ARTHRITIS & RHEUMATOLOGY

Vol. 67, No. 8, August 2015, pp 2164–2175

DOI 10.1002/art.39154

VC 2015, American College of Rheumatology

Repeated Exposure to High-Frequency Low-AmplitudeVibration Induces Degeneration of Murine

Intervertebral Discs and Knee Joints

Matthew R. McCann,1 Priya Patel,1 Michael A. Pest,1 Anusha Ratneswaran,1

Gurkeet Lalli,1 Kim L. Beaucage,1 Garth B. Backler,1 Meg P. Kamphuis,1

Ziana Esmail,1 Jimin Lee,1 Michael Barbalinardo,1 John S. Mort,2

David W. Holdsworth,3 Frank Beier,1 S. Jeffrey Dixon,1 and Cheryle A. S!eguin1

Objective. High-frequency, low-amplitude whole-body vibration (WBV) is being used to treat a range ofmusculoskeletal disorders; however, there is surprisinglylimited knowledge regarding its effect(s) on joint tissues.This study was undertaken to examine the effects ofrepeated exposure to WBV on bone and joint tissues inan in vivo mouse model.

Methods. Ten-week-old male mice were exposedto vertical sinusoidal vibration under conditions thatmimic those used clinically in humans (30 minutes perday, 5 days per week, at 45 Hz with peak acceleration at0.3g). Following WBV, skeletal tissues were examinedby micro–computed tomography, histologic analysis,and immunohistochemistry, and gene expression wasquantified using real-time polymerase chain reaction.

Results. Following 4 weeks of WBV, intervertebraldiscs showed histologic hallmarks of degeneration in theannulus fibrosus, disruption of collagen organization,and increased cell death. Greater Mmp3 expression inthe intervertebral disc, accompanied by enhanced colla-gen and aggrecan degradation, was found in miceexposed to WBV as compared to controls. Examinationof the knee joints after 4 weeks of WBV revealed menis-cal tears and focal damage to the articular cartilage,changes resembling osteoarthritis. Moreover, miceexposed to WBV also demonstrated greater Mmp13 geneexpression and enhanced matrix metalloproteinase–mediated collagen and aggrecan degradation in articu-lar cartilage as compared to controls. No changes intrabecular bone microarchitecture or density weredetected in the proximal tibia.

Conclusion. Our experiments reveal significantnegative effects of WBV on joint tissues in a mouse model.These findings suggest the need for future studies of theeffects of WBV on joint health in humans.

Whole-body vibration (WBV) platforms, designedto deliver low-amplitude, high-frequency mechanicalstimulation in the form of sinusoidal vibrations, haveemerged as a popular trend in the fitness industry.Within the last decade, the use of WBV as a clinical

Supported by the Natural Sciences and Engineering ResearchCouncil of Canada (grant 371546) and the Canadian Institutes of HealthResearch (CIHR grants 132377, 312615, and 86574). Infrastructure sup-port was provided in part by the Canada Foundation for Innovation–Leaders Opportunity Fund (grant 25086 to Dr. S!eguin). Dr. McCann andMr. Pest’s work was supported by CIHR Doctoral Awards and the CIHRJoint Motion Program. Ms Patel’s work was supported by a CIHR Insti-tute of Musculoskeletal Health and Arthritis Undergraduate ResearchAward. Ms Ratneswaran and Dr. Beaucage’s work was supported in partby the CIHR Joint Motion Program; Ms Ratneswaran’s work was alsosupported by an Arthritis Society Doctoral Award. Ms Esmail andMr. Barbalinardo’s work was supported by the Schulich Dentistry StudentResearch Program. Ms Lee’s work was supported by a National Sciencesand Engineering Research Council of Canada Undergraduate ResearchAward. Dr. Beier holds the Canada Research Chair in MusculoskeletalResearch at the University of Western Ontario. Dr. S!eguin’s work wassupported by an Arthritis Society/Canadian Arthritis Network ScholarAward and a CIHR New Investigator Award.

1Matthew R. McCann, PhD, Priya Patel, MSc, Michael A. Pest,BMSc, Anusha Ratneswaran, BSc (Hons), Gurkeet Lalli, BSc, Kim L.Beaucage, PhD, Garth B. Backler, BAT, Meg P. Kamphuis, ZianaEsmail, BSc, Jimin Lee, BSc, Michael Barbalinardo, BSc (Hons), FrankBeier, PhD, S. Jeffrey Dixon, DDS, PhD, Cheryle A. S!eguin, PhD: Uni-versity of Western Ontario, Schulich School of Medicine and Dentistry,London, Ontario, Canada; 2John S. Mort, PhD: Shriners Hospital forChildren and McGill University, Montreal, Quebec, Canada; 3David W.Holdsworth, PhD: Robarts Research Institute and University of WesternOntario, Schulich School of Medicine and Dentistry, London, Ontario,Canada.

Address correspondence to Cheryle A. S!eguin, PhD, Depart-ment of Physiology and Pharmacology, Schulich School of Medicineand Dentistry, DSB0034, University of Western Ontario, London,Ontario N6A 5C1, Canada. E-mail: cheryle.seguin@schulich.uwo.ca.

Submitted for publication October 16, 2014; accepted inrevised form April 7, 2015.

2164

therapy for musculoskeletal disorders has expanded fromits original use as an adjunctive therapy for osteoporosis(1,2) and is now being used to treat a wide range of con-ditions including stroke (3), spinal cord injury (4), andmultiple sclerosis (5). Furthermore, WBV was investi-gated in clinical trials as an adjunctive or stand-alonetherapy for nonspecific back pain (6) and osteoarthritis(7). A recent review of WBV as a treatment for backpain raised concerns based on the authors’ view that inte-gration of WBV into clinical practice has not beenfounded on rigorous research-based evidence of efficacyand safety (8). In fact, the widespread use of WBV in thefitness industry, as well as the marketing of these devicesfor home gyms, has raised concern within the scientificcommunity (9). WBV was implemented in the clinicalsetting as a therapy for osteoporosis based on reports ofbone-strengthening effects in postmenopausal women(1,2). Within the last 10 years, the use of mouse modelsto investigate the biologic effects of WBV has been vali-dated in numerous studies, and recent studies have dem-onstrated that WBV induces local effects in bone thatdiffer based on the anatomic site (e.g., tibia, femur, orvertebrae) (10).

Of concern is the fact that the effects of WBV onjoint tissues have not been thoroughly evaluated. Vibra-tion of the intervertebral disc (IVD) poses an intriguingdichotomy. At amplitudes and frequencies associatedwith operation of heavy machinery, vibration is an estab-lished risk factor for back pain (11,12); however, WBVplatforms are being used to treat back pain (13–15). Inclinical trials, WBV (30 Hz for 10 minutes per day)reduced the incidence of self-reported back pain follow-ing prolonged bed rest (although conflicting resultswere provided regarding measurable changes in discmorphology) (16,17). In a rat model of hind-limb un-loading, WBV (45 Hz at 0.3g for 15 minutes per day)did not alter the biochemistry or morphology of theIVD but did enhance muscle volume (18); however,changes in the morphology of the IVD resulting fromhind-limb unloading were ameliorated when the frequencyof vibration was increased to 90 Hz (19). Interestingly, arecent study demonstrated increased neurotrophins in cer-vical IVDs following exposure of rats to WBV (15 Hz for30 minutes per day) (20).

Similarly, few studies have directly assessed theeffects of WBV on synovial joints. Patient-reported painin osteoarthritis was shown to decrease following WBV(7,21); however, these studies did not directly assessjoint health. One report described the ability of WBV toprevent loss of cartilage thickness resulting from pro-longed immobilization, in healthy male human subjects

(22). The overall lack of research demonstrates theurgent need to investigate the specific effects of WBVon joint tissues, given the increasing use of vibrationplatforms in both clinical practice and the fitnessindustry.

Our recent study using mouse models demon-strated anabolic effects of a single exposure to WBV onthe IVD (23). Therefore, we sought to determinewhether the transient changes previously reportedwould result in long-term beneficial effects on jointhealth. The current study was designed to assess theeffects of repeated exposure of mice to WBV, using pro-tocols that mirror vibration training in humans. Weexamined the effects of WBV on multiple skeletal tis-sues, including IVDs, knees, and long bones. Our find-ings provide evidence of deleterious responses of jointtissues to WBV in mice, highlighting the critical need todetermine the safety of WBV for joint health in humans.

MATERIALS AND METHODS

In vivo vibration. All procedures were approved bythe Council on Animal Care at The University of WesternOntario, in accordance with the guidelines of the CanadianCouncil on Animal Care. Based on parameters of WBV used inclinical protocols, 10-week-old male CD-1 mice were subjectedto vertical sinusoidal vibration at a frequency of 45 Hz, with apeak-to-peak amplitude of 74 mm, and peak acceleration at 0.3gfor 30 minutes per day, 5 days per week, for 2 or 4 weeks, usinga previously described vibration platform (23). Age-matchedcontrols were housed in identical chambers on a sham (nonvi-brated) platform to replicate handling and environmental condi-tions. Following WBV, mice were returned to conventionalhousing and monitored daily. At specified time points, micewere euthanized with a dose of sodium pentobarbital.

Tissue harvest and RNA extraction. Twenty-fourhours after the final exposure to WBV, thoracic IVDs (T10–T15)from each mouse were isolated by microdissection. Articular car-tilage was isolated from the tibial plateau and femoral condyles(1 knee per mouse). One femur per mouse was isolated andflushed with sterile phosphate buffered saline (PBS) to removebone marrow. Tissues were immediately placed in TRIzol rea-gent (Life Technologies) and homogenized using a PRO250tissue homogenizer (PRO Scientific). RNA was extractedaccording to the manufacturer’s instructions, quantified using aNanoDrop 2000 spectrophotometer (Thermo Scientific), and0.5 mg was reverse transcribed into complementary DNA(cDNA) (iScript; Bio-Rad).

Real-time quantitative polymerase chain reaction(qPCR). Gene expression was assessed by real-time PCR usinga Bio-Rad CFX384. PCR analyses were run in triplicate, using120 ng of cDNA per reaction and 310 nM forward and reverseprimers with 23 SsoFast EvaGreen Supermix (Bio-Rad). ThePCR parameters consisted of an initial 2 minutes of denaturingat 958C, followed by 40 cycles of 10 seconds of denaturingat 958C and 10 seconds of annealing/elongation (for informa-tion on primer sequences and temperatures, see Supplementary

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2165

Table 1, available on the Arthritis & Rheumatology web site athttp://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract).Transcript levels were calculated using the DDCt method,and data were normalized for input based on hypoxanthineguanine phosphoribosyltransferase (Hprt) (24) and expressedrelative to controls not exposed to vibration.

Histologic analysis. Intact lumbar spinal segments(L1–L5) and right knees (with joint capsule intact) were iso-lated and fixed in 4% paraformaldehyde. Spinal columns weredecalcified for 5 days in Shandon’s TBD-2 (Fisher Scientific),and knee joints were decalcified for 10 days in 5% EDTA inPBS (pH 7.0). Tissues were processed and embedded in paraf-fin. Spines were sectioned sagittally and knees were sectionedcoronally, at a thickness of 5 mm, using a microtome (LeicaMicrosystems). Following established protocols (23,25), serialsections were stained with either 0.1% Safranin O–0.02% fastgreen for sulfated glycosaminoglycans or 1.3% picric acid and0.1% Direct Red 80 (Sigma) for collagen. Sections were im-aged on a Leica DM1000 microscope (equipped with a polar-izing filter [no. 11505087] and analyzer [no. 11555045]), withLeica Application Suite. Safranin O–fast green–stained sec-tions were evaluated according to the modified Thompsongrading scheme (26), a 5-category grading scale originally usedto assess the gross morphologic changes in sections of cadav-eric lumbar spine segments. Each tissue within the IVD wasscored independently, based on changes in morphologic fea-tures. Intraobserver and interobserver agreement values in theinitial Thompson grading scheme were .85%, and these levelswere maintained when the scheme was applied across species(27). This grading scale has been used previously by our groupto evaluate histologic changes in mice (28).

Immunohistochemistry. Antigen retrieval was per-formed with 0.1% Triton X-100 in PBS for 20 minutes at roomtemperature, and tissue sections were blocked with 5% goatserum/5% bovine serum albumin for 1 hour at room tempera-ture. Tissue sections were incubated overnight at 4!C withrabbit primary antibodies against the products of ADAMTS-mediated aggrecan cleavage (NITEGE), matrix metalloprotei-nase (MMP)–mediated aggrecan cleavage (DIPEN) (29), orMMP-mediated collagen cleavage (C1,2C) (30). Goat anti-rabbit secondary antibody conjugated to horseradish peroxi-dase (Santa Cruz Biotechnology) was used in conjunction withdiaminobenzidine-positive chromogen (Dako Canada) for col-orimetric detection of antibody binding. Incubation with sec-ondary antibodies only (as controls) was performed in parallel.Sections were counterstained using 0.5% methyl green andimaged on a Leica DM1000 microscope.

Cell death assay. Spinal sections were assessed for insitu cell death using a TUNEL staining kit according to theinstructions of the manufacturer (Roche). Sections weremounted using Vectashield medium containing DAPI (Vec-tor) and imaged with a Leica DMI 6000B inverted microscopeusing Leica Application Suite. Images were scored by 2 inde-pendent blinded observers, and TUNEL-positive cells werecounted within each IVD compartment (nucleus pulposus[NP] and annulus fibrosus [AF]) and expressed as a percent-age of the total cells. Pretreatment with DNase I (Roche) wasperformed as a positive control, and labeling solution wasomitted as a negative control.

Micro–computed tomography (micro-CT). Right hindlimbs (midfemur to ankle, with knee joint capsule intact) wereisolated and fixed in 4% paraformaldehyde. To avoid motion

during scanning, specimens were fixed in 50-ml tubes contain-ing 1% agarose in PBS. Individual tubes were mounted ontothe bed of a GE eXplore Locus micro-CT scanner (GEHealthcare Biosciences) with a calibrating phantom composedof air, water, and synthetic bone-mimicking epoxy having abone mineral equivalent of 1.1 gm/cm3 (SB3; Gammex RMI).The scanning protocol included 900 projection images at a 0.48angle increment, obtained over 165 minutes of gantry rotation.The x-ray tube potential was 80 kVp with a tube currentof 450 mA, an exposure time of 4,500 msec, and 2 framesper view angle averaged. Images were reconstructed into 3-dimensional volumes with an isotropic voxel size of 20 mmand linearly rescaled into Hounsfield units using internal cali-bration standards.

Using MicroView (GE Healthcare Biosciences), fullvolumes were cropped to contain only the tibia and fibula, andreoriented to the same axes. To determine trabecular bonemorphometry, a standardized region of interest (ROI) wasselected in the proximal tibia using the largest dimensions pos-sible to capture trabecular bone and to exclude cortical bonein all scans. The ROI was an elliptic cylinder (41 pixels [x-axis]3 42 pixels [y-axis] 3 48 pixels [z-axis]) positioned 50 mm dis-tal to the growth plate, to measure the secondary spongiosa.Bone morphometry was quantified using the Bone Analysistool in MicroView, as previously described (31).

Statistical analysis. Data are from experiments con-ducted in 2 independent trials (n 5 4–6 mice per treatmentgroup). Findings in mice exposed to WBV (at each time point)were compared to those in controls not exposed to vibrationusing a parametric, unpaired 2-tailed t-test with Welch’s cor-rection. P values less than 0.05 were considered significant.

RESULTS

To examine the effects of repeated exposure toWBV on joint tissues, 10-week-old wild-type mice wereexposed to vertical sinusoidal WBV for 2 or 4 weeks.Conditions were based on current clinical and exerciseprotocols (30 minutes per day, 5 days per week, at 45 Hzwith peak acceleration at 0.3g). Skeletal tissues, includ-ing a synovial joint (knee), cartilaginous joints (IVDs),and bones (tibia and femur) were assessed and com-pared to those of age-matched control mice.

We first assessed lumbar IVD health. No discern-ible differences were found in the IVD following 2weeks of WBV. However, in mice exposed to WBV for 4weeks, Safranin O–fast green staining revealed the fol-lowing (compared to controls not exposed to WBV): 1)loss of a distinct NP and AF boundary, 2) the accumula-tion of mucinous material leading to enhanced glycos-aminoglycan staining in the interlamellar matrix of theAF, and 3) focal disruptions in the AF lamellae (Figure1A). Evaluation of the histologic appearance using themodified Thompson scoring system (26) indicated signif-icant degenerative changes in the AF of mice exposed toWBV as compared to controls not exposed to vibration(Figure 1B). Collagen organization within the AF was

2166 McCANN ET AL

examined using picrosirius red staining and brightfieldmicroscopy; no discernible differences in either the NPor the AF were observed between mice exposed to 4weeks of WBV and controls (Figure 1C). However,examination of sections using polarized light microscopyrevealed disrupted collagen organization, with breakswithin the collagen lamellae in the inner AF and widen-ing of the interlamellar spaces in the AF of mice exposedto WBV; these changes were not observed in controls(Figure 1D). Interestingly, similar degenerative changesinduced by WBV in lumbar IVDs were also detectedin the caudal spine (see Supplementary Figure 1, avail-able on the Arthritis & Rheumatology web site at http://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract).

To investigate the cellular response to repeatedexposure to WBV, we performed real-time PCR onwhole-disc RNA (Figure 1E). IVD tissues from miceexposed to WBV demonstrated a significant increase inthe expression of Sox9 as compared to controls (a 1.4-foldincrease at 2 weeks and a 1.6-fold increase at 4 weeks).This was accompanied by increased expression of Acan(a 1.5-fold increase at 2 weeks and a 1.8-fold increase at 4weeks), and a 2.0-fold increase in Col1a1 expression after2 weeks of WBV. In contrast, no significant change inCol2a1 expression was detected at either time point fol-lowing WBV.

We further investigated WBV-induced disc de-generation by examining the accumulation of matrix

Figure 1. Negative effects of repeated exposure to whole-body vibration (WBV) on the lumbar intervertebral disc (IVD). A, Representative SafraninO–fast green–stained sections of the lumbar spine from mice exposed to WBV (30 minutes per day, 5 days per week, for 4 weeks at 45 Hz and 0.3g)and control mice not exposed to vibration (sham). Images are oriented with the rostral portion of the lumbar spine on top and the dorsal portion onthe right. B, Histologic scores on the modified Thompson grading scale. Evaluation of the morphologic grade of tissue degeneration demonstrated a sig-nificant increase in tissue degeneration in the annulus fibrosus (AF) of mice subjected to WBV. Data are representative of 3 IVDs per mouse(n 5 5 mice per group). * 5 P , 0.05 versus controls. C, Picrosirius red staining of a representative IVD. D, Disc tissue in C visualized withbrightfield microscopy. Disrupted collagen organization (arrows) and widening of the interlamellar spaces between lamella in the AF wereapparent in mice exposed to WBV for 4 weeks. E, SYBR Green–based real-time polymerase chain reaction analysis of IVD gene expression.Expression of anabolic genes at each time point was determined relative to the expression of the housekeeping gene Hprt and normalized tothat in controls. Bars show the mean 6 SEM of 5 pooled IVDs per mouse (n 5 4–5 mice per group), with polymerase chain reaction run intriplicate. * 5 P , 0.05; ** 5 P , 0.01 versus controls.

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2167

degradation fragments. Exposure to WBV for 4 weeksappeared to increase MMP-mediated aggrecan cleavagein the outer AF (immunohistochemical staining forDIPEN appeared more intense compared to controls)(Figure 2A). In contrast, no changes in aggrecanaseactivity were detected following exposure of mice toWBV, as indicated by the intensity of NITEGE staining(Figure 2B). We next labeled C1,2C neoepitopes, whichresult from type I and/or type II collagen cleavage by

MMPs (30). Similar to the results for aggrecan, wedetected greater intensity of the MMP-mediated colla-gen cleavage products in the outer AF of mice exposedto WBV compared to controls (Figure 2C). No differen-ces between mice exposed to WBV and controls weredetected in the intensity of staining in either the innerAF or NP. Increased matrix cleavage in mice exposed toWBV was accompanied by a significant increase in theexpression of Mmp3 (a 1.5-fold increase at 2 weeks anda 2.1-fold increase at 4 weeks compared to controls)(Figure 2D). In contrast, exposure of mice to WBV didnot alter the expression of Mmp13, Adamts4, orAdamts5 in IVD tissues compared to controls notexposed to WBV.

To determine if WBV altered cell viability in theIVD, TUNEL staining was performed on lumbar IVDsfollowing 4 weeks of WBV. Mice exposed to WBV dem-onstrated a greater percentage of TUNEL-positive cellsin the NP and, to a greater extent, in the AF comparedto controls (Figures 3A and B).

We next sought to determine whether the deleteri-ous changes detected within the IVD also occurred withina synovial joint such as the knee. Histologic examinationrevealed tears in the medial meniscus of mice exposed to2 weeks of WBV (3 of 4 mice) (Figure 4A), changes thatwere not detected in the controls. Alterations in the artic-ular cartilage were not detected following 2 weeks ofexposure to WBV. However, signs of early osteophyteformation were observed on the medial tibial plateau of 1mouse (Figure 4A) (the same mouse demonstrating themost severe meniscal damage at this time point).

Assessment of knee joint tissues after 4 weeks ofWBV revealed meniscal tears in 4 of the 5 mice exposedto WBV (Figure 4A); these changes were not detectedin controls. The extent of meniscal damage was greaterin mice exposed to 4 weeks of WBV than that in miceexposed to 2 weeks of WBV, and was likewise accompa-nied by osteophyte formation in 1 mouse (Figure 4A).Extensive articular cartilage damage was observed in 2of the 5 mice exposed to 4 weeks of WBV, with loss ofthe superficial zone cartilage extending to the calcifiedcartilage zone of both the tibial and femoral heads (Fig-ure 4A). Notably, focal damage to the articular surfacewas limited to the medial joint compartment; no defectswere detected in the articular cartilage of the lateraljoint compartment (see Supplementary Figure 2, avail-able on the Arthritis & Rheumatology web site at http://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract).No apparent changes in the organization of collagenfibres in either the meniscus or the articular cartilagewere detected in the medial joint following WBV (seeSupplementary Figure 3).

Figure 2. Matrix degradation in mouse intervertebral discs (IVDs)following whole-body vibration (WBV). A–C, Representative sagit-tal sections of IVDs from mice exposed to 4 weeks of WBV andcontrol mice not exposed to vibration (sham), stained for DIPEN(matrix metalloproteinase [MMP]–cleaved aggrecan neoepitope)(A), NITEGE (ADAMTS-4/5–cleaved aggrecan neoepitope) (B), orC1,2C (MMP-cleaved collagen neoepitope) (C) and counterstainedwith methyl green. Arrows indicate areas of positive neoepitopestaining. D, SYBR Green–based real-time polymerase chain reac-tion analysis of IVD gene expression. Expression of catabolic genesat each time point was determined relative to the expression of thehousekeeping gene Hprt and normalized to that in controls. Barsshow the mean 6 SEM of 5 pooled IVDs per mouse (n5 4–5 mice pergroup), with polymerase chain reaction run in triplicate. * 5 P , 0.05 versuscontrols.

2168 McCANN ET AL

To investigate the cellular response of articularchondrocytes to 2 weeks or 4 weeks of exposure toWBV, real-time gene expression analysis was per-formed (Figure 4B). While no significant changes weredetected following 2 weeks of WBV, significant induc-

tion of both Sox9 and Col2a1 gene expression wasdetected in articular chondrocytes following exposureto 4 weeks of WBV (a 2.1-fold and 1.9-fold increase,respectively). No significant change in the expressionof Acan was detected.

Figure 3. TUNEL staining of intervertebral discs (IVDs) after repeated exposure to whole-body vibration (WBV). A, Representative sections oflumbar IVDs stained with TUNEL to detect DNA fragmentation and counterstained with DAPI. Arrows indicate TUNEL-positive cells. B, Per-centage of TUNEL-positive cells in the nucleus pulposus (NP) and annulus fibrosus (AF) within the IVD. Mice exposed to WBV demonstrateda significant increase in cell death within the IVD (specifically within the NP and AF) when compared to control mice not exposed to WBV(sham). Bars show the mean 6 SEM of 3 IVDs per mouse (n 5 4–5 mice per group). * 5 P , 0.05; *** 5 P , 0.001 versus controls.

Figure 4. Histologic sections of mouse medial knee joints after exposure to whole-body vibration (WBV). A, Coronal sections of knee jointsfrom 1 control mouse not exposed to WBV (sham) and 2 mice exposed to WBV for 2 weeks or 4 weeks. Sections were stained with Safranin O–fast green to detect sulfated glycosaminoglycans. Images are oriented with the medial meniscus on the left, the femoral condyle on top, and thetibial plateau on the bottom. Arrows indicate microfissures (detected within the medial meniscus in 3 of 4 mice exposed to WBV for 2 weeksand 4 of 5 mice exposed to WBV for 4 weeks). No meniscal damage was detected in control mice not exposed to WBV. Arrowheads indicatesevere degeneration of the articular cartilage on the medial quadrants of both the tibia and the femur. Focal defects in the articular cartilagewere detected in 2 of the 5 mice subjected to WBV. No articular cartilage degeneration was detected in the controls. Asterisks indicate osteo-phytes. B, SYBR Green–based real-time polymerase chain reaction analysis of articular cartilage gene expression. Expression of anabolic genesat each time point was determined relative to the expression of the housekeeping gene Hprt and normalized to that in controls. Bars show themean 6 SEM of 4–5 mice per group, with experiments run in triplicate. * 5 P , 0.05; ** 5 P , 0.01 versus controls.

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2169

To assess articular cartilage breakdown, we per-formed neoepitope staining to detect matrix breakdownfragments within the joint compartment. In contrast to con-trols not exposed to WBV, diffuse extracellular DIPEN

staining was detected in superficial articular cartilage fibril-lations on the tibial plateau as well as in the meniscus ofWBV-exposed mice (Figure 5A). DIPEN staining asso-ciated with the chondrocytes of the calcified cartilageappeared more intense in mice exposed to 4 weeks ofWBV compared to controls (Figure 5A). Due to the lossof the superficial articular cartilage in the medial jointcompartment following 4 weeks of WBV, we examinedthe lateral joint compartments for matrix degradation.Pericellular DIPEN staining was detected more uni-formly throughout the meniscus in mice exposed toWBV than in controls (see Supplementary Figure 4,available on the Arthritis & Rheumatology web site athttp://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract).Furthermore, pericellular DIPEN staining appearedmore intense within the superficial zone of the tibial andfemoral articular cartilage in mice following 4 weeks ofWBV than in controls (see Supplementary Figure 4A). Incontrast, no overt change in NITEGE staining wasdetected in the articular cartilage of either the medial orlateral knee joint compartments (Figure 5B and Supple-mentary Figure 4B, available on the Arthritis & Rheuma-tology web site at http://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract). Pericellular NITEGE stainingappeared more intense in the meniscus within the lat-eral joint compartment of mice exposed to WBV thanin controls (see Supplementary Figure 4B).

The presence of collagen breakdown fragmentswas likewise assessed following 4 weeks of WBV.Greater diffuse C1,2C neoepitope staining was detectedin the fibrillated articular cartilage of the tibial plateauand the meniscus of mice exposed to WBV compared tocontrols (Figure 5C). The lateral joint compartments ofthe same mice demonstrated a similar increase in C1,2Cstaining in the extracellular matrix of the meniscus, aswell as an increase in pericellular staining throughoutthe superficial zone of the articular cartilage (see Sup-plementary Figure 4C, available on the Arthritis &Rheumatology web site at http://onlinelibrary.wiley.com/doi/10.1002/art.39154/abstract). Real-time gene expres-sion analysis of articular cartilage RNA demonstrated nosignificant changes in Mmp3 expression; however, expo-sure to 4 weeks of WBV induced a significant increase inMmp13 expression (1.5-fold increase compared to con-trols) (Figure 5D). Similar to the IVD, no change wasdetected in expression of Adamts4 or Adamts5 in articu-lar cartilage following exposure of mice to WBV.

We used high-resolution micro-CT to determinewhether exposure to 4 weeks of WBV altered bonemicroarchitecture in mice. Volumetric analysis was con-ducted within an ROI localized to the secondary spon-giosa of the tibia (Figures 6A and B). No significant

Figure 5. Matrix degradation in mouse medial knee joint compart-ments following whole-body vibration (WBV). A–C, Representativesections of medial knee joints from mice exposed to 4 weeks ofWBV and control mice not exposed to WBV (sham), stained forDIPEN (matrix metalloproteinase [MMP]–cleaved aggrecan neoepi-tope) (A), NITEGE (ADAMTS-cleaved aggrecan neoepitope) (B),or C1,2C (MMP-cleaved collagen neoepitope) (C) and counter-stained with methyl green. Arrows indicate increased staining in thearticular cartilage of the tibial plateau and the meniscus. Arrowheadsindicate increased staining of chondrocytes in calcified cartilage. D,SYBR Green–based real-time polymerase chain reaction analysis ofarticular cartilage gene expression. Expression of catabolic genes ateach time point was determined relative to the expression of thehousekeeping gene Hprt and normalized to that in controls. Barsshow the mean 6 SEM (n 5 4–5 mice per group), with polymerasechain reaction run in triplicate. * 5 P , 0.05 versus controls.

2170 McCANN ET AL

differences in bone mineral density, bone mineral con-tent, bone volume fraction, trabecular thickness, trabec-ular number, or trabecular separation were observedbetween mice exposed to 4 weeks of WBV and controls(Figure 6C). To investigate cellular responses withinbone to WBV, we performed real-time PCR on RNAisolated from the femur. After 2 weeks of exposure toWBV, significantly greater expression of Dmp1 (2.5-fold) and Ibsp (2.0-fold) was detected compared to con-trols (Figure 6D). Similarly, exposure of mice to WBVincreased the expression of Wnt10b (1.9-fold comparedto controls), which encodes a secreted signaling mole-cule implicated as an effector of bone mechanotrans-duction (32). No significant change in expression of theosteoclast receptor Rank was detected following expo-sure to WBV.

DISCUSSION

WBV has recently been incorporated as an ad-juvant or stand-alone treatment for a wide range ofdiseases, including stroke and chronic obstructive pul-monary disease. Notably, it is used to treat musculoskel-etal disorders including osteoporosis (2), back pain (13),and osteoarthritis (7). However, conflicting resultsregarding the ability of WBV to alter bone mineral den-sity or trabecular bone structure, both in mouse modelsand in clinical studies, have recently been reported(24,33). Further confounding their interpretation, manyclinical studies of WBV are based on patient-reportedpain and not quantitative assessment of tissue health(7,13). Surprisingly, to our knowledge, no studies have ex-amined the cellular changes in joint soft tissues following

Figure 6. Analysis of bone microarchitecture and gene expression following whole-body vibration (WBV). A, Representative coronal micro–computed tomography (micro-CT) images of the proximal tibia. Hind limbs from mice after 4 weeks of exposure to WBV and control mice notexposed to WBV (sham) were isolated postmortem and prepared for micro-CT scanning at an isotropic voxel size of 20 mm. A standardizedregion of interest (ROI; indicated in yellow) was selected in the proximal tibia to assess trabecular bone and exclude cortical bone. The ROIwas an elliptic cylinder (41 pixels [x-axis] 3 42 pixels [y-axis] 3 48 pixels [z-axis]) positioned 50 mm distal to the growth plate to measure the sec-ondary spongiosa. B, Isosurface image of the ROI shown in A. C, Bone mineral content (BMC), bone mineral density (BMD), bone volume frac-tion (BVF), trabecular thickness (trabecular Th), trabecular number, and trabecular spacing (trabecular Sp) in controls and mice exposed to 4weeks of WBV. Bars show the mean 6 SEM (n 5 4–6 mice per group). No significant differences were observed in bone density, mineral con-tent, or microarchitectural parameters. D, SYBR Green–based real-time polymerase chain reaction analysis of gene expression of the femur incontrols not exposed to WBV and mice exposed to WBV. Gene expression at each time point was determined relative to the expression of thehousekeeping gene Hprt and normalized to that in controls. Bars show the mean 6 SEM (n 5 6 mice per group), with polymerase chain reac-tion run in triplicate. * = P , 0.05 versus controls.

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2171

exposure to WBV, in either animal models or humans. Assuch, the present study was designed to examine theeffects of repeated exposure to WBV on musculoskeletaltissues (including the IVD and knee joints) using an invivo mouse model.

The parameters of WBV used in the currentstudy were chosen to introduce specific values of peakacceleration and frequency. The combination of acceler-ation and frequency uniquely determines the amplitudeof the platform displacement. These parameters werechosen because they are comparable to those used inhuman studies and in order to expose individual cells(the functional units responding to vibration) to similarmechanical stimuli. Importantly, the parameters ofWBV used in the present study (45 Hz, peak-to-peakamplitude of 74 mm, and 0.3g peak acceleration) wereselected based on previous studies that demonstratedbeneficial effects of WBV on muscle and bone (34). Itshould be noted that there is currently no consensus asto the relative importance of specific parameters ofWBV (e.g., amplitude, frequency, or acceleration) withregard to their influence on bone adaptation, as evi-denced by recent reports of apparently contradictoryresults (35). Interestingly, previous clinical studies thatdemonstrated beneficial effects of WBV on hip bonemineral density (36) used similar frequencies, but accel-eration values that were an order of magnitude greaterthan was experienced by mice in the current study.Thus, it is possible that our findings may underestimatethe potential for joint damage in humans if exposed toeven greater accelerations during WBV therapy.

Our previous work used ex vivo and in vitromouse models to examine the acute response of IVDtissues to WBV. These studies established that a singleexposure to WBV resulted in a transient decrease in theexpression of catabolic genes (Adamts4, Adamts5, andMmp3) and an increase in the expression of anabolicgenes (Acan, Bgn, Dcn, Col1a1, and Col2a1), with signif-icant increases in matrix proteins detected in the IVD 6hours after exposure to vibration (23). Therefore, wesought to establish if repeated exposure to WBV wouldresult in beneficial effects on the IVD and cartilaginoustissues of the knee joint.

To our surprise, the current study demonstratedthat 4-week exposure to WBV leads to degeneration ofthe IVD in mice, with changes detected predominantlyin the AF. A recent study demonstrated that exposureof excised annular lamellae to vibration resulted in alter-ations in the deformation magnitude of the tissue, whichthe authors postulate was caused by damage to theintralamellar matrix (37). Our findings are consistentwith the characterized effects of dynamic compressive

loading on the IVD. Although structural changes werereported to occur predominantly in the NP, in vivodynamic compression was shown to increase aggrecanexpression and apoptosis in the inner AF (changes asso-ciated with the progression of degeneration) (38,39).Interestingly, these studies demonstrated differentialeffects of dynamic compression on specific tissue com-partments in the IVD; these effects varied with thestress and frequency of loading (38). Further studies areneeded to determine if the response of NP and AF cellsto WBV may also be modulated by the parameters ofthe vibrational stimulus.

In the present study, changes in the histologicappearance of the IVD induced by WBV were accom-panied by increased MMP activity, as evidenced bythe accumulation of matrix degradation fragments andincreased expression of Mmp3. Interestingly, single-nucleotide polymorphism(s) of the MMP3 locus that resultin increased MMP3 expression are associated with degen-erative lumbar spinal stenosis (40), correlate with the radi-ographic progression of lumbar disc degeneration (40),and confer an increased risk of disc degeneration followingoccupational exposure to vibration (41). Our previouswork demonstrated no change in Adamts4/5 expressionyet a transient decrease in Mmp3 expression in the IVDafter acute exposure to WBV (23), consistent with datashowing a similar decrease in MMP3 expression by AFcells following acute exposure to cyclic tensile strain (42).Taken together, these findings suggest that MMPs areregulated by mechanosensitive pathways in IVD tissuesdependent upon parameters of mechanical stimulationsuch as the cumulative exposure to the applied load.

In the knee, we detected meniscal damage andfocal articular cartilage erosion in the medial joint com-partment (damage that resembles osteoarthritis) after 4weeks of WBV. These results were surprising given theyoung age of the mice, since spontaneous osteoarthritishas been reported to present at 17–20 months of age inmice (43). We noted increased MMP-mediated extracel-lular matrix degradation within the joint tissues following4 weeks of WBV, accompanied by increased Mmp13expression. We also noted increased Col2a1 expression inthe articular cartilage after 4 weeks of WBV, a changethat has been associated with the osteoarthritis phenotypein vivo (44). Although SOX9 expression in cartilage is typ-ically down-regulated during late-stage osteoarthritis (44),mechanical loading has been shown to induce both SOX9and type II collagen in cells of the meniscus (45). Theseincreases in Sox9 and Col2a1 expression may representcellular attempts to maintain cartilage integrity that areultimately unsuccessful because of the overwhelminginduction of catabolic factors.

2172 McCANN ET AL

As with the IVD, there are surprisingly few stud-ies aimed at assessing the effect of WBV on synovialjoints such as the knee. Recent reports described theeffects of WBV on articular cartilage in a rodent modelof osteoporosis that was induced by prednisolone (46)and in a surgical model of osteoarthritis in rodents (47);however, in both studies, cartilage was not examined inanimals subjected to WBV alone. Our findings are con-sistent with those of the latter study, which demonstratedincreased cartilage degradation and functional deteriora-tion of osteoarthritis-affected joints following WBV (47).

Although the extensive damage to the knee jointcaused by WBV in our mouse model was unexpected,several mechanisms may underlie the observed changes.First, we noted that WBV-induced meniscus damagepreceded damage to the articular surface, suggestingthat destabilization of the joint may contribute to carti-lage degeneration. While mechanisms responsible forinitiation of meniscal damage are as yet unknown,removal of or damage to the meniscus is known to in-crease focal-point stress on the articular cartilage sur-face of the tibial plateau (48), which mirrors the focaldamage induced by WBV in our study. In fact, surgicaldestabilization of the medical meniscus is routinely usedto induce an osteoarthritis-like pathology in animalmodels (49). Alternatively, articular cartilage damagemay result from changes to the subchondral bonerelated to repeated exposure to WBV. Increasedmechanical load on the articular surface has been shownto increase subchondral bone thickness (50), therebyaltering joint biomechanics leading to increased loadingof the articular surface (51). Cartilage biology is furtheraltered by changes in the activity and availability ofgrowth factors and cytokines within the tissue (ultimatelypromoting osteoarthritis progression) (52). The cellularpathways responsible for the initiation of tissue degrada-tion in response to WBV in the meniscus and articularcartilage require further examination.

Although the current study reveals damagingeffects of WBV on joint tissues, it is important to acknowl-edge that we have only examined wild-type CD-1 malemice that were 10 weeks old when vibration protocol wasinitiated. Although the age and sex of the mice used in thecurrent study do not mirror those of the human partici-pants who currently use WBV platforms (the age and sexof whom vary widely), our study provides evidence ofpotentially negative effects of WBV that warrant furtherexamination. The use of male mice may also have influ-enced our findings regarding the response of bone toWBV in the current study: specifically, our finding thatbone microarchitecture in the secondary spongiosa wasunaffected. A previous study showed that 12-week-old

female rats exposed to WBV showed no significant changesin trabecular spacing, number, and thickness compared tocontrols not exposed to vibration, whereas ovariectomizedfemale rats exposed to the same parameters of WBVshowed a significant increase in bone mass (53). These find-ings suggest that systemic factors, such as circulating hor-mone levels, may modulate the response of bone to WBV.

Furthermore, the current study used young mice,in which degenerative changes are typically not detectedin the IVD or knee joint tissues. Given that WBV is beingused clinically to treat musculoskeletal disorders, followupstudies should explore the response of diseased joint tis-sues to WBV, to better model its clinical use in humans.An additional limitation associated with the use of youngmice is the inherent difference between the compositionof the IVD in humans and mice. Human IVD tissuesshow a loss of notochord cells within the first decade oflife (54), and the NP is instead populated by smallercartilage-like cells, whereas mice maintain notochord cellsin the NP into adulthood (55). Interestingly, rabbit noto-chord cells have been reported to be less resistant tomechanical stress than NP cells (56), suggesting that thecellular composition of the NP may be an important regu-lator of the response of the tissue to mechanical stimulisuch as WBV.

Taken together, results of the current study dem-onstrate that repeated exposure to WBV leads to degener-ation of both the IVD and the knee joints in a mousemodel. These findings raise concerns regarding the clinicaluse of these platforms for the treatment of various condi-tions, as well as the use of vibration platforms by the gen-eral population in daily exercise regimens. Further studiesare needed to determine if WBV is safe and effective forthe treatment of human conditions and to specificallyaddress the potential negative effects on joint health.

AUTHOR CONTRIBUTIONS

All authors were involved in drafting the article or revising itcritically for important intellectual content, and all authors approvedthe final version to be published. Drs. McCann and S!eguin had fullaccess to all of the data in the study and takes responsibility for theintegrity of the data and the accuracy of the data analysis.Study conception and design. McCann, Patel, Pest, Ratneswaran,Beaucage, Holdsworth, Beier, Dixon, S!eguin.Acquisition of data. McCann, Patel, Pest, Ratneswaran, Lalli, Beaucage,Backler, Kamphuis, Esmail, Lee, Barbalinardo.Analysis and interpretation of data. McCann, Patel, Pest, Ratneswaran,Lalli, Beaucage, Backler, Mort, Holdsworth, Beier, Dixon, S!eguin.

REFERENCES

1. Rubin C, Pope M, Fritton JC, Magnusson M, Hansson T,McLeod K. Transmissibility of 15-hertz to 35-hertz vibrations tothe human hip and lumbar spine: determining the physiologicfeasibility of delivering low-level anabolic mechanical stimuli to

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2173

skeletal regions at greatest risk of fracture because of osteoporo-sis. Spine 2003;28:2621–7.

2. Rubin C, Recker R, Cullen D, Ryaby J, McCabe J, McLeod K.Prevention of postmenopausal bone loss by a low-magnitude,high-frequency mechanical stimuli: a clinical trial assessing com-pliance, efficacy, and safety. J Bone Miner Res 2004;19:343–51.

3. Pang MY, Lau RW, Yip SP. The effects of whole-body vibrationtherapy on bone turnover, muscle strength, motor function, andspasticity in chronic stroke: a randomized controlled trial. Eur JPhys Rehabil Med 2013;49:439–50.

4. Herrero AJ, Menendez H, Gil L, Martin J, Martin T, Garcia-LopezD, et al. Effects of whole-body vibration on blood flow and neuro-muscular activity in spinal cord injury. Spinal Cord 2011;49:554–9.

5. Claerbout M, Gebara B, Ilsbroukx S, Verschueren S, Peers K,van Asch P, et al. Effects of 3 weeks’ whole body vibration train-ing on muscle strength and functional mobility in hospitalizedpersons with multiple sclerosis. Mult Scler 2012;18:498–505.

6. Rittweger J, Just K, Kautzsch K, Reeg P, Felsenberg D. Treatment ofchronic lower back pain with lumbar extension and whole-body vibra-tion exercise: a randomized controlled trial. Spine 2002;27:1829–34.

7. Park YG, Kwon BS, Park JW, Cha DY, Nam KY, Sim KB,et al. Therapeutic effect of whole body vibration on chronicknee osteoarthritis. Ann Rehabil Med 2013;37:505–15.

8. Perraton L, Machotka Z, Kumar S. Whole-body vibration totreat low back pain: fact or fad? Physiother Can 2010;63:88–93.

9. Muir J, Kiel DP, Rubin CT. Safety and severity of accelerationsdelivered from whole body vibration exercise devices to standingadults. J Sci Med Sport 2013;16:526–31.

10. Pasqualini M, Lavet C, Elbadaoui M, Vanden-Bossche A,Laroche N, Gnyubkin V, et al. Skeletal site-specific effects ofwhole body vibration in mature rats: from deleterious to benefi-cial frequency-dependent effects. Bone 2013;55:69–77.

11. Funakoshi M, Taoda K, Tsujimura H, Nishiyama K. Measure-ment of whole-body vibration in taxi drivers. J Occup Health2004;46:119–24.

12. Matsumoto Y, Griffin MJ. Non-linear characteristics in thedynamic responses of seated subjects exposed to vertical whole-body vibration. J Biomech Eng 2002;124:527–32.

13. Del Pozo-Cruz B, Hernandez Mocholi MA, Adsuar JC, Parraca JA,Muro I, Gusi N. Effects of whole body vibration therapy on mainoutcome measures for chronic non-specific low back pain: a single-blind randomized controlled trial. J Rehabil Med 2011;43:689–94.

14. Belavy DL, Hides JA, Wilson SJ, Stanton W, Dimeo FC,Rittweger J, et al. Resistive simulated weightbearing exercisewith whole body vibration reduces lumbar spine deconditioningin bed-rest. Spine 2008;33:E121–31.

15. Iwamoto J, Takeda T, Sato Y, Uzawa M. Effect of whole-bodyvibration exercise on lumbar bone mineral density, bone turnover,and chronic back pain in post-menopausal osteoporotic womentreated with alendronate. Aging Clin Exp Res 2005;17:157–63.

16. Holguin N, Muir J, Rubin C, Judex S. Short applications of verylow-magnitude vibrations attenuate expansion of the interverte-bral disc during extended bed rest. Spine J 2009;9:470–7.

17. Belavy DL, Armbrecht G, Gast U, Richardson CA, Hides JA,Felsenberg D. Countermeasures against lumbar spine decondi-tioning in prolonged bed rest: resistive exercise with and withoutwhole body vibration. J Appl Physiol 2010;109:1801–11.

18. Holguin N, Judex S. Rat intervertebral disc health during hind-limb unloading: brief ambulation with or without vibration. AviatSpace Environ Med 2010;81:1078–84.

19. Holguin N, Martin JT, Elliott DM, Judex S. Low-intensity vibra-tions partially maintain intervertebral disc mechanics and spinalmuscle area during deconditioning. Spine J 2013;13:428–36.

20. Kartha S, Zeeman ME, Baig HA, Guarino BB, Winkelstein BA.Upregulation of BDNF and NGF in cervical intervertebral discsexposed to painful whole body vibration. Spine 2014;39:1542–8.

21. Salmon JR, Roper JA, Tillman MD. Does acute whole-bodyvibration training improve the physical performance of peoplewith knee osteoarthritis? J Strength Cond Res 2012;26:2983–9.

22. Liphardt AM, Mundermann A, Koo S, Backer N, AndriacchiTP, Zange J, et al. Vibration training intervention to maintaincartilage thickness and serum concentrations of cartilage oligo-metric matrix protein (COMP) during immobilization. Osteoar-thritis Cartilage 2009;17:1598–603.

23. McCann MR, Patel P, Beaucage KL, Xiao Y, Bacher C,Siqueira WL, et al. Acute vibration induces transient expressionof anabolic genes in the murine intervertebral disc. ArthritisRheum 2013;65:1853–64.

24. Wenger KH, Freeman JD, Fulzele S, Immel DM, Powell BD,Molitor P, et al. Effect of whole-body vibration on bone proper-ties in aging mice. Bone 2010;47:746–55.

25. Pest MA, Russell BA, Zhang YW, Jeong JW, Beier F. Dis-turbed cartilage and joint homeostasis resulting from a loss ofmitogen-inducible gene 6 in a mouse model of joint dysfunction.Arthritis Rheumatol 2014;66:2816–27.

26. Thompson JP, Pearce RH, Schechter MT, Adams ME, TsangIK, Bishop PB. Preliminary evaluation of a scheme for gradingthe gross morphology of the human intervertebral disc. Spine1990;15:411–5.

27. Bergknut N, Grinwis G, Pickee E, Auriemma E, Lagerstedt AS,Hagman R, et al. Reliability of macroscopic grading of interver-tebral disk degeneration in dogs by use of the Thompson systemand comparison with low-field magnetic resonance imaging find-ings. Am J Vet Res 2011;72:899–904.

28. Bedore J, Sha W, McCann MR, Liu S, Leask A, Seguin CA.Impaired intervertebral disc development and premature discdegeneration in mice with notochord-specific deletion of CCN2.Arthritis Rheum 2013;65:2634–44.

29. Sztrolovics R, Alini M, Roughley PJ, Mort JS. Aggrecan degra-dation in human intervertebral disc and articular cartilage. Bio-chem J 1997;326:235–41.

30. Billinghurst RC, Dahlberg L, Ionescu M, Reiner A, Bourne R,Rorabeck C, et al. Enhanced cleavage of type II collagen by col-lagenases in osteoarthritic articular cartilage. J Clin Invest 1997;99:1534–45.

31. Ulici V, Hoenselaar KD, Agoston H, McErlain DD, Umoh J,Chakrabarti S, et al. The role of Akt1 in terminal stages ofendochondral bone formation: angiogenesis and ossification.Bone 2009;45:1133–45.

32. Hou WW, Zhu ZL, Zhou Y, Zhang CX, Yu HY. Involvement ofWnt activation in the micromechanical vibration-enhanced osteo-genic response of osteoblasts. J Orthop Sci 2011;16:598–605.

33. Slatkovska L, Alibhai SM, Beyene J, Hu H, Demaras A, CheungAM. Effect of 12 months of whole-body vibration therapy onbone density and structure in postmenopausal women: a random-ized trial [published erratum appears in Ann Intern Med 2011;155:860]. Ann Intern Med 2011;155:668–79, W205.

34. Oxlund BS, Ortoft G, Andreassen TT, Oxlund H. Low-intensity,high-frequency vibration appears to prevent the decrease instrength of the femur and tibia associated with ovariectomy ofadult rats. Bone 2003;32:69–77.

35. Torcasio A, van Lenthe GH, van Oosterwyck H. The importance ofloading frequency, rate and vibration for enhancing bone adapta-tion and implant osseointegration. Eur Cell Mater 2008;16:56–68.

36. Verschueren SM, Roelants M, Delecluse C, Swinnen S,Vanderschueren D, Boonen S. Effect of 6-month whole bodyvibration training on hip density, muscle strength, and posturalcontrol in postmenopausal women: a randomized controlledpilot study. J Bone Miner Res 2004;19:352–9.

37. Gregory DE, Callaghan JP. An examination of the mechanicalproperties of the annulus fibrosus: the effect of vibration on theintra-lamellar matrix strength. Med Eng Phys 2012;34:472–7.

38. Walsh AJ, Lotz JC. Biological response of the intervertebral discto dynamic loading. J Biomech 2004;37:329–37.

39. Lotz JC, Chin JR. Intervertebral disc cell death is dependent on themagnitude and duration of spinal loading. Spine 2000;25:1477–83.

40. Omair A, Holden M, Lie BA, Reikeras O, Brox JI. Treatmentoutcome of chronic low back pain and radiographic lumbar disc

2174 McCANN ET AL

degeneration are associated with inflammatory and matrixdegrading gene variants: a prospective genetic association study.BMC Musculoskelet Disord 2013;14:105.

41. Yuan HY, Tang Y, Liang YX, Lei L, Xiao GB, Wang S, et al.Matrix metalloproteinase-3 and vitamin D receptor genetic poly-morphisms, and their interactions with occupational exposure inlumbar disc degeneration. J Occup Health 2010;52:23–30.

42. Gilbert HT, Hoyland JA, Freemont AJ, Millward-Sadler SJ. Theinvolvement of interleukin-1 and interleukin-4 in the response ofhuman annulus fibrosus cells to cyclic tensile strain: an alteredmechanotransduction pathway with degeneration. Arthritis ResTher 2011;13:R8.

43. Wilhelmi G, Faust R. Suitability of the C57 black mouse as anexperimental animal for the study of skeletal changes due toageing, with special reference to osteo-arthrosis and its responseto tribenoside. Pharmacology 1976;14:289–96.

44. Brew CJ, Clegg PD, Boot-Handford RP, Andrew JG,Hardingham T. Gene expression in human chondrocytes in lateosteoarthritis is changed in both fibrillated and intact cartilagewithout evidence of generalised chondrocyte hypertrophy. AnnRheum Dis 2010;69:234–40.

45. Kanazawa T, Furumatsu T, Hachioji M, Oohashi T, NinomiyaY, Ozaki T. Mechanical stretch enhances COL2A1 expressionon chromatin by inducing SOX9 nuclear translocalization ininner meniscus cells. J Orthop Res 2012;30:468–74.

46. Musumeci G, Loreto C, Leonardi R, Castorina S, Giunta S,Carnazza ML, et al. The effects of physical activity on apoptosis andlubricin expression in articular cartilage in rats with glucocorticoid-induced osteoporosis. J Bone Miner Metab 2013;31:274–84.

47. Qin J, Chow SK, Guo A, Wong WN, Leung KS, Cheung WH.Low magnitude high frequency vibration accelerated cartilage

degeneration but improved epiphyseal bone formation in ante-rior cruciate ligament transect induced osteoarthritis rat model.Osteoarthritis Cartilage 2014;22:1061–7.

48. Kurosawa H, Fukubayashi T, Nakajima H. Load-bearing modeof the knee joint: physical behavior of the knee joint with orwithout menisci. Clin Orthop Relat Res 1980:283–90.

49. Welch ID, Cowan MF, Beier F, Underhill TM. The retinoic acidbinding protein CRABP2 is increased in murine models ofdegenerative joint disease. Arthritis Res Ther 2009;11:R14.

50. Hwang J, Bae WC, Shieu W, Lewis CW, Bugbee WD, Sah RL.Increased hydraulic conductance of human articular cartilageand subchondral bone plate with progression of osteoarthritis.Arthritis Rheum 2008;58:3831–42.

51. Anderson-MacKenzie JM, Quasnichka HL, Starr RL, Lewis EJ,Billingham ME, Bailey AJ. Fundamental subchondral bonechanges in spontaneous knee osteoarthritis. Int J Biochem CellBiol 2005;37:224–36.

52. Burr DB, Gallant MA. Bone remodelling in osteoarthritis. NatRev Rheumatol 2012;8:665–73.

53. Rubinacci A, Marenzana M, Cavani F, Colasante F, Villa I,Willnecker J, et al. Ovariectomy sensitizes rat cortical bone towhole-body vibration. Calcif Tissue Int 2008;82:316–26.

54. Trout JJ, Buckwalter JA, Moore KC, Landas SK. Ultrastructureof the human intervertebral disc. I. Changes in notochordal cellswith age. Tissue Cell 1982;14:359–69.

55. McCann MR, Tamplin OJ, Rossant J, Seguin CA. Tracingnotochord-derived cells using a Noto-cre mouse: implications forintervertebral disc development. Dis Model Mech 2012;5:73–82.

56. Guehring T, Nerlich A, Kroeber M, Richter W, Omlor GW.Sensitivity of notochordal disc cells to mechanical loading: anexperimental animal study. Eur Spine J 2010;19:113–21.

DOI 10.1002/art.39264

Erratum

In the article by Margheri et al published in the August 2010 issue of Arthritis & Rheumatism (pages 2488–2498), there was an error in Figure 2B. In the upper portion of the figure, the panel at the far right of thethird row (1VEGF/pTX3) was inadvertently mounted as a replica of the panel in the middle of the secondrow (1FGF2/pMMP12). This did not affect the results or scientific message of the study. The correct upperportion of Figure 2B is shown below.

We regret the error.

WHOLE-BODY VIBRATION INDUCES JOINT DEGENERATION 2175

Supplementary Data:

Supplemental Figure 1: Repeated exposure to whole-body vibration negatively affects the caudal intervertebral disc. A. Representative histological sections from the caudal spine stained with Safranin O/fast green for glycosaminoglycans, and picrosirius red imaged with polarized light for collagen organization, in mice exposed to 4 weeks of WBV (30 min/day; 45 Hz, 0.3 g) or non-vibrated sham controls. Evaluation of the morphologic grade of tissue degeneration (using the modified Thompson score) demonstrated a significant increase in tissue degeneration in the AF of mice subjected to WBV compared to sham controls. Data are presented as the mean ± SEM, based on 3 IVDs per animal, 4-5 animals/group (n=15), * = P < 0.05.

Supplemental Figure 2: Histological sections of the lateral compartment of the mouse knee joint after exposure to whole-body vibration. Representative coronal sections of the knee joint from 1 control and 2 mice exposed to WBV at each time point stained with Safranin O/fast green to detect sulfated glycosaminoglycans. No meniscal or articular cartilage damage was detected in the lateral knee joint compartment in mice from either group at A. 2 weeks or B. 4 weeks.

Supplemental Figure 3: Histological sections of mouse medial knee joint after 4 week of exposure to whole-body vibration. Representative coronal sections of the knee joint from 1 sham and 2 mice exposed to WBV stained with picrosirius red and imaged with polarized light to detect collagen organization. Images are oriented with medical meniscus on the left, femoral condyle on top and tibial plateau beneath. No apparent changes were seen in the organization of collagen following WBV.

Supplemental Figure 4: Evidence of matrix degradation in the lateral mouse knee joints following whole-body vibration. A. Representative images of lateral knee joint sections from mice subjected to 4 weeks of WBV or sham controls stained by immunohistochemistry for DIPEN (ADAMTS-cleaved aggrecan neoepitope), NITEGE (MMP cleaved aggrecan neoepitope) and C1,2C (MMP cleaved collagen neoepitope) and counterstained with methyl green.

Supplementary,Table,1,

NCBI Gene Symbol Primer Sequence 5’ ! 3’ Hprt Fwd CAGGCCAGACTTTGTTGGAT Hprt Rev TTGCGCTCATCTTAGGCTTT Adamts4 Fwd GAGGAGGAGATCGTGTTTCCAG Adamts4 Rev CAAACCCTCTACCTGCACCC Adamts5 Fwd GGAGCGAGGCCATTTACAAC Adamts5 Rev GCGTAGACAAGGTAGCCCACTTT Acan Fwd CTGGGATCTACCGCTGTGAAG Acan Rev GTGTGGAAATAGCTCTGTAGTGGAA Col1a1 Fwd CTGGCGGTTCAGGTCCAAT Col1a1 Rev TCCAGGCAATCCAGGAGC Col2a1 Fwd GCACATCTGGTTTGGAGAGACC Col2a1 Rev TAGCGGTGTTGGGAGCCA Dmp1 Fwd CTGAAGAGAGGACGGGTGATT Dmp1 Rev CGTGTGGTCACTATTTGCCTG Ibsp Fwd ACGGCGATAGTTCCGAAGAG Ibsp Rev CTAGCTGTTACACCCGAGAGT Mmp3 Fwd TTGTCCCGTTTCCATCTCTCTC Mmp3 Rev TTGGTGATGTCTCAGGTTCCAG Mmp13 Fwd CTTCTTCTTGTTGAGCTGGAACTC Mmp13 Rev CTCTGTGGACCTCACTGTAGACT RANK Fwd CCAGGAGAGGCATTATGAGCA RANK Rev ACTGTCGGAGGTAGGAGTGC Sox9 Fwd AGTACCCGCATCTGCACAAC Sox9 Rev TACTTGTAATCGGGGTGGTCTT Wnt10b Fwd CGGACTGAGTAAGCGACAGC Wnt10b Rev ACTCGTGAACGGCGATGTG Annealing Temperature: 60°C degree

!