Research ArticleAntibiotic Resistance Pattern and Evaluation ofMetallo-Beta Lactamase Genes Including bla-IMP andbla-VIM Types in Pseudomonas aeruginosa Isolatedfrom Patients in Tehran Hospitals

Samira Aghamiri1 Nour Amirmozafari2 Jalil Fallah Mehrabadi3

Babak Fouladtan1 and Hossein Samadi Kafil4

1 Department of Microbiology Islamic Azad University Lahijan Branch Lahijan Iran2 School of Medicine Microbiology Department Iran University of Medical Sciences Tehran Iran3Department of Bioscience and Biotechnology Malek-Ashtar University of Technology Tehran Iran4Drug Applied Research Center Tabriz University of Medical Sciences 5166614766 Tabriz Iran

Correspondence should be addressed to Nour Amirmozafari amirmozafariyahoocom

Received 4 February 2014 Accepted 2 March 2014 Published 23 April 2014

Academic Editors C Pazzani and P Zunino

Copyright copy 2014 Samira Aghamiri et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections Carbapenemsare among the most effective antibiotics used against Pseudomonas infections but they can be rendered infective by group B 120573-lactamase commonly called metallo-beta lactamase In this study the antimicrobial sensitivity patterns of P aeruginosa strainsisolated from 9 different hospitals in Tehran Iran as well as the prevalence of MBLs genes (bla-

119881119868119872and bla-

119868119872119875) were determined

A total of 212 strains of P aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemicalmethods and PCRTheir antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusionmethod FollowingMICdetermination imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination ofMBLs genes bla-

119868119872119875and bla-

119881119868119872 The results indicated that in the DDST phenotypic method among the 100 imipenem resistant

isolates 75 strains were MBLs positive The PCR test indicated that 70 strains (33) carried bla-119881119868119872

gene and 20 strains (9)harbored bla-

119868119872119875 The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise This

may be due to production of MBLs enzymes Therefore determination of antibiotic sensitivity patterns and MBLs production bythese bacteria can be important in control of clinical Pseudomonas infection

1 Introduction

Pseudomonas aeruginosa is one of the commonest causes ofinfection in burn patients and an important agent for hospitalacquired infections and death in immunocompromised suchas cystic fibrosis and cancer patients [1] This bacterium isoften resistant to many antimicrobial agents The cause ofresistance can be efflux pumps decreased outer membranepermeability and secretion of beta-lactamase enzymes [2]Several kinds of beta-lactamase enzymes have been recog-nized These enzymes were initially seen in Gram-negativebacteria which were detected in periplasmic space [3]

Metallo-beta lactamases are classified in group B of Amblerclassification This group is divided into three subclasses BIBII and BIII The BI subclass is divided into four categoriesaccording to their molecular structures the IMP VIM GIMand SPM types [4] The first MBLs enzymes were IMP-1which was initially found in S marcescens in Japan (1991)VIM-1 originally detected in Italy (1997) SPM-1 first detectedin Brazil (1997) and finally GIM detected in Germany(2002) [5 6] Carbapenems are effective antibiotics againstPseudomonas infections But because the genes for MBLsare often carried on plasmids and class I integron they canrapidly spread among different species of this bacterium and

Hindawi Publishing CorporationISRN MicrobiologyVolume 2014 Article ID 941507 6 pageshttpdxdoiorg1011552014941507

2 ISRNMicrobiology

other bacteria [7 8] MBLs can potently hydrolyze all beta-lactam antibiotics except azetreonamThese enzymes requirezinc ion as cofactor [9] Hence their activity is inhibitedby chelators like ethylenediaminetetraacetic acid (EDTA)sodium mercaptoacetic acid (SMA) 2-mercaptopropionicacid (MPA) and dipicolinic acid (DPA) Sulbactam tazobac-tam and clavulanic acid which are often used to inhibit beta-lactamase enzymes are not effective against MBLs [2 10]Several phenotypic methods are available for detection ofMBLs producing bacteria All these methods are based onthe ability of metal chelators such as EDTA to inhibit theactivity of MBLs The double disk synergy test method wasemployed in this investigation [9] The goal of this study wasto determine the antibiotic resistance pattern in P aeruginosaspecies isolated from nine hospitals in Tehran Iran andevaluate the prevalence of MBLs genes bla-VIM and bla-IMPin imipenem resistance strains

2 Materials and Methods

21 Collection of Strains A total of 212 strains of P aeruginosawere collected during six-month period from October 2011to March 2012 from Motahari Shariati Hashemi NejadKasra Hazrat Rasoul Milad Mehr Tebbi Kodakan andBaghiatallah hospitals in Tehran Iran These strains wereisolated from wound blood urine trachea sputum pleuralfluid eye catheter and larynges samples 148 isolates wereobtained from male patients and 64 isolates from femalepatients These isolates were subcultured on Brucella agarand their identification was performed by both biochemicalmethods such as oxidase test catalase test OF test growth at42∘C and PCR using specific primers for oprL gene (oprL isa constitutively produced peptidoglycan-associated lipopro-tein which contains covalently bound fatty acyl chains) [11]Bacterial strains were preserved in Trypticase soy broth

22 Antibiotic Susceptibility Tests Antimicrobial sensitiv-ity tests were performed on Mueller-Hinton agar (Biolab-Hungary) by Kirby-Bauer disk diffusion method [12] andinterpreted according to CLSI (Clinical and LaboratoryStandards Institute) standard tables Pseudomonas aerug-inosa ATCC

27853was used as control for the suscep-

tibility tests The antibiotic disks used were Imipenem(10 120583g) Ciprofloxacin (5 120583g) Gentamicin (10 120583g) Tetra-cyclin (30 120583g) Ceftazidime (30 120583g) Cefotaxime (30 120583g)Azithromycin (15120583g) Tobramycin (10120583g) Ticarcylin (75120583g)and Piperacillin (100 120583g) (Padtan Teb Iran) At first thebacteria were cultured into TSB and incubated at 35∘C for24 hours After 24 hours microbial suspension was preparedequivalent to the turbidity of 05 McFarland standard Withsterile swabs they were plated on MH agar The antibioticdisks were placed on the plate and incubated at 35∘C for 24hours Following incubation the diameters of the zone ofinhibition were measured

23 Minimum Inhibitory Concentration (MIC) Determina-tion of MIC was performed for imipenem resistant strains byagar dilution method according to CLSI standards Isolates

with MIC value of ge16 120583gmL were screened as MBLs pro-ducing strains Pseudomonas aeruginosaATCC

27853was used

as a control strain for the susceptibility testing

24 Detection of MBLs Producing Isolates by Double DiskSynergy Test (DDST) Method Imipenem resistance isolateswere investigated for MBLs producing strains by DDSTmethod The bacterial suspension with turbidity equivalentto 05 McFarland standard was prepared and cultured onMueller-Hinton agar [13] For preparation of IMP-EDTAdisk 750120583g of EDTA solution was added to 10 120583g imipenemdisk and dried in an incubator [13] At first the bacterialsuspension with turbidity equivalent to 05 McFarland wasprepared and cultured with sterile swab on MH agar Thentwo 10 120583g imipenem and imipenem-EDTA disks were placedon the agar surface After 18 hours of incubation at 35∘Cthe inhibition zone of imipenem disk and IMP-EDTA weremeasured An increase of seven mm or more in the zonediameter for IMP-EDTA disk in comparison with imipenemdisk alone was considered as a MBLs producing isolate [14]

25 DNA Extraction DNA from P aeruginosa isolates wasextracted by boiling method In this method a number ofbacterial colonies were inoculated in 10mL of LB broth andincubation at 37∘C for 16 hours 15mL of the LB broth culturewas centrifuged at 13000timesg at room temperature for 10minThe bacterial pellet was suspended in 300 120583L sterile waterThe cells in the suspension were lysed by heating at 100∘C for10min and the leftover cells were removed by centrifugationat 13000timesg at room temperature for 10minThe supernatantwas transferred into new tubes and used as template DNA forPCR reactions For purity assurance the template DNA waselectrophoresed on agarose gel [10]

26 PCRReaction for Confirmation of Pseudomonas aerugino-sa Strains (oprL Gene) PCR reaction for identification ofP aeruginosa strains (oprL gene) was performed in a finalvolume of 25 120583L PCR Buffer (10x) 25 120583L MgCl

2(50mM)

075 120583L dNTPs (10mM) 1 120583L forward (51015840ATG-GAA-A-TG-CTG-AAA-TTC-GG-ltCgt31015840) and reverse (51015840CTT-CT-T-CAG-CTC-GAC-GCG-AC-ltGgt31015840) primers [11] 500 bp(10 pmol120583L) 1 120583L + 1 120583L Taq DNA polymerase (5U120583L)1 120583L distilled water 1675120583L and Template DNA 1 120583L Thethermocycler program for oprL gene consisted of 3min initialdenaturation at 94∘C 35 cycles of denaturation at 94∘C for1min annealing at 60∘C for 1min extension at 72∘C for 1minand final extension at 72∘C for 5min

27 PCR Assays for Detection of MBLs Genes

271 Primers For design of primers the nucleotide sequen-ces of bla-VIM and bla-IMP genes in P aeruginosa wereobtained from Gene bank and aligned with Clastalw2 soft-ware (alignment program) After identification of common-ality region Gene Runner program was used for primerdesign Finally for confirmation of primer specificity theywere subjected to BLAST program

ISRNMicrobiology 3

PCR reactions for bla-IMP and bla-VIM genes were per-formed in a final volume of 25 120583L containing the following

bla-IMP PCRBuffer (10x) 25 120583LMgCl2(50mM) 1 120583L dNTPs

(10mM) 1 120583L forward (51015840GTTTGAAGAAGTTAACGG-GTGG31015840) and reverse (51015840ATAATTTGGCGGACTTTGGC31015840)primers (designed) 459 bp (10 pmol120583L) 1 + 1 120583L Taq DNApolymerase (5U120583L) 1 120583L template DNA 3 120583L and distilledwater 145 120583L The thermocycler program for bla-IMP geneconsisted of 4min initial denaturation at 94∘C 35 cycles ofdenaturation at 94∘C for 1min annealing at 61∘C for 1minextension at 72∘C for 1min and final extension at 72∘C for5min

bla-VIM PCR Buffer (10x) 25 120583L MgCl2(50mM) 1 120583L

dNTPs (10mM) 1 120583L forward (51015840TGGTGTTTGGTCGCA-TATCG31015840) and reverse (51015840GAGCAAGTCTAGACCGCC-CG31015840) primers (designed) 595 bp (10 pmol120583L) 1 + 1 120583L TaqDNA polymerase (50U120583L) 1 120583L template DNA 2 120583L anddistilled water 155 120583L Scheduled program for bla-VIM geneby thermocycler was 4min initial denaturation at 94∘C 35cycles of denaturation at 94∘C for 1min annealing at 62∘Cfor 1min extension at 72∘C for 1min and final extension at72∘C for 10min

Water was used as negative control and P aeruginosastrains producing MBLs genes (bla-VIM and bla-IMP) (pro-vided from Pasteur Institute Iran) were used as positivecontrols for MBL detection

The PCR products were confirmed by gel electrophore-sis in 1 (wv) agarose gel (HT bioscience UK) in TBEbuffer and visualized with ethidium bromide staining andphotographed with UV waves through Gel Documentation(Technogen Iran) (Figures 2 3 and 4)

3 Results

In total 212 P aeruginosa isolates were collected Afterperforming initial bacteriological tests they were confirmedto be P aeruginosa by PCR assay They were obtained fromclinical specimens such as wound (119899 = 78) urine (119899 = 62)blood (119899 = 39) trachea (119899 = 16) sputum (119899 = 7) pleural fluid(119899 = 5) eye (119899 = 2) catheter (119899 = 2) and larynges (119899 = 1)The majority were from patients in burn unit (119899 = 58) andthe least were from patients in cardiac unit (119899 = 1)

31 Antibiotic Susceptibility Antibiotic susceptibility of the212 isolates in the initial disk diffusion method against10 antibiotics is presented in Figure 1 The isolates showedhigh resistance to tetracycline (86) and the most effectiveantibiotic was ciprofloxacin (44)

32 MIC Determination of MIC for imipenem by agardilutionmethod indicated that 4716 (119899 = 100) of the strainswere resistant to imipenem (MIC ge 16 120583gmL)

33 Detection of MBLs Producing Isolates by Double DiskMethod In the double disk method performed on the 100

0

10

20

30

40

50

60

70

80

90 86

6260

5451 50

47 47 4744

CTX TIC PIP GM TOB IMP AZM CAZ CIPAntibiotics

TET

Resistance(

)

Figure 1 Antibiotic resistance among isolates of P aeruginosa

1000 bp

500bp

Figure 2 Electrophoresis of oprL (500 bp) PCR products on agarosegel Line 1 shows the positive control Lines 2 and 3 show Paeruginosa strains Line 4 shows the negative control Line 5 shows100ndash1000 bp ladder

imipenem resistance isolates 70 strains were shown to bepositive by this phenotypic method

34 Molecular Analysis The PCR assays indicated that 20(9) of these strains contained the IMP gene whereas 70(33) of them harbored the VIM gene

4 Discussion

Pseudomonas aeruginosa is an opportunistic human patho-gen [15 16] Different antibiotics are commonly used for thetreatment of Pseudomonas infections such as aminoglyco-sides beta-lactamases and quinolones [16ndash18] Carbapenemsare potent beta-lactam antibiotics against MBLs producingand multidrug resistance P aeruginosa [19] There have beenmany recent reports that clinical isolates of P aeruginosa andGram-negative bacilli are becoming resistant to carbapenems

4 ISRNMicrobiology

Figure 3 Electrophoresis of bla-IMP (459 bp) PCR products onagarose gel Line 1 is the positive control Lines 2 and 3 show isolatespositive for IMP Line 4 is negative in PCR products Line 5 shows100ndash1000 bp ladder Line 6 is negative control Lines 7 and 8 showisolates positive for IMP

1000 bp

500bp

Figure 4 Agarose gel electrophoresis of bla-VIM (595 bp) PCRproducts Line 1 is 100ndash1000 bp ladder Line 2 is positive controlLines 3 4 5 6 and 7 show isolates positive forVIM Line 8 is negativecontrol

in many countries [19] In recent years MBLs have beenidentified from clinical isolates with increasing frequencyacross the world and strains that produce these enzymeshave been responsible for prolonged treatment and acuteinfections [20] A study from Japan showed that patientsinfected with MBLs producing P aeruginosa needed toreceive multiple antibiotics and infections leading to deathdue to IMP producing P aeruginosa were more commonthan those with bla-IMP negative P aeruginosa [21] MBLsproducing P aeruginosa is a serious intimidation in hospitallocations especially in burn units These strains can createsignificant problem in treatment and spread of resistanceamong other bacteria [22] Resistance to carbapenems viaacquirement ofMBLs genes among P aeruginosa strains have

increased rapidly in Asia Europe and South America Thishas led to a drastic change in the pattern of antibiotics usageagainst multidrug resistant P aeruginosa [23] Detectionof MBLs producing strains can be effective for optimaltreatment of patients particularly in burned and hospitalizedpatients and control the spread of resistance [6] Resistanceto imipenem is increasing in Iran in recent years [9 2224ndash27] The differences in the reported values between thepresent study and those reported earlier may be due tothe difference in geographical regions difference in kind ofinfections the enormous usage of antibiotics or differencein antibiotic therapy regimens in the selective hospitals inthis study than those in other studies Among the 100 isolateswhich were resistant to imipenem 70 (70) were foundto be MBLs producers In the other strains which wereresistant to imipenem but were MBLs negative resistanceto imipenem may be due to efflux systems decreased outermembrane permeability or production of Ampc enzymesFor confirmation of MBLs producing strains PCR is animportant and accurate method [10] In this study all isolateswere screened for VIM and IMP genes by PCR 20 isolateshad IMP gene and 70 isolates hadVIM gene Of the 11 isolatesthat were negative with phenotypic method 4 harbored IMPgene and 7 isolates hadVIM gene as detected by PCR Also 3isolates that were positive with DDST method were negativewith PCRThis shows that theremay be genes other thanVIMand IMP responsible for MBLs trait

Yazdi et al isolated 126 P aeruginosa strains fromnonburn patients in Iran in 2007 Production of MBL inthese isolates was determined by E-test followed by PCR todetect bla-IMP and bla-VIM Among 70 imipenem resistantP aeruginosa strains 8 strains produced MBLs by E-testall of which carried bla-VIM None of them were carriersof bla-IMP gene [24] In another study in Iran during 2008Shahcheraghi et al collected 243 P aeruginosa strains fromnonburn patients 22 strains were MBLs positive 15 of themhad bla-VIM and none was bla-IMP positive [25] In a studycarried out in India between 2005 and 2007 among 61 Paeruginosa strains collected 20 strains produced MBLs Ofthe 20 MBLs confirmed strain by E-test 17 strains weresubjected to PCR testing 15 of these strains were bla-VIMpositive and two isolates were negative for both bla-VIMand bla-IMP and all were negative for bla-IMP [28] In 2008Khosravi and Mihani collected 100 P aeruginosa in IranProduction of MBLs was determined both by E-test andPCR method Among 41 imipenem resistant P aeruginosa8 strains were shown to be MBLs producer by E-test andall of these 8 strains carried bla-VIM and none of them hadbla-IMP [22] In another study in Turkey 100 P aeruginosastrains were collected from patients in a Turkish universityhospital One (1) isolate was found to carry bla-VIM genewhereas 9 (9) carried bla-IMP gene Among 9 isolates thatcarried bla-IMP gene only 4 isolates were shown to be MBLproducer by E-test [29] In our study the percent of strainsthat carried bla-VIM and bla-IMP genes was higher than thosereported in previous studies The reasons maybe an overallincrease in the extent of acquirement of MBLs genes amongP aeruginosa More MBLs genes are found to be located onthe class I integron and can therefore easily transfer between

ISRNMicrobiology 5

P aeruginosa strains [7] In themajority of studies in Iran andother countries vim-type MBL was the most prevalent genereported [30ndash32]

5 Conclusion

This study illustrated that the majority of P aeruginosastrains were resistant to various antibiotics The high rateof antibiotic resistanceamong P aeruginosa strains is veryalarming and can be responsible for serious infections Soidentification of MBLs producing strains and taking effortsto reduce the rate of transfer between different strains areimportant goal for treatment of P aeruginosa infections

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank the Microbiology Department staff ofthe studied hospitals and Pasteur Institute of Iran for theirassistance

References

[1] H C Neu ldquoThe role of Pseudomonas aeruginosa in infectionsrdquoJournal of Antimicrobial Chemotherapy vol 11 pp 1ndash13 1983

[2] Y Arakawa N Shibata K Shibayama et al ldquoConvenient testfor screening metallo-120573-lactamase-producing gram- negativebacteria by using thiol compoundsrdquo Journal of Clinical Micro-biology vol 38 no 1 pp 40ndash43 2000

[3] K Senda Y Arakawa S Ichiyama et al ldquoPCR detection ofmetallo-120573-lactamase gene (bla(IMP)) in gram-negative rodsresistant to broad-spectrum 120573-lactamsrdquo Journal of ClinicalMicrobiology vol 34 no 12 pp 2909ndash2913 1996

[4] K Bush G A Jacoby and A A Medeiros ldquoA functionalclassification scheme for 120573-lactamases and its correlation withmolecular structurerdquo Antimicrobial Agents and Chemotherapyvol 39 no 6 pp 1211ndash1233 1995

[5] L Poirel M Magalhaes M Lopes and P Nordmann ldquoMolec-ular analysis of metallo-beta-lactamase gene bla (SPM-1) sur-rounding sequences from disseminated Pseudomonas aerug-inosa isolates in Recife Brazilrdquo Antimicrobial Agents andChemotherapy vol 48 no 4 pp 1406ndash1409 2004

[6] P Nordmann and L Poirel ldquoEmerging carbapenemases inGram-negative aerobesrdquo Clinical Microbiology and Infectionvol 8 no 6 pp 321ndash331 2002

[7] G Cornaglia A Mazzariol L Lauretti G M Rossoliniand R Fontana ldquoHospital outbreak of carbapenem-resistantPseudomonas aeruginosa producingVIM-1 a novel transferablemetallo-120573-lactamaserdquo Clinical Infectious Diseases vol 31 no 5pp 1119ndash1125 2000

[8] J Yatsuyanagi S Saito S Harata et al ldquoClass 1 integron con-taining metallo-120573-lactamase gene bla VIM-2 in Pseudomonasaeruginosa clinical strains isolated in Japanrdquo AntimicrobialAgents and Chemotherapy vol 48 no 2 pp 626ndash628 2004

[9] H Saderi Z Karimi P Owlia A Bahar and S M BAkhavi Rad ldquoPhenotypic detection of metallo-beta-lactamase

producingPseudomonas aeruginosa strain isolated fromburnedpatientsrdquo Iranian Journal of Pathology vol 3 no 1 pp 20ndash242008

[10] J D D Pitout D B Gregson L Poirel J-A McClure P Le andD L Church ldquoDetection ofPseudomonas aeruginosa producingmetallo-120573-lactamases in a large centralized laboratoryrdquo Journalof Clinical Microbiology vol 43 no 7 pp 3129ndash3135 2005

[11] E Mahabir D Bulian S Bensch and J Schmidt ldquoEliminationof P aeruginosa in mice by treatment with chlorine and the useof microbiological and PCR analysesrdquo Scandinavian Journal ofLaboratory Animal Science vol 36 no 4 pp 355ndash361 2009

[12] AW BauerWMKirby J C Sherris andM Turck ldquoAntibioticsusceptibility testing by a standardized single disk methodrdquoAmerican Journal of Clinical Pathology vol 45 no 4 pp 493ndash496 1966

[13] V Hemalatha U Sekar and V Kamat ldquoDetection of metallobetalactamase producing Pseudomonas aeruginosa in hospital-ized patientsrdquo Indian Journal of Medical Research vol 122 no2 pp 148ndash152 2005

[14] S Irfan A Zafar D Guhar T Ahsan and R Hasan ldquoMetallo-120573-lactamase-producing clinical isolates ofAcinetobacter speciesand Pseudomonas aeruginosa from intensive care unit patientsof a tertiary care hospitalrdquo Indian Journal of Medical Microbiol-ogy vol 26 no 3 pp 243ndash245 2008

[15] A R Lari and R Alaghehbandan ldquoNosocomial infections inan Iranian burn care centerrdquo Burns vol 26 no 8 pp 737ndash7402000

[16] H Hanberger J-A Garcia-Rodriguez M Gobernado HGoossens L E Nilsson and M J Struelens ldquoAntibiotic sus-ceptibility among aerobic gram-negative bacilli in intensive careunits in 5 European countriesrdquo Journal of the American MedicalAssociation vol 281 no 1 pp 67ndash71 1999

[17] U Altoparlak S Erol M N Akcay F Celebi and A KadanalildquoThe time-related changes of antimicrobial resistance patternsand predominant bacterial profiles of burn wounds and bodyflora of burned patientsrdquo Burns vol 30 no 7 pp 660ndash6642004

[18] A Rastegar Lari H Bahrami Honar and R AlaghehbandanldquoPseudomonas infections in Tohid Burn Center Iranrdquo Burnsvol 24 no 7 pp 637ndash641 1998

[19] D Church S Elsayed O Reid B Winston and R LindsayldquoBurn wound infectionsrdquo Clinical Microbiology Reviews vol 19no 2 pp 403ndash434 2006

[20] J D D Pitout G Revathi B L Chow et al ldquoMetallo-120573-lactamase-producing Pseudomonas aeruginosa isolated froma large tertiary centre in Kenyardquo Clinical Microbiology andInfection vol 14 no 8 pp 755ndash759 2008

[21] A Mirsalehian M Feizabadi F A Nakhjavani F JabalameliH Goli and N Kalantari ldquoDetection of VEB-1 OXA-10 andPER-1 genotypes in extended-spectrum120573-lactamase-producingPseudomonas aeruginosa strains isolated from burn patientsrdquoBurns vol 36 no 1 pp 70ndash74 2010

[22] A D Khosravi and F Mihani ldquoDetection of metallo-120573-lactamase-producing Pseudomonas aeruginosa strains isolatedfrom burn patients in Ahwaz Iranrdquo Diagnostic Microbiologyand Infectious Disease vol 60 no 1 pp 125ndash128 2008

[23] J A Griswold ldquoWhite blood cell response to burn injuryrdquoSeminars in Nephrology vol 13 no 4 pp 409ndash415 1993

6 ISRNMicrobiology

[24] H R Yazdi G B Nejad S N Peerayeh and M MostafaeildquoPrevalence and detection of metallo-120573-lactamase (MBL)-producing Pseudomonas aeruginosa strains from clinical iso-lates in Iranrdquo Annals of Microbiology vol 57 no 2 pp 293ndash2962007

[25] F Shahcheraghi V S Nikbin F Shooraj A Bagheri MShafiee and M R Arabestani ldquoPCR detection of VIM-1 VIM-2 and IMP-1 metallo-beta-lactamases in clinically multi-drugresistant P aeruginosa isolated in Tehranrdquo Iranian Journal ofClinical Infectious Diseases vol 12 p 118 2008

[26] S SepehrisereshtM A Boroumand L PourgholiM SotoudehAnvari E Habibi and M Sattarzadeh Tabrizi ldquoDetection ofvim- and ipm-type metallobeta-lactamases in Pseudomonasaeruginosa clinical isolatesrdquo Archives of Iranian Medicine vol15 no 11 pp 670ndash673 2012

[27] H Fazeli Z Moslehi Takantape G H Irajian and M SalehildquoDetermination of antibiotic resistance pattern and identifica-tion of bla-VIM gene in P aeruginosa isolates from ImamMosaKazemBurnsHospital Isfahan Iranrdquo Iranian Journal ofMedicalMicrobiology vol 3 no 4 pp 1ndash8 2009

[28] A Manoharan S Chatterjee and D Mathai ldquoDetection andcharacterization of metallo beta lactamases producing Pseu-domonas aeruginosardquo Indian Journal of Medical Microbiologyvol 28 no 3 pp 241ndash244 2010

[29] O B Ozgumus R Caylan I Tosun C Sandalli K Aydin andI Koksal ldquoMolecular epidemiology of clinical Pseudomonasaeruginosa isolates carrying IMP-1metallo-120573-lactamase gene ina university hospital in TurkeyrdquoMicrobial Drug Resistance vol13 no 3 pp 191ndash198 2007

[30] F Luzzaro A Endimiani J-D Docquier et al ldquoPrevalence andcharacterization of metallo-120573-lactamases in clinical isolates ofPseudomonas aeruginosardquo Diagnostic Microbiology and Infec-tious Disease vol 48 no 2 pp 131ndash135 2004

[31] E-J Oh S Lee Y-J Park et al ldquoPrevalence of metallo-120573-lactamase among Pseudomonas aeruginosa and Acinetobacterbaumannii in a Korean University hospital and comparison ofscreening methods for detecting metallo-120573-lactamaserdquo Journalof Microbiological Methods vol 54 no 3 pp 411ndash418 2003

[32] I-S Kim N Y Lee C-S Ki W S Oh K R Peckand J-H Song ldquoIncreasing prevalence of imipenem-resistantPseudomonas aeruginosa and molecular typing of metallo-120573-lactamase producers in a Korean hospitalrdquo Microbial DrugResistance vol 11 no 4 pp 355ndash359 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

ISRNMicrobiology 3

PCR reactions for bla-IMP and bla-VIM genes were per-formed in a final volume of 25 120583L containing the following

bla-IMP PCRBuffer (10x) 25 120583LMgCl2(50mM) 1 120583L dNTPs

(10mM) 1 120583L forward (51015840GTTTGAAGAAGTTAACGG-GTGG31015840) and reverse (51015840ATAATTTGGCGGACTTTGGC31015840)primers (designed) 459 bp (10 pmol120583L) 1 + 1 120583L Taq DNApolymerase (5U120583L) 1 120583L template DNA 3 120583L and distilledwater 145 120583L The thermocycler program for bla-IMP geneconsisted of 4min initial denaturation at 94∘C 35 cycles ofdenaturation at 94∘C for 1min annealing at 61∘C for 1minextension at 72∘C for 1min and final extension at 72∘C for5min

bla-VIM PCR Buffer (10x) 25 120583L MgCl2(50mM) 1 120583L

dNTPs (10mM) 1 120583L forward (51015840TGGTGTTTGGTCGCA-TATCG31015840) and reverse (51015840GAGCAAGTCTAGACCGCC-CG31015840) primers (designed) 595 bp (10 pmol120583L) 1 + 1 120583L TaqDNA polymerase (50U120583L) 1 120583L template DNA 2 120583L anddistilled water 155 120583L Scheduled program for bla-VIM geneby thermocycler was 4min initial denaturation at 94∘C 35cycles of denaturation at 94∘C for 1min annealing at 62∘Cfor 1min extension at 72∘C for 1min and final extension at72∘C for 10min

Water was used as negative control and P aeruginosastrains producing MBLs genes (bla-VIM and bla-IMP) (pro-vided from Pasteur Institute Iran) were used as positivecontrols for MBL detection

The PCR products were confirmed by gel electrophore-sis in 1 (wv) agarose gel (HT bioscience UK) in TBEbuffer and visualized with ethidium bromide staining andphotographed with UV waves through Gel Documentation(Technogen Iran) (Figures 2 3 and 4)

3 Results

In total 212 P aeruginosa isolates were collected Afterperforming initial bacteriological tests they were confirmedto be P aeruginosa by PCR assay They were obtained fromclinical specimens such as wound (119899 = 78) urine (119899 = 62)blood (119899 = 39) trachea (119899 = 16) sputum (119899 = 7) pleural fluid(119899 = 5) eye (119899 = 2) catheter (119899 = 2) and larynges (119899 = 1)The majority were from patients in burn unit (119899 = 58) andthe least were from patients in cardiac unit (119899 = 1)

31 Antibiotic Susceptibility Antibiotic susceptibility of the212 isolates in the initial disk diffusion method against10 antibiotics is presented in Figure 1 The isolates showedhigh resistance to tetracycline (86) and the most effectiveantibiotic was ciprofloxacin (44)

32 MIC Determination of MIC for imipenem by agardilutionmethod indicated that 4716 (119899 = 100) of the strainswere resistant to imipenem (MIC ge 16 120583gmL)

33 Detection of MBLs Producing Isolates by Double DiskMethod In the double disk method performed on the 100

0

10

20

30

40

50

60

70

80

90 86

6260

5451 50

47 47 4744

CTX TIC PIP GM TOB IMP AZM CAZ CIPAntibiotics

TET

Resistance(

)

Figure 1 Antibiotic resistance among isolates of P aeruginosa

1000 bp

500bp

Figure 2 Electrophoresis of oprL (500 bp) PCR products on agarosegel Line 1 shows the positive control Lines 2 and 3 show Paeruginosa strains Line 4 shows the negative control Line 5 shows100ndash1000 bp ladder

imipenem resistance isolates 70 strains were shown to bepositive by this phenotypic method

34 Molecular Analysis The PCR assays indicated that 20(9) of these strains contained the IMP gene whereas 70(33) of them harbored the VIM gene

4 Discussion

Pseudomonas aeruginosa is an opportunistic human patho-gen [15 16] Different antibiotics are commonly used for thetreatment of Pseudomonas infections such as aminoglyco-sides beta-lactamases and quinolones [16ndash18] Carbapenemsare potent beta-lactam antibiotics against MBLs producingand multidrug resistance P aeruginosa [19] There have beenmany recent reports that clinical isolates of P aeruginosa andGram-negative bacilli are becoming resistant to carbapenems

4 ISRNMicrobiology

Figure 3 Electrophoresis of bla-IMP (459 bp) PCR products onagarose gel Line 1 is the positive control Lines 2 and 3 show isolatespositive for IMP Line 4 is negative in PCR products Line 5 shows100ndash1000 bp ladder Line 6 is negative control Lines 7 and 8 showisolates positive for IMP

1000 bp

500bp

Figure 4 Agarose gel electrophoresis of bla-VIM (595 bp) PCRproducts Line 1 is 100ndash1000 bp ladder Line 2 is positive controlLines 3 4 5 6 and 7 show isolates positive forVIM Line 8 is negativecontrol

in many countries [19] In recent years MBLs have beenidentified from clinical isolates with increasing frequencyacross the world and strains that produce these enzymeshave been responsible for prolonged treatment and acuteinfections [20] A study from Japan showed that patientsinfected with MBLs producing P aeruginosa needed toreceive multiple antibiotics and infections leading to deathdue to IMP producing P aeruginosa were more commonthan those with bla-IMP negative P aeruginosa [21] MBLsproducing P aeruginosa is a serious intimidation in hospitallocations especially in burn units These strains can createsignificant problem in treatment and spread of resistanceamong other bacteria [22] Resistance to carbapenems viaacquirement ofMBLs genes among P aeruginosa strains have

increased rapidly in Asia Europe and South America Thishas led to a drastic change in the pattern of antibiotics usageagainst multidrug resistant P aeruginosa [23] Detectionof MBLs producing strains can be effective for optimaltreatment of patients particularly in burned and hospitalizedpatients and control the spread of resistance [6] Resistanceto imipenem is increasing in Iran in recent years [9 2224ndash27] The differences in the reported values between thepresent study and those reported earlier may be due tothe difference in geographical regions difference in kind ofinfections the enormous usage of antibiotics or differencein antibiotic therapy regimens in the selective hospitals inthis study than those in other studies Among the 100 isolateswhich were resistant to imipenem 70 (70) were foundto be MBLs producers In the other strains which wereresistant to imipenem but were MBLs negative resistanceto imipenem may be due to efflux systems decreased outermembrane permeability or production of Ampc enzymesFor confirmation of MBLs producing strains PCR is animportant and accurate method [10] In this study all isolateswere screened for VIM and IMP genes by PCR 20 isolateshad IMP gene and 70 isolates hadVIM gene Of the 11 isolatesthat were negative with phenotypic method 4 harbored IMPgene and 7 isolates hadVIM gene as detected by PCR Also 3isolates that were positive with DDST method were negativewith PCRThis shows that theremay be genes other thanVIMand IMP responsible for MBLs trait

Yazdi et al isolated 126 P aeruginosa strains fromnonburn patients in Iran in 2007 Production of MBL inthese isolates was determined by E-test followed by PCR todetect bla-IMP and bla-VIM Among 70 imipenem resistantP aeruginosa strains 8 strains produced MBLs by E-testall of which carried bla-VIM None of them were carriersof bla-IMP gene [24] In another study in Iran during 2008Shahcheraghi et al collected 243 P aeruginosa strains fromnonburn patients 22 strains were MBLs positive 15 of themhad bla-VIM and none was bla-IMP positive [25] In a studycarried out in India between 2005 and 2007 among 61 Paeruginosa strains collected 20 strains produced MBLs Ofthe 20 MBLs confirmed strain by E-test 17 strains weresubjected to PCR testing 15 of these strains were bla-VIMpositive and two isolates were negative for both bla-VIMand bla-IMP and all were negative for bla-IMP [28] In 2008Khosravi and Mihani collected 100 P aeruginosa in IranProduction of MBLs was determined both by E-test andPCR method Among 41 imipenem resistant P aeruginosa8 strains were shown to be MBLs producer by E-test andall of these 8 strains carried bla-VIM and none of them hadbla-IMP [22] In another study in Turkey 100 P aeruginosastrains were collected from patients in a Turkish universityhospital One (1) isolate was found to carry bla-VIM genewhereas 9 (9) carried bla-IMP gene Among 9 isolates thatcarried bla-IMP gene only 4 isolates were shown to be MBLproducer by E-test [29] In our study the percent of strainsthat carried bla-VIM and bla-IMP genes was higher than thosereported in previous studies The reasons maybe an overallincrease in the extent of acquirement of MBLs genes amongP aeruginosa More MBLs genes are found to be located onthe class I integron and can therefore easily transfer between

ISRNMicrobiology 5

P aeruginosa strains [7] In themajority of studies in Iran andother countries vim-type MBL was the most prevalent genereported [30ndash32]

5 Conclusion

This study illustrated that the majority of P aeruginosastrains were resistant to various antibiotics The high rateof antibiotic resistanceamong P aeruginosa strains is veryalarming and can be responsible for serious infections Soidentification of MBLs producing strains and taking effortsto reduce the rate of transfer between different strains areimportant goal for treatment of P aeruginosa infections

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank the Microbiology Department staff ofthe studied hospitals and Pasteur Institute of Iran for theirassistance

References

[1] H C Neu ldquoThe role of Pseudomonas aeruginosa in infectionsrdquoJournal of Antimicrobial Chemotherapy vol 11 pp 1ndash13 1983

[2] Y Arakawa N Shibata K Shibayama et al ldquoConvenient testfor screening metallo-120573-lactamase-producing gram- negativebacteria by using thiol compoundsrdquo Journal of Clinical Micro-biology vol 38 no 1 pp 40ndash43 2000

[3] K Senda Y Arakawa S Ichiyama et al ldquoPCR detection ofmetallo-120573-lactamase gene (bla(IMP)) in gram-negative rodsresistant to broad-spectrum 120573-lactamsrdquo Journal of ClinicalMicrobiology vol 34 no 12 pp 2909ndash2913 1996

[4] K Bush G A Jacoby and A A Medeiros ldquoA functionalclassification scheme for 120573-lactamases and its correlation withmolecular structurerdquo Antimicrobial Agents and Chemotherapyvol 39 no 6 pp 1211ndash1233 1995

[5] L Poirel M Magalhaes M Lopes and P Nordmann ldquoMolec-ular analysis of metallo-beta-lactamase gene bla (SPM-1) sur-rounding sequences from disseminated Pseudomonas aerug-inosa isolates in Recife Brazilrdquo Antimicrobial Agents andChemotherapy vol 48 no 4 pp 1406ndash1409 2004

[6] P Nordmann and L Poirel ldquoEmerging carbapenemases inGram-negative aerobesrdquo Clinical Microbiology and Infectionvol 8 no 6 pp 321ndash331 2002

[7] G Cornaglia A Mazzariol L Lauretti G M Rossoliniand R Fontana ldquoHospital outbreak of carbapenem-resistantPseudomonas aeruginosa producingVIM-1 a novel transferablemetallo-120573-lactamaserdquo Clinical Infectious Diseases vol 31 no 5pp 1119ndash1125 2000

[8] J Yatsuyanagi S Saito S Harata et al ldquoClass 1 integron con-taining metallo-120573-lactamase gene bla VIM-2 in Pseudomonasaeruginosa clinical strains isolated in Japanrdquo AntimicrobialAgents and Chemotherapy vol 48 no 2 pp 626ndash628 2004

[9] H Saderi Z Karimi P Owlia A Bahar and S M BAkhavi Rad ldquoPhenotypic detection of metallo-beta-lactamase

producingPseudomonas aeruginosa strain isolated fromburnedpatientsrdquo Iranian Journal of Pathology vol 3 no 1 pp 20ndash242008

[10] J D D Pitout D B Gregson L Poirel J-A McClure P Le andD L Church ldquoDetection ofPseudomonas aeruginosa producingmetallo-120573-lactamases in a large centralized laboratoryrdquo Journalof Clinical Microbiology vol 43 no 7 pp 3129ndash3135 2005

[11] E Mahabir D Bulian S Bensch and J Schmidt ldquoEliminationof P aeruginosa in mice by treatment with chlorine and the useof microbiological and PCR analysesrdquo Scandinavian Journal ofLaboratory Animal Science vol 36 no 4 pp 355ndash361 2009

[12] AW BauerWMKirby J C Sherris andM Turck ldquoAntibioticsusceptibility testing by a standardized single disk methodrdquoAmerican Journal of Clinical Pathology vol 45 no 4 pp 493ndash496 1966

[13] V Hemalatha U Sekar and V Kamat ldquoDetection of metallobetalactamase producing Pseudomonas aeruginosa in hospital-ized patientsrdquo Indian Journal of Medical Research vol 122 no2 pp 148ndash152 2005

[14] S Irfan A Zafar D Guhar T Ahsan and R Hasan ldquoMetallo-120573-lactamase-producing clinical isolates ofAcinetobacter speciesand Pseudomonas aeruginosa from intensive care unit patientsof a tertiary care hospitalrdquo Indian Journal of Medical Microbiol-ogy vol 26 no 3 pp 243ndash245 2008

[15] A R Lari and R Alaghehbandan ldquoNosocomial infections inan Iranian burn care centerrdquo Burns vol 26 no 8 pp 737ndash7402000

[16] H Hanberger J-A Garcia-Rodriguez M Gobernado HGoossens L E Nilsson and M J Struelens ldquoAntibiotic sus-ceptibility among aerobic gram-negative bacilli in intensive careunits in 5 European countriesrdquo Journal of the American MedicalAssociation vol 281 no 1 pp 67ndash71 1999

[17] U Altoparlak S Erol M N Akcay F Celebi and A KadanalildquoThe time-related changes of antimicrobial resistance patternsand predominant bacterial profiles of burn wounds and bodyflora of burned patientsrdquo Burns vol 30 no 7 pp 660ndash6642004

[18] A Rastegar Lari H Bahrami Honar and R AlaghehbandanldquoPseudomonas infections in Tohid Burn Center Iranrdquo Burnsvol 24 no 7 pp 637ndash641 1998

[19] D Church S Elsayed O Reid B Winston and R LindsayldquoBurn wound infectionsrdquo Clinical Microbiology Reviews vol 19no 2 pp 403ndash434 2006

[20] J D D Pitout G Revathi B L Chow et al ldquoMetallo-120573-lactamase-producing Pseudomonas aeruginosa isolated froma large tertiary centre in Kenyardquo Clinical Microbiology andInfection vol 14 no 8 pp 755ndash759 2008

[21] A Mirsalehian M Feizabadi F A Nakhjavani F JabalameliH Goli and N Kalantari ldquoDetection of VEB-1 OXA-10 andPER-1 genotypes in extended-spectrum120573-lactamase-producingPseudomonas aeruginosa strains isolated from burn patientsrdquoBurns vol 36 no 1 pp 70ndash74 2010

[22] A D Khosravi and F Mihani ldquoDetection of metallo-120573-lactamase-producing Pseudomonas aeruginosa strains isolatedfrom burn patients in Ahwaz Iranrdquo Diagnostic Microbiologyand Infectious Disease vol 60 no 1 pp 125ndash128 2008

[23] J A Griswold ldquoWhite blood cell response to burn injuryrdquoSeminars in Nephrology vol 13 no 4 pp 409ndash415 1993

6 ISRNMicrobiology

[24] H R Yazdi G B Nejad S N Peerayeh and M MostafaeildquoPrevalence and detection of metallo-120573-lactamase (MBL)-producing Pseudomonas aeruginosa strains from clinical iso-lates in Iranrdquo Annals of Microbiology vol 57 no 2 pp 293ndash2962007

[25] F Shahcheraghi V S Nikbin F Shooraj A Bagheri MShafiee and M R Arabestani ldquoPCR detection of VIM-1 VIM-2 and IMP-1 metallo-beta-lactamases in clinically multi-drugresistant P aeruginosa isolated in Tehranrdquo Iranian Journal ofClinical Infectious Diseases vol 12 p 118 2008

[26] S SepehrisereshtM A Boroumand L PourgholiM SotoudehAnvari E Habibi and M Sattarzadeh Tabrizi ldquoDetection ofvim- and ipm-type metallobeta-lactamases in Pseudomonasaeruginosa clinical isolatesrdquo Archives of Iranian Medicine vol15 no 11 pp 670ndash673 2012

[27] H Fazeli Z Moslehi Takantape G H Irajian and M SalehildquoDetermination of antibiotic resistance pattern and identifica-tion of bla-VIM gene in P aeruginosa isolates from ImamMosaKazemBurnsHospital Isfahan Iranrdquo Iranian Journal ofMedicalMicrobiology vol 3 no 4 pp 1ndash8 2009

[28] A Manoharan S Chatterjee and D Mathai ldquoDetection andcharacterization of metallo beta lactamases producing Pseu-domonas aeruginosardquo Indian Journal of Medical Microbiologyvol 28 no 3 pp 241ndash244 2010

[29] O B Ozgumus R Caylan I Tosun C Sandalli K Aydin andI Koksal ldquoMolecular epidemiology of clinical Pseudomonasaeruginosa isolates carrying IMP-1metallo-120573-lactamase gene ina university hospital in TurkeyrdquoMicrobial Drug Resistance vol13 no 3 pp 191ndash198 2007

[30] F Luzzaro A Endimiani J-D Docquier et al ldquoPrevalence andcharacterization of metallo-120573-lactamases in clinical isolates ofPseudomonas aeruginosardquo Diagnostic Microbiology and Infec-tious Disease vol 48 no 2 pp 131ndash135 2004

[31] E-J Oh S Lee Y-J Park et al ldquoPrevalence of metallo-120573-lactamase among Pseudomonas aeruginosa and Acinetobacterbaumannii in a Korean University hospital and comparison ofscreening methods for detecting metallo-120573-lactamaserdquo Journalof Microbiological Methods vol 54 no 3 pp 411ndash418 2003

[32] I-S Kim N Y Lee C-S Ki W S Oh K R Peckand J-H Song ldquoIncreasing prevalence of imipenem-resistantPseudomonas aeruginosa and molecular typing of metallo-120573-lactamase producers in a Korean hospitalrdquo Microbial DrugResistance vol 11 no 4 pp 355ndash359 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 ISRNMicrobiology

Figure 3 Electrophoresis of bla-IMP (459 bp) PCR products onagarose gel Line 1 is the positive control Lines 2 and 3 show isolatespositive for IMP Line 4 is negative in PCR products Line 5 shows100ndash1000 bp ladder Line 6 is negative control Lines 7 and 8 showisolates positive for IMP

1000 bp

500bp

Figure 4 Agarose gel electrophoresis of bla-VIM (595 bp) PCRproducts Line 1 is 100ndash1000 bp ladder Line 2 is positive controlLines 3 4 5 6 and 7 show isolates positive forVIM Line 8 is negativecontrol

in many countries [19] In recent years MBLs have beenidentified from clinical isolates with increasing frequencyacross the world and strains that produce these enzymeshave been responsible for prolonged treatment and acuteinfections [20] A study from Japan showed that patientsinfected with MBLs producing P aeruginosa needed toreceive multiple antibiotics and infections leading to deathdue to IMP producing P aeruginosa were more commonthan those with bla-IMP negative P aeruginosa [21] MBLsproducing P aeruginosa is a serious intimidation in hospitallocations especially in burn units These strains can createsignificant problem in treatment and spread of resistanceamong other bacteria [22] Resistance to carbapenems viaacquirement ofMBLs genes among P aeruginosa strains have

increased rapidly in Asia Europe and South America Thishas led to a drastic change in the pattern of antibiotics usageagainst multidrug resistant P aeruginosa [23] Detectionof MBLs producing strains can be effective for optimaltreatment of patients particularly in burned and hospitalizedpatients and control the spread of resistance [6] Resistanceto imipenem is increasing in Iran in recent years [9 2224ndash27] The differences in the reported values between thepresent study and those reported earlier may be due tothe difference in geographical regions difference in kind ofinfections the enormous usage of antibiotics or differencein antibiotic therapy regimens in the selective hospitals inthis study than those in other studies Among the 100 isolateswhich were resistant to imipenem 70 (70) were foundto be MBLs producers In the other strains which wereresistant to imipenem but were MBLs negative resistanceto imipenem may be due to efflux systems decreased outermembrane permeability or production of Ampc enzymesFor confirmation of MBLs producing strains PCR is animportant and accurate method [10] In this study all isolateswere screened for VIM and IMP genes by PCR 20 isolateshad IMP gene and 70 isolates hadVIM gene Of the 11 isolatesthat were negative with phenotypic method 4 harbored IMPgene and 7 isolates hadVIM gene as detected by PCR Also 3isolates that were positive with DDST method were negativewith PCRThis shows that theremay be genes other thanVIMand IMP responsible for MBLs trait

Yazdi et al isolated 126 P aeruginosa strains fromnonburn patients in Iran in 2007 Production of MBL inthese isolates was determined by E-test followed by PCR todetect bla-IMP and bla-VIM Among 70 imipenem resistantP aeruginosa strains 8 strains produced MBLs by E-testall of which carried bla-VIM None of them were carriersof bla-IMP gene [24] In another study in Iran during 2008Shahcheraghi et al collected 243 P aeruginosa strains fromnonburn patients 22 strains were MBLs positive 15 of themhad bla-VIM and none was bla-IMP positive [25] In a studycarried out in India between 2005 and 2007 among 61 Paeruginosa strains collected 20 strains produced MBLs Ofthe 20 MBLs confirmed strain by E-test 17 strains weresubjected to PCR testing 15 of these strains were bla-VIMpositive and two isolates were negative for both bla-VIMand bla-IMP and all were negative for bla-IMP [28] In 2008Khosravi and Mihani collected 100 P aeruginosa in IranProduction of MBLs was determined both by E-test andPCR method Among 41 imipenem resistant P aeruginosa8 strains were shown to be MBLs producer by E-test andall of these 8 strains carried bla-VIM and none of them hadbla-IMP [22] In another study in Turkey 100 P aeruginosastrains were collected from patients in a Turkish universityhospital One (1) isolate was found to carry bla-VIM genewhereas 9 (9) carried bla-IMP gene Among 9 isolates thatcarried bla-IMP gene only 4 isolates were shown to be MBLproducer by E-test [29] In our study the percent of strainsthat carried bla-VIM and bla-IMP genes was higher than thosereported in previous studies The reasons maybe an overallincrease in the extent of acquirement of MBLs genes amongP aeruginosa More MBLs genes are found to be located onthe class I integron and can therefore easily transfer between

ISRNMicrobiology 5

P aeruginosa strains [7] In themajority of studies in Iran andother countries vim-type MBL was the most prevalent genereported [30ndash32]

5 Conclusion

This study illustrated that the majority of P aeruginosastrains were resistant to various antibiotics The high rateof antibiotic resistanceamong P aeruginosa strains is veryalarming and can be responsible for serious infections Soidentification of MBLs producing strains and taking effortsto reduce the rate of transfer between different strains areimportant goal for treatment of P aeruginosa infections

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank the Microbiology Department staff ofthe studied hospitals and Pasteur Institute of Iran for theirassistance

References

[1] H C Neu ldquoThe role of Pseudomonas aeruginosa in infectionsrdquoJournal of Antimicrobial Chemotherapy vol 11 pp 1ndash13 1983

[2] Y Arakawa N Shibata K Shibayama et al ldquoConvenient testfor screening metallo-120573-lactamase-producing gram- negativebacteria by using thiol compoundsrdquo Journal of Clinical Micro-biology vol 38 no 1 pp 40ndash43 2000

[3] K Senda Y Arakawa S Ichiyama et al ldquoPCR detection ofmetallo-120573-lactamase gene (bla(IMP)) in gram-negative rodsresistant to broad-spectrum 120573-lactamsrdquo Journal of ClinicalMicrobiology vol 34 no 12 pp 2909ndash2913 1996

[4] K Bush G A Jacoby and A A Medeiros ldquoA functionalclassification scheme for 120573-lactamases and its correlation withmolecular structurerdquo Antimicrobial Agents and Chemotherapyvol 39 no 6 pp 1211ndash1233 1995

[5] L Poirel M Magalhaes M Lopes and P Nordmann ldquoMolec-ular analysis of metallo-beta-lactamase gene bla (SPM-1) sur-rounding sequences from disseminated Pseudomonas aerug-inosa isolates in Recife Brazilrdquo Antimicrobial Agents andChemotherapy vol 48 no 4 pp 1406ndash1409 2004

[6] P Nordmann and L Poirel ldquoEmerging carbapenemases inGram-negative aerobesrdquo Clinical Microbiology and Infectionvol 8 no 6 pp 321ndash331 2002

[7] G Cornaglia A Mazzariol L Lauretti G M Rossoliniand R Fontana ldquoHospital outbreak of carbapenem-resistantPseudomonas aeruginosa producingVIM-1 a novel transferablemetallo-120573-lactamaserdquo Clinical Infectious Diseases vol 31 no 5pp 1119ndash1125 2000

[8] J Yatsuyanagi S Saito S Harata et al ldquoClass 1 integron con-taining metallo-120573-lactamase gene bla VIM-2 in Pseudomonasaeruginosa clinical strains isolated in Japanrdquo AntimicrobialAgents and Chemotherapy vol 48 no 2 pp 626ndash628 2004

[9] H Saderi Z Karimi P Owlia A Bahar and S M BAkhavi Rad ldquoPhenotypic detection of metallo-beta-lactamase

producingPseudomonas aeruginosa strain isolated fromburnedpatientsrdquo Iranian Journal of Pathology vol 3 no 1 pp 20ndash242008

[10] J D D Pitout D B Gregson L Poirel J-A McClure P Le andD L Church ldquoDetection ofPseudomonas aeruginosa producingmetallo-120573-lactamases in a large centralized laboratoryrdquo Journalof Clinical Microbiology vol 43 no 7 pp 3129ndash3135 2005

[11] E Mahabir D Bulian S Bensch and J Schmidt ldquoEliminationof P aeruginosa in mice by treatment with chlorine and the useof microbiological and PCR analysesrdquo Scandinavian Journal ofLaboratory Animal Science vol 36 no 4 pp 355ndash361 2009

[12] AW BauerWMKirby J C Sherris andM Turck ldquoAntibioticsusceptibility testing by a standardized single disk methodrdquoAmerican Journal of Clinical Pathology vol 45 no 4 pp 493ndash496 1966

[13] V Hemalatha U Sekar and V Kamat ldquoDetection of metallobetalactamase producing Pseudomonas aeruginosa in hospital-ized patientsrdquo Indian Journal of Medical Research vol 122 no2 pp 148ndash152 2005

[14] S Irfan A Zafar D Guhar T Ahsan and R Hasan ldquoMetallo-120573-lactamase-producing clinical isolates ofAcinetobacter speciesand Pseudomonas aeruginosa from intensive care unit patientsof a tertiary care hospitalrdquo Indian Journal of Medical Microbiol-ogy vol 26 no 3 pp 243ndash245 2008

[15] A R Lari and R Alaghehbandan ldquoNosocomial infections inan Iranian burn care centerrdquo Burns vol 26 no 8 pp 737ndash7402000

[16] H Hanberger J-A Garcia-Rodriguez M Gobernado HGoossens L E Nilsson and M J Struelens ldquoAntibiotic sus-ceptibility among aerobic gram-negative bacilli in intensive careunits in 5 European countriesrdquo Journal of the American MedicalAssociation vol 281 no 1 pp 67ndash71 1999

[17] U Altoparlak S Erol M N Akcay F Celebi and A KadanalildquoThe time-related changes of antimicrobial resistance patternsand predominant bacterial profiles of burn wounds and bodyflora of burned patientsrdquo Burns vol 30 no 7 pp 660ndash6642004

[18] A Rastegar Lari H Bahrami Honar and R AlaghehbandanldquoPseudomonas infections in Tohid Burn Center Iranrdquo Burnsvol 24 no 7 pp 637ndash641 1998

[19] D Church S Elsayed O Reid B Winston and R LindsayldquoBurn wound infectionsrdquo Clinical Microbiology Reviews vol 19no 2 pp 403ndash434 2006

[20] J D D Pitout G Revathi B L Chow et al ldquoMetallo-120573-lactamase-producing Pseudomonas aeruginosa isolated froma large tertiary centre in Kenyardquo Clinical Microbiology andInfection vol 14 no 8 pp 755ndash759 2008

[21] A Mirsalehian M Feizabadi F A Nakhjavani F JabalameliH Goli and N Kalantari ldquoDetection of VEB-1 OXA-10 andPER-1 genotypes in extended-spectrum120573-lactamase-producingPseudomonas aeruginosa strains isolated from burn patientsrdquoBurns vol 36 no 1 pp 70ndash74 2010

[22] A D Khosravi and F Mihani ldquoDetection of metallo-120573-lactamase-producing Pseudomonas aeruginosa strains isolatedfrom burn patients in Ahwaz Iranrdquo Diagnostic Microbiologyand Infectious Disease vol 60 no 1 pp 125ndash128 2008

[23] J A Griswold ldquoWhite blood cell response to burn injuryrdquoSeminars in Nephrology vol 13 no 4 pp 409ndash415 1993

6 ISRNMicrobiology

[24] H R Yazdi G B Nejad S N Peerayeh and M MostafaeildquoPrevalence and detection of metallo-120573-lactamase (MBL)-producing Pseudomonas aeruginosa strains from clinical iso-lates in Iranrdquo Annals of Microbiology vol 57 no 2 pp 293ndash2962007

[25] F Shahcheraghi V S Nikbin F Shooraj A Bagheri MShafiee and M R Arabestani ldquoPCR detection of VIM-1 VIM-2 and IMP-1 metallo-beta-lactamases in clinically multi-drugresistant P aeruginosa isolated in Tehranrdquo Iranian Journal ofClinical Infectious Diseases vol 12 p 118 2008

[26] S SepehrisereshtM A Boroumand L PourgholiM SotoudehAnvari E Habibi and M Sattarzadeh Tabrizi ldquoDetection ofvim- and ipm-type metallobeta-lactamases in Pseudomonasaeruginosa clinical isolatesrdquo Archives of Iranian Medicine vol15 no 11 pp 670ndash673 2012

[27] H Fazeli Z Moslehi Takantape G H Irajian and M SalehildquoDetermination of antibiotic resistance pattern and identifica-tion of bla-VIM gene in P aeruginosa isolates from ImamMosaKazemBurnsHospital Isfahan Iranrdquo Iranian Journal ofMedicalMicrobiology vol 3 no 4 pp 1ndash8 2009

[28] A Manoharan S Chatterjee and D Mathai ldquoDetection andcharacterization of metallo beta lactamases producing Pseu-domonas aeruginosardquo Indian Journal of Medical Microbiologyvol 28 no 3 pp 241ndash244 2010

[29] O B Ozgumus R Caylan I Tosun C Sandalli K Aydin andI Koksal ldquoMolecular epidemiology of clinical Pseudomonasaeruginosa isolates carrying IMP-1metallo-120573-lactamase gene ina university hospital in TurkeyrdquoMicrobial Drug Resistance vol13 no 3 pp 191ndash198 2007

[30] F Luzzaro A Endimiani J-D Docquier et al ldquoPrevalence andcharacterization of metallo-120573-lactamases in clinical isolates ofPseudomonas aeruginosardquo Diagnostic Microbiology and Infec-tious Disease vol 48 no 2 pp 131ndash135 2004

[31] E-J Oh S Lee Y-J Park et al ldquoPrevalence of metallo-120573-lactamase among Pseudomonas aeruginosa and Acinetobacterbaumannii in a Korean University hospital and comparison ofscreening methods for detecting metallo-120573-lactamaserdquo Journalof Microbiological Methods vol 54 no 3 pp 411ndash418 2003

[32] I-S Kim N Y Lee C-S Ki W S Oh K R Peckand J-H Song ldquoIncreasing prevalence of imipenem-resistantPseudomonas aeruginosa and molecular typing of metallo-120573-lactamase producers in a Korean hospitalrdquo Microbial DrugResistance vol 11 no 4 pp 355ndash359 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

ISRNMicrobiology 5

P aeruginosa strains [7] In themajority of studies in Iran andother countries vim-type MBL was the most prevalent genereported [30ndash32]

5 Conclusion

This study illustrated that the majority of P aeruginosastrains were resistant to various antibiotics The high rateof antibiotic resistanceamong P aeruginosa strains is veryalarming and can be responsible for serious infections Soidentification of MBLs producing strains and taking effortsto reduce the rate of transfer between different strains areimportant goal for treatment of P aeruginosa infections

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank the Microbiology Department staff ofthe studied hospitals and Pasteur Institute of Iran for theirassistance

References

[1] H C Neu ldquoThe role of Pseudomonas aeruginosa in infectionsrdquoJournal of Antimicrobial Chemotherapy vol 11 pp 1ndash13 1983

[2] Y Arakawa N Shibata K Shibayama et al ldquoConvenient testfor screening metallo-120573-lactamase-producing gram- negativebacteria by using thiol compoundsrdquo Journal of Clinical Micro-biology vol 38 no 1 pp 40ndash43 2000

[3] K Senda Y Arakawa S Ichiyama et al ldquoPCR detection ofmetallo-120573-lactamase gene (bla(IMP)) in gram-negative rodsresistant to broad-spectrum 120573-lactamsrdquo Journal of ClinicalMicrobiology vol 34 no 12 pp 2909ndash2913 1996

[4] K Bush G A Jacoby and A A Medeiros ldquoA functionalclassification scheme for 120573-lactamases and its correlation withmolecular structurerdquo Antimicrobial Agents and Chemotherapyvol 39 no 6 pp 1211ndash1233 1995

[5] L Poirel M Magalhaes M Lopes and P Nordmann ldquoMolec-ular analysis of metallo-beta-lactamase gene bla (SPM-1) sur-rounding sequences from disseminated Pseudomonas aerug-inosa isolates in Recife Brazilrdquo Antimicrobial Agents andChemotherapy vol 48 no 4 pp 1406ndash1409 2004

[6] P Nordmann and L Poirel ldquoEmerging carbapenemases inGram-negative aerobesrdquo Clinical Microbiology and Infectionvol 8 no 6 pp 321ndash331 2002

[7] G Cornaglia A Mazzariol L Lauretti G M Rossoliniand R Fontana ldquoHospital outbreak of carbapenem-resistantPseudomonas aeruginosa producingVIM-1 a novel transferablemetallo-120573-lactamaserdquo Clinical Infectious Diseases vol 31 no 5pp 1119ndash1125 2000

[8] J Yatsuyanagi S Saito S Harata et al ldquoClass 1 integron con-taining metallo-120573-lactamase gene bla VIM-2 in Pseudomonasaeruginosa clinical strains isolated in Japanrdquo AntimicrobialAgents and Chemotherapy vol 48 no 2 pp 626ndash628 2004

[9] H Saderi Z Karimi P Owlia A Bahar and S M BAkhavi Rad ldquoPhenotypic detection of metallo-beta-lactamase

producingPseudomonas aeruginosa strain isolated fromburnedpatientsrdquo Iranian Journal of Pathology vol 3 no 1 pp 20ndash242008

[10] J D D Pitout D B Gregson L Poirel J-A McClure P Le andD L Church ldquoDetection ofPseudomonas aeruginosa producingmetallo-120573-lactamases in a large centralized laboratoryrdquo Journalof Clinical Microbiology vol 43 no 7 pp 3129ndash3135 2005

[11] E Mahabir D Bulian S Bensch and J Schmidt ldquoEliminationof P aeruginosa in mice by treatment with chlorine and the useof microbiological and PCR analysesrdquo Scandinavian Journal ofLaboratory Animal Science vol 36 no 4 pp 355ndash361 2009

[12] AW BauerWMKirby J C Sherris andM Turck ldquoAntibioticsusceptibility testing by a standardized single disk methodrdquoAmerican Journal of Clinical Pathology vol 45 no 4 pp 493ndash496 1966

[13] V Hemalatha U Sekar and V Kamat ldquoDetection of metallobetalactamase producing Pseudomonas aeruginosa in hospital-ized patientsrdquo Indian Journal of Medical Research vol 122 no2 pp 148ndash152 2005

[14] S Irfan A Zafar D Guhar T Ahsan and R Hasan ldquoMetallo-120573-lactamase-producing clinical isolates ofAcinetobacter speciesand Pseudomonas aeruginosa from intensive care unit patientsof a tertiary care hospitalrdquo Indian Journal of Medical Microbiol-ogy vol 26 no 3 pp 243ndash245 2008

[15] A R Lari and R Alaghehbandan ldquoNosocomial infections inan Iranian burn care centerrdquo Burns vol 26 no 8 pp 737ndash7402000

[16] H Hanberger J-A Garcia-Rodriguez M Gobernado HGoossens L E Nilsson and M J Struelens ldquoAntibiotic sus-ceptibility among aerobic gram-negative bacilli in intensive careunits in 5 European countriesrdquo Journal of the American MedicalAssociation vol 281 no 1 pp 67ndash71 1999

[17] U Altoparlak S Erol M N Akcay F Celebi and A KadanalildquoThe time-related changes of antimicrobial resistance patternsand predominant bacterial profiles of burn wounds and bodyflora of burned patientsrdquo Burns vol 30 no 7 pp 660ndash6642004

[18] A Rastegar Lari H Bahrami Honar and R AlaghehbandanldquoPseudomonas infections in Tohid Burn Center Iranrdquo Burnsvol 24 no 7 pp 637ndash641 1998

[19] D Church S Elsayed O Reid B Winston and R LindsayldquoBurn wound infectionsrdquo Clinical Microbiology Reviews vol 19no 2 pp 403ndash434 2006

[20] J D D Pitout G Revathi B L Chow et al ldquoMetallo-120573-lactamase-producing Pseudomonas aeruginosa isolated froma large tertiary centre in Kenyardquo Clinical Microbiology andInfection vol 14 no 8 pp 755ndash759 2008

[21] A Mirsalehian M Feizabadi F A Nakhjavani F JabalameliH Goli and N Kalantari ldquoDetection of VEB-1 OXA-10 andPER-1 genotypes in extended-spectrum120573-lactamase-producingPseudomonas aeruginosa strains isolated from burn patientsrdquoBurns vol 36 no 1 pp 70ndash74 2010

[22] A D Khosravi and F Mihani ldquoDetection of metallo-120573-lactamase-producing Pseudomonas aeruginosa strains isolatedfrom burn patients in Ahwaz Iranrdquo Diagnostic Microbiologyand Infectious Disease vol 60 no 1 pp 125ndash128 2008

[23] J A Griswold ldquoWhite blood cell response to burn injuryrdquoSeminars in Nephrology vol 13 no 4 pp 409ndash415 1993

6 ISRNMicrobiology

[24] H R Yazdi G B Nejad S N Peerayeh and M MostafaeildquoPrevalence and detection of metallo-120573-lactamase (MBL)-producing Pseudomonas aeruginosa strains from clinical iso-lates in Iranrdquo Annals of Microbiology vol 57 no 2 pp 293ndash2962007

[25] F Shahcheraghi V S Nikbin F Shooraj A Bagheri MShafiee and M R Arabestani ldquoPCR detection of VIM-1 VIM-2 and IMP-1 metallo-beta-lactamases in clinically multi-drugresistant P aeruginosa isolated in Tehranrdquo Iranian Journal ofClinical Infectious Diseases vol 12 p 118 2008

[26] S SepehrisereshtM A Boroumand L PourgholiM SotoudehAnvari E Habibi and M Sattarzadeh Tabrizi ldquoDetection ofvim- and ipm-type metallobeta-lactamases in Pseudomonasaeruginosa clinical isolatesrdquo Archives of Iranian Medicine vol15 no 11 pp 670ndash673 2012

[27] H Fazeli Z Moslehi Takantape G H Irajian and M SalehildquoDetermination of antibiotic resistance pattern and identifica-tion of bla-VIM gene in P aeruginosa isolates from ImamMosaKazemBurnsHospital Isfahan Iranrdquo Iranian Journal ofMedicalMicrobiology vol 3 no 4 pp 1ndash8 2009

[28] A Manoharan S Chatterjee and D Mathai ldquoDetection andcharacterization of metallo beta lactamases producing Pseu-domonas aeruginosardquo Indian Journal of Medical Microbiologyvol 28 no 3 pp 241ndash244 2010

[29] O B Ozgumus R Caylan I Tosun C Sandalli K Aydin andI Koksal ldquoMolecular epidemiology of clinical Pseudomonasaeruginosa isolates carrying IMP-1metallo-120573-lactamase gene ina university hospital in TurkeyrdquoMicrobial Drug Resistance vol13 no 3 pp 191ndash198 2007

[30] F Luzzaro A Endimiani J-D Docquier et al ldquoPrevalence andcharacterization of metallo-120573-lactamases in clinical isolates ofPseudomonas aeruginosardquo Diagnostic Microbiology and Infec-tious Disease vol 48 no 2 pp 131ndash135 2004

[31] E-J Oh S Lee Y-J Park et al ldquoPrevalence of metallo-120573-lactamase among Pseudomonas aeruginosa and Acinetobacterbaumannii in a Korean University hospital and comparison ofscreening methods for detecting metallo-120573-lactamaserdquo Journalof Microbiological Methods vol 54 no 3 pp 411ndash418 2003

[32] I-S Kim N Y Lee C-S Ki W S Oh K R Peckand J-H Song ldquoIncreasing prevalence of imipenem-resistantPseudomonas aeruginosa and molecular typing of metallo-120573-lactamase producers in a Korean hospitalrdquo Microbial DrugResistance vol 11 no 4 pp 355ndash359 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 ISRNMicrobiology

[24] H R Yazdi G B Nejad S N Peerayeh and M MostafaeildquoPrevalence and detection of metallo-120573-lactamase (MBL)-producing Pseudomonas aeruginosa strains from clinical iso-lates in Iranrdquo Annals of Microbiology vol 57 no 2 pp 293ndash2962007

[25] F Shahcheraghi V S Nikbin F Shooraj A Bagheri MShafiee and M R Arabestani ldquoPCR detection of VIM-1 VIM-2 and IMP-1 metallo-beta-lactamases in clinically multi-drugresistant P aeruginosa isolated in Tehranrdquo Iranian Journal ofClinical Infectious Diseases vol 12 p 118 2008

[26] S SepehrisereshtM A Boroumand L PourgholiM SotoudehAnvari E Habibi and M Sattarzadeh Tabrizi ldquoDetection ofvim- and ipm-type metallobeta-lactamases in Pseudomonasaeruginosa clinical isolatesrdquo Archives of Iranian Medicine vol15 no 11 pp 670ndash673 2012

[27] H Fazeli Z Moslehi Takantape G H Irajian and M SalehildquoDetermination of antibiotic resistance pattern and identifica-tion of bla-VIM gene in P aeruginosa isolates from ImamMosaKazemBurnsHospital Isfahan Iranrdquo Iranian Journal ofMedicalMicrobiology vol 3 no 4 pp 1ndash8 2009

[28] A Manoharan S Chatterjee and D Mathai ldquoDetection andcharacterization of metallo beta lactamases producing Pseu-domonas aeruginosardquo Indian Journal of Medical Microbiologyvol 28 no 3 pp 241ndash244 2010

[29] O B Ozgumus R Caylan I Tosun C Sandalli K Aydin andI Koksal ldquoMolecular epidemiology of clinical Pseudomonasaeruginosa isolates carrying IMP-1metallo-120573-lactamase gene ina university hospital in TurkeyrdquoMicrobial Drug Resistance vol13 no 3 pp 191ndash198 2007

[30] F Luzzaro A Endimiani J-D Docquier et al ldquoPrevalence andcharacterization of metallo-120573-lactamases in clinical isolates ofPseudomonas aeruginosardquo Diagnostic Microbiology and Infec-tious Disease vol 48 no 2 pp 131ndash135 2004

[31] E-J Oh S Lee Y-J Park et al ldquoPrevalence of metallo-120573-lactamase among Pseudomonas aeruginosa and Acinetobacterbaumannii in a Korean University hospital and comparison ofscreening methods for detecting metallo-120573-lactamaserdquo Journalof Microbiological Methods vol 54 no 3 pp 411ndash418 2003

[32] I-S Kim N Y Lee C-S Ki W S Oh K R Peckand J-H Song ldquoIncreasing prevalence of imipenem-resistantPseudomonas aeruginosa and molecular typing of metallo-120573-lactamase producers in a Korean hospitalrdquo Microbial DrugResistance vol 11 no 4 pp 355ndash359 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology