B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

ava i l ab l e a t www.sc i enced i rec t . com

www.e l sev i e r. com/ l oca te /b ra in res

Research Report

Rodent BDNF genes, novel promoters, novel splice variants,and regulation by cocaine☆

Qing-Rong Liua, Lin Lub, Xu-Guang Zhua, Jian-Ping Gonga,Yavin Shahamb, George R. Uhla,⁎aMolecular Neurobiology Branch, National Institute on Drug Abuse-Intramural Research Program (NIDA-IRP), NIH,Department of Health and Human Services (DHHS), Box 5180, Baltimore, MD 21224, USAbBehaviour Neuroscience Branch, National Institute on Drug Abuse-Intramural Research Program (NIDA-IRP), NIH,Department of Health and Human Services (DHHS), Baltimore, MD 21224, USA

A R T I C L E I N F O

☆ NCBI GenBank accession numbers. MoumBDNF2A, AY057909; mBDNF2B, AY05791mBDNF6A, AY231131; and mBDNF6B, AY231⁎ Corresponding author. Fax: +1 410 550 1535.

E-mail address: guhl@intra.nida.nih.gov (

0006-8993/$ – see front matter. Published bydoi:10.1016/j.brainres.2005.10.004

A B S T R A C T

Article history:Accepted 2 October 2005Available online 22 December 2005

Results from studies using molecular and genetic methods in humans and rodents suggestthat brain-derived neurotrophic factor (BDNF) is involved in the behavioral effects of abuseddrugs, making understanding of its genomic structure and regulation of substantial interest.Recently, we have reported that the human BDNF gene contains seven upstream exons thatcan each be spliced independently to the major BDNF coding exon to form diverse bipartiteBDNF transcripts. We also identified a novel “BDNFOS” gene that is transcribed to producealternatively spliced natural antisense transcripts (NATs); its fifth exon overlaps with theprotein coding exon VIII of human BDNF. To better understand BDNF's genomic structureand differential regulation, we now describe the rodent BDNF gene and transcripts. Thisgene includes six bipartite transcripts that are generated by six independently transcribedexons, each of which is spliced to a major coding exon and a tripartite transcript that iscomposed of two upstream exons and one coding exon. In addition, we found no evidencefor antisense, opposite strand BDNFOS gene transcripts in mice or rats. The BDNF rodentsplice variants display specific patterns of differential expression in different brain regionsand peripheral tissues. Acute cocaine administration increased striatal expression of aspecific BDNF4 splice variant by up to 5-fold. Interestingly, however, neither experimenter-nor self-administered chronic cocaine administration enhanced striatal BDNF expression.These data suggest a role of specific BDNF promoter regions and regulatory sequences instimulant-induced alterations in BDNF expression, and in the alterations that changedBDNF expression is likely to confer in the brain.

Published by Elsevier B.V.

Theme:Cellular and molecular biologyTopic:Gene structure and function: general

Keywords:NeurotrophinGene regulationAddictionDopamineCocaine

se BDNF gene sequence: AY057907. Mouse BDNF cDNA sequences: mBDNF1, AY057908;0; mBDNF2C, AY057911; mBDNF3, AY057912; mBDNF4, AY057913; mBDNF5, AY057914;132. Rat cDNA sequences: rBDNF3, AY559248; rBDNF6A, AY559249; rBDNF6B, AY559250.

G.R. Uhl).

Elsevier B.V.

2 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

Abbreviations:BDNF, brain-derived neurotrophicfactorBDNFOS, brain-derived neurotrophicfactor opposite strand geneNATs, natural antisense transcriptsUTR, untranslated regionNRSE, neuron-restrictive silencerelementCaRF, calcium-responsivetranscription factorsCREB, cAMP/calcium-responsiveelement binding proteinsMeCP2, methyl-CpG bindingprotein 2

1. Introduction

The brain-derived neurotrophic factor (BDNF) gene encodespeptides that are important for the function of a number ofbrain circuits, including those involved in the behavioral andphysiological effects of abused drugs (Bolanos et al., 2004). Theevidence that supports such roles include BDNF's effects onmorphology and function of reward-associated dopaminergicneurons invitro (Hymanet al., 1991; Kontkanenet al., 1999) andin vivo (Shen et al., 1994). BDNF is packaged in the large dense-core neuronal vesicles and is released from hippocampal andstriatal slices upon neuronal stimulation (Balkowiec et al.,2002; Goggi et al., 2002; Hartmann et al., 2001; Mowla et al.,1999). BDNF infusions into the nucleus accumbens or theventral tegmental area enhance cocaine-induced locomotoractivity, cocaine-induced potentiation of conditioned reward,and drug seeking after cocaine withdrawal (Horger et al., 1999;Lu et al., 2004). Inhibition of BDNF in the nucleus accumbensreduces amphetamine-induced dopamine release (Narita etal., 2003). Cocaine self-administration and subsequent with-drawal result in time-dependent increases in BDNF proteinlevels in the ventral tegmental area, nucleus accumbens, andamygdala that persist for 90 days after the last exposure tococaine (Grimm et al., 2003). Heterozygous BDNF knockoutmice with about half of normal levels of BDNF expressiondisplay about half wild-type levels of striatal dopamine(Dluzen et al., 1999) and are less sensitive to the locomotorand rewarding effects of cocaine than wild-type mice (Hall etal., 2003). We and others have linked genomic markers at thehuman BDNF locus to individual differences in vulnerability topolysubstance abuse (Liu et al., 2005b; Uhl et al., 2001).

These previous findings make the understanding of theBDNF gene structure, function, and regulation of interest. Theprevious work on BDNF's gene structure in rodent was notcomplete, and, therefore, the annotation of BDNF exons wasunclear (Aoyamaet al., 2001; Bishopet al., 1994; Timmusket al.,1993).Wehave recently reporteddetailed studies of thehumanBDNF gene that support a complex pattern of regulation, theuse of a variety of promoters, and the involvement of a numberof cis- and trans-acting transcriptional control processes toproduce a variety of differentially spliced sense and antisensetranscripts. The human BDNF gene thus contains seven 5′exons, each of which is spliced independently to a major

coding exon. We renamed human BDNF exons in accordancewith 5′ to 3′ order, exon I and II are homologous to Timmusk'srat exon I and II (Timmusk et al., 1993), respectively. Exon III ishomologous to Bishop's rat exon 1a (Bishop et al., 1994). ExonsIV and V are homologous to Timmusk's rat exon III and IV,respectively. Exons VIA and VIB are homologous to Aoyama'shuman exon 4I, and the exon VII has the same transcriptioninitiation site of Aoyama's human exon 5U. However, exon VIIis spliced to the exon VIII instead of directly connected to themajor coding exon as found for Aoyama's exon 5U (Aoyama etal., 2001). The major coding exons from different laboratoriesare the same, the exon VIII in our study, exon V in Timmusk's,and exon 5 in Aoyama'swork (Aoyama et al., 2001; Timmusk etal., 1993). The opposite strandof humanBDNFgene encodes aneleven-exon gene that we have termed BDNFOS (AF411339).This gene's eleven exons are alternatively spliced to producenatural antisense transcripts (NATs) that produce 225 bpregions that are complementary to sequences found in themajor protein coding exon VIII of the BDNF gene itself (Liu etal., 2005b).

Studies of BDNF's roles in drug addiction and other mentaldisorders and more generally in brain function would befacilitated by improved understanding of the gene and itsstructure/function relationships in rodents. However, previ-ous studies lack the details that proved essential for improvedunderstanding of the human BDNF gene. Thus, we now reportwork that characterizes the rat and mouse BNDF genes' exon–intron structures, identifies novel BDNF exons, and definestwo- and three-part BDNF transcripts. These observationsreveal striking differences between rodent and primate BDNFgenes, including the apparent absence of rodent antisensetranscripts that correspond to the human BDNFOS. Studies onthe effect of cocaine exposure reveal promoter-specificupregulation of specific BDNF's transcripts in striatum andfrontal cortex by acute, but not by repeated drug exposures.

2. Results

2.1. Genomic structures of mouse and rat BDNF genes

Aligning human chromosome 11 BDNF exon sequences withthose from mouse (Mus musculus) chromosome 2 and rat

3B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

(Rattus norvegicus) chromosome 3 genomic contigs AY057907and NW_047673, respectively, yielded good alignments for ratand mouse exons that corresponded to each human senseBDNF exon except exon VII. Previously identified rat exons I–V(Timmusk et al., 1993) and 1a exon (Bishop et al., 1994) werereadily apparent; gaps in previous sequence assembliesappear to have hidden several novel non-coding exons.These exons were confirmed by sequencing RT-PCR frag-ments. To reflect these additions, to retain nomenclature thatreflects the human BDNF genomic structure as much aspossible and to provide species-specific designators, we nameand rename these exons according to their positions asfollows, using r/m subscripts: Exons Ir/m, IIr/m, and IIIr/m thuscorrespond to the previously described rat exons I, II, and 1a.Intra-exonic splice sites within exon II produce splice variantsthat we term IIA, IIB, and IIC. Exons IVr/m and Vr/m correspondto the previously described exons III and IV (Timmusk et al.,1993). Inter-exonic splice sites that we term exons VIAr/m andVIBr/m can be spliced with the main coding exon to form two-and three-part transcripts. Mouse and rat BDNF genes thuseach encode eight two-part transcripts that we term BDNF1,2A, 2B, 2C, 3, 4, 5, and 6A. For each, the exon that encodes adifferent 5′-untranslated region begins transcripts that arespliced to amajor peptide-encoding exon VIIIr/m. In addition, athree-part transcript, BDNF6B, is the result of splicing eventsthat incorporate exons VIr/m, VIIr/m, and VIIIr/m (Fig. 1 andTable 1). Each rat and mouse BDNF exon is flanked byconsensus splice acceptor (AG) and donor (GT) sites (Table 1).Interestingly, close homologues of rodent exon VIIr/m areabsent from the human genome (Liu et al., 2005b).

Only one of the exon sequences that correspond to thehuman BDNFOS gene (AF411339), its exon 11, displays even

Fig. 1 – Mouse and rat BDNF gene structure and splicing variantthree-part splice variants. Arrows indicate within-exon splice an

partial alignment with either mouse, rat, or dog (Canisfamiliaris chromosome 21 genomic contig NW_139891) ge-nomic sequences. There is no evidence for BDNFOS geneexpression in other lower mammals in whom the human androdent BDNF gene structures are well conserved, including pig(Sus scrofa), cat (Felis catus), and cow (Bos taurus). There is noevidence for BDNFOS in other vertebrates that display BDNFexons with lower levels of sequence conservation, includingchicken (Gallus gallus), frog (Xenopus laevis), lamprey (Lampetrafluviatilis) (Hallbook et al., 1998), zebrafish (Danio rerio) or pufferfish (Tetraodon nigroviridis) (Heinrich et al., 2004). By contrast, inchimpanzee (Pan troglodytes), all of the eleven antisenseBDNFOS gene exons and all eight of the sense BDNF exonsalign with chromosome 11 BDNF genomic sequences fromcontig NW_113870 with N99% nucleotide sequence identity(data not shown). While there is thus no clear support forrodent BDNF antisense transcripts that are homologous withthe human BDNFOS transcripts, these sequences appear tohave evolved under the evolutionary pressures that yieldedprimates. Species-specific natural antisense transcripts arenot uncommon. For instance, at the Wilms tumor suppressorgene (WT1/WIT-1) that is ∼4.5 mb centromeric to BDNF/BDNFOS, human WIT-1 opposite-strand-encoded NAT wasnot found in mouse genome (Gong et al., 2001).

2.2. Potential 5′ BDNF regulatory sequences

A number of features of the rodent 5′ flanking BDNF genomicsequences fall into cluster 1 that spans ∼3 kb and consists ofthe 5′ sequences that flank exons I, II, and III and cluster 2 thatcovers∼3 kb of genomic sequence and provides the 5′ flankingregions for exons IV, V, and VI (Fig. 1 and Table 1). Short 500–

s. Open boxes represent exons. Lines connect two- andd alternative polyadenylation sites.

Table 1 – Splice junctions for mouse BDNF exons and introns

mBDNF Exon Sizes (bp) Acceptor Exon sequences Donor Intron Size (bp)

mBDNF 1 I 640 …AGCCACAAGTG gtgagtagca… 1 48,002VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 2A IIA 204 …CTTCATCCAG gtattctttt… 2A 47,241VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 2B IIB 416 …CAAGCTCCGG gttggtatac… 2B 47,029VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 2C IIC 502 …CGCAAAGAAG gtaagcaccg... 2C 46,946VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 3 III 131 …TTGAGCCCAG gtccgagtca… 3 46,117VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 4 IV 339 …ACTGAAAAAG gtgggtttct… 4 30,564VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 5 V 547 …GGACCCCTGAG gtaggcgact… 5 29,430VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 6A VI 153 …TCATCCGGGA gtaggttggg… 6 28,718VIII 3621 …cttcccacag TTCCACCAGG…

mBDNF 6B VI 153 …TCATCCGGGA gtaggttggg… 7 14,979VII 75 …tgcatcccag GAGAAAGGCT…TGTCGTAAAG gtgagcaaca… 8 13,666VIII 3621 …cttcccacag TTCCACCAGG…

Upper case letters represent exon sequences and lower case letters intron sequences.

4 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

800 bp sequences at the 5′-flanks of candidate promoters IIand III in cluster 1 and candidate promoters V and VI in cluster2 are thus likely to display much of the regulatory machineryfor the transcripts that are initiated with these exons.Sequences of each candidate promoter region in both clustersare highly conserved between rodent and human sequences(∼80% identity), promoter VI displays only ∼40% identity.Promoters III and VI lack TATA boxes. These observationsaccord with the lower levels of brain transcription driven fromthese promoters than from the TATA-containing promoters I,II, IV, and V (Liu et al., 2005b; Nakayama et al., 1994).

As with the rat, murine BDNF1, 2, and 3 splice variantsare predominantly expressed in the central nervous system(Figs. 2A and B). This was confirmed by Northern analyses inwhich specific probes for rat exon I and II sequenceshybridized with 1.6 and 4.2 kb bands in mRNAs extractedfrom brain regions. These observations contrast with resultsfrom exon IV and V probes that hybridize with mRNAs fromboth brain and peripheral tissues (Hofer et al., 1990;Timmusk et al., 1993). The observations correlate with: (1)finding neuron-restrictive silencer elements within 5′ un-translated sequence regions of rat promoter II transcripts(Timmusk et al., 1999; Zuccato et al., 2003); (2) 5′ RACEresults from rat mRNAs (Nakayama et al., 1994); and (3) RT-PCR data using oligonucleotides specific for exons II and VIIIsequences from mouse mRNAs (Table 2A and Fig. 2A).Conceivably, binding of neuron-restrictive silencer factor togenomic sequences that encode BDNF2 5′ UTR (Gurrola-Diazet al., 2003) could suppress non-neuronal expression drivenfrom some or all of the cluster 1 promoters.

Expression of transcripts initiated from cluster 2 promo-ters IV, V, and VI is more widespread (Figs. 2A and B). Thismight correlate with observations that the mouse promotersin cluster 2, like the corresponding rat BDNF promotersequences, contain widely expressed transcriptional regula-tory elements that recognize calcium-responsive transcrip-tion factors (CaRF), cAMP/calcium-responsive element

binding proteins (CREB), and methyl-CpG binding protein 2(MeCP2) (Chen et al., 2003a; Martinowich et al., 2003; Tao etal., 2002).

2.3. Mouse BDNF cDNA and tissue-specific expression ofdifferent splicing variants

Evidence for differential usage of polyadenylation sites derivesfrom comparison of the sequences of (1) a mouse expressedsequence tag (EST) IMAGE: 1397218 clone which encodes ashorter 3′ UTR using the most proximal polyadenylation siteand (2) cDNA clone C24 from our library screening whichencodes a longer 3′ UTR with polyadenylation at the distalpolyadenylation site (Fig. 1). These cDNAs predict transcriptsconsistent with the 1.6 and 4.2 kb BDNF mRNAs reported inNorthern analyses of mRNAs from brain and peripheraltissues (Hofer et al., 1990).

Exon-specific RT-PCR reactions using mRNAs isolatedfrom different mouse brain regions and peripheral tissuesproduced size-defined amplicons whose sequences wereverified (Tables 2A and 2B and Fig. 2) to contain previouslydescribed and novel mouse and rat BDNF splicing variants.The novel variants, termed BDNF6A and BDNF6B, as well asother mouse and rat BDNF sequences were deposited inGenBank with accession numbers: mBDNF1, AY057908;mBDNF2A, AY057909; mBDNF2B, AY057910; mBDNF2C,AY057911; mBDNF3, AY057912; mBDNF4, AY057913;mBDNF5, AY057914; mBDNF6A, AY231131; and mBDNF6B,AY231132; rBDNF3, AY559248; rBDNF6A, AY559249; rBDNF6B,AY559250.

Most splice variants could be detected in most mousebrain regions. Highest expression levels of all the variants,including BDNF6B, were observed in hippocampus. RT-PCRusing hippocampus mRNA as template amplified 230, 442,and 525 bp fragments of three intra-exon splice of exon IIand 266 and 341 bp fragments of two inter-exonal spliceproducts of exons VI and VII (Table 2A and Fig. 2A,

Fig. 2 – Isoform-specific RT-PCR amplification using cDNA templates from (A) CNS tissues and (B) peripheral tissues.(1) mBDNF1; (2) mBDNF2A/B/C; (3) mBDNF3; (4) mBDNF4; (5) mBDNF5; (6) mBDNF6A/B; (M) molecular size markers.

5B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

hippocampus). The different splicing isoformswere confirmedby subcloning of RT-PCR fragments and then DNA sequencing.Lowest levels of expression occurred in striatum, although

BDNF4 and 5 were expressed at significant levels in thisstructure (Fig. 2A and real-time RT-PCR). BDNF1was expressedat very low levels or was absent in mRNAs isolated from

Table 2A – RT-PCR primer sequences for mouse BDNF gene amplifications

Variants Primers Orientations Sequences Fragment sizes (bp)

mBDNF 1 mExon I Sense AGTTGCTTTGTCTTCTGTAGTCGC 385mBDNF 2A mExon II Sense GAGCAGAGTCCATTCAGCACCTTG 230mBDNF 2B mExon II Sense GAGCAGAGTCCATTCAGCACCTTG 442mBDNF 2C mExon II Sense GAGCAGAGTCCATTCAGCACCTTG 525mBDNF 3 mExon III Sense GAGAGTTCCGGGTGCTGGCTTGGA 266mBDNF 4 mExon IV Sense GAGTACATATCGGCCACCAAAGAC 311mBDNF 5 mExon V Sense CCGCTGGCTGGCTGTCGCACGGTTC 409mBDNF 6A mExon VI Sense TCTGCGGAACTCCAGGACAGCCTG 266mBDNF 6B mExon VI Sense TCTGCGGAACTCCAGGACAGCCTG 341

6 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

olfactory bulb, striatum, brain stem, and cerebellum. BDNF6Aand 6B were expressed at very low levels or were absent inmRNAs isolated from olfactory bulb, cerebral cortex, striatum,thalamus, and brainstem (Fig. 2A). Interestingly, most BDNFsplice variants were also expressed in heart and spleen (Fig.2B). BDNF4 and BDNF5 variantswere prominently expressed inall peripheral tissues tested. BDNF6A expression was onlyobserved in skeletal muscle (Fig. 2B).

Real-time PCR (RT-PCR) quantification of BDNF splicevariants in different tissues confirmed these patterns, withbrain BDNF4 and 5 expression levels 2- to 10-fold higherthan those manifest in peripheral tissues. Other BDNFvariants were expressed in peripheral tissues at levels less1/20th those found in brain. In mouse hippocampus, splicevariant expression levels were found in the rank order:BDNF5 N BDNF4 N BDNF1 N BDNF2 N BDNF3 N BDNF6. Thenovel BDNF variants BDNF3, 6A, and 6B were expressed atless than 10% of the levels of expression of the previouslyidentified BDNF variants termed BDNF1, 2, 4, and 5.

2.4. Acute cocaine regulation of rat BDNF splicing variants

Male Sprague–Dawley and Long–Evans rats were studied.For both strains, the expression of BDNF variants waslower in striatum when compared with hippocampus andfrontal cortex. Real-time PCR experiments in Long–Evansrats demonstrated that BDNF4 and BDNF5 expression instriatum was about 1/20th that in hippocampus. Ratswhich were treated with saline and those which weretreated with 40 mg/kg cocaine and displayed locomotorstimulation without evidence for epileptiform activitysupplied mRNA for RT-PCR studies of BDNF variantmRNA expression (Wang et al., 1997). Striatal BDNF4mRNA increased 3.1 ± 1.1 (SD)-fold (P = 0.0017, n = 5) inSprague–Dawley rats that were sacrificed 4 h after cocaineadministration (data not shown). This was confirmed inLong–Evans rats in which cocaine elevated BDNF4 expres-sion by 6.5 ± 1.4-fold (P b 0.0001, n = 6) and 3.4 ± 1.7-fold(P = 0.023, n = 6), in the dorsal and ventral striatum,respectively (Figs. 3A, B). In Long–Evans frontal cortex,more modest but statistically significant changes in BDNF4expression (1.8 ± 0.69-fold; P = 0.044, n = 6) were accompa-nied by modest changes in BDNF1 expression (1.8 ± 0.83-fold;P = 0.019, n = 6; Fig. 3C). Neither rat strain displayed anystatistically significant changes in BDNF splice variantexpression in hippocampus (Fig. 3D). Sprague–Dawley ratsfailed to display significant changes in BDNF splice variant

expression in whole cerebral cortex and hippocampus (datanot shown).

Cocaine regulation of BDNF4 mRNA was also analyzedby in situ hybridization using coronal sections of ratstreated acutely with saline or cocaine (40 mg/kg for 4 h). Inthe striatum, BDNF4 mRNA was expressed widely in mediumsized neurons, (Figs. 4B and D). The use of the DIG-labeledRNA antisense probe revealed that the expression of BDNF4mRNA in striatum was up-regulated by acute cocaineexposure (Figs. 4C and D) in comparison with salinetreatment (Figs. 4A and B); no significant signal was visiblewhen the control DIG-labeled RNA sense probe was used(Figs. 4E and F).

2.5. Effect of repeated cocaine administration on rat BDNFsplicing variants

When male Sprague–Dawley rats were injected daily with 20mg/kg cocaine for 10 days and sacrificed 4 h after the lastinjection, no significant changes in BDNF splice variantexpression were observed in the cortex, hippocampus, orstriatum (data not shown). Neither cocaine self-administeringrats (1 mg/kg/infusion, 6 h/day for 10 days that were sacrificed1, 30, or 90 days after the end of the drug self-administrationperiod) nor rats self-administering oral sucrose (0.4 ml/rewarddelivery, 6 h/days for 10 days that were sacrificed 1 day afterthe last self-administration session) displayed any significantdifferences in levels of BDNF splice variant expression ineither striatum (Fig. 5A), frontal cortex (Fig. 5B), or hippocam-pus (Fig. 5C).

3. Discussion

The rodent BDNF gene structures and gene regulation thatemerges from these studies and the comparison of thesesequences with data from the BDNF genes in humans andother species indicate a significant diversity in the gene and inits likely regulatory mechanisms between species, withinspecies, and after cocaine exposures.

Mouse and rat BDNF genes display similar structures,sequences, and homologies to other vertebrate BDNF genes.BDNF genes with multiple transcriptional initiation sites andsplicing into two- and three-part transcripts (Heinrich et al.,2004) can also be identified in humans, chimpanzees, dogs,pigs, cats, cows, chicken, frogs, lampreys, zebrafish, andpufferfish. In contrast, BDNF sequence homologues cannot

Tab

le2B

–Re

al-tim

ePC

Rpr

imer

sequ

ence

san

dMGB-

tagg

ed(m

inor

groo

vebindingpr

otein)p

robe

sequ

ence

sforratBD

NFge

ne

Forw

ardpr

imers

Forw

ardpr

imer

sequ

ence

sMGB-

prob

esProb

ese

quen

ces

Rev

erse

prim

ers

Rev

erse

prim

erse

quen

ces

rExo

nI-F

CACATTACCTTCCAGCATCTGTTG

rExo

nI

AAGCCACAATGTTCCACCAG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

rExo

nIIA-F

CCATTCAGCACCTTGGACAGA

rExo

nIIA

AGTACTTCATCCAGTTCCACCAG

rExo

nVIII-R2

CGAAGTATGAAATAACCATAGTAAGGAAAA

rExo

nIIB-

FAGTTGGCTTCCTAGCGGTGTAG

rExo

nIIB

AAGCTCCGGTTCCACCAG

rExo

nVIII-R2

CGAAGTATGAAATAACCATAGTAAGGAAAA

rExo

nIIC-F

TTGGGAAATGCAAGTGTTTATCT

rExo

nIIC

CCGCAAAGAAGTTCCACCAG

rExo

nVIII-R2

CGAAGTATGAAATAACCATAGTAAGGAAAA

rExo

nIII-F

CCGGGCTGGATGCT

rExo

nIII

TTGAGCCCAGTTCCACCAG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

rExo

nIV

-FCTGCCTTGATGTTTACTTTGACAAG

rExo

nIV

TGACTGAAAAAGTTCCACCAGG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

rExo

nV-F

CAGGAGCGTGACAACAATGTGA

rExo

nV

ACCCTGAGTTCCACCAGG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

rExo

nVIA

-FTCCAGAGGAAGTGAAAGTTTTGACT

rExo

nVIA

TCATCCGGGATTCCACCAG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

rExo

nVIB-F

CCGAACAAACTGATTGCTGAAA

rExo

nVIB

TGGTGTCGTAAAGTTCCACCAG

rExo

nVIII-R1

ACCATAGTAAGGAAAAGGATGGTCAT

7B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

be identified in invertebrate genomes including those forDrosophila melanogaster and Caenorhabditis elegans. Indeed, noneurotrophin gene has been clearly described in invertebrates(Chao, 2000). Neither rodents nor other non-primates appearto possess the additional mechanism for BDNF genomicregulation provided by the BDNFOS antisense gene inhuman and chimpanzee. Other levels of BDNF's similarityand diversity come from the apparent exquisitely tuned use ofmultiple promoters that are likely to lie in the relatively short5′ flanking sequences and exons that encode 5′ untranslatedregions of this gene. While additional control and diversitysites may reside in other genomic regions that have not beenidentified to date, the sequences that we have characterizedhere are likely to play important roles in the highly diverselyregulated expression of BDNF. This diversity is likely todepend on diverse repertoires of negative regulatory elementsthat are likely to include the presence or absence of TATAAsequences in the different BDNF promoters, negative elementssuch as the neuron restricted silencing element and often-positively regulated and/or activity-dependent elements suchas CaRF, CREB, and MeCP2 (Chen et al., 2003a; Martinowich etal., 2003; Tao et al., 2002). This diversity of potential regulatorysequences could allow different constellations of transcriptionfactors that are present in distinct tissues and different brainregions to regulate BDNF in ways that produce the differen-tial patterns of BDNF isoform expression that we and othershave observed.

Most BDNF transcripts produce the well-known 32 kDapropeptide precursor of the well-known mature 14 kDa BDNFpeptide (Mowla et al., 2001). However, the 5′ UTR of BDNF1contains an additional translation initiation codon that couldadd the eight additional amino acids MFHQVRRV to mouseproBDNF in ways that could alter its function. The combina-tion of alternative transcriptional initiation sites and alterna-tive adenylation site usage that generates ∼1.6 and ∼4.2 kbmRNA species with different 3′ UTR lengths provides a varietyof BDNF transcripts that appear likely to differ in their stabilityand/or in the intracellular compartments into which they aretrafficked and translated. Some transcripts might be differen-tially trafficked to dendrites, for example, allowing localizedsynaptic BDNF translation (Steward and Worley, 2001a,b;Tongiorgi et al., 2004). The evidence for differential BDNFregulation through use of species-specific antisense tran-scripts, differential promoter usage, and differential splicevariant usage that we describe here is accompanied byevidence from other reports. These reports support regulationof BDNF expression in cells or tissues by variations in DNAmethylation (Chen et al., 2003a; Martinowich et al., 2003),second messenger systems (Lauterborn et al., 1996), mRNAsplicing, targeting and/or half-life (Righi et al., 2000) andproBDNF processing, posttranslational modifications, packag-ing transport, and/or secretion (Heymach et al., 1996; Mowla etal., 2001).

Brain regional patterns of BDNF isoform expression providespecific examples of the exquisite regulation of BDNF genomiccontrol. Most BDNF splice variants are expressed at high levelsin cortex, hippocampus, and cerebellum. In the dorsal andventral striatum, BDNF4 and 5 could be reliably quantified byreal-timePCR in 40 cycles, but BDNF1, 2, 3, and6 couldnot (Figs.3A and B). Using different sets of primers (Table 2A), BDNF1, 2,

Fig. 3 – Real-time PCR quantification of mRNA from the rat brain regions in animals sacrificed 4 h after 40 mg/kg acute cocainetreatments. (A) Dorsal striatum; (B) ventral striatum; (C) frontal cortex; and (D) hippocampus. Open boxes represent salinecontrols. Filled boxes represent cocaine-treated rats. **P b 0.0001. *P b 0.05.

8 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

and 3 transcripts could be weakly detected in whole striatumby 45–50 PCR cycles (Fig. 2A). Our current results are in accordwith previous reports that have detected striatal BDNF4mRNA

Fig. 4 – In situ hybridization using the exon-IV-specific probe on(A and B) and cocaine (C and D). The boxed regions (A, C, and E)(B, D, and F). Control antisense probe hybridization is also show

expression using Northern (Hofer et al., 1990) and RT-PCRanalyses (Zuccato et al., 2003) but diverge from those of otherstudies in which investigators failed to detect striatal

striatum coronal sections of the rat brain treated with salineare enlarged to show BDNF4 regulation on cellular leveln (E and F).

Fig. 5 – Real-time PCR quantification of the rat brain region mRNAs from (A) striatum; (B) frontal cortex; and (C) hippocampus.Open bars represent naive rats. Striped boxes represent rats that were sacrificed 1 day after 10 daily 6-h sessions ofsucrose self-administration (0.4 ml 10% sucrose/reward delivery). Filled boxes represent rats sacrificed 1 day after 10 daily6-h sessions of intravenous cocaine self-administration (1.0 mg/kg/infusion).

9B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

expression by in situ hybridization (Conner et al., 1997).However, using in vitro transcribed digoxigenin-labeled exonIV specific RNA probe, we were able to observe significantlydifferential expression of BDNF4mRNA in striatumof ratswithacute cocaine and saline treatments (Fig. 4).

It is striking that acute cocaine injections increased BDNF4expression up to 5-fold in striatum, but not in the hippocam-pus where BDNF1, 2, and 4 transcripts can be stimulated by upto 50-fold following exposure to kainic acid (Metsis et al., 1993).The increase in BDNF4 in the striatum by acute cocaine wasalso a transient event; we could not observe the increase inchronic treatment and cocaine self-administration for 10 days(Fig. 5). The differential BDNF gene regulation by kainic acidand cocaine in the hippocampus and striatum, implies theexistence of different forms of synaptic plasticity in the twosystems. Medium spiny neurons in striatum may possessspecial calcium entry routes that are stimulated by cocaineand dopamine that activate calcium-permeable NMDA recep-tors, L-type calcium channels, and type 1 inositol 1,4,5-triphosphate receptors (InsP3R1) by activation of PKA andinhibition of protein phosphatase 1 (PP1) (Bernard et al., 1997;Carter et al., 2004; Hernandez-Lopez et al., 1997). The calciuminflux may activate two calcium responsive elements (CaRE)and a cAMP responsive element (CRE) located in the promoterregion of BDNF4 (Chen et al., 2003b). The transient increase ofBDNF from otherwise low basal levels in striatum mightactivate tyrosine receptor kinase B (trkB) and promote neurongrowth by increasing densities of dendritic spines on mediumspiny neurons in nucleus accumbens (Robinson et al., 2004).

Our data suggested that BDNF-trkB signaling pathways couldplay important roles in neuronal plasticity in mesolimbicsystems and promotes dopamine and glutamate interactionsinduced by cocaine. Thus, the special form of cocaine inducedsynaptic plasticity in mesolimbic systems might involveinhibition of the dopamine transporter, activation of dopa-mine and glutamate receptors, and stimulation of BDNF geneexpression leading to downstream serine/threonine andtyrosine phosphorylation which is regulated by their corres-ponding kinases/phosphatases and modulators (Greengard etal., 1999; Liu et al., 2005a). Some of the specificity of the effectsof cocaine on BDNF expression was unanticipated, givenprevious extensive literature that is especially prominent intying BDNF to the dopaminergic systems that are modulatedby cocaine. BDNF co-localizes with tyrosine hydroxylase-immunopositive ventral midbrain (VTA) dopaminergic neu-rons (Seroogy et al., 1994) that are implicated in the rewardingeffects of cocaine and other abused substances (Wise et al.,2004). BDNF infusions into the VTA or the nucleus accumbensincrease psychostimulant-dependent locomotor activity(Pierce et al., 2001). Chronic infusions of BDNF into thenucleus potentiate cocaine effects on conditioned responsesto reward-paired cues (Horger et al., 1999). Acute VTA BDNFinduces long-lasting potentiation of the ability of cocaine-paired cues to induce cocaine seeking (Lu et al., 2004).

The patterns of change in cocaine-induced BDNF expres-sion in the current report are in accord with some previousobservations, but do not readily parallel other observationsreported by previous investigators. We did not identify

10 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

changes in BDNF splice variantmRNAs in the cortex, striatum,or hippocampus in rats sacrificed after withdrawal fromcocaine self-administration at times similar to those atwhich VTA and nucleus accumbens BDNF immunoreactivityhas been reported to increase (Grimm et al., 2003; Lu et al.,2004). We did not find changes in splice variant expression inrats which were chronically treated with stimulants, eventhoughMeredith et al. (2002) identified BDNFmRNA upregula-tion in rats sacrificed following repeated administration of asimilar, though not identical stimulant, amphetamine. Whilemany reports in the literature document cocaine regulation ofmany mRNAs and proteins (Kalivas et al., 2003; Wolf et al.,2003), we and others have also clearly documented toleranceor desensitization to many of the gene regulatory effects ofpsychostimulants (Persico et al., 1993).

The additional characterization of the rat andmouse BDNFgenes presented here, the additional evidence for theirdifferential transcription and expression, and the specificityof the patterns of regulation by cocaine each underscores theways in which a single gene's control can be tailored in manyways to the apparently substantial requirements for itsspecific regulation in complex organs such as the brain. Thelarge variety of mechanisms, including species-nonspecificand relatively species-specific mechanisms that appear tolead to the full normal patterns of BDNF regulation andexpression, each appears to point toward substantial evolu-tionary importance for complex patterns of expression andregulation of this gene.

4. Experimental procedures

4.1. Acute and chronic cocaine administration

Rats and mice (Charles River, Raleigh, NC, USA) were kept under12-h light/dark cycle with free access to water and food. Theexperimental procedures followed the “Principles of LaboratoryAnimal Care” (NIH publication no. 86-23, 1996) and were approvedby the local Animal Care and Use Committee. Tissues wereobtained from male 20–30g C57/BL6 mice sacrificed by cervicaldislocation. For acute cocaine treatments, male Sprague–Dawleyor Long–Evans rats (350–400 g, n = 6) were injected with cocaine (40mg/kg, i.p.) or saline and sacrificed 4 h after drug administration.For chronic cocaine treatment, male Sprague–Daley rats (n = 6)were injected with cocaine (20 mg/kg cocaine, i.p.) or saline everyday for 10 days and sacrificed 4 h after the last injection. When thedissected whole striatum tissues of Sprague–Dawley rats showedincreased BDNF4 expression by acute cocaine, dorsal and ventralstriatum punches of Long–Evans rats were used to show moredetailed brain regional expression regulation. Brains, peripheraltissues and/or brain regions were rapidly dissected and frozen onpowdered dry ice.

4.2. Cocaine and sucrose self-administration

Male Long–Evans rats (n = 8–9) were trained to self-administerintravenous cocaine (1.0 mg/kg/infusion, infusion volume of 0.13ml, drug was dissolved in saline and was delivered over 4.5 s) or10% oral sucrose solution (0.4 ml/reward delivery) as previouslydescribed (Grimm et al., 2003; Lu et al., 2004). Briefly, rats weretrained for 10 days under fixed-ratio-1 schedules during six 1-h daily sessions that began at the onset of the dark cycle and wereseparated by 5-min intervals. Each reward was accompanied by a5-s tone–light cue. Rats were then sacrificed 1 day, 30 days, or 90

days after the end of the last exposure to cocaine, the brains wererapidly frozen, and bilateral punch samples taken from frontalcortex, dorsal striatum, ventral striatum, and hippocampus usingcryostat sections cut at coordinates: AP: +2.8 mm (frontal cortex);+2.2 mm (striatum); and −3.0 mm (hippocampus) (Paxinos et al.,1990). The mean ± SEM of cocaine of cocaine self-administrationduring the last 3 days of training were 52.9 ± 1.8, 54.4 ± 1.9, and57.3 ± 1.7 mg/kg/6 h, respectively. The behavioral data on time-dependent increases in cocaine seeking, as measured in extinc-tion tests 1, 30, and 90 after withdrawal from the drug, as well asdata on the time-dependent increase in BDNF protein expressionin mesolimbic dopamine areas, are described elsewhere (Grimmet al., 2003).

4.3. Mouse BDNF cDNA clones and sequences

Mouse EST clones (IMAGE: #1397218 in pT3T7 D-Pac 1 vector and#3675386 in pCMV-Sport 6 vector) were obtained from Clone-Ranger™ (Invitrogen, Carlsbad, CA) and sequenced by primerwalking. Both cDNA clones contained themajor coding exon (exonVIII). Additional mouse BDNF cDNA clones were obtained byscreening a neonatal mouse brain cDNA library, cloned in theEcoRI/XhoI sites of the Uni-ZAP XR vector (Stratagen, La Jolla, CA)using methods previously described (Liu et al., 1993).

4.4. RNA isolation, cDNA synthesis, RT-PCR, and real-time PCRquantitation

Total RNA was extracted from mouse peripheral tissues, brainregions, or rat brain punches using RNAzolB (Tel-Test, Inc.Friendwood, TX) protocol. Single strand cDNA was synthesizedfrom total RNA using SuperScript™ One-Step RT-PCR System(Invitrogen, Carlsbad, CA). Novel rodent exons were identified byaligning mouse or rat genomic sequences with human BDNF exonsequences using Sequencher (Version 3.0, Gene Code Co., AnnArbor, MI) and RT-PCR with corresponding primer sequences.Two-step PCR programs were used to amplify exon-specificmouse or rat BDNF transcripts. Thermal cycling was carried outas follows: (1) 95 °C for 8min, (2) 7 cycles of 30 s at 94 °C, 2min at 72°C with descending temperature of 1 °C for each cycle, (3) 45 cyclesof 30 s at 94 °C, 2 min at 65 °C, and (4) a final 5 min 65 °C extension.Reverse primer sequences were the reverse compliment to themajor coding exon of rodent BDNF. Forward primers were senseorientation for the six 5′ upstream non-coding exons (Table 2A).Molecular masses of cross-intron BDNF RT-PCR amplicons wereanalyzed using 2% agarose gels, ethidium bromide staining, anddideoxynucleotide termination sequencing after subcloning intopCR4-TOPO vector (Invitrogen, Carlsbad, CA).

For quantitative real-time PCR assays, the exon-specificprimers and fluorescent Fam-labeled probes were designed(Table 2B) using Primer Express (Applied Biosystems, Foster City,CA) to produce amplimers that spanned several BDNF exonregions. Single strand cDNA templates were synthesized frommRNA extracted from brain regions, and peripheral tissues, two-step PCR reactions used default settings (ABI 7900 HT PCR; AppliedBiosystems, Foster City, CA), analyses used methods in userbulletin #2 (ABI Prism 7700 Sequence Detection System) andPrism-3 programs (GraphPad Software, Inc., San Diego, CA) forgraphical and statistical analyses including t tests and one-wayanalyses of variance.

4.5. In situ hybridization

BDNF exon IV specific probe (159 bp) was amplified (forwardprimer: gagtacatatcggccaccaaagac; reverse primer: tggaccacctt-gaaaaagtcagt) using mouse brain cDNA as templates and clonedinto pBluescript vector. In situ hybridization was performed asdescribed previously (Gong et al., 1999). Briefly, DNA templates forriboprobe synthesis were prepared by digesting plasmid clones

11B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

containing the exon 4 of mBDNF. After linearization, digoxigenin(DIG)-labeled RNA probes were prepared by in vitro transcription.Long–Evans rats that were injected with saline or cocaine acutelywere used for analysis of BDNF4 mRNA expression. The rats wereanesthetized, perfused, and their brains were removed immedi-ately and fixed in 4% paraformaldehyde for 2 h. Frozen sections (20μm) were cut on a cryostat, thaw-mounted onto SuperfrostPlusslides, and air-dried. All solutions were prepared in deionized H2Otreated with 0.1% (V/V) diethylpyrocarbonate and autoclaved.Sections were fixed by immersion in 4% paraformaldehyde in PBS,pH 7.4, and then briefly rinsed twice with PBS. After treatmentwith Proteinase K, sections were refixed in 4% paraformaldehyde.The sections then were acetylated by immersion in 0.1 Mtriethanolamine containing 0.25% acetic anhydride, permeabi-lized by 1% Triton X-100, and rinsed twice with PBS. Prehybridiza-tion was carried out at 4 °C overnight with prehybridizationsolution (50% formamide, 5× SSC, 5× Denhardt's solution, 250 μg/ml yeast tRNA, and 500 μg/ml salmon sperm DNA). For hybridiza-tion, the sections on each slide were covered by a prehybridizationsolution containing 1 μg/ml of cRNA probe, incubated at 65 °Covernight in a humid chamber. Sections were immersed sequen-tially in 0.2× SSC twice and buffer 1 (0.1 M Tris pH 7.5, 0.15 M NaCl)twice. The sections were covered by 1:2000 anti-digoxin antibodyin buffer 2 (1% inactivated normal goat serum in buffer 1) andincubated at 4 °C overnight. After rinsing with buffer 1 and buffer 3(0.1 M Tris pH 9.5, 0.1 M NaCl, and 50mMMgCl2), the sections weredeveloped with a solution containing 1.2 mg levamisole and 300 μlNBT/BCIP in 5 ml development buffer containing 0.1 M Tris (pH9.5), 0.1 M NaCl, and 50 mM MgCl2.

Acknowledgments

We acknowledge financial support from NIDA-IRP, NIH/DHSS.Some of these data were generated through the use of theCelera Discovery System and Celera's associated databases.

R E F E R E N C E S

Aoyama, M., Asai, K., Shishikura, T., Kawamoto, T., Miyachi, T.,Yokoi, T., Togari, H., Wada, Y., Kato, T., Nakagawara, A., 2001.Human neuroblastomas with unfavorable biologies expresshigh levels of brain-derived neurotrophic factor mRNA and avariety of its variants. Cancer Lett. 164, 51–60.

Balkowiec, A., Katz, D.M., 2002. Cellular mechanisms regulatingactivity-dependent release of native brain-derivedneurotrophic factor from hippocampal neurons. J. Neurosci. 22,10399–10407.

Bernard, V., Somogyi, P., Bolam, J.P., 1997. Cellular, subcellular, andsubsynaptic distribution of AMPA-type glutamate receptorsubunits in the neostriatum of the rat. J. Neurosci. 17, 819–833.

Bishop, J.F., Mueller, G.P., Mouradian, M.M., 1994. Alternate 5′exons in the rat brain-derived neurotrophic factor gene:differential patterns of expression across brain regions. BrainRes. Mol. Brain Res. 26, 225–232.

Bolanos, C.A., Nestler, E.J., 2004. Neurotrophicmechanisms in drugaddiction. Neuromol. Med. 5, 69–83.

Carter, A.G., Sabatini, B.L., 2004. State-dependent calciumsignaling in dendritic spines of striatal medium spiny neurons.Neuron 44, 483–493.

Chao, M.V., 2000. Trophic factors: an evolutionary cul-de-sac ordoor into higher neuronal function? J. Neurosci. Res. 59,353–355.

Chen,W.G., Chang, Q., Lin, Y., Meissner, A.,West, A.E., Griffith, E.C.,Jaenisch, R., Greenberg, M.E., 2003a. Derepression of BDNF

transcription involves calcium-dependent phosphorylation ofMeCP2. Science 302, 885–889.

Chen, W.G., West, A.E., Tao, X., Corfas, G., Szentirmay, M.N.,Sawadogo, M., Vinson, C., Greenberg, M.E., 2003b. Upstreamstimulatory factors are mediators of Ca2+-responsivetranscription in neurons. J. Neurosci. 23, 2572–2581.

Conner, J.M., Lauterborn, J.C., Yan, Q., Gall, C.M., Varon, S.,1997. Distribution of brain-derived neurotrophic factor(BDNF) protein and mRNA in the normal adult rat CNS:evidence for anterograde axonal transport. J. Neurosci. 17,2295–2313.

Dluzen, D.E., Story, G.M., Xu, K., Kucera, J., Walro, J.M., 1999.Alterations in nigrostriatal dopaminergic function withinBDNF mutant mice. Exp. Neurol. 160, 500–507.

Goggi, J., Pullar, I.A., Carney, S.L., Bradford, H.F., 2002. Modulationof neurotransmitter release induced by brain-derivedneurotrophic factor in rat brain striatal slices in vitro. BrainRes. 941, 34–42.

Gong, J., Xu, J., Bezanilla, M., van Huizen, R., Derin, R., Li, M., 1999.Differential stimulation of PKC phosphorylation of potassiumchannels by ZIP1 and ZIP2. Science 285, 1565–1569.

Gong, Y., Eggert, H., Englert, C., 2001. The murine Wilms tumorsuppressor gene (wt1) locus. Gene 279, 119–126.

Greengard, P., Allen, P.B., Nairn, A.C., 1999. Beyond the dopaminereceptor: the DARPP-32/protein phosphatase-1 cascade.Neuron 23, 435–447.

Grimm, J.W., Lu, L., Hayashi, T., Hope, B.T., Su, T.P., Shaham,Y., 2003. Time-dependent increases in brain-derivedneurotrophic factor protein levels within the mesolimbicdopamine system after withdrawal from cocaine:implications for incubation of cocaine craving. J. Neurosci.23, 742–747.

Gurrola-Diaz, C., Lacroix, J., Dihlmann, S., Becker, C.M., von KnebelDoeberitz, M., 2003. Reduced expression of the neuronrestrictive silencer factor permits transcription of glycinereceptor alpha1 subunit in small-cell lung cancer cells.Oncogene 22, 5636–5645.

Hall, F.S., Drgonova, J., Goeb, M., Uhl, G.R., 2003. Reducedbehavioral effects of cocaine in heterozygous brain-derivedneurotrophic factor (BDNF) knockout mice.Neuropsychopharmacology 28, 1485–1490.

Hallbook, F., Lundin, L.G., Kullander, K., 1998. Lampetra fluviatilisneurotrophin homolog, descendant of a neurotrophinancestor, discloses the early molecular evolution ofneurotrophins in the vertebrate subphylum. J. Neurosci. 18,8700–8711.

Hartmann, M., Heumann, R., Lessmann, V., 2001. Synapticsecretion of BDNF after high-frequency stimulation ofglutamatergic synapses. EMBO J. 20, 5887–5897.

Heinrich, G., Pagtakhan, C.J., 2004. Both 5′ and 3′ flanks regulateZebrafish brain-derived neurotrophic factor gene expression.BMC Neurosci. 5, 19.

Hernandez-Lopez, S., Bargas, J., Surmeier, D.J., Reyes, A., Galarraga,E., 1997. D1 receptor activation enhances evoked discharge inneostriatal medium spiny neurons by modulating an L-typeCa2+ conductance. J. Neurosci. 17, 3334–3342.

Heymach Jr., J.V., Kruttgen, A., Suter, U., Shooter, E.M., 1996. Theregulated secretion and vectorial targeting of neurotrophins inneuroendocrine and epithelial cells. J. Biol. Chem. 271,25430–25437.

Hofer, M., Pagliusi, S.R., Hohn, A., Leibrock, J., Barde, Y.A.,1990. Regional distribution of brain-derived neurotrophicfactor mRNA in the adult mouse brain. EMBO J. 9,2459–2464.

Horger, B.A., Iyasere, C.A., Berhow, M.T., Messer, C.J., Nestler, E.J.,Taylor, J.R., 1999. Enhancement of locomotor activity andconditioned reward to cocaine by brain-derived neurotrophicfactor. J. Neurosci. 19, 4110–4122.

Hyman, C., Hofer, M., Barde, Y.A., Juhasz, M., Yancopoulos, G.D.,

12 B R A I N R E S E A R C H 1 0 6 7 ( 2 0 0 6 ) 1 – 1 2

Squinto, S.P., Lindsay, R.M., 1991. BDNF is a neurotrophic factorfor dopaminergic neurons of the substantia nigra. Nature 350,230–232.

Kalivas, P.W., McFarland, K., Bowers, S., Szumlinski, K., Xi, Z.X.,Baker, D., 2003. Glutamate transmission and addiction tococaine. Ann. N. Y. Acad. Sci. 1003, 169–175.

Kontkanen, O., Castren, E., 1999. Trophic effects of selegiline oncultured dopaminergic neurons. Brain Res. 829, 190–192.

Lauterborn, J.C., Rivera, S., Stinis, C.T., Hayes, V.Y., Isackson, P.J.,Gall, C.M., 1996. Differential effects of protein synthesisinhibition on the activity-dependent expression of BDNFtranscripts: evidence for immediate-early gene responses fromspecific promoters. J. Neurosci. 16, 7428–7436.

Liu, Q.R., Lopez-Corcuera, B., Mandiyan, S., Nelson, H., Nelson, N.,1993. Molecular characterization of four pharmacologicallydistinct gamma-aminobutyric acid transporters in mousebrain [corrected]. J. Biol. Chem. 268, 2106–2112.

Liu, Q.-R., Gong, J.-P., Uhl, G.R., 2005a. Families of proteinphosphatase 1modulators activated by protein kinase A and C:focus on brain. Prog. Nucleic Acid Res. 79, 371–404.

Liu, Q.R., Walther, D., Drgon, T., Polesskaya, O., Lesnick, T.G.,Strain, K.J., de Andrade, M., Maraganore, D.M., Uhl, G.R., 2005b.Human brain derived neurotrophic factor (BDNF) genes,splicing patterns, and assessments of associations withsubstance abuse and Parkinson's disease. Am. J. Med. Genet.,Part B Neuropsychiatr. Genet. 134, 93–103.

Lu, L., Dempsey, J., Liu, S.Y., Bossert, J.M., Shaham, Y., 2004.A single infusion of brain-derived neurotrophic factor intothe ventral tegmental area induces long-lastingpotentiation of cocaine seeking after withdrawal.J. Neurosci. 24, 1604–1611.

Martinowich, K., Hattori, D., Wu, H., Fouse, S., He, F., Hu, Y., Fan, G.,Sun, Y.E., 2003. DNA methylation-related chromatinremodeling in activity-dependent BDNF gene regulation.Science 302, 890–893.

Meredith, G.E., Callen, S., Scheuer, D.A., 2002. Brain-derivedneurotrophic factor expression is increased in the ratamygdala, piriform cortex and hypothalamus followingrepeated amphetamine administration. Brain Res. 949,218–227.

Metsis, M., Timmusk, T., Arenas, E., Persson, H., 1993. Differentialusage of multiple brain-derived neurotrophic factor promotersin the rat brain following neuronal activation. Proc. Natl. Acad.Sci. U. S. A. 90, 8802–8806.

Mowla, S.J., Pareek, S., Farhadi, H.F., Petrecca, K., Fawcett, J.P.,Seidah, N.G., Morris, S.J., Sossin, W.S., Murphy, R.A., 1999.Differential sorting of nerve growth factor and brain-derivedneurotrophic factor in hippocampal neurons. J. Neurosci. 19,2069–2080.

Mowla, S.J., Farhadi, H.F., Pareek, S., Atwal, J.K., Morris, S.J., Seidah,N.G., Murphy, R.A., 2001. Biosynthesis and post-translationalprocessing of the precursor to brain-derived neurotrophicfactor. J. Biol. Chem. 276, 12660–12666.

Nakayama, M., Gahara, Y., Kitamura, T., Ohara, O., 1994.Distinctive four promoters collectively direct expression ofbrain-derived neurotrophic factor gene. Brain Res. Mol. BrainRes. 21, 206–218.

Narita, M., Aoki, K., Takagi, M., Yajima, Y., Suzuki, T., 2003.Implication of brain-derived neurotrophic factor in therelease of dopamine and dopamine-related behaviorsinduced by methamphetamine. Neuroscience 119, 767–775.

Paxinos, G., Tork, I., 1990. Neuroanatomical nomenclature. TrendsNeurosci. 13, 169.

Persico, A.M., Schindler, C.W., O'Hara, B.F., Brannock, M.T.,Uhl, G.R., 1993. Brain transcription factor expression: effects ofacute and chronic amphetamine and injection stress. BrainRes. Mol. Brain Res. 20, 91–100.

Pierce, R.C., Bari, A.A., 2001. The role of neurotrophic factors inpsychostimulant-induced behavioral and neuronal plasticity.Rev. Neurosci. 12, 95–110.

Righi, M., Tongiorgi, E., Cattaneo, A., 2000. Brain-derivedneurotrophic factor (BDNF) induces dendritic targeting of BDNFand tyrosine kinase BmRNAs in hippocampal neurons througha phosphatidylinositol-3 kinase-dependent pathway.J. Neurosci. 20, 3165–3174.

Robinson, T.E., Kolb, B., 2004. Structural plasticity associated withexposure to drugs of abuse. Neuropharmacology 47 (Suppl. 1),33–46.

Seroogy, K.B., Lundgren, K.H., Tran, T.M., Guthrie, K.M.,Isackson, P.J., Gall, C.M., 1994. Dopaminergic neurons in ratventral midbrain express brain-derived neurotrophicfactor and neurotrophin-3 mRNAs. J. Comp. Neurol. 342,321–334.

Shen, R.Y., Altar, C.A., Chiodo, L.A., 1994. Brain-derivedneurotrophic factor increases the electrical activity of parscompacta dopamine neurons in vivo. Proc. Natl. Acad. Sci.U. S. A. 91, 8920–8924.

Steward, O., Worley, P., 2001a. Localization of mRNAs at synapticsites on dendrites. Results Probl. Cell Differ. 34, 1–26.

Steward, O., Worley, P.F., 2001b. A cellular mechanism fortargeting newly synthesized mRNAs to synaptic sites ondendrites. Proc. Natl. Acad. Sci. U. S. A. 98, 7062–7068.

Tao, X., West, A.E., Chen, W.G., Corfas, G., Greenberg, M.E., 2002.A calcium-responsive transcription factor, CaRF, that regulatesneuronal activity-dependent expression of BDNF. Neuron 33,383–395.

Timmusk, T., Palm, K., Metsis, M., Reintam, T., Paalme, V., Saarma,M., Persson, H., 1993. Multiple promoters direct tissue-specificexpression of the rat BDNF gene. Neuron 10, 475–489.

Timmusk, T., Palm, K., Lendahl, U., Metsis, M., 1999. Brain-derivedneurotrophic factor expression in vivo is under the control ofneuron-restrictive silencer element. J. Biol. Chem. 274,1078–1084.

Tongiorgi, E., Armellin, M., Giulianini, P.G., Bregola, G., Zucchini, S.,Paradiso, B., Steward, O., Cattaneo, A., Simonato, M., 2004.Brain-derived neurotrophic factor mRNA and protein aretargeted to discrete dendritic laminas by events that triggerepileptogenesis. J. Neurosci. 24, 6842–6852.

Uhl, G.R., Liu, Q.R., Walther, D., Hess, J., Naiman, D., 2001.Polysubstance abuse-vulnerability genes: genome scans forassociation, using 1004 subjects and 1494 single-nucleotidepolymorphisms. Am. J. Hum. Genet. 69, 1290–1300.

Wang, X.B., Funada, M., Imai, Y., Revay, R.S., Ujike, H.,Vandenbergh, D.J., Uhl, G.R., 1997. rGbeta1:a psychostimulant-regulated gene essential for establishingcocaine sensitization. J. Neurosci. 17, 5993–6000.

Wise, R.A., 2004. Dopamine and food reward: back to theelements. Am. J. Physiol.: Regul., Integr. Comp. Physiol. 286,R13.

Wolf, F.W., Heberlein, U., 2003. Invertebrate models of drug abuse.J. Neurobiol. 54, 161–178.

Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M.,Conti, L., Cataudella, T., Leavitt, B.R., Hayden, M.R.,Timmusk, T., Rigamonti, D., Cattaneo, E., 2003. Huntingtininteracts with REST/NRSF to modulate the transcription ofNRSE-controlled neuronal genes. Nat. Genet. 35, 76–83.