that are similar to ALS. For example, one of the earliestevidences in this direction was obtained in Drosophila whereit was shown that deletion of the Drosophila homolog ofTDP-43 results in loss of neuromuscular junction formation,a paralytic phenotype, and reduced lifespan (Feiguin et al.,2009). This result has been confirmed in several other flymodels (Lin et al., 2011; Lu et al., 2009), and more recentmouse and human cell line studies have confirmed that de-pletion of TDP-43 can lead to major changes in the expressionof genes that have been previously seen to participate in neu-rodegeneration (Polymenidou et al., 2011; Tollervey et al.,2011). In real disease situations, TDP-43 is not artificially de-pleted from cells as it has been achieved in all these modelsystems. However, any aggregation process occurring in thecellular cytoplasm might mimic exactly just this kind of situ-ation, as it would result in the total or even partial reductionof TDP-43 levels within the nucleus. Such a depletion might

C-terminal tail

C

S Q/N

toregulation

TDP Binding region (TDPBR)

AAAAAA

m7G

mRNA transport and stability

414342 366

Aggregation (via stress granules?)

Translation

top left) and of TDP43-regulated cellular functions inside thendicated.

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

+ + + + +- + + + +

- - 2 4 8 25

hnRNP A2TDP- 43+

+

M

5GFP 6 7 8

GFP-3’UTR wt65GFP 7 8

– +

Tet

tag

tag

TDPBR

GFP 7 8tag

2 3 4 51 66 7 8

tag

A

B TAT-pCont

TD

P-

43M

erge

(TD

P-

43/D

AP

I)

TAT-p342-366C

GFPreporters

endogenousTG

Non - coding

Coding

µ

x7

Fig. 2 – Fig. 2A shows that expression of a flag-tagged TDP-43 transgene (TG) following Tet treatment of stably transfectedHEK293 cell lines can induce downregulation of the endogenous protein (endogenous) as detected using a polyclonal antibodyagainst TDP-43 protein (α-TDP43). Autoregulation also works when using an EGFP reporter construct carrying the last portionof the TDP-43 gene starting from exon 5 (GFP-3′UTRWT) before (−) and after (+) the induction of transgenic TDP-43. In this case,Western blot is performed using aα-GFP antibody. Other GFP reporter constructs used in this assay are schematically reportedas well (Fig. 2A, lower panels). Fig. 2B shows the effect of adding a TDP-43 peptide carrying the 342–366 sequence to inhibitsuper-shift formation formed by a (ug)6-TDP43-hnRNP A2 complex. As shown in this gel, aggregate formation is observed inthe origin of the gel following successful inhibition of super-shift formation. No inhibition can be observed using a controlpeptide (pCont). When these two peptides are transduced in U2OS cells by addition of a TAT tail, aggregations (indicated byarrows) can be observed to occur in the cytoplasm of p342–366 transduced cells but not in pCont transduced cells (Fig. 2C).

3B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

lead both to disruption of all TDP-43-controlled processes and,because autoregulation occurs through a negative feedbackloop, the increased production of TDP-43 that might contributeto increase aggregate formation and thus establishing a viciouscycle that might eventually lead to cellular death. For this rea-son, setting up model systems to study and mimic TDP-43aggregation process might be an important tool to test thesekinds of connections.

2. Results

2.1. Setting up a TDP-43 aggregation model

In previous studies, we have identified the exact interactingregion of TDP-43 with several members of the hnRNP family(Buratti et al., 2005; D'Ambrogio et al., 2009). Using biochemicaland functional approaches, the TDP-43 interacting region hasbeen narrowed down to residues 342–366 in the C-terminalsequences. More recently, this interaction of TDP-43withmem-bers of the hnRNP proteins has been recently confirmed by im-munoprecipitation (Zhang et al., 2009) and proteomic studies(Freibaum et al., 2010; Ling et al., 2010). As a first approachtowards gaining a better understanding of the functional prop-erties of this region, in our studies we tested a peptide carrying

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

this sequence for its ability to inhibit the interaction of wild-type TDP-43 recombinant protein with hnRNPA2 (visualized assuper-shift complex in an EMSA assay) (Fig. 2B). As shown inthis figure, addition of a recombinant peptide carrying thewild-type 342–366 sequence to a UG6-TDP43-hnRNP A2 super-shifted complex had the effect of abolishing the interactionwith hnRNP A2 while leaving intact the interaction betweenTDP-43 and the (UG)6 labeled RNA. Most importantly, loss ofsuper-shift formation was also associated with the formationof a retarded/aggregated complex that accumulates in theorigin of the gel. It was then decided to check whether the342–366 C-terminal region was capable of inducing a similarkind of aggregate formation in vivo when transfected intoU2OS cell lines. In order to test this hypothesis, we have there-fore synthesized a 339–366 peptide (TAT-339-366) that could betransduced directly in culture cells through the addition of“TAT”N-terminal tail using a strategy that has been used beforein investigating neuronal processes (Lavaur et al., 2007; Nagel etal., 2008). The three extra residues at the N-terminal tail wereadded to better distance the 342–366 region from the TAT tail.Following the introduction of the TAT-p342–366 peptide adistinct pattern of aggregates made its appearance in the cellcytoplasm (Fig. 2C, left panels, indicated by arrow). On theother hand, few aggregates could be detected following theintroduction of a control peptide that also carries a Tat

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

4 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

N-terminal tail (Fig. 2C, right panels). A quantification of morethan 100 individual cells transduced with the two peptidesshowed that an average of 38% of cells transduced with theTAT-p342–366 peptide contained these aggregates againstapproximately 8% of cells transduced with the control peptide(TAT-pCont).

2.2. Mutations in the 342–366 region: importance forinteraction with hnRNP A2 and aggregation

Although aggregation of TDP-43 usually occurs in neurons thatexpress the wild type protein, TDP-43 disease-associatedmuta-tions may be of help to understand the aggregation process. Infact, several of these TDP-43 mutations have been reported toenhance inclusion formation in a variety of experimental sys-tems (Arai et al., 2010; Johnson et al., 2009; Nonaka et al., 2009).In this report, therefore, it was of interest to investigate theeffect of missense mutations in the sequence 342–366 to deter-mine their possible effects onhnRNPbinding, splicing regulation,and aggregate formation (see Fig. 3A and Table 1 for a summaryof the experimental data regarding the possible effect of thesemutations as reported so far). Therefore, it was of interest to fur-ther explore their functional effects on protein functionality/ag-gregation potential using our available experimental systems.

The peptide competition experiment was then repeatedwith peptides that carried the missense mutations shown inFig. 3A added in increasing concentrations to a mix that couldform this super-shifted complex. As reported in Fig. 3B, at highconcentrations (25 μM) only the G348C peptide could competefor super-shift formation (consistent with D'Ambrogio et al.,2009) and only P363A could induce significant aggregation inthe wells of the acrylamide gel (Fig. 3B, last panel). Based onthese results we concluded that most of these mutation-carrying peptides could not efficiently compete for the TDP-43-hnRNP A2 interaction, raising the possibility therefore that

SQQNQSGPSGNNQNQGNMQR

- 7,5 15 25- 7,5 15 25 - 7,51M - 7,5 15 25

A

B

RRM1 RRM2

NLSN

NES Q/N

1 342 366

Q343R

N345K

G348CG348V N352S R361

µ

Fig. 3 – Fig. 3A shows a schematic diagram of the different synthmutations that fall in the 342–366 TDP-43 region. The same expecarried the missense mutations. Peptide concentrations are indi

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

these mutations could have affected the splicing properties ofTDP-43.

2.3. Effect of disease-associated mutations on pre-mRNAsplicing

We therefore decided to experimentally test the splicing func-tionality of three of the least efficient competing mutants(N345K, G348V, and N352S) and to achieve greater confidencein this evaluation we used two add-back assays previously setup for the functional identification of the 321–366 region ofTDP-43 (D'Ambrogio et al., 2009). These two minigenesystems, based on Apo AII exon 3 and CFTR exon 9, carrymutations in two enhancer elements within their sequencein order to enhance their dependence on TDP-43 cellularlevels for correct exon inclusion (Fig. 4A, lane 1). As expected,when the endogenous TDP-43 was removed both Apo andCFTR exon recognition substantially increased in both cases(Fig. 4A, lane 2) and splicing inhibition was fully recoveredfollowing addition of a si-resistant TDP-43 wild-type molecule(Fig. 4A, lane 3). We then tested the effect of si-resistant TDP-43 molecules that carried the three mutations. These proteinswere expressed at the same level as the si-resistant wild-typeprotein (see Western blots in Fig. 4B). As shown in Figs. 4Cand D, the quantification of the Apo AII exon 3 and CFTRexon 9 inclusion levels based on the densitometric readingof the RT-PCR showed an average drop of approximately 10%in the ability of each of these mutants to promote exon skip-ping. Statistical analysis showed that this reduced splicing ef-fect may be marginally statistically significant (p<0.05). It isdifficult to definitively conclude if this slight defect in splicingfunction may or may not have consequences in the cellularmetabolism during the life time of an organism, it is morelikely that other TDP-43 properties, such as solubility, may beaffected by the mutations.

EPNQA

5 25 - 7,5 15 25 - 7,5 15 25 - 7,5 15 25

C

414

SP363A

etic peptides carrying known disease-associated missenseriment described in Fig. 2B was repeated using peptides thatcated in the figure.

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

Table 1 – TDP-43 mutations in the 342–366 hnRNP binding region.

Mutation Mutation reported by a Functional consequences of the mutation b Other references c

Q343R (Yokoseki et al., 2008) Probable increase in fragment production. Whenexpressed in yeast, this mutation causes increasedaggregation and toxicity in vivo with respect to wildtype TDP-43. Promotes number of aggregates inSH-SY5Y cells.

(Johnson et al., 2009;Nonaka et al., 2009)

N345K (Rutherford et al., 2008; Ticozzi et al., 2011a) Increased degradation in lymphoblastoid cell line.When expressed in yeast, this mutation causesincreased aggregation and toxicity in vivo withrespect to wild type TDP-43.

(Johnson et al., 2009)

G348C (Daoud et al., 2009; Del Bo et al., 2009; Kabashiet al., 2008; Kuhnlein et al., 2008; Millecampset al., 2010; Ticozzi et al., 2011a)

Increased degradation in lymphoblastoid cell line.Neurotoxic when injected in primary motor neuronsand zebrafish embryos. Forms larger-size stressgranules than wild type TDP-43 following sorbitoltreatment. Transgenic mice carrying human genomicfragments bearing this mutation develop manyage-related pathological hallmarks of ALS includingTDP-43 positive inclusions and cleavage fragments.Results in premature lethality when expressedubiquitously in a Drosophila model.

(Dewey et al., 2011; Kabashiet al., 2010; Swarup et al.,2011; Voigt et al., 2010)

G348V (Kirby et al., 2010) n.d.G348R (Ticozzi et al., 2011b) One FALS patient carrying this mutation also carried a

missense mutation, R395Q in the TAF15 gene.N352S (Iida et al., 2010; Kamada et al., 2009; Kuhnlein

et al., 2008)n.d.

N352T (Ticozzi et al., 2011a) n.d.G357S (Iida et al., 2010) n.d.M359V (Borroni et al., 2010) n.d.R361S (Kabashi et al., 2008) Increased degradation in lymphoblastoid cell line.

When expressed in yeast, this mutation causesincreased aggregation and toxicity in vivo withrespect to wild type TDP-43. Does not interfere withbinding to FUS/TLS or complex forming potential ingel filtration experiments. Cells expressing thismutation have deregulated G3BP and TIA-1 levels andare hampered in their ability to form SGs.

(Johnson et al., 2009; Kim etal., 2010; McDonald et al.,2011)

P363A (Daoud et al., 2009) n.d.

a Reference of mutation report.b Not determined (n.d.).c Reference containing only functional consequences (no patients).

5B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

2.4. Repeated units of the 331–369Q/N rich region of TDP-43can trigger aggregation within cells

As part of the establishment of a model system that couldallow the study of TDP-43 aggregation under experimentalconditions we have recently found that in various cell lines(and in rat primary neuronal cultures) the introduction of aplasmid expressing an EGFP protein fused to twelve 331–369Q/N tandem repeats of TDP-43 (Fig. 5A, right schematicdiagram) can trigger the formation of phosphorylated and ubi-quitinated aggregates in a way that is similar to the appear-ance observed in patients (Budini et al., 2011). As shown inFig. 5B (upper panels), cotransfecting this plasmid togetherwith a flag TDP-43 wild-type caused the appearance of severalaggregates within the cytoplasm of the cell that had the abilityto recruit the wild-type flagged TDP-43 protein (Fig. 5B, upperpanels,merge EGFP/TDP-43 image). As expected, noaggregationcould be observed using a control plasmid overexpressing theEGFP protein itself (Fig. 5B, lower panels). We therefore usedthis model to investigate the effect played by pathologicalmissense mutations found in the Q/N-rich region of TDP-43.

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

2.5. Effect of the G348V and N352S mutations on EGFP-12xQ/N induced aggregation

In order to investigate whether these missense mutationscould possess different aggregation properties with respectto wild-type TDP-43 we then performed cotransfection inU2OS cells of the EGFP-12xQ/N construct with flag-TDP-43wild type and two mutants, one carrying the G348V mutationand the other carrying the N352S mutation. In order to avoidany interference from endogenous TDP-43, U2OS cells werealso treated with TDP-43 siRNA before transfecting thesesiRNA-resistant mutants (Fig.6A). As previously reported, theresults of this experiment showed that colocalization occurredefficiently between TDP-43 wild type and EGFP-12xQ/N(Fig. 6B, top panels) (Budini et al., 2011). Interestingly, in bothmutants this aggregation/colocalization process seemed to besubstantially increased with respect to TDP-43 wild-type andalso to the outward appearanceof the aggregates (Fig.6B,middleand bottompanels). This specific increase observed for themu-tants was confirmed by quantification of the number of aggre-gates greater than 4 μm2 in the three transfection experiments

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

Fig. 4 – This figure shows the effect on CFTR exon 9 and Apo AII exon 3 recognition following knock-down of the endogenousTDP-43 (siTDP-43) upon adding back si-resistant wild-type flag-TDP-43WT or three different flag-TDP-43 mutants carrying theN345K, G348V, and N352S mutants. The results of RT-PCRs for each reporter plasmid are showed in the two upper panels(Fig. 4A). The + and −marks indicate the inclusion or exclusion of the exons, respectively. The two lower panels showWesternblots against flag TDP-43 and tubulin to check for silencing efficiency and equal transgene expression (Fig. 4B). The rightpanels, Figs. 4C and D, show a densitometric quantification of exon inclusion for each reporter plasmid. Standard deviationswere obtained from three independent transfection experiments.

6 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

(Fig. 6C). No cytoplasmic co-localization could be observedwhen either these mutants were contransfected with theplasmid expressing EGFP alone (data not shown and asdemonstrated for thewild-type protein in Fig. 5B, lower panels).Some cells showed also a decrease in the nuclear TDP-43 signallike some neurons in patient's brains suggesting a possible lossof nuclear function. However, this was by nomeans a phenom-enon observed in all the cells.

Finally, this apparent ability of mutant TDP-43 proteins tobetter aggregate with the EGFP-12XQ/N construct was alsoassayed in a quantifiable manner following their transfectionin U2OS cells together with the flag-TDP-43 (in each case, co-transfection with EGFP was used as a control). The cell lysateswere then centrifuged and the soluble (S) and pelleted (P) frac-tions were analyzed by Western blot for flag-TDP-43 localiza-tion. In the presence of EGFP, both wild type and mutantproteins were predominantly localized in the soluble fraction(S) following transfection (the input lane, IN, also demon-strates that all proteins were expressed to similar levels)(Fig. 7, upper panels). On the other hand, the results in Fig. 7,lower panel, show that transfection of wildtype and mutant

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

TDP-43s with EGFP-12XQ/N has the effect of increasing con-siderably the amount of TDP-43 protein in the pellet (P) frac-tion with respect to the soluble (S) fraction. In particular, thisshift from the S to the P fraction was particularly evident forthe TDP-43 proteins carrying the mutation.

3. Discussion

The identification of missense mutations in the C-terminalregion of TDP-43 that segregated with familial ALS casesstrengthens the link between TDP-43 aggregation and disease(Sreedharan et al., 2008). Since then, many screening studieshave been performed in patients and more than forty muta-tions have been described so far. In the last few years, severalreview articles and dedicated databases have been publishedon the subject of these TDP-43 mutations. They have beenshown to occur in approximately 5% of all familial ALS casesand 00.5–2% of sporadic cases (Banks et al., 2008; Barmadaand Finkbeiner, 2010; Pesiridis et al., 2009; Pinto et al., 2011).Moreover, several recent animal models have overexpressed

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

pEGFPC-2pEGFPC-2

EG

FP

EG

FP

-12x

Q/N

Flag-TDP-43(anti-Flag)

MergeEGFP/TDP-43

A

B

Fig. 5 – This figure shows a schematic diagram of the plasmids EGFP and EGFP-12xQ/N plasmids (Fig. 5A). Fig. 5B shows animmunofluorescence of U2OS cells transfected with EGFP and EGFP-12xQ/N (green) together with a plasmid expressingrecombinant flagged TDP-43 (red). Cell nuclei were visualized with DAPI. The merged images showed co-localization ofendogenous TDP-43 aggregates with those from EGFP-12xQ/N (yellow). (Scale bars: 10 μm).

7B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

mutation-carrying proteins in a variety of animal and diseasemodels that include yeast, Drosophila, C. elegans, mice, rat,and zebrafish. The results of several of these models havebeen reviewed in a series of recent publications (Gendronand Petrucelli, 2011; Wegorzewska and Baloh, 2011). However,as discussed in these publications, results have been ratherconflicting even within the same organism. Probably, mostof these difficulties reside in the observation that different pro-moters can produce different levels and patterns of expression.The consequence of this variability makes it especially difficultto separate mutation-specific effects from the background ofnatural TDP-43 toxicity when overexpressed, as pointed out ina recent study (Voigt et al., 2010).

For all these reasons, what is sorely needed is an experimen-tal model that can reproducibly mimic TDP-43 aggregation orother pathological features in a “uniform” background onwhich one can then test the effect of different mutations ofTDP-43 (or other type of effectors such as positive and negativeregulators of aggregation). In this respect, the EGFP-12XQ/Nconstructmight represent one of the first attempts in this direc-tion (Budini et al., 2011). It should always be considered, none-theless, the fact that these aggregates are similar but notidentical to patient's aggregates. Among the similarities, infact, we can include their prevalent cytoplasmic localization,

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

and the observation that they are ubiquitinated and phosphor-ylated (Budini et al., 2011). Besides the obvious absence of any12XQ/N repeats in the human pathology, however, the mostnotable differences are represented by the observation thatthe co-localized TDP-43 in our aggregates is not cleaved togenerate the classical C-terminal fragments and does notshow concomitant or previous colocalization in stress granules.Further work, therefore, will be required to exactly determineall the similarities/differences and hence their eventual prosand cons for use as a pathological aggregation model. None-theless, as shown in this report, this system can be used toeffectively test for specific aggregation effects of TDP-43 mis-sense mutations.

4. Experimental procedure

4.1. Plasmid preparation

The flag-tagged TDP-43 mutants N345K, G348V and N352Swere generated by site-directed mutagenesis using comple-mentary primers carrying the point mutation in the originalpFlag TDP-43 wild-type construct (Ayala et al., 2008). Theprimers used were as follows: for the N345K mutant primers

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

G384VEGFP-12xQ/N Merge

N352SEGFP-12xQ/N Merge

WTEGFP-12xQ/N Merge

fTDP-43

EndTDP-43

N35

2S

G34

8VWT

+

+ +

siTDP-43 -

A

C

B

% cells containingaggregates 4µm2

0

10

20

30

40

WT G348V N352S

+ + +

Fig. 6 – Fig. 6A shows a Western blot depicting the TDP-43 endogenous siRNA efficiency and the expression levels of thesi-resistant WT and mutant TDP-43s. Fig. 6B shows an immunofluorescence of cellular distribution of flag-TDP-43WT,flag-TDP-43 G348V and flag-TDP-43 N352S (red) cotransfected with EGFP-12xQ/N (green) in U2OS cells. Merged images areshown on the right (bottom panels). Nuclei were highlighted with white dotted lines. Scale bars: 15 μm. Fig. 6C shows aquantification of the number of aggregates greater than 4 μm2 in the three transfections. (For interpretation of the references tocolor in this figure legend, the reader is referred to the web version of this article.)

47,5 47,5

flag-TDP-43

IN S P

flag-TDP-43N352S

IN S P IN S P

-flag

flag-TDP-43G348V

+ EGFP-12xQ/N

flag-TDP-43

IN S P

flag-TDP-43N352S

IN S P IN S P

flag-TDP-43G348V

+ EGFP

kD kD

% flag-TDP-43in Pellet (P) 20± 10± 1 17± 8 60± 0,6 75± 4,2 70± 5

-tubulin

-flag

-tubulin

7

Fig. 7 – U2OS cells were co-transfected with flag-TDP-43WT (WT), flag-TDP-43 G348V, flag-TDP43 N352S either in the presenceof control EGFP- (upper panels) or EGFP-12xQ/Nexpressing constructs (lower panels). Cell lysateswere fractioned in soluble (S) andinsoluble pellet (P) fractions and the presence of flag-TDP-43 was detected byWestern Blot using an anti-flag Ab (IN: inputs).Tubulin levels were used as equal loading control (lower panels).

8 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

Please cite this article as: Budini, M., et al., Role of selectedmutations in the Q/N rich region of TDP-43 in EGFP-12xQ/N-inducedaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.2012.02.031

9B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

forward N345K_F (5′ gccagccagcagaagcagtcaggcccatcg 3′) andreverse N345K_R (5′ cgatgggcctgactgcttctgctggctggc 3′), forthe G348V mutant primers forward G348V_F (5′ gcagaaccagt-cagtcccatcgggtaataac 3′), and G348V_R reverse (5′ gttattaccc-gatgggactgactggttctgc 3′), and for the N352S mutant primersforward N352S_F (5′ caggcccatcgggtagtaaccaaaaccaagg 3′),and reverse N352S_R (5′ ccttggttttggttactacccgatgggcctg 3′). ThePCR products were then digested (2–3 h at 37 °C) with 20 U ofDnpI (New England Biolabs) restriction enzyme in order to digestonly the methylated parental DNA. One microliter of digestionproduct was used to transform E. coli (DH5α). In addition, a silentmutationwas introduced in all the pFLAGTDP-43mutants usingstandard PCR procedure in order to make them resistant to theanti-TDP-43 siRNA. Primers used for this taskwere the following:forward siTDP_KOFW (5′ taattctaagcagtcccaggatga 3′) and re-verse siTDP_KOREV (5′ tcatcctgggactgcttagaatta 3′).

4.2. Peptide synthesis

All peptides were synthesized on solid phase (Fmoc/t-Buchemistry) using a home-built automatic synthesizer basedon a Gilson Aspec XL SPE system. The peptide-resin (pre-loaded NovaSyn TGT, Novabiochem) was cleaved/deprotectedusing a modified Reagent H mixture (trifluoroacetic acid 80%,phenol 3%, thioanisole 3%, 3,6-dioxa-1,8-octanedithiol 8%,water 2.5%, methylethylsulphide 2%, hydroiodic acid 1.5% w/w) for 3 h. The peptides were precipitated by diethylether,washed, freeze-dried, and purified by preparative RP-HPLCon a 25×300 mm column (Load&Lock system, Varian) packedwith VariTide RPC resin (Polymer Laboratories — Varian)using a gradient from 0.1% TFA in water to 0.1% TFA in aceto-nitrile. The purified fractions were checked by ESI-MS, pooledand freeze-dried.

4.3. Peptide transduction and immunofluorescencemicroscopy

U2OS cells (5×105) were plated in 6-well plates containingcoverslips. The next day the cells were incubated (or not)with 2.5 μM of TAT-339-366 and TAT-pControl peptides (seesequences below) for 20 h. Cells were washed 2 times withPBS, fixed in 4% paraformal-dehyde in PBS (15 min at roomtemperature) and permeabilized by using 0.3% Triton in PBSfor 5 min on ice. After blocking with 2% BSA/PBS for 20 minat room temperature, an immunolabeling using a commercialAb against TDP-43 (Protein Tech) was carried out at room tem-perature for 1 h in 2% BSA/PBS. Cells were washed 3 timeswith PBS and incubated with conjugated secondary antibodyat room temperature for 1 h. Nuclei were stainedwith 4,6-dia-midino-2-phenylindole (DAPI). Peptide sequences transducedin these experiments: TAT-p342–366 (GGYGRKKRRQRRR(TAT)

GGMLASQQNQSGPSGNNQNQGNMQREPNQA), TAT-pCont (GGYGRKKRRQRRR(TAT)GGSHTLRGRRLVFDNQLTIRSPSRREC).

4.4. Tissue culture and cell transfection

HeLa and U2OS cell lines were grown in DMEM-Glutamax-I(GIBCO) supplemented with 10% fetal bovine serum (GIBCO)and Antibiotic–Antimycotic stabilized suspension (Sigma).The plasmid transfections were carried out with Effectene

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

Transfection reagent (Qiagen) according to manufacturer'sinstructions. Cells were grown in DMEM-Glutamax-I supple-mented with 10% fetal bovine serum, Antibiotic–Antimycoticstabilized suspension (Sigma) and 100 μg/ml hygromicin(Invivogen).

4.5. Add-back assays

Add-back experiments were performed as previously described(D'Ambrogio et al., 2009). The reporter minigenes used in thesplicing assays, pTB CFTR C155T and pTB Apo AII, have alreadybeen described by Pagani et al. (2003) and Mercado et al. (2005),respectively. Briefly, 1.7×105 HeLa cells were plated in 6-wellplates (day 0) and two rounds of TDP-43 siRNA transfectionswere carried out according to the procedure already described(Mercado et al., 2005) on days 1 and 2 in order to maximizeTDP-43 silencing efficiency. Transfection of 0.5 μg of the reporterminigenes together with 0.5 μg of flag-expressed proteins wasperformed on day 3. Cells were harvested on day 4 and totalRNA was collected with Trizol Reagent (Invitrogen). The siRNAtarget sequence used to silence the endogenous TDP-43 was (5′aagcaaagccaagaugagccu3′). Reverse transcriptionwas performedusing M-MLV Reverse Transcriptase (Invitrogen), according tothe manufacturer's protocol. PCR with DNA Polymerase (Roche)was carried out for 20 amplification cycles (95 °C for 30 s, 55 °Cfor 30 s, 72 °C for 30 s). PCR products were analyzed on 1.8% aga-rose gels.

4.6. Protein expression and super-shift EMSA assays

All GST-fusion proteins were obtained transforming E. coliBL21-DE3 with the respective expression vectors and recombi-nant protein expression and purification were performedaccording to the procedure already described by Buratti et al.(2001). Electro-mobility shift assays (EMSAs) were conductedaccording to procedures already described (Buratti and Baralle,2001) with minor modifications. The binding buffer contained20mM HEPES pH 7.5, 2 mM EDTA, 0.5 mM DTT and 6% glycerol.The RNA oligonucleotide (UG)6 5′-uguguguguguga-3′ was madeby Integrated DNA Technologies. The 5′ end labeling of the oli-gonucleotide was carried out with PNK according to standardprotocols. In all experiments, 100–200 ng of GST-TDP-43 fusionprotein and indicates amounts of competitor peptides were in-cubated for 5 min at room temperature. For super-shift analysis,0.5 μg of GST-hnRNP A2 and 0.5 ng of labeled oligonucleotidewere added and the mix incubated at room temperature for5 min. Native 5% polyacrylamide gels were run at 100–120 V at4 °C using 0.5X TBE buffer. Gels were dried and an expositionusing Biomax RAR (Kodak) was performed.

4.7. Immunofluorescence microscopy

For indirect immunofluorescence U2OS cells were transfectedand processed as previously described (Ayala et al., 2008). Theanti-flag and anti-TDP-43 antibodies were purchased fromSigma and Protein Tech, respectively. The secondary anti-bodies, anti-mouse-AlexaFluor, anti-rabbit-AlexaFluor or anti-mouse-FarRed, were from Molecular Probe while the anti-rabbit-FITC was from Jackson Immuno Research. Cells wereanalyzed on a Zeiss LSM 510 confocalmicroscope. For aggregate

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

10 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

quantification (of a minimum size of 4 μm2), the colocalizationbetween the flagged wild-type and mutant TDP-43 proteinsand EGFP-12xQ/N construct was measured using the Volocitysoftware designed by Velocity Software, Inc.

4.8. Cell lysate fractionation

U2OS cell were cotransfected with the flagged TDP-43 WT ormutants and EGFP or EGFP-12xQ/N. After 24 h, cells were cen-trifuged at 1000×g for 5 min. at 4 °C. The cellular pellets wereresuspended in 300 μl of lysis buffer (15 mM Hepes pH 7.5,250 mM NaCl, 0.5% NP40 and 10% glycerol) supplementedwith proteases (Roche cocktail) and phosphatases inhibitors(10 mM NaF, 1 mM β-glycerolphosphate and 1 mM Na3VO4).Cells were sonicated with 10 pulses (30% of pulse) at 50% ofpower and centrifuged at 700×g for 10 min at 4 °C. The pelletswere discarded and total cell lysates were quantified by Brad-ford. For the fractionation, 450 μg from each total cell lysateswas centrifuged at 16,000×g for 30 min at 4 °C. The superna-tants were transferred into a new tube and the pellets werewashed again with lysis buffer, resuspended in 50 μl of ureabuffer, and sonicated again. To analyze each fraction byWestern blot, 50 μg of total lysates (IN), 50 μg of solublefraction (S), and all pellet volume were loaded in a 10% SDS-PAGE.

Acknowledgments

This work was supported by AriSLA. The EGFP-12XQ/N iscurrently patentpending, no. RM2011A000582.We thankCorradoGuarnaccia (ICGEB) for synthesizing the peptides.

R E F E R E N C E S

Arai, T., Hasegawa, M., Akiyama, H., Ikeda, K., Nonaka, T., Mori, H.,Mann, D., Tsuchiya, K., Yoshida, M., Hashizume, Y., Oda, T.,2006. TDP-43 is a component of ubiquitin-positivetau-negative inclusions in frontotemporal lobar degenerationand amyotrophic lateral sclerosis. Biochem. Biophys. Res.Commun. 351, 602–611.

Arai, T., Hasegawa, M., Nonoka, T., Kametani, F., Yamashita, M.,Hosokawa, M., Niizato, K., Tsuchiya, K., Kobayashi, Z., Ikeda,K., Yoshida, M., Onaya, M., Fujishiro, H., Akiyama, H., 2010.Phosphorylated and cleaved TDP-43 in ALS, FTLD and otherneurodegenerative disorders and in cellular models of TDP-43proteinopathy. Neuropathology 30, 170–181.

Ayala, Y.M., Zago, P., D'Ambrogio, A., Xu, Y.F., Petrucelli, L., Buratti,E., Baralle, F.E., 2008. Structural determinants of the cellularlocalization and shuttling of TDP-43. J. Cell Sci. 121, 3778–3785.

Ayala, Y.M., De Conti, L., Avendano-Vazquez, S.E., Dhir, A.,Romano, M., D'Ambrogio, A., Tollervey, J., Ule, J., Baralle, M.,Buratti, E., Baralle, F.E., 2011. TDP-43 regulates its mRNA levelsthrough a negative feedback loop. EMBO J. 30, 277–288.

Baloh, R.H., 2011. TDP-43: the relationship between proteinaggregation and neurodegeneration in amyotrophic lateralsclerosis and frontotemporal lobar degeneration. FEBS J. 278,3539–3549.

Banks, G.T., Kuta, A., Isaacs, A.M., Fisher, E.M., 2008. TDP-43 is aculprit in human neurodegeneration, and not just an innocentbystander. Mamm. Genome 19, 299–305.

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

Barmada, S.J., Finkbeiner, S., 2010. Pathogenic TARDBP mutationsin amyotrophic lateral sclerosis and frontotemporal dementia:disease-associated pathways. Rev. Neurosci. 21, 251–272.

Borroni, B., Archetti, S., Del Bo, R., Papetti, A., Buratti, E., Bonvicini,C., Agosti, C., Cosseddu, M., Turla, M., Di Lorenzo, D., PietroComi, G., Gennarelli, M., Padovani, A., 2010. TARDBPmutationsin frontotemporal lobar degeneration: frequency, clinicalfeatures, and disease course. Rejuvenation Res. 13, 509–517.

Budini, M., Baralle, F.E., Buratti, E., 2011. Regulation of geneexpression by TDP-43 and FUS/TLS in frontotemporal lobardegeneration. Curr. Alzheimer Res. 8, 237–245.

Buratti, E., Baralle, F.E., 2001. Characterization and functionalimplications of the RNA binding properties of nuclear factorTDP-43, a novel splicing regulator of CFTR exon 9. J. Biol. Chem.276, 36337–36343.

Buratti, E., Baralle, F.E., 2008. Multiple roles of TDP-43 in geneexpression, splicing regulation, and human disease. Front.Biosci. 13, 867–878.

Buratti, E., Baralle, F.E., 2009. The molecular links between TDP-43dysfunction and neurodegeneration. Adv. Genet. 66, 1–34.

Buratti, E., Baralle, F.E., 2010. The multiple roles of TDP-43 inpre-mRNA processing and gene expression regulation. RNABiol. 7, 420–429.

Buratti, E., Dork, T., Zuccato, E., Pagani, F., Romano, M., Baralle,F.E., 2001. Nuclear factor TDP-43 and SR proteins promote invitro and in vivo CFTR exon 9 skipping. EMBO J. 20, 1774–1784.

Buratti, E., Brindisi, A., Giombi, M., Tisminetzky, S., Ayala, Y.M.,Baralle, F.E., 2005. TDP-43 binds heterogeneous nuclearribonucleoprotein A/B through its C-terminal Tail: an importantregion for the inhibition of cystic fibrosis transmembraneconductance regulator exon 9 splicing. J. Biol. Chem. 280,37572–37584.

D'Ambrogio, A., Buratti, E., Stuani, C., Guarnaccia, C., Romano, M.,Ayala, Y.M., Baralle, F.E., 2009. Functional mapping of theinteraction between TDP-43 and hnRNP A2 in vivo. NucleicAcids Res. 37, 4116–4126.

Daoud, H., Valdmanis, P.N., Kabashi, E., Dion, P., Dupre, N., Camu,W., Meininger, V., Rouleau, G.A., 2009. Contribution of TARDBPmutations to sporadic amyotrophic lateral sclerosis. J. Med.Genet. 46, 112–114.

Del Bo, R., Ghezzi, S., Corti, S., Pandolfo, M., Ranieri, M., Santoro,D., Ghione, I., Prelle, A., Orsetti, V., Mancuso, M., Soraru, G.,Briani, C., Angelini, C., Siciliano, G., Bresolin, N., Comi, G.P.,2009. TARDBP (TDP-43) sequence analysis in patients withfamilial and sporadic ALS: identification of two novelmutations. Eur. J. Neurol. 16, 727–732.

Dewey, C.M., Cenik, B., Sephton, C.F., Dries, D.R., Mayer III, P.,Good, S.K., Johnson, B.A., Herz, J., Yu, G., 2011. TDP-43 isdirected to stress granules by sorbitol, a novel physiologicalosmotic and oxidative stressor. Mol. Cell. Biol. 31, 1098–1108.

Feiguin, F., Godena, V.K., Romano, G., D'Ambrogio, A., Klima, R.,Baralle, F.E., 2009. Depletion of TDP-43 affects Drosophilamotoneurons terminal synapsis and locomotive behavior.FEBS Lett. 583, 1586–1592.

Fiesel, F.C., Kahle, P.J., 2011. TDP-43 and FUS/TLS: cellular functionsand implications for neurodegeneration. FEBS J. 278, 3550–3568.

Freibaum, B.D., Chitta, R.K., High, A.A., Taylor, J.P., 2010. Globalanalysis of TDP-43 interacting proteins reveals strongassociation with RNA splicing and translation machinery. J.Proteome Res. 9, 1104–1120.

Gendron, T.F., Petrucelli, L., 2011. Rodent models of TDP-43proteinopathy: investigating the mechanisms of TDP-43-me-diated neurodegeneration. J. Mol. Neurosci. 45 (3), 486–499.

Geser, F., Martinez-Lage, M., Kwong, L.K., Lee, V.M., Trojanowski,J.Q., 2009. Amyotrophic lateral sclerosis, frontotemporaldementia and beyond: the TDP-43 diseases. J. Neurol. 256,1205–1214.

Igaz, L.M., Kwong, L.K., Lee, E.B., Chen-Plotkin, A., Swanson, E.,Unger, T., Malunda, J., Xu, Y., Winton, M.J., Trojanowski, J.Q.,

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

11B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

Lee, V.M., 2011. Dysregulation of the ALS-associated geneTDP-43 leads to neuronal death and degeneration in mice. J.Clin. Invest. 121, 726–738.

Iida, A., Kamei, T., Sano, M., Oshima, S., Tokuda, T., Nakamura,Y., Ikegawa, S., 2010. Large-scale screening of TARDBPmutation in amyotrophic lateral sclerosis in Japanese.Neurobiol. Aging 33 (4), 786–790.

Johnson, B.S., Snead, D., Lee, J.J., McCaffery, J.M., Shorter, J., Gitler,A.D., 2009. TDP-43 is intrinsically aggregation-prone, andamyotrophic lateral sclerosis-linked mutations accelerateaggregation and increase toxicity. J. Biol. Chem. 284,20329–20339.

Kabashi, E., Valdmanis, P.N., Dion, P., Spiegelman, D., McConkey,B.J., Vande Velde, C., Bouchard, J.P., Lacomblez, L., Pochigaeva,K., Salachas, F., Pradat, P.F., Camu,W., Meininger, V., Dupre, N.,Rouleau, G.A., 2008. TARDBP mutations in individuals withsporadic and familial amyotrophic lateral sclerosis. Nat. Genet.40, 572–574.

Kabashi, E., Lin, L., Tradewell, M.L., Dion, P.A., Bercier, V.,Bourgouin, P., Rochefort, D., Bel Hadj, S., Durham, H.D., Velde,C.V., Rouleau, G.A., Drapeau, P., 2010. Gain and loss of functionof ALS-related mutations of TARDBP (TDP-43) cause motordeficits in vivo. Hum. Mol. Genet. 19, 671–683.

Kamada, M., Maruyama, H., Tanaka, E., Morino, H., Wate, R., Ito,H., Kusaka, H., Kawano, Y., Miki, T., Nodera, H., Izumi, Y., Kaji,R., Kawakami, H., 2009. Screening for TARDBP mutations inJapanese familial amyotrophic lateral sclerosis. J. Neurol. Sci.284, 69–71.

Kim, S.H., Shanware, N.P., Bowler, M.J., Tibbetts, R.S., 2010.Amyotrophic lateral sclerosis-associated proteins TDP-43 andFUS/TLS function in a common biochemical complex toco-regulate HDAC6 mRNA. J. Biol. Chem. 285, 34097–34105.

Kirby, J., Goodall, E.F., Smith, W., Highley, J.R., Masanzu, R.,Hartley, J.A., Hibberd, R., Hollinger, H.C., Wharton, S.B.,Morrison, K.E., Ince, P.G., McDermott, C.J., Shaw, P.J., 2010.Broad clinical phenotypes associated with TAR-DNA bindingprotein (TARDBP) mutations in amyotrophic lateral sclerosis.Neurogenetics 11, 217–225.

Kuhnlein, P., Sperfeld, A.D., Vanmassenhove, B., Van Deerlin, V.,Lee, V.M., Trojanowski, J.Q., Kretzschmar, H.A., Ludolph, A.C.,Neumann, M., 2008. Two German kindreds with familialamyotrophic lateral sclerosis due to TARDBP mutations. Arch.Neurol. 65, 1185–1189.

Lavaur, J., Bernard, F., Trifilieff, P., Pascoli, V., Kappes, V., Pages, C.,Vanhoutte, P., Caboche, J., 2007. A TAT-DEF-Elk-1 peptideregulates the cytonuclear trafficking of Elk-1 and controlscytoskeleton dynamics. J. Neurosci. 27, 14448–14458.

Lee, E.B., Lee, V.M., Trojanowski, J.Q., 2011. Gains or losses:molecular mechanisms of TDP43-mediated neurodegeneration.Nat. Rev. Neurosci. 13, 38–50.

Lin, M.J., Cheng, C.W., Shen, C.K., 2011. Neuronal function anddysfunction of Drosophila dTDP. PLoS One 6, e20371.

Ling, S.C., Albuquerque, C.P., Han, J.S., Lagier-Tourenne, C.,Tokunaga, S., Zhou, H., Cleveland, D.W., 2010. ALS-associatedmutations in TDP-43 increase its stability and promote TDP-43complexes with FUS/TLS. Proc. Natl. Acad. Sci. U. S. A. 107,13318–13323.

Lu, Y., Ferris, J., Gao, F.B., 2009. Frontotemporal dementia andamyotrophic lateral sclerosis-associated disease proteinTDP-43 promotes dendritic branching. Mol. Brain 2, 30.

McDonald, K.K., Aulas, A., Destroismaisons, L., Pickles, S., Beleac,E., Camu, W., Rouleau, G.A., Vande Velde, C., 2011. TARDNA-binding protein 43 (TDP-43) regulates stress granuledynamics via differential regulation of G3BP and TIA-1. Hum.Mol. Genet. 20, 1400–1410.

Mercado, P.A., Ayala, Y.M., Romano, M., Buratti, E., Baralle, F.E.,2005. Depletion of TDP 43 overrides the need for exonic andintronic splicing enhancers in the human apoA-II gene.Nucleic Acids Res. 33, 6000–6010.

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

Millecamps, S., Salachas, F., Cazeneuve, C., Gordon, P., Bricka, B.,Camuzat, A., Guillot-Noel, L., Russaouen, O., Bruneteau, G.,Pradat, P.F., Le Forestier, N., Vandenberghe, N., Danel-Brunaud,V., Guy, N., Thauvin-Robinet, C., Lacomblez, L., Couratier, P.,Hannequin, D., Seilhean, D., Le Ber, I., Corcia, P., Camu, W.,Brice, A., Rouleau, G., LeGuern, E., Meininger, V., 2010. SOD1,ANG, VAPB, TARDBP, and FUS mutations in familialamyotrophic lateral sclerosis: genotype–phenotypecorrelations. J. Med. Genet. 47, 554–560.

Nagel, F., Falkenburger, B.H., Tonges, L., Kowsky, S., Poppelmeyer,C., Schulz, J.B., Bahr, M., Dietz, G.P., 2008. Tat-Hsp70 protectsdopaminergic neurons in midbrain cultures and in thesubstantia nigra inmodels of Parkinson's disease. J. Neurochem.105, 853–864.

Neumann, M., 2009. Molecular neuropathology of TDP-43proteinopathies. Int. J. Mol. Sci. 10, 232–246.

Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi,M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M., Clark,C.M., McCluskey, L.F., Miller, B.L., Masliah, E., Mackenzie, I.R.,Feldman, H., Feiden, W., Kretzschmar, H.A., Trojanowski, J.Q.,Lee, V.M., 2006. Ubiquitinated TDP-43 in frontotemporal lobardegeneration and amyotrophic lateral sclerosis. Science 314,130–133.

Nonaka, T., Kametani, F., Arai, T., Akiyama, H., Hasegawa, M.,2009. Truncation and pathogenic mutations facilitate theformation of intracellular aggregates of TDP-43. Hum. Mol.Genet. 18, 3353–3364.

Pagani, F., Buratti, E., Stuani, C., Baralle, F.E., 2003. Missense,nonsense, and neutral mutations define juxtaposed regulatoryelements of splicing in cystic fibrosis transmembrane regulatorexon 9. J. Biol. Chem. 278, 26580–26588.

Passoni, M., De Conti, L., Baralle, M., Buratti, E., 2012. UG repeats/TDP-43 interactions near 5′ splice sites exert unpredictableeffects on splicing modulation. J. Mol. Biol. 415, 46–60.

Pesiridis, G.S., Lee, V.M., Trojanowski, J.Q., 2009. Mutations inTDP-43 link glycine-rich domain functions to amyotrophiclateral sclerosis. Hum. Mol. Genet. 18, R156–R162.

Pinto, S., Vlahovicek, K., Buratti, E., 2011. PRO-MINE: a bioinformaticsrepository and analytical tool for TARDBP mutations. Hum.Mutat. 32, E1948–E1958.

Polymenidou, M., Lagier-Tourenne, C., Hutt, K.R., Huelga, S.C.,Moran, J., Liang, T.Y., Ling, S.C., Sun, E., Wancewicz, E., Mazur,C., Kordasiewicz, H., Sedaghat, Y., Donohue, J.P., Shiue, L.,Bennett, C.F., Yeo, G.W., Cleveland, D.W., 2011. Long pre-mRNA depletion and RNA missplicing contribute to neuronalvulnerability from loss of TDP-43. Nat. Neurosci. 14, 459–468.

Rutherford, N.J., Zhang, Y.J., Baker, M., Gass, J.M., Finch, N.A., Xu,Y.F., Stewart, H., Kelley, B.J., Kuntz, K., Crook, R.J., Sreedharan, J.,Vance, C., Sorenson, E., Lippa, C., Bigio, E.H., Geschwind, D.H.,Knopman, D.S., Mitsumoto, H., Petersen, R.C., Cashman, N.R.,Hutton, M., Shaw, C.E., Boylan, K.B., Boeve, B., Graff-Radford,N.R., Wszolek, Z.K., Caselli, R.J., Dickson, D.W., Mackenzie, I.R.,Petrucelli, L., Rademakers, R., 2008. Novel mutations in TARDBP(TDP-43) in patients with familial amyotrophic lateral sclerosis.PLoS Genet. 4, e1000193.

Sreedharan, J., Blair, I.P., Tripathi, V.B., Hu, X., Vance, C., Rogelj, B.,Ackerley, S., Durnall, J.C., Williams, K.L., Buratti, E., Baralle, F., deBelleroche, J.,Mitchell, J.D., Leigh, P.N., Al-Chalabi, A.,Miller, C.C.,Nicholson, G., Shaw, C.E., 2008. TDP-43mutations in familial andsporadic amyotrophic lateral sclerosis. Science 319, 1668–1672.

Swarup, V., Phaneuf, D., Bareil, C., Robertson, J., Rouleau, G.A.,Kriz, J., Julien, J.P., 2011. Pathological hallmarks of amyotrophiclateral sclerosis/frontotemporal lobar degeneration in transgenicmice produced with TDP-43 genomic fragments. Brain 134,2610–2626.

Ticozzi, N., LeClerc, A.L., van Blitterswijk, M., Keagle, P., McKenna-Yasek, D.M., Sapp, P.C., Silani, V., Wills, A.M., Brown Jr., R.H.,Landers, J.E., 2011a. Mutational analysis of TARDBP inneurodegenerative diseases. Neurobiol. Aging 32, 2096–2099.

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031

12 B R A I N R E S E A R C H X X ( 2 0 1 2 ) X X X – X X X

Ticozzi, N., Vance, C., Leclerc, A.L., Keagle, P., Glass, J.D., McKenna-Yasek, D., Sapp, P.C., Silani, V., Bosco, D.A., Shaw, C.E., Brown Jr.,R.H., Landers, J.E., 2011b. Mutational analysis reveals the FUShomolog TAF15 as a candidate gene for familial amyotrophiclateral sclerosis. Am. J. Med. Genet. B Neuropsychiatr. Genet.156B, 285–290.

Tollervey, J.R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci,M., Konig, J., Hortobagyi, T., Nishimura, A.L., Zupunski, V.,Patani, R., Chandran, S., Rot, G., Zupan, B., Shaw, C.E., Ule, J.,2011. Characterizing the RNA targets and position-dependentsplicing regulation by TDP-43. Nat. Neurosci. 14, 452–458.

Voigt, A., Herholz, D., Fiesel, F.C., Kaur, K., Muller, D., Karsten, P.,Weber, S.S., Kahle, P.J., Marquardt, T., Schulz, J.B., 2010.TDP-43-mediated neuron loss in vivo requires RNA-bindingactivity. PLoS One 5, e12247.

Wegorzewska, I., Baloh, R.H., 2011. TDP-43-based animal modelsof neurodegeneration: new insights into ALS pathology andpathophysiology. Neurodegener Dis 8, 262–274.

Wegorzewska, I., Bell, S., Cairns, N.J., Miller, T.M., Baloh, R.H., 2009.TDP-43 mutant transgenic mice develop features of ALS and

Please cite this article as: Budini, M., et al., Role of selectedmutatiaggregate formation, Brain Res. (2012), doi:10.1016/j.brainres.201

frontotemporal lobar degeneration. Proc. Natl. Acad. Sci. U. S.A. 106, 18809–18814.

Xu, Y.F., Gendron, T.F., Zhang, Y.J., Lin, W.L., D'Alton, S., Sheng, H.,Casey, M.C., Tong, J., Knight, J., Yu, X., Rademakers, R., Boylan,K., Hutton, M., McGowan, E., Dickson, D.W., Lewis, J., Petrucelli,L., 2010. Wild-type human TDP-43 expression causes TDP-43phosphorylation, mitochondrial aggregation, motor deficits,and early mortality in transgenic mice. J. Neurosci. 30,10851–10859.

Yokoseki, A., Shiga, A., Tan, C.F., Tagawa, A., Kaneko, H., Koyama,A., Eguchi, H., Tsujino, A., Ikeuchi, T., Kakita, A., Okamoto, K.,Nishizawa, M., Takahashi, H., Onodera, O., 2008. TDP-43mutation in familial amyotrophic lateral sclerosis. Ann.Neurol. 63, 538–542.

Zhang, Y.J., Xu, Y.F., Cook, C., Gendron, T.F., Roettges, P., Link,C.D., Lin, W.L., Tong, J., Castanedes-Casey, M., Ash, P., Gass, J.,Rangachari, V., Buratti, E., Baralle, F., Golde, T.E., Dickson,D.W., Petrucelli, L., 2009. Aberrant cleavage of TDP-43enhances aggregation and cellular toxicity. Proc. Natl. Acad.Sci. U. S. A. 106, 7607–7612.

ons in the Q/N rich region of TDP-43 in EGFP-12xQ/N-induced2.02.031