Right Ventricular Injury in ST-Elevation Myocardial Infarction: Risk Stratification by Visualization...

1942-0080American Heart Association. All rights reserved. Print ISSN: 1941-9651. Online ISSN: 2011 Copyright ©

Dallas, TX 72514Circulation: Cardiovascular Imaging is published by the American Heart Association. 7272 Greenville Avenue,

DOI: 10.1161/CIRCIMAGING.111.967810 published online November 11, 2011;Circ Cardiovasc Imaging

GutberletSuzanne de Waha, Steffen Desch, Ingo Eitel, Meinhard Mende, Holger Thiele and Matthias Matthias Grothoff, Christian Elpert, Janine Hoffmann, Johannes Zachrau, Lukas Lehmkuhl,

ResonanceVisualization of Wall Motion, Edema and Delayed Enhancement Cardiac Magnetic

Right Ventricular Injury in ST-Elevation Myocardial Infarction: Risk Stratification by

World Wide Web at:

The online version of this article, along with updated information and services, is located on the

initial publication. Advance online articles must include the digital object identifier (DOIs) and date ofpublication priority; they are indexed by PubMed from initial publication. Citations to available prior to final publication). Advance online articles are citable and establishnot yet appeared in the paper journal (edited, typeset versions may be posted when Advance online articles have been peer reviewed and accepted for publication but have

http://www.lww.com/reprintsReprints: Information about reprints can be found online at

[email protected] West Camden Street, Baltimore, MD 21201-2436. Phone: 410-528-4050. Fax: 410-528-8550. E-mail:Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters Kluwer Health,

http://circimaging.ahajournals.org/site/subscriptions/Subscriptions: Information about subscribing to Circulation: Cardiovascular Imaging is online at

by guest on February 21, 2013circimaging.ahajournals.orgDownloaded from

http://circimaging.ahajournals.org/site/subscriptions/

mailto:[email protected]

http://www.lww.com/reprints

http://circimaging.ahajournals.org/

Right Ventricular Injury in ST-Elevation Myocardial Infarction:

Risk Stratification by Visualization of Wall Motion, Edema and Delayed

Enhancement Cardiac Magnetic Resonance Grothoff et al: Right Ventricular Injury in CMR

Matthias Grothoff¹, MD; Christian Elpert¹, BSc; Janine Hoffmann¹, MD;

Johannes Zachrau², BSc; Lukas Lehmkuhl¹, MD; Suzanne de Waha², MD;

Steffen Desch², MD; Ingo Eitel², MD; Meinhard Mende³, PhD;

Holger Thiele²*, MD; Matthias Gutberlet¹*, MD

The first three authors contributed equally to this work

*H.T. and M.G. should be both considered as senior authors

¹Department of Radiology, University of Leipzig – Heart Center, Germany

²Department of Cardiology, University of Leipzig – Heart Center, Germany

³Clinical Trial Centre – University of Leipzig, Germany

Correspondence to: Matthias Grothoff, MD Department of Diagnostic and Interventional Radiology University of Leipzig, Heart Center Strümpellstr. 39 04289 Leipzig, Germany Tel.: +49-341-865-1702 Fax: +49-341-865-1803 E-mail: [email protected]

Journal Subject Codes: Acute myocardial infarction, CT and MRI, Catheter-based coronary

interventions: stents

GRadiology, University of Leipzig Heart Center, Germany

C

e

Radiology, University of Leipzig Heart Center, Germany

Cardiology, University of Leipzig – Heart Center, Germany

entre – University of Leipzig, Germany



Abstract Background Patients with right ventricular injury (RVI) complicating ST-elevation

myocardial infarction (STEMI) suffer from impaired prognosis, but it is unclear which

patients are at risk of developing RVI. Cardiac magnetic resonance (CMR) can identify these

patients and might add important information on risk stratification, prognosis and treatment.

Aims were to determine the predictors and the prognostic significance of RVI assessed by

wall motion abnormalities, edema, myocardial-salvage-index (MSI) and delayed enhancement

(DE) in acute reperfused STEMI.

Methods and Results We studied 450 patients 1-4 days after primary angioplasty in

STEMI. T2-weighted and DE CMR was used for visualizing edema and scar to calculate

MSI. Cine-imaging was performed to assess wall motion abnormalities, which, in

combination with edema, were considered diagnostic for RVI. Patients with RVI were

compared to matched patients with isolated left ventricular (LV) infarction. The primary

endpoint was the occurrence of a major adverse cardiac event (MACE): a composite of death,

reinfarction and congestive heart failure after a median follow-up period of 20.9 months. RVI

was present in 69 patients and 41/69 showed myocardial necrosis. In a multivariable stepwise

forward logistic regression analysis a high RV myocardial mass (Odds-Ratio 2.06, 95%

Confidence-Interval 1.18-3.58, p=0.012) and a low TIMI-flow pre angioplasty (Odds-Ratio

0.50, 95% CI 0.32-0.76, p=0.011) were associated with RVI. Cox regression analysis

revealed RVI as the most statistically significant predictor of time to MACE (Hazard-Ratio

3.36, 95% CI 1.99-5.66, p<0.001).

Conclusions RVI detected by CMR is a strong and independent predictor of clinical

outcome after acute reperfused STEMI.

Clinical Trial Registration URL: http://www.clinicaltrials.gov. Unique identifier:

NCT01359306.

Key Words: acute myocardial infarction; cardiac magnetic resonance imaging; right ventricle

infarction; myocardial salvage; prognosis

on abnormalitittttieieieieieieies

VI. P PPPPPPatatatatatatatieieieieieieientntntntntntnts s s wiwiwiwiwiwiwi

tched patients with isolated left ventricular (LV) infarction.

occurrence of a major adverse cardiac event (MACE): a com o

c

9 tients and 41/69 showed ocardial necrosis. In a multivari

regression analysis a high RV myocardial mass (Odds-Rati

tched patients with isolated left ventricular (LV) infarction.

occurrence of a major adverse cardiac event (MACE): a compo

congestive heart failure after a median follow-up period of 20.9

9 patients and 41/69 showed myocardial necrosis. In a multivari

regression analysis a high RV myocardial mass (Odds-Rati



Right ventricular injury (RVI) in ST-elevation myocardial infarction (STEMI) can cause

severe hemodynamic derangements and is associated with increased mortality and morbidity

(1). Owing to the right ventricular (RV) volume pump characteristics, RVI with

hemodynamic compromise requires a specific treatment (2). Hence, for optimizing

therapeutic strategies an early and accurate diagnosis is mandatory.

In necropsy studies RVI can be found in up to 50% of patients with inferior STEMI (3). In

clinical routine, however, RVI is diagnosed by echocardiography, electrocardiography and

clinical findings and detection rates show a wide range depending on the population and

diagnostic criteria used (2).

Cardiac magnetic resonance (CMR) emerged as a powerful tool in visualizing myocardial

injury after left ventricular (LV) STEMI. High signal intensity in T2-weighted imaging

visualizes myocardial edema representing myocardium at risk (4) and delayed enhancement

(DE) indicates myocardial necrosis (5). Comparing the extent of reversible to irreversible

injured myocardium allows for calculation of myocardial salvage or myocardial salvage index

(MSI), which to maximize is the goal of reperfusion because of its prognostic impact (6).

Recently, CMR has been also introduced for detection and visualization of RVI. Previous

studies demonstrated that early postinfarction RVI is common and is characterized by the

presence of myocardial edema, DE and functional abnormalities (7). However, to date, there

is no systematic evaluation of the clinical prognostic value of RVI assessed by CMR in a

large STEMI population.

The aim of this study was to investigate the predictors for RVI development and its prognostic

impact after reperfused STEMI. A secondary objective was to evaluate the utility and clinical

value of RV MSI assessment in a large STEMI cohort.

ooooooooooooool l l l l l l ininininininin v v vv v vvisisisisisisisuauauauauauaualililililililizizizizizizizinnnnnnn

sity ininininininin TTTTTTT2-2-2-2-2-2-2-weweweweweweweigiigii h

a

myocardial necrosis . Comparing the extent of reversible

um allows for calculation of m cardial salv e or m cardial

ardial edema representing myocardium at risk (4) and delayed

myocardial necrosis (5). Comparing the extent of reversible t

um allows for calculation of myocardial salvage or myocardial



Methods

Patient population and study design

Primary angioplasty was performed in 524 consecutive patients with STEMI at our tertiary

care institution. Of these, 450 patients were referred to CMR 24-96 h after the index event.

Eligibility criteria were the onset of symptoms <12 h before angioplasty and ST-segment

elevation of >0.1 mV in 2 extremity leads or >0.2 mV in 2 precordial leads. Exclusion

criteria were usual CMR contraindications such as implanted defibrillators/pacemakers and

ferromagnetic intracranial metallic implants.

After physical examination and assessment of medical history the TIMI-risk score was

calculated for each patient (8). We conducted follow-up by a standardized telephone

questionnaire after a median follow-up period of 20.9 months (range 4.7 to 39.0 months). The

interviewers were blinded to the CMR results. Reported adverse events were verified by

hospital or out-patient documentation.

Some of the patients included in this prospective analysis have been included in randomised

trials published previously (6,9,10). The study was approved by the local ethics committee

and complies with the Declaration of Helsinki. All patients gave written informed consent.

Primary angioplasty, angiographic analysis and subsequent treatment

Intravenous application of 500 mg aspirin and 60 IU/kg bodyweight heparin was performed in

all patients prior to angioplasty. Clopidogrel with a 600 mg loading dose was given orally at

the earliest time point followed by daily administration of 75 mg for 12 months plus 100 mg

aspirin indefinitely. According to current guidelines glycoprotein IIb/IIIa inhibitors,

angiotensin-converting-enzyme-inhibitors, beta-blockers, and statins were administered (11).

Primary angioplasty was performed according to standard clinical practice. In case of a high

thrombus burden additional thrombectomy was conducted. Before and after angioplasty

coronary angiography was performed with the same projections. Post TIMI-flow was

bybybybybybyby a a aa a a a s sssssstatatatatatatandndndndndndndararararararardididididididizzzzzzz

angeeeeeee 4444444 7777777 tototototototo 33333339999999 00000

r

a

ents included in this os ctive anal is have been included n

e blinded to the CMR results. Reported adverse events wer

atient documentation.

ents included in this prospective analysis have been included in



categorized as: TIMI-flow III – reperfusion success; TIMI-flow 0-II –no reperfusion success.

Angiographic visual analysis was performed offline by two blinded observers.

ST-segment resolution and enzymatic infarct size analysis

Early ST-segment resolution was evaluated by measuring the sum of ST-segment elevation

before and approximately 90 minutes after angioplasty in a standard 12-lead ECG and

expressed as percentage. Data was also categorized as complete ( 70%), partial (<70-30%),

and no ST-segment resolution (<30%). The number of leads with ST-segment elevation was

obtained. Plasma creatine kinase and creatine kinase-myocardial band were assessed on

admission and subsequently for every 8 h for 2 days.

Cardiac magnetic resonance imaging

All CMR examinations were performed on a 1.5 Tesla scanner (Intera CV, Philips Medical

Systems, Best, The Netherlands). The scan protocol and technical parameters have been

described in detail previously (6). In brief, cine steady-state-free-precession sequences in

short-axis- and horizontal and vertical long-axis orientation were acquired for volumetric and

functional imaging. Visualization of myocardial edema was performed using a black-blood

T2-weighted short inversion time turbo-spin-echo sequence in short-axis orientation. DE

images, also covering both ventricles in short-axis orientation, were acquired for

quantification of necrosis and microvascular obstruction (MO) 10–15 minutes after

application of 0.15 mmol/kg/bodyweight gadobutrol (Gadovist, BayerSchering, Germany)

using a three-dimension T1-weighted inversion recovery turbo gradient echo sequence.

Inversion time for optimal nulling of RV and LV myocardium was individually optimized

within a range of 200–300 ms.

c

nations were performed on a 1.5 Tesla scanner Intera CV, Ph

The Netherlands The scan otocol and technical aramet

c resonance imaging

nations were performed on a 1.5 Tesla scanner (Intera CV, Ph

The Netherlands). The scan protocol and technical paramete



CMR image analysis was performed by fully blinded observers on an independent

workstation in the CMR core laboratory, which has proven low intra- and interobserver

variability as well as reproducibility for assessment of infarct size, MSI and MO (9).

Biventricular volumes and function were determined by manually tracing endocardial and

epicardial borders in end-systole and end-diastole. Biventricular myocardial masses were

calculated on cine images in end-diastole. In T2-weighted images and in the corresponding

DE images the area of high signal intensity was manually delineated in each short-axis slice.

For RV edema assessment, signal intensity of LV edema was taken as reference and slices

were compared to short-axis cine images as described previously (7). MO was included into

infarct size and additionally assessed in a separate fashion. Patients with non-diagnostic image

quality of the RV myocardium were excluded from further analysis. Right ventricular regional

wall motion abnormalities were assessed qualitatively and classified as dyskinesia, akinesia,

or hypokinesia.Wall motion impairment in combination with edema was considered as being

diagnostic for RVI.

The following parameters were calculated for both the RV and LV:

- end-diastolic, end-systolic, stroke-volume index and myocardial mass index (related to body

surface area)

- ejection fraction

- %area at risk=volume edema/ventricular mass

- %infarct size=volume infarct/ventricular mass

- %MO=volume MO/ventricular mass

- MSI=area at risk–infarct size/area at risk

For comparison every patient with RVI was matched without replacement to a patient with

isolated LV infarction with the same vessel (RCA, LAD or LCX), and, where possible, with

the same vessel segment (proximal, mid, distal). Furthermore age (±3 years) and sex were

matched. Isolated LV infarction was defined by CMR absence of RVI (Table 1).

nnnnnnntststststststs w wwwww wititititititith h h h h h h nononononononon-n-n-n-n-n-n-dididididididiagagagagagagag

ysis RiRiRiRiRiRiRighghghghghghghttttttt vvvvvvvenenenenenenentrtrtrtrtrtt ic

o e

Wall motion impairment in combination with edema was cons d

V

ormalities were assessed qualitatively and classified as dyskine

Wall motion impairment in combination with edema was consid

VI.



Endpoints

The primary endpoint of this study was the occurrence of major adverse cardiac event

(MACE), a composite of death, reinfarction and new congestive heart failure. Secondary

endpoints were the individual components of the primary endpoint.

At index hospitalization reinfarction was diagnosed based on clinical symptoms, new ST-

segment changes and an increase in the creatine kinase-myocardial band levels as previously

described (12). During follow-up any new ischemic symptoms leading to hospital admission

in combination with troponin elevation were defined as recurrent infarction. Congestive heart

failure was diagnosed in case of rales and dyspnea (New York Heart Association class III-IV)

occurring >24 h after the index and requiring medical attention. In case of more than one

event, the first event was chosen for the combined clinical endpoint. When 2 events occurred

simultaneously, the most severe event was chosen (death>myocardial reinfarction>congestive

heart failure).

Statistical Analysis

Categorical variables are expressed as number and percentage. Normally distributed variables

are presented as mean ± SD, non-normally distributed variables are given as median [25%,

75% percentile]. Differences between groups were assessed by the student’s t-test for

continuous data with normal distribution and homogeneity of variance. The Wilcoxon rank-

sum test was used for continuous not normally distributed data or for continuous data without

homogeneity of variance. Differences between categorical variables were assessed either by

the Chi-Square or Fisher‘s exact test. Differences between related continuous variables were

tested using the paired t-test or the Wilcoxon signed-rank depending on their distribution.

Univariate and multivariable conditional binary logistic regression analyses were performed

to find factors associated with RVI. This method accounts for the matched-pair nature of the

HeHeHeHeHeHeHeararararararart tt t t tt AsAsAsAsAsAsAssososososososocicicicicicciatatatatatatatioioioioioioionnnnnnn

on IIIIIIInnnnnnn cacacacacacacasesesesesesese ooooooofffffff mm

v v

h o

vent was chosen for the combined clinical endpoint. When 2 ev

he most severe event was chosen (death>myocardial reinfarctio



sample. Categorical variables included Killip-class on admission, categorized TIMI-flow after

angioplasty and categorized ST-segment resolution. Continuous variables included pain-to-

balloon time, biventricular myocardial mass index, LV area at risk, LV infarct size, LV MSI,

peak creatine kinase, peak creatine kinase-myocardial band, number of leads with ST-segment

elevation, sum of ST-segment elevation, mean blood pressure,heart rate and TIMI-risk score

as quasi continuous. A stepwise forward regression procedure was performed to select

variables into multivariable models.

The Kaplan-Meier method was applied for the combined clinical endpoint and death;

differences were assessed by the log-rank test. To identify possible predictors of MACE

univariate Cox-regression analyses were performed using CMR parameters and traditional

prognostic factors. A multivariable stepwise forward Cox regression analysis took only three

of the significant variables into the model. Including matched-pairs as strata accounted for the

paired structure of the data. The tests were performed as two-sided at significance level

=0.05. For statistical analyses the SPSS software, version 16.0 (SPSS Inc., Chicago, Il,

USA) was used.

Results

Of 524 STEMI patients undergoing primary angioplasty, 450 were referred to CMR 24-96 h

after reperfusion. Reasons for not undergoing CMR are listed in Figure 1. Image quality for

RV edema quantification was inappropriate in 29 (6.4%) patients; 7 patients were lost to

follow-up. In 414 patients clinical outcome data were available.

Right ventricular injury

RVI as defined by a combination of myocardial edema (Figure 2) and local wall motion

impairment occurred in 69 out of 421 patients (16.4%). Of these 69 patients, 54 (78%)

presented with hypokinesia and 15 (22%) with akinesia. None of the patients showed RV

MRMRMRMRRRR p p pp p p parararararararamamamamamamametetetetetetetererererererers ss s s ss anananananana

ssionnnnnnn anananananananalalalalalalalysysysysysysysisisisisisisis ttttto

o

i

i ,

variables into the model. Including matched-pairs as strata acco

of the data. The tests were performed as two-sided at signi

istical analyses the SPSS software, version 16.0 (SPSStt Inc.,



edema without local wall motion abnormalities in the same region. In 41 of these patients

(59.4%) RV myocardial necrosis was detected in DE imaging. RV MO was present in only

one patient (Figure 3). Distribution of the culprit lesion is shown in Table 1. Patients with a

lesion in the left circumflex had a left dominant coronary circulation and a lateral to inferior

injury of the left ventricular myocardium, extending to the inferior wall of the right ventricle.

Baseline characteristics of the entire patient cohort, RVI patients and the matched control-

group are presented in Table 1. RVI patients had a significantly higher RV myocardial mass

index compared to the non-RVI group. These patients also presented with a significantly

longer pain-to-balloon time and a lower LV MSI. Within the RVI-group the number of

patients with 100% myocardial salvage (RV MSI=1) was high (28/69; 40.6%), resulting in

significantly higher mean RV MSI (0.80±0.2) as compared to the mean LV MSI (0.47±0.2;

p<0.01). Furthermore, patients with RVI showed a significantly lower ST-segment resolution

and a lower RV ejection fraction (Table 1).

Predictors of RVI

In a multivariable stepwise forward regression model adjusted for significant variables in

univariate regression analysis using RVI as the dependent variable a low TIMI-flow pre

angioplasty was a predictor of RVI (Table 2). Also RV myocardial mass index was related to

RVI. Pain-to-balloon time was associated with RVI in the univariate analysis but failed to

predict RVI in the multivariable model. The sum of ST-segment elevation and the number of

leads with ST-segment elevation were not related to RVI.

Prognostic impact of RVI

MACE occurred in 73/421 patients (17.3%). Most MACE with 22/69 (31.9%) occurred in

patients with RVI compared with 5/69 (7.3%) in the matched non-RVI group. There were 8

h h h h h h (2(2(2(2(2(2(28/8/8/8/8/8/8/69696969696969; ; ; ; ; 40404040404040.6.6.6.6.6.6.6%)%)%)%)%)%)%)

the mmmmmmmeaeaeaeaeaeaeannnnnnn LVLVLVLVLVLVLV MMMMM

m

e

more, patients with RVI showed a significantly lower ST-segm

ejection fraction (Table 1).



deaths, 6 non-fatal reinfarctions and 8 cases of new congestive heart failure in patients with

RVI as opposed to 3 deaths and 2 non-fatal reinfarctions in the matched non-RVI patients.

Within the RVI-group patients with MACE demonstrated with greater RV area at risk (23.2%

[15.3, 34.7] vs. 18.2% [10.0, 27.9]; p=0.047), a greater RV infarct size (8.7% [5.2, 11.7] vs.

0% [0, 3.9]; p<0.001) and a lower RV MSI (0.61 [0.57, 0.75] vs. 1.00 [0.81, 1.00]; p<0.001)

compared to RVI patients without MACE.

Kaplan-Meier estimates illustrated reduced periods of MACE-free survival and higher

mortality in patients with RVI compared to the matched non-RVI group (Figure 4 a & b).

These results were confirmed when the analysis was repeated with LV EF categorized for the

presence or absence of severe LV dysfunction (LV EF / >40%) used as stratum. Log-rank

tests pooled over these strata were both significant (MACE: p<0.001, mortality: p=0.036)

demonstrating the prognostic value of RVI independent of LV dysfunction. Within the RVI-

group patients with RV MSI=1 had a better prognosis than patients with MSI<1 (Figure 5 a &

b). Furthermore prognosis of patients with RV MSI=1was not different from patients with

isolated LV infarction (p=0.70).

Analyzing the entire patient group, RVI remained associated with MACE in the univariate

Cox-regression analysis but also other established markers of increased patient risk

demonstrated significant associations with MACE (Table 3). However, in a multivariable Cox

regression, RVI together with LV ejection fraction and TIMI-risk score remained the only

independent predictors for occurrence of MACE. In the subgroup of patients with RVI plus

matched non-RVI patients (n=138) RVI showed association with the combined endpoint in

univariate (HR 6.74, 95%CI [2.32-19.59]) and multivariable (HR 5.5, 95%CI [1.71-14.94])

Cox regression analysis.

%)%)%)%)%)%)%) u uuuuu usesesesesesesed d d d ddd asasasasasasas s s s s s sstrtrtrtrtrtrtratatatatatatatuuuuuuu

p<0000 000000000000001111111 mmmmmmmororororororortatatatatatt l

e

i

p nosis of atients with RV MSI=1was not different from

e prognostic value of RVI independent of LV dysfunction. Wi

ith RV MSI=1 had a better prognosis than patients with MSI<1

prognosis of patients with RV MSI=1was not different from



Discussion

To the best of our knowledge this is the first CMR study to evaluate the prognostic impact of

RV area at risk as measured with edema sensitive T2-weighted images and infarct size by

using DE in a large group of reperfused STEMI patients. The results might be summarized as

follows: 1) RVI with DE is a strong independent prognostic marker of long-term prognosis

after STEMI; 2) Similar to isolated LV infarction, RV area at risk, infarct size, and MO can

also be calculated; 3) RVI is associated with a low LV MSI, an impaired ST-segment

resolution and a high RV mass index; 4) RVI defined by regional RV edema and wall motion

impairment or right-sided infarction can be found in approximately 17% of STEMI patients

after mechanical reperfusion.

Assessment of RV area at risk, infarct size and MO

The concept of myocardial salvage calculated by the area at risk in T2-weighted images and

the infarct size in DE images is increasingly used for the assessment of reperfusion therapy in

LV infarction (6,13). Whereas a few studies showed the applicability for DE of the RV (7,14)

only limited studies evaluated the RV area at risk (7).

Our study clearly demonstrates that RV area at risk, visualized by T2-weighted imaging, can

be quantified in the majority of patients with RVI. Consequently, RV-MSI can be calculated

with significantly higher MSI values compared to the LV (15). As shown by our data, a

substantial number of patients reaches major or even complete salvage of the RV area at risk.

Such a high incidence of aborted RV infarctions is in line with a recent publication (7) and

may be explained by the lower oxygen demand and the dual anatomic supply system of the

RV myocardium making it less vulnerable to ischemia. Our findings in part underline a

previous thesis assuming that acute right ischemic dysfunction represents viable myocardium

(16). Nevertheless, ischemic scarring also exists in the RV myocardium, probably too small to

cause sustained impairment of global RV function in the majority of cases. According to the

V

myocardial salvage calculated by the area at risk in T2-wei e

n DE ima s is increasin used for the assessment of r erfu i

V area at risk, infarct size and MO

myocardial salvage calculated by the area at risk in T2-weighte

n DE images is increasingly used for the assessment of reperfusi



lower degree of RV scarring, right-sided MO is a very rare finding after acute reperfused

STEMI and was found in only one out of 421 patients. Further studies with large patient

cohorts might be necessary to assess the incidence and potentially the prognostic impact of

RV MO.

Predictors of RVI

RVI typically occurs with infarction of the LV inferior wall. In the present study population

the culprit lesion was located in most patients (84%) in the right coronary artery, mainly in the

proximal and mid segments. Additionally, we were able to identify a low TIMI-flow pre

angioplasty as a furtherparameter associated with RVI. Patients with RVI also demonstrated

with an increased RV myocardial mass index.

Only one patient in the RVI group suffered from severe pulmonary hypertension as a reason

of RV hypertrophy. Two more patients in this group demonstrated with mild pulmonary

hypertension and an RV myocardial mass within the upper normal range. An increased

oxygen demand in high RV mass might result in injury of the RV myocardium which would

confirm the results of non-imaging studies (17-19). These studies in part also report necropsy

data of chronic RV infarctions in which edema can be excluded. On the other hand there are

studies reporting an increase of LV myocardial mass caused by edema (20) and swelling of

the thin compacted layer of RV myocytes might also result in an increase of measured RV

myocardial mass. Actually we assessed RV myocardial mass after infarction and certainly

included a substantial amount of RV edema in the calculation of myocardial mass. Thus, it is

most likely that increased RV mass is the result rather than the cause of RVI.

s s s s s s wiwiwiwiwiwiwiththththththth R R RR R RRVIVIVIVIVIVIVI a a a a a a alslslslslslslso o ooo oo

in the RVI ou suffered from severe ulmona h ertens o

p l

d an RV m cardial mass within the r normal ran . A

in the RVI group suffered from severe pulmonary hypertensio

phy. Two more patients in this group demonstrated with mil

d an RV myocardial mass within the upper normal range. A



Comparison with recent studies

Compared to other studies assessing RVI in STEMI, the percentage of RVI was lower in our

larger consecutive patient group with approximately 17%. Kumar et al. found RV DE in 57%

of patients with inferior infarction and a mean pain-to-balloon time of 8.8±5.4 h (21). This

difference might be explained by the shorter pain-to-balloon time in our patient group with a

median of only 211 minutes. Masci et al. also presented a higher percentage of RV edema

with 51% and RV DE with 31% (7), but again in this study, the pain-to balloon-time was

longer (252±134 minutes for RVI patients, 270±166 minutes for non-RVI patients) compared

with the current cohort. One discrepancy in the assessment of RV edema was the use of the

integrated body coil in the current approach, whereas Masci et al. used surface coils with a

correction algorithm to homogenize signal. However, it is unlikely that this accounts for the

significant difference in the occurrence of RV edema. Other parameters were comparable

between Masci et al. and the present study: In both the RCA was identified as the infarct

related artery in 43% and also the distribution of the affected RCA segments were similar.

In a recent study Francone et al. reported on the influence of time to reperfusion on

myocardial injury assessed by CMR after STEMI with primary angioplasty (22). The authors

found that the extend of myocardial edema did not change significantly as pain-to-balloon

time progressed. This is in contradiction to our results, which show an association of pain-to-

balloon time to the occurrence of RVI defined by edema. However, Francone et al. report on

LVs and our findings relate to RVs. Owing to the better collateralization of the RV the

oxygen supply of the myocardium might be initially sufficient for not developing edema.

Prognostic impact of RVI

Our study clearly demonstrates the prognostic impact of RVI in a large group of reperfused

STEMI patients when no complete myocardial salvage can be achieved. This is in line with

two recent studies, which found RV edema being a prognostic factor for RV function

ttt a a a aaaal.l.l.l.l.l. u u u u uu usesesesesesesed d d d d d d sususususususurfrfrfrfrfrfrfacacacacacacaceeeeeee

kelyyy ttttttthahahahahahahatttttt thththththththisisisisisisis aaaaaaacccccc

e

et al. and the present stu : In both the RCA was identified

4 r

ence in the occurrence of RV edema. Other parameters were

et al. and the present study: In both the RCA was identified

43% and also the distribution of the affected RCA segments wer



recovery at follow-up (7, 23). However, in one of these studies no clinical follow-up data was

reported (7) and the other study included only “soft” clinical endpoints such as recurrent

angina and repeated revascularization. A recent study demonstrated a strong predictive value

of RV infarction assessed by CMR (24). The authors also defined RV ejection fraction as an

important prognostic marker. However, this study did not measure RV edema and RV

myocardial salvage. Moreover, our study did not find such a strong relationship between RV

ejection fraction and clinical outcome. In contrast we could demonstrate that prognosis of

patients with RVI mainly depends on RV MSI rather than RV ejection fraction.

Analyzing the entire patient group RVI was independently related to “hard” outcome

parameters. In addition, RVI assessed by CMR was compared to established clinical,

angiographic and CMR parameters.

In clinical routine RVI is diagnosed by echocardiography and/or ECG, but both modalities

have their specific limitations. Wall motion impairment of the inferior RV wall is sometimes

difficult to visualize in echocardiography and may lead to false negative results. ECG changes

of RVI are transient, frequently vanishing 8-10 h after symptom onset (25). CMR is a

promising tool to fill this diagnostic gap and to identify patients with RVI. This might lead to

an early adequate therapy before developing severe hemodynamic compromise.

Limitations

Assessment of myocardial edema is discussed controversially (26). Quantification of RV

edema is even more challenging than in the LV. Using a black-blood T2-weighted short

inversion time turbo spin-echo sequence with a surface coil leads to inhomogeneities of the

myocardium which might result in misinterpretation of edema. Therefore we combined the

T2-weighted sequence with the body coil to achieve signal homogeneity in the biventricular

myocardium. Nevertheless, signal-to-noise ratio in this sequence is relatively low and the thin

compacted myocardial layer of the RV makes hyperintense areas less obvious. Additionally

papapapapaaparerererererered d d d d dd tototototototo e e e e e e eststststsss ababababababablililililililisssssss

ne RVI is dia osed b echocardio hy and/or ECG, but bo

ic limitations. Wall motion impairment of the inferior RV wall

ize in echocardio and m lead to false n ative results.

ne RVI is diagnosed by echocardiography and/or ECG, but bo

ic limitations. Wall motion impairment of the inferior RV wall

ize in echocardiography and may lead to false negative results.



slow-flow artifacts in the intertrabecular recesses, which are adjacent to edema, can

complicate quantification of the latter.

Also visualization of DE in the thin RV myocardium is more difficult as compared with the

thicker compacted myocardial layer of the LV wall. We used the same inversion time for both

ventricles. Choosing a shorter inversion time for the RV does not improve image quality and

reproducibility and may result in dark rim artifacts (27).

Owing to these specific challenges, both acquisition and evaluation of CMR in RVI is time

consuming and requires expertise in this field. Therefore calculation of RV edema and RV

MSI might only be accomplished in CMR referral centers.

Conclusions

This large prospective study demonstrates that RVI, defined as edema, wall motion

impairment and DE as assessed by CMR, is a strong predictor for the occurrence of death,

reinfarction and congestive heart failure when no complete myocardial salvage can be

achieved. It should therefore be considered for further risk stratification and optimized clinical

treatment.

pective study demonstrates that RVI, defined as edema,

DE as assessed CMR, is a strong predictor for the occurre

l

pective study demonstrates that RVI, defined as edema,

DE as assessed by CMR, is a strong predictor for the occurre

congestive heart failure when no complete myocardial sal



Disclosures

Matthias Grothoff: none; Christian Elpert: none; Janine Hoffmann: none; Johannes Zachrau:

none; Lukas Lehmkuhl: none; Suzanne de Waha: none; Steffen Desch: none; Ingo Eitel: none;

Meinhard Mende: none; Holger Thiele: none

Matthias Gutberlet: Research Grant:

Siemens Syngo Via <$10k

Core Lab for CRISP-AMI study (Counterpulsation to Reduce Infarct

Size Pre-PCI-Acute Myocardial Infarction) <$10k

Grip Study Bayer (Safety of Gadolinium in renally-impaired

Patients) <$10k

Other Research Support:

IMRICOR interventional MRI <$10k

Honoraria:

Talks for Siemens <$10k

Consultant/Advisory Board

Philips iCT Advisory Board no money

Other Research Support:

IMRICOR interventional MRI <$10k



References

1. Mehta SR, Eikelboom JW, Natarajan MK, Diaz R, Yi C, Gibbons RJ, Yusuf S. Impact

of right ventricular involvement on mortality and morbidity in patients with inferior

myocardial infarction. J Am Coll Cardiol. 2001; 37:37-43.

2. Kinch JW, Ryan TJ. Right ventricular infarction. N Engl J Med. 1994; 330:1211-7.

3. Andersen HR, Falk E, Nielsen D. Right ventricular infarction: frequency, size and

topography in coronary heart disease: a prospective study comprising 107 consecutive

autopsies from a coronary care unit. J Am Coll Cardiol. 1987; 10:1223-32.

4. Aletras AH, Tilak GS, Natanzon A, Hsu LY, Gonzales FM, Hoyt RF Jr., Arai AE.

Retrospective determination of the area at risk for reperfused acute myocardial

infarction with T2-weighted cardiac magnetic resonance imaging: histopathological

and displacement encoding with stimulated echoes (DENSE) functional validations.

Circulation. 2006; 113:1865-70.

5. Kim HW, Farzaneh-Far A, Kim RJ. Cardiovascular magnetic resonance in patients

with myocardial infarction: current and emerging applications. J Am Coll Cardiol.

2009; 55:1-16.

6. Eitel I, Desch S, Fuernau G, Hildebrand L, Gutberlet M, Schuler G, Thiele H.

Prognostic significance and determinants of myocardial salvage assessed by

cardiovascular magnetic resonance in acute reperfused myocardial infarction. J Am

Coll Cardiol. 2010; 55:2470-9.

7. Masci PG, Francone M, Desmet W, Ganame J, Todiere G, Donato R, Siciliano V,

Carbone I, Mangia M, Strata E, Catalano C, Lombardi M, Agati L, Janssens S,

Bogaert J. Right Ventricular Ischemic Injury in Patients With Acute ST-Segment

Elevation Myocardial Infarction. Characterization With Cardiovascular Magnetic

Resonance. Circulation. 2010; 122:737-42

M,M,M,M,M,,, H Hoyoyoyoyoyoyoyt t RFRFRRRR J Jr.r.r.r.r.r.r., , , , , , , AAAAAAA

usedddddd aaaaaaacucucucucucucutetetetetetete mmmmmmmyoyoyoyoyoyoyocac

a

acement encoding with stimulated echoes (DENSE) functional v

o

with T2-weighted cardiac magnetic resonance imaging: histopa

acement encoding with stimulated echoes (DENSE) functional v

on. 2006; 113:1865-70.



https://www.researchgate.net/publication/44637729_Prognostic_Significance_and_Determinants_of_Myocardial_Salvage_Assessed_by_Cardiovascular_Magnetic_Resonance_in_Acute_Reperfused_Myocardial_Infarction?el=1_x_8&enrichId=rgreq-8acf41c5-bb3b-4e2a-8337-5221232a24bb&enrichSource=Y292ZXJQYWdlOzUxNzk1ODU5O0FTOjI2MTMxOTk5NTY4NjkxM0AxNDM5MzE0OTUwNzQ4




https://www.researchgate.net/publication/19480725_Right_ventricular_infarction_Frequency_size_and_topography_in_coronary_heart_disease_A_prospective_study_comprising_107_consecutive_autopsies_from_a_coronary_unit?el=1_x_8&enrichId=rgreq-8acf41c5-bb3b-4e2a-8337-5221232a24bb&enrichSource=Y292ZXJQYWdlOzUxNzk1ODU5O0FTOjI2MTMxOTk5NTY4NjkxM0AxNDM5MzE0OTUwNzQ4



https://www.researchgate.net/publication/298283188_RIGHT-VENTRICULAR_INFARCTION_-_REPLY?el=1_x_8&enrichId=rgreq-8acf41c5-bb3b-4e2a-8337-5221232a24bb&enrichSource=Y292ZXJQYWdlOzUxNzk1ODU5O0FTOjI2MTMxOTk5NTY4NjkxM0AxNDM5MzE0OTUwNzQ4

8. Morrow DA, Antman EM, Charlesworth A, Cairns R, Murphy SA, de Lemos JA,

Giugliano RP, McCabe CH, Braunwald E. TIMI risk score for ST-elevation

myocardial infarction: A convenient, bedside, clinical score for risk assessment at

presentation: An intravenous nPA for treatment of infarcting myocardium early II trial

substudy. Circulation. 2000; 102:2031-7.

9. Desch S, Engelhardt H, Meissner J, Eitel I, Sareban M, Fuernau G, de Waha S,

Grothoff M, Gutberlet M, Schuler G, Thiele H. Reliability of myocardial salvage

assessment by cardiac magnetic resonance imaging in acute reperfused myocardial

infarction. Int J Cardiovasc Imaging. 2011 Jan 30. [Epub ahead of print].

10. Thiele H, Hildebrand L, Schirdewahn C, Eitel I, Adams V, Fuernau G, Erbs S, Linke

A, Diederich KW, Nowak M, Desch S, Gutberlet M, Schuler G. Impact of high-dose

N-acetylcysteine versus placebo on contrast-induced nephropathy and myocardial

reperfusion injury in unselected patients with ST-segment elevation myocardial

infarction undergoing primary percutaneous coronary intervention. The LIPSIA-N-

ACC (Prospective, Single-Blind, Placebo-Controlled, Randomized Leipzig Immediate

PercutaneouS Coronary Intervention Acute Myocardial Infarction N-ACC) Trial. J

Am Coll Cardiol. 2010; 55:2201-9.

11. Van de Werf F, Bax J, Betriu A, Blomstrom-Lundqvist C, Crea F, Falk V, Filippatos

G, Fox K, Huber K, Kastrati A, Rosengren A, Steg PG, Tubaro M, Verheugt F,

Weidinger F, Weis M, Vahanian A, Camm J, De Caterina R, Dean V, Dickstein K,

Filippatos G, Funck-Brentano C, Hellemans I, Kristensen SD, McGregor K, Sechtem

U, Silber S, Tendera M, Widimsky P, Zamorano JL, Silber S, Aguirre FV, Al-Attar N,

Alegria E, Andreotti F, Benzer W, Breithardt O, Danchin N, Di Mario C, Dudek D,

Gulba D, Halvorsen S, Kaufmann P, Kornowski R, Lip GY, Rutten F. Management of

acute myocardial infarction in patients presenting with persistent ST-segment

elevation: the Task Force on the Management of ST-Segment Elevation Acute

V,V,V,V,V,V,V, F F FF FF Fueueueueueueuernrnrnrnrnrnrnauauauauauauau G G G GGG G, , ,, ,, , ErErErErErErEr

hulerrrrrrr GGGGGGG IIIIImpmpmpmpmpmpmpacacacacacacacttttttt o

y y

o c

under in imar rcutaneous coronar intervention. The L

ysteine versus placebo on contrast-induced nephropathy and my

on injury in unselected patients with ST-segment elevation myoc

undergoing primary percutaneous coronary intervention. The L



Myocardial Infarction of the European Society of Cardiology. Eur Heart J. 2008;

29:2909-45.

12. Thygesen K, Alpert JS, White HD. Universal definition of myocardial infarction. J

Am Coll Cardiol. 2007; 50:2173-95.

13. Friedrich MG, Abdel-Aty H, Taylor A, Schulz-Menger J, Messroghli D, Dietz R. The

salvaged area at risk in reperfused acute myocardial infarction as visualized by

cardiovascular magnetic resonance. J Am Coll Cardiol. 2008; 51:1581-7.

14. Ibrahim T, Schwaiger M, Schomig A. Images in cardiovascular medicine. Assessment

of isolated right ventricular myocardial infarction by magnetic resonance imaging.

Circulation. 2006; 113:e78-e79.

15. Eitel I, Desch S, Sareban M, Fuernau G, Gutberlet M, Schuler G, Thiele H. Prognostic

significance and magnetic resonance imaging findings in aborted myocardial

infarction after primary angioplasty. Am Heart J. 2009; 158:806-13.

16. Goldstein JA. Pathophysiology and management of right heart ischemia. J Am Coll

Cardiol. 2002; 40:841-53.

17. Forman MB, Wilson BH, Sheller JR, Kopelmann HA, Vaughn WK, Virmani R,

Friesinger GC. Right ventricular hypertrophy is an important determinant of right

ventricular infarction complicating acute inferior left ventricular infarction. J Am Coll

Cardiol. 1987; 10:1180-7.

18. Isner JM, Roberts WC. Right ventricular infarction complicating left ventricular

infarction secondary to coronary heart disease. Frequency, location, associated

findings and significance from analysis of 236 necropsy patients with acute or healed

myocardial infarction. Am J Cardiol. 1978; 42:885-94.

19. Kopelman HA, Forman MB, Wilson BH, Kolodgie FD, Smith RF, Friesinger GC,

Virmani R. Right ventricular myocardial infarction in patients with chronic lung

chulererererererer GGGGGGG ThThThThThThThieieieieieieielelelelelelele H

nce and m netic resonance im in findin in aborted oc d

JA. Path siol and mana ment of ri t heart ischemia. J

nce and magnetic resonance imaging findings in aborted myocard

after primary angioplasty. Am Heart J. 2009; 158:806-13.

JA. Pathophysiology and management of right heart ischemia. J



disease: possible role of right ventricular hypertrophy. J Am Coll Cardiol. 1985;

5:1302-7.

20. Schroeder AP, Houlind K, Pedersen EM, Nielsen TT, Egeblad H . Serial magnetic

resonance imaging of global and regional left ventricular remodeling during 1 year

after acute myocardial infarction. Cardiology. 2001; 96:106-14.

21. Kumar A, Abdel-Aty H, Kriedemann I, Schulz-Menger J, Gross CM, Dietz R,

Friedrich MG. Contrast-enhanced cardiovascular magnetic resonance imaging of right

ventricular infarction. J Am Coll Cardiol. 2006; 48:1969-76.

22. Francone M, Bucciarelli-Ducci C, Carbone I, Canali E, Scardala R, Calabrese FA,

Sardella G, Mancone M, Catalano C, Fedele F, Passariello R, Bogaert J, Agati L.

Impact of primary coronary angioplasty delay on myocardial salvage, infarct size, and

microvascular damage in patients with ST-segment elevation myocardial infarction:

insight from cardiovascular magnetic resonance. J Am Coll Cardiol. 2009; 54:2145-53

23. Jensen CJ, Jochims M, Hunold P, Sabin GV, Schlosser T, Bruder O. Right ventricular

involvement in acute left ventricular myocardial infarction: prognostic implications of

MRI findings. AJR Am J Roentgenol. 2010; 194:592-8.

24. Miszalski-Jamka T, Klimeczek P, Tomala M, Krupinski M, Zawadowski G, Noelting

J, Lada M, Sip K, Banys R, Mazur W, Kereiakes DJ, Zmudka K, Pasowicz M. Extent

of RV dysfunction and myocardial infarction assessed by CMR are independent

outcome predictors early after STEMI treated with primary angioplasty. JACC

Cardiovasc Imaging. 2010; 3:1237-46.

25. Braat SH, Brugada P, de Zwaan C, Coenegracht JM, Wellens HJ. Value of

electrocardiogram in diagnosing right ventricular involvement in patients with an

acute inferior wall myocardial infarction. Br Heart J. 1983; 49:368-72.

26. Friedrich M, Kim H, Kim R. T2-weighted imaging to assess post-infarct myocardium

at risk. JACC Cardiovasc Imaging. 2011; 4:1014-1021

lolooloooo R R R R R RR, , ,,,,, BoBoBoBoBoBoBogagagagagagagaererererererert ttt tt t J,J,J,J,J,J,J, A AA A A A A

rdiallll sasasasasasasalvlvlvlvlvlvlvagagagagagagageeeeeee iiiiiiinfnnnnnn a

cular dama in tients with ST-s ment elevation m cardial

om cardiovascular magnetic resonance. J Am Coll Cardiol. 2009

J h

cular damage in patients with ST-segment elevation myocardial

om cardiovascular magnetic resonance. J Am Coll Cardiol. 2009

J, Jochims M, Hunold P, Sabin GV, Schlosser T, Bruder O. Righ



27. Grosse-Wortmann L, Macgowan CK, Vidarsson L, Yoo SJ. Late gadolinium

enhancement of the right ventricular myocardium: is it really different from the left ? J

Cardiovasc Magn Reson. 2008; 10:20.



Table 1. Patient characteristics

Entire patient group n=421

RVI-group n=69

Non-RVI-group n=69

P-value

Age, years 66±12 65±13 65±11 0.81

Male sex, n (%) 321 (76) 55 (80) 55 (80)

Killip-class on admission, n (%) I II III IV

304 (72) 92 (22) 19 (5) 6 (1)

53 (77) 12 (17) 3 (5) 1 (1)

56 (82) 11 (16) 1 (1) 1 (1)

0.57

TIMI*- risk score 3 [2,4] 2 [1,3] 1 [0,2] 0.14

Pain-to-balloon time, min 211 [140,352] 240 [157,431] 179 [129,324] 0.04

RV† injury, n 69 69 0

TIMI*-flow after angioplasty, n 0-II III

53 368

9 60

10 59

0.81

ST-segment resolution, % 73 [49,95] 61 [37,91] 91 [66,100] 0.004

LV‡ ejection fraction, % 49±12 48±9 50±10 0.29

RV† ejection fraction, % 50±9 43±10 54±6 <0.001

LV‡ end diastolic volume index, ml/m² 77±17 78±18 73±14 0.10

RV† end diastolic volume index, ml/m² 77±19 79±19 75±20 0.27

LV‡ myocardial mass index, g/m² 66±15 65±15 60±14 0.045

RV† myocardial mass index, g/m² 25±5 23±4 0.002

Infarct size, % LV 21±12 17±14 0.10

Infarct size, % RV 5±6

LV‡ myocardial salvage index 0.57±0.25 0.47±0.2 0.59±0.26 0.006

RV† myocardial salvage index 0.80±02

Microvascular obstruction, % LV 1.47±4.46 1.12±1.80 0.79±1.26 0.19

Localization of culprit lesion, n LAD§ (proximal/mid/distal) RCA|| (proximal/mid/distal) LCX¶ (proximal/distal)

185 (74/104/7) 182 (89/51/42) 54 (46/8)

11 (5/5/1) 53 (23/21/9) 5 (5/0)

11 (4/6/1) 53 (26/15/12) 5 (5/0)

Cardiovascular risk factors, n (%) Diabetes mellitus Hypertension Smoking Hyperlipidemia Family history of coronary artery disease

111 (26) 292 (69) 175 (42) 142 (34) 128 (30)

15 (22) 46 (67) 33 (48) 21 (30) 17 (25)

14 (20) 46 (67) 27 (39) 24 (35) 20 (29)

0.83 1.00 0.30 0.59 0.56

Heart rate, beats per minute 80±17 77±17 78±14 0.58

Mean blood pressure, mmHg 95±17 93±16 94±14 0.67

Continuous data are presented as mean±SD or median (interquartile range). Categorical variables are given as frequency and percentage. *TIMI=Thrombolysis in myocardial infarction; †RV=right ventricular; ‡LV=left ventricular; §LAD=left anterior descending coronary artery; ||RCA=right coronary artery; ¶LCX=left circumflex coronary artery

59

91919191919191 [ [ [ [ [ [ [66666666666666,1,1,,,,, 00000000000000]]]]]]]

50505050505050±1±1±1±1±1±1±10000000

o

o

o

s

a

21±12 17±14

on, % 50±9 43±10 54±6

olume index, ml/m² 77±17 78±18 73±14

olume index, ml/m² 77±19 79±19 75±20

ss index, g/m² 66±15 65±15 60±14

ass index, g/m² 25±5 23±4

21±12 17±14



Table 2. Univariate and multivariable stepwise forward logistic regression analysis for the

prediction of RVI

RVI group and matched group, n=138

Parameter Univariate Multivariable

p-value OR* [CI†] p-value OR* [CI†]

TIMI‡-risk score 0.14 1.17 [0.95;1.44]

Pain-to-balloon time (per 10 minutes)

0.03 1.03 [1.00;1.05]

RV§-myocardial mass index (per 5 g/m²)

0.004 1.94 [1.24;3.05] 0.01 2.06 [1.18;3.58]

LV||-myocardial mass index (per 5 g/m²)

0.05 1.12 [1.00;1.27]

LV||% infarct size (per 5%)

0.10 1.12 [0.98;1.29]

LV||% area at risk (per 5%)

0.96 1.00 [0.91;1.10]

LV|| myocardial salvage index

0.01 0.16 [0.04;0.65]

Killip-class on admission 0.49 1.21 [0.70;2.10]

Peak CK¶ (μmol/ls) 0.049 1.02 [1.00;1.03]

Peak CK¶-MB# (μmol/ls) 0.07 1.20 [0.99;1.45]

TIMI‡-flow pre angioplasty 0.001 0.50 [0.34;0.74] 0.001 0.49 [0.32;0.76]

TIMI‡-flow post angioplasty 0.63 0.98 [0.78;1.19]

Incomplete ST-segment resolution (<70%)

0.02 1.37 [1.17;2.62] 0.06 1.58 [1.22;2.46]

Sum ST-segment elevation (mV) 0.64 1.12 [0.70;1.78]

Leads with ST-segment elevation (number)

0.75 0.96 [0.75;1.23]

Mean blood pressure (per 10 mmHg)

0.66 0.95 [0.76;1.19]

Heart rate (per 10 beats per minute)

0.58 0.94 [0.76;1.16]

*OR=odds ratio, †CI=confidence interval; ‡TIMI=Thrombolysis in myocardial infarction; §RV=right ventricular; ||LV=left ventricular; ¶CK=creatine kinase; #MB=myocardial band

s

0.96 1.00 [0.91;1.10]

0.01 0.16 [0.04;0.65]

ssion 0.49 1.21 [0.70;2.10]



Table 3. Predictors of MACE in the univariate and stepwise forward multivariable Cox regression analysis of the entire patient group, n=421

Univariate Multivariable Parameter

p Hazard ratio [CI*] p Hazard ratio [CI*]

<0.001

0.02

2.66 [1.61-4.11]

0.97 [0.94 -0.99]

<0.001

3.36 [1.99-5.66]

RV† injury

RV† ejection fraction

LV‡ ejection fraction

LV‡-MSI

<0.001

<0.001

0.93 [0.94-0.97]

0.12 [0.04-0.36]

0.004

0.96 [0.93-0.99]

<0.001 1.04 [1.02-1.05] LV‡% infarct size

TIMI§-flow after angioplasty 0-II 0.002 2.41 [1.38-4.21]

Microvascular obstruction (%LV‡) 0.001 1.04 [1.02-1.07]

<0.001 1.25 [1.13-1.38] 0.01 1.20 [1.04-1.34] TIMI§-risk score

ST-segment resolution (%) 0.03 0.99 [0.99-1.00]

*CI=confidence interval; †RV= right ventricular; ‡LV= left ventricular;

§TIMI=Thrombolysis in myocardial infarction

0000000 01010101010101

%) 0.03 0.99 [0.99-1.00]

i

o

%) 0.03 0.99 [0.99-1.00]

interval; †RV= right ventricular; ‡LV= left ventricular;

lysis in myocardial infarction



Figure Legends

Figure 1. Study flow chart. STEMI=ST-elevation myocardial infarction; CMR=cardiac

magnetic resonance; RV=right ventricle

Figure 2. Coronary angiography and CMR of a patient with isolated RV infarction (a)

demonstrating a high degree stenosis of the right coronary artery, (b)

successfully treated by angioplasty with a TIMI-flow III after treatment. (c)

There is a large area at risk (brown contour) of the inferior and free RV wall,

(d) but no infarction zone in DE imaging resulting in a 100% myocardial

salvage.

Figure 3. Coronary angiography and CMR of a severe inferior infarction: (a) proximal

occlusion of the right coronary artery, (b) after angioplasty with post TIMI-

flow II. (c) Area at risk (brown contour) extends from the LV inferior wall to

the interventricular septum and the RV inferior and free wall. In d MO of the

the LV (cyan contour) and the area of infarction (magenta contour) is shown.

Figure 4a & b. Kaplan-Meier curves of all matched patients (n=138) (a) for the incidence of

MACE and (b) for the incidence of death in patients with (solid line; n=69) and

without (broken line; n=69) RVI.

Figure 5a & b. Kaplan-Meier curves of all RVI-patients (n=69) (a) for the incidence of

MACE and (b) for the incidence of death in patients with 100% RV

myocardial salvage (broken line RV MSI=1; n=28) and patients <100%

myocardial salvage (solid line RV MSI<1; n=41).

ululululuu titingngngngngngng i in n n n n n a a 101010100000%0%0%0%0%0%0%

oronary angiography and CMR of a severe inferior infarction

c t

o n

oronary angiography and CMR of a severe inferior infarction:

clusion of the right coronary artery, (b) after angioplasty wit

ow II. (c) Area at risk (brown contour) extends from the LV in



Right Ventricular Injury in ST-Elevation Myocardial Infarction: Risk Stratification by Visualization...

Documents

Transcript of Right Ventricular Injury in ST-Elevation Myocardial Infarction: Risk Stratification by Visualization...