Gene 526 (2013) 155–163

Contents lists available at SciVerse ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Prolonged fasting activates hypoxia inducible factors-1α, -2α and -3α in atissue-specific manner in northern elephant seal pups

José G. Soñanez-Organis a,⁎, José P. Vázquez-Medina a, Daniel E. Crocker b, Rudy M. Ortiz a

a School of Natural Sciences, University of California, Merced, 5200 N Lake Road, Merced, CA 95343, USAb Department of Biology, Sonoma State University, Rohnert Park, CA 94928, USA

Abbreviations: ARNT, Aryl-hydrocarbon receptor nuhelix–loop–helix; C-TAD, Carboxyl-terminal transactivatdehyde 3-phosphate dehydrogenase; HIFs, HypoxHypoxia-responsive elements; IH, Intermittent hypoxiaNLS, Nuclear localization signal; N-TAD, Amino-termODD, Oxygen-dependent degradation domain; ORF, OArnt–Sim; PHDs, Prolyl hydroxylases; TAD, Transactivatiprotein; UTRs, Untranslated regions; VEGF, Vascular en⁎ Corresponding author. Tel.: +1 209 228 4016; fax:

E-mail addresses: josegpeso@gmail.com, jorganis@n(J.G. Soñanez-Organis).

0378-1119/$ – see front matter © 2013 Elsevier B.V. Allhttp://dx.doi.org/10.1016/j.gene.2013.05.004

a b s t r a c t

a r t i c l e i n f o

Article history:Accepted 1 May 2013Available online 22 May 2013

Keywords:Hypoxia inducible factorNorthern elephant sealGene expressionProlonged fastingNuclear protein

Hypoxia inducible factors (HIFs) are important regulators of energy homeostasis and cellular adaptation tolow oxygen conditions. Northern elephant seals are naturally adapted to prolonged periods (1–2 months)of food deprivation (fasting) which result in metabolic changes that may activate HIF-1. However, the effectsof prolonged fasting on HIFs are not well defined. We obtained the full-length cDNAs of HIF-1α and HIF-2α,and partial cDNA of HIF-3α in northern elephant seal pups. We also measured mRNA and nuclear proteincontent of HIF-1α, -2α, -3α in muscle and adipose during prolonged fasting (1, 3, 5 & 7 weeks), alongwith mRNA expression of HIF-mediated genes, LDH and VEGF. HIF-1α, -2α and -3α are 2595, 2852 and1842 bp and encode proteins of 823, 864 and 586 amino acid residues with conserved domains needed fortheir function (bHLH and PAS) and regulation (ODD and TAD). HIF-1α and -2α mRNA expression increased3- to 5-fold after 7 weeks of fasting in adipose and muscle, whereas HIF-3α increased 5-fold after 7 weeks offasting in adipose. HIF-2αprotein expressionwas detected innuclear fractions fromadipose andmuscle, increas-ing approximately 2-fold, respectively with fasting. Expression of VEGF increased 3-fold after 7 weeks in adiposeand muscle, whereas LDHmRNA expression increased 12-fold after 7 weeks in adipose. While the 3 HIFα genesare expressed in muscle and adipose, only HIF-2α protein was detectable in the nucleus suggesting that HIF-2αmay contribute more significantly in the up-regulation of genes involved in the metabolic adaptation duringfasting in the elephant seal.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Hypoxia inducible factors (HIFs) are transcriptional activators thatregulate cellular oxygen homeostasis by regulating genes involved inerythropoiesis, angiogenesis, and glucose metabolism (Semenza, 1994;Semenza et al., 1994, 1996, 1997). HIFs are heterodimeric proteins com-posed of a regulatory α subunit (HIF-α) and a constitutive β subunit(HIF-β), which is also known as aryl-hydrocarbon receptor nucleartranslocator (ARNT) (Semenza, 1998; Wenger and Gassmann, 1997).Three isoforms of the HIF-α subunit (HIF-1α, HIF-2α [also called endo-thelial PAS domain protein 1] and HIF-3α) and three paralogues of theHIF-β subunit (ARNT1, ARNT2 and ARNT3) have been characterized in

clear translocator; bHLH, Basicion domain; GAPDH, Glyceral-ia inducible factors; HREs,; LDH, Lactate dehydrogenase;inal transactivation domain;pen reading frame; PAS, Per–on domain; TBP, TATA bindingdothelial grown factor.+1 209 228 4060.avojoa.uson.mx

rights reserved.

mammals (Zagorska and Dulak, 2004). Both HIF-α and HIF-β belongto the basic helix–loop–helix (bHLH)–Per–Arnt–Sim (PAS) family oftranscription factors. These transcription factors contain the bHLH do-main for DNA binding and two PAS domains for target gene specificity,dimerization and transactivation (Wang et al., 1995). HIF-α is regulatedat the post-translational level by proteosomal degradation via anubiquitin-dependent pathway. This pathway involves the hydroxyl-ation of specific proline residues (Pro402/564) within the oxygen-dependent degradation domain (ODD) by prolyl hydroxylases (PHDs)under aerobic conditions (Bruick and McKnight, 2001; Epstein et al.,2001). During hypoxia, prolyl hydroxylation does not occur; thereforeHIF-α is rapidly stabilized and translocated into the nucleus where itdimerizes with HIF-β and binds to hypoxia-responsive elements (HREs)on hypoxia sensitive genes (Comerford et al., 2002; Jewell et al., 2001;Nordal et al., 2004; Semenza et al., 1994).

HIF-α genes are expressed constitutively in a tissue-specific mannerunder normoxia and hypoxia conditions in mammals (Heidbreder etal., 2003; Law et al., 2006; Wiesener et al., 2003; Zhao et al., 2004), fish(Chen et al., 2012; Law et al., 2006; Shen et al., 2010; Soitamo et al.,2001) and crustaceans (Li and Brouwer, 2007; Soñanez-Organis et al.,2009). In rat, HIF-α mRNA isoforms are expressed higher in brain andlung compared to heart, liver and kidney, implicating an organ-specificpriority. HIF-1α and HIF-4α expression in grass carp exposed to

Table 1Primers used to obtain the cDNA sequences of esHIF-1α, -2α and -3α.

Primer name Nucleotide sequences (5′–3′)

HIF-1αphocaHIF1a-F1 phocaHIF1a-F2 dogHIF1a-F3dogHIF1a-F4 esealHIF1a-F1 phocaHIF1a-R1phocaHIF1a-R2 dogHIF1a-R4 dogHIF1a-R5dogHIF1a-R7 esealHIF1a-R1 esealHIF1a-R2

GTGAGCTCGCATCTTGATAAGGCGGATGCAAATCTAGTGAACACCCGATTCGCCATGGAGGGCGATGCTTTAACTTTGCTGGCCGGTTCTCACAGATGATGGTGACGGATGAGTAAAATCAAACACACGCTCTGAGTAATTCTTCACCCGGTAATGAGCCACCAGTGTCCGCAGTATTGTAGCCAGGCTTCCACTACTTCGAATGTGCTTTGGCTGGTCAGTTGTGGTAATCCCTACATGCTAAATCAGAGGG

HIF-2αphocaHIF1a-F1 HIF2aFw4 esealHIF2aFw1esealHIF2aFw2 HIF2aRv1 HIF2aRv5esealHIF2aRv1 esealHIF2aRv2esealHIF2aRv3 esealHIF2aRv4esealHIF2aRv5

GRTRTGGAAACGRATGAAGAGCCCATGVCRARCATCTTCCAGCCCCTGGCCATCAGCTTCCTGCGGTGGAAACGGATGAAGAGCCGTGAACTGCCCTCTGATGCCCCTGACMCCTTKTGAGCYCMTGGGCTCAGGCTCTATCTTCTTGCGCTGTAGTCCTGGTACGGAGCCTGACACCTTGTGAGCTCCCATGATGATGAGGCAGGAGAGCCAGAGCCACTTTTGAGACTCGATCATGTCGCCATCTTGGG

HIF-3αHIF3aFw2 HIF3aFw3 HIF3aFw4 esealHIF3aFw1esealHIF3aFw2 HIF3aRv1 HIF3aRv4esealHIF3aRv1 esealHIF3aRv2 esealHIF3aRv3esealHIF3aRv4 esealHIF3aRv5 LDHFw2LDHRv2 VEGF-Fw1 VEGF-Rv1 GAPDHFwGAPDHRv

CTTCCATGGCCTGTCRCCMCCCAGGAGACGGAGGTGCTGTACGAGCAAGGGCCAGGCAGTAACCTCTGGATCTGGAGATGCTGGGATGACTTCCAGCTCAACTCCCAGAAGGAAACTCAGGCTGAGGTTACTGCCTGGCCCTTGCTCGAGCCAGGGTCCTCTTCCGAGCTCTGGAAGGGCTGGAGCAGCGGATGGCTTCACAGATGAGCCTCATGTGTCCAGAGCAGTGGTGTCCGATGAGCTCAAGCTGCTTAATGAAGGACTTGGCAGCTTTCTCCCTCTTGCTGACGATGCGGATCAAACCTCACCAAGTTCGTTTAACTCAAGCTGCCCAGAACATCATCCCTGCCTCCTGCTTCACCACCTTCTTGA

156 J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

normoxia and hypoxiawas constitutively and also tissue-specific (Lawetal., 2006). Recurrent apneas (breath-holding episodes) (Prabhakar et al.,2009, 2010), which cause periodic decreases in arterial bloodO2 or inter-mittent hypoxia (IH), are implicate in the induction of cellular HIF-αaccumulation in mammals.

Northern elephant seals are naturally adapted to tolerate prolongedfasting, which is characterized by increased: 1) number and duration ofsleep apneas, and 2) time spent submerged in near-shore waters(Blackwell and Le Boeuf, 1993; Castellini et al., 1988, 1994); all ofwhich can contribute to the stimulation of HIF in mammals. However,the effects of prolonged food deprivation on HIF expression and regula-tion inmammals are notwell defined. To assess the impact of prolongedfasting on adipose and muscle HIF in northern elephant seals, we 1)identified and characterized three distinct HIF-α cDNAs (esHIF-1α,esHIF-2 and esHIF-3α), 2) quantified the mRNA expression and nuclearaccumulation of each HIF-α isoform, and 3) quantified themRNA levelsof the HIF target genes, LDH and VEGF. Because increased plasma Ang IIand apneas occur simultaneously during prolonged fasting, we hypoth-esized that prolonged fasting up-regulates adipose and muscle HIF-αisoforms in elephant seals and that cDNA of HIF-α isoforms has highidentity to their homologues of mammals. The elephant seal's abilityto tolerate prolonged fasting without deleterious consequences makesit an interesting model to understand the molecular and physiologicalmechanisms that allow adaptedmammals to cope prolonged food dep-rivation and the associated characteristics (i.e., excessive sleep apneas).

2. Material and methods

Institutional Animal Care and Use Committees of the University ofCalifornia, Merced, and Sonoma State University reviewed and approvedall methods. All work was realized under the National Marine FisheriesService marine mammal permit # 87-1743.

2.1. Animals and sample collection

Sixteen elephant seal pups of known agewere sampled at Año NuevoState Reserve, CA, seven at a time, at four periods during their naturalpost-weaning fast (1, 3, 5 and 7 weeks post-weaning). Pupswere initiallysedatedwith 1 mg kg−1 tiletamine hydrochloride and zolazepamhydro-chloride (telazol; Fort Dodge Animal Health, Fort Dodge, IA, USA). Onceimmobilized, a 16 gauge, 3.5 in. spinal needle was inserted into theextradural spinal vein. Sedationwasmaintainedwith 100 mgbolus intra-venous injections of ketamine (Fort Dodge Animal Health) as needed.Adipose and muscle biopsies (20–40 mg) were collected as describedpreviously (Vázquez-Medina et al., 2010). Briefly, a small region in theflank of the animal near the hind flipper is cleansed with alternatingwipes of isopropyl alcohol and betadine and 2–3 mL of lidocaine(Henry Schein, Melville, NY) is injected subcutaneously with a 21 gaugeneedle. Next, a small (b1.5 cm) incision is made and, a muscle andadipose biopsy was collected with a sterile biopsy punch needle (HenrySchein). Finally, tissue samples were frozen by immersion in liquid nitro-gen immediately after collection and stored at−80 °C until analyzed.

2.2. HIF-1α, -2α, & -3α cDNA cloning

The complete cDNA sequences for each HIF-α isoformwere obtainedusing primers designed based on their respective homolog nucleotidesequences from mammals using Primer3 software (http://frodo.wi.mit.edu) (Rozen and Skaletsky, 2000) (Table 1). Internal PCR fragmentsof HIF-1α, -2α, and -3α were obtained using the following primers:1) for HIF-1α, phocaHIF1aFw1 + phocaHIFaRv1, phocaHIF1aFw2 +phocaHIF1aRv2, esealHIF1aFw1 + dogHIF1a-R4 and dogHIF1a-F4 +esealHIF1a-R2, 2) for HIF-2α, HIF2aFw3 + HIF2aRv1, HIF2aFw4 +HIF2aRv5 and HIF2aFw2 + esealHIF2aRv1, and 3) for HIF-3α,HIF3aFw4 + HIF3aRv1 and HIF3aF3 + HIF3aRv4. To obtain a 30 μLfinal reaction volume, 15 μL of Platinum PCR SuperMix (Invitrogen,

Carlsbad, CA, USA), 3 μL of muscle cDNA (equivalent to 150 ng of totalRNA) and 1 μL (20 μM) of each primer were mixed and subjected tothe following conditions: 94 °C for 3 min for 1 cycle, 40 cycles at94 °C for 30 s, 55 °C for 40 s and 68 °C for 1–2 min, and an overexten-sion step at 68 °C for 7 min. PCR fragments of ~200 to ~1500 bp wereobtained, sequenced and identified as HIF-1α, -2α and -3α, respective-ly, by comparing them with GenBank data using the BLAST algorithm(Altschull et al., 1990).

The 5′ and 3′ ends of each HIF-α isoform were obtained usingprimers designed on their respective untranslated regions (UTRs)of each homolog nucleotide sequence of HIF-α. The followingprimers were used to obtain the 5′ and 3′ ends from: 1) HIF-1α,dogHIF1a-F3 + phocaHIF1a-R1 andphocaHIF1a-F2 + dogHIF1a-R5, re-spectively, 2) HIF-2α, HIF2aFw1 + esHIF2aRv4 and esealHIF2aFw1 +CDSIII, respectively, and 3) HIF-3α, HIF3aFw5 + esHIF3aRv3 andHIF3aFw2, respectively. To obtain a 25 μL final reaction volume, 12.5 μLof PlatinumPCRSuperMix (Invitrogen, Carlsbad, CA, USA), 3 μL ofmusclecDNA (equivalent to 150 ng of total RNA) and 1 μL (20 μM) of eachprimer were mixed and subjected to the following conditions: 94 °Cfor 3 min for 1 cycle, 40 cycles at 94 °C for 30 s, 55 C for 40 s and68 °C for 1 min, and an overextension step at 68 °C for 7 min. PCR prod-ucts of ~500 bp (for the 5′ and 3′ end)were obtained, cloned on pGEM-TEasy Vector System (Promega, San Luis Obispo, CA, USA) and sequenced.

157J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

The full-length cDNA sequences for HIF-1α (esHIF-1α) and HIF-2α(esHIF-2α), and partial cDNA sequence for HIF-3α (esHIF-3α) wereobtained by overlapping their respective PCR fragments. The predictedHIF-α amino acid sequences were obtained using a translation web site(http://arbl.cvmbs.colostate.edu/molkit/translate/), aligned with otherHIF-α using ClustalW (Thompson et al., 1994) and compared withprotein databases using BLAST (Altschull et al., 1990).

2.2.1. HIF-1α, -2α & -3α phylogenetic analysisA phylogenetic analysis based on 36 HIF-α amino acid sequences

(Table 2, including esHIF-1α, esHIF-2α and esHIF-3α) was performedwith MEGA software version 5 (Tamura et al., 2007). The analyseswere subjected to the Neighbor-joining method, the Jones–Taylor–Thornton model for substitution, and the bootstrap method supportedby 2000 replicates to test phylogeny.

2.3. Quantification of HIF-α isoforms, LDH and VEGF mRNA expression

Total RNAwas isolated individually from adipose and muscle sam-ples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) followingthe manufacturer's instructions. RNA integrity was confirmed bymeasuring the absorbance at 260 nm/280 nm and by 1% agarose gelelectrophoresis (Sambrook and Russell, 2001). Contamination of ge-nomic DNA in total RNA was eliminated by digestion with DNase I(Roche, Indianapolis, IN, USA), as specified by the manufacturer.Separate cDNAs from each tissue were synthesized from total DNAfreeRNA (1 μg) using oligo-dT and the QuantiTect Reverse Transcriptionkit (Qiagen, Valencia, CA, USA).

Specific primers for each esHIF-α isoformwere designed and validatedby PCR using specific clones from each HIF-α subunit, whereas LDH andVEGF primers were designed based on homologous mammalian nucleo-tide sequences. The expression of glyceraldehyde 3-phosphate dehydro-genase (GAPDH) was used as an internal standard to normalize theexpression of each esHIF-α isoform. Isoforms of esHIF-α, LDH, VEGF andGAPDH mRNA expressions were measured by quantitative RT-qPCRusing esHIF1aFw1 + esHIF1aRv1, esealHIF2aFw1 + esealHIF2aRv1,esealHIF3aFw1 + esealHIF3aRv1, LDHFw2 + LDHRv2, VEGF-Fw1 +VEGF-Rv1 andGAPDHFw + GAPDHRv primers, respectively. The PCR re-actions of each tissue sample were run on a 7500 Real-Time PCR system(Applied Biosystems, Foster City, CA, USA) in a final volume of 20 μLcontaining 10 μL of SYBR Green PCR Master Mix (Applied Biosystems),6 μL of H2O, 0.5 μL of each primer (20 μM) and 3 μL of cDNA (equivalentto 150 ng of total RNA). After an initial denaturing step at 94 °C for 5 min,amplifications were performed for 40 cycles at 94 °C for 30 s, 60 °C for30 s and a final step of 30 s at 72 °C, with a single fluorescencemeasure-ment and a finalmelting curve program decreasing 0.3 °C each 20 s from95 to 60 °C. Positive and negative controls were included. Standardcurves for each esHIF-α isoform and GAPDH were run to determine theefficiency of amplification using dilutions from 5E−4 to 5E−8 ng μL−1 of

Table 2List of amino acid sequences included in the phylogenetic analyses.

Organism HIF-α t

Ailuropoda melanoleuca (giant panda) 1, 2, 3Bos taurus (cow) 1, 2, 3Brucella melitensis (bacterium) ⁎PDPCapra hircus (goat) 1, 2Canis lupus familiaris (domestic dog) 1, 2, 3Equus caballus (horse) 1, 2, 3Gallus gallus (domestic chicken) 1, 2Homo sapiens (human) 1, 2, 3Loxodonta africana (African elephant) 2, 3Meleagris gallopavo (wild turkey) 1, 2Mirounga angustirostris (northern elephant seal) 1, 2, 3Mus musculus (house mouse) 1, 2, 3Rattus norvegicus (rat) 1, 2, 3Sus scrofa (pig) 1, 2, 3

PCR fragment. For each measurement, expression levels (ng μL−1) werenormalized to the expression of GAPDH. The use of GAPDH to normalizethe expressions of the genes of interest was appropriate here because wedid not detect any changes in the expression of GAPDH with fastingduration.

2.4. HIF-1α, -2α, & -3α protein expression

Nuclear protein fractions were prepared from frozen adipose andmuscle samples using the NE-PER nuclear protein extraction kit (Pierce,Rockford, IL, USA). Total protein content was measured using theBio-Rad Bradford protein assay (Bio-Rad Laboratories, Hercules, CA,USA). Ten micrograms of protein was mixed with Laemmli samplebuffer, boiled and resolved in 4–15% Tris–HCl gradient gels. Proteinswere electroblotted onto 0.45 μm nitrocellulose membranes using theTrans-Blot Turbo transfer system (Bio-Rad Laboratories). Membraneswere blocked for 1 h at room temperature and incubated overnightwith primary antibodies against HIF-1α, -2α, and -3α (Santa CruzBiotechnology, Santa Cruz, CA, USA) diluted 1:100. Membranes werewashed, incubated with HRP-conjugated secondary antibodies (SantaCruz Biotechnology) diluted 1:20,000, re-washed and developed withthe Immun-Star™ WesternC™ kit (Bio-Rad Laboratories). Blots werevisualized using a Chemi-Doc XRS system (Bio-Rad Laboratories) andquantified by using Bio-Rad's Quantity One software. Percent changefrom 1 week was calculated after band densities were normalizedagainst TATA binding protein (TBP).

2.5. Statistics

Differences among of HIF-1α, -2α and -3αmRNA and protein levelsacross the fastwere detected by one-wayANOVAwith Bonferroni's posthoc tests. Means (±s.e.m.) were considered statistically different atP b 0.05. Statistical analyses were performed using STATISTICA 8 soft-ware (StatSoft Inc., Tulsa, OK, USA).

3. Results

3.1. Characterization of elephant seal HIF-α isoforms

The full-length of HIF-1α (esHIF-1α; GenBank JX310322) andHIF-2α (esHIF-2α; GenBank JX310323), and partial HIF-3α (esHIF-3α;GenBank JX310324) cDNA sequences forMirounga angustirostriswereobtained from seal muscle. The esHIF-1α sequence is 2595 bp longwith a 2469 bp open reading frame (ORF) and encodes a predictedprotein of 823 amino acid residues and a calculated molecular weightof 92 kDa. The translated esHIF-1α exhibited high identity to HIF-1αfrom the giant panda (98%), the domestic dog (98%), the bovine(97%), the goat (97%) and the human (94%) (Fig. 1A). The esHIF-2α se-quence is 2852 bp long with a 2679 bp ORF and encodes a predicted

ype GenBank accession numbers

XP_002913080, XP_002912483, XP_002923099NP_776764, DAA24674, NP_001098812EEW88394AEW10558XP_865513, XP_531807, XP_533636JX310322, JX310323, JX310324NP_989628, NP_990138NP_001521, NP_001421, EAW57411XP_003417640, XP_003406518XP_003206838, XP_003203937XP_001493256, XP_001498492, XP_001500830AAC52730, AAB41496, NP_001156422CAA70701, EDM02660, NP_071973NP_001116596, NP_001090889, XP_003127298

A) HIF-1α

B) HIF-2α

C) HIF-3α

Fig. 1. Multiple alignment of the deduced amino acid sequences of northern elephant seal: A) esHIF-1α, B) esHIF-2α, and C) esHIF-3α. Typical domains characteristic of HIF-α aredenoted on the alignments. The two conserved proline (Pro) residues within the ODD domain are indicated by arrowheads, and the asparagine (Asn) residue (Asn-803 in human)in TAD-C is indicated by an arrow. The nuclear localization signal (NLS) necessary for HIF-α accumulation and translocation to the nucleus under hypoxic conditions is underlined.

158 J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

Fig. 2. Phylogenetic tree for HIF-1α, -2α and -3α from a selected list of animal species.Species and accession numbers of all used sequences are shown in Table 2. Each shadedbox represents a distinct cluster on the tree. Numbers on the base of each node indicatethe percentages of bootstrap support based on 1000 bootstrap resamplings.

Fig. 3.Mean (±s.e.m.) mRNA levels of HIF-1α in A) adipose and B) muscle from fastedelephant seal pups. Asterisks denote significant (P b 0.05) differences from week 1.

159J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

protein of 864 amino acid residues and a calculated molecular weightof 95.6 kDa. The predicted protein esHIF-2α has high identity toHIF-2α from the giant panda (94%), the domestic dog (93%), the bovine(87%), the pig (88%) and the human (87%) (Fig. 1B). The partialesHIF-3α fragment sequenced is 1805 bp and encodes a predictedprotein fragment of 601 amino acid residues. The translated esHIF-3αfragment has high identity to HIF-3α from the giant panda (89%), thedomestic dog (88%), the bovine (85%), the pig (84%) and the human(84%) (Fig. 1C).

The three esHIF-α isoforms have low homology among theirfull-length sequences: esHIF-1α has overall identity of 44% and 39%with esHIF-2α and esHIF-3α, respectively. In contrast, the identity ofthe three esHIF-α isoforms is much higher within most of the differentfunctional domains derived from their human counterparts. The bHLHdomain of esHIF-1α (positions 15–69) is 83% and 76% identical withesHIF-2α (positions 10–69) and esHIF-3α (positions 1–56), respectively.The PAS-A (positions 96–150) and PAS-B (positions 247–300) domainsof esHIF-1α have identities with the corresponding domains of esHIF-2α(positions 81–151 and 231–300) and esHIF-3α (positions 69–135 and214–286) of 73% and 69% and of 72% and 60%, respectively. The ODD(positions 399–598) and TAD (positions 782–823) domains of esHIF-1αhave lower identities with the corresponding domains of esHIF-2α(positions 403–569 and 821–864) and esHIF-3α (positions 378–482and 586–601) of approximately 15–37% and of 50%, respectively. How-ever, the proline (Pro) and asparagine (Asp) which are importantfor the HIF-α regulation under normoxic conditions are conserved inthe corresponding ODD and TAD domains of each esHIF-α isoform(Figs. 1A, B and C).

3.2. Phylogenetic analyses demonstrate distinct clades for homologues ofmammalian HIF-1

The amino acid sequences of HIF-α from other species based onthe closest homologues derived from BLASTX searches were obtainedfor phylogenetic analysis. Multiple predicted amino acid sequencealignment demonstrated that esHIF-α deduced proteins were clusteredwith the homologues of other vertebrate species and constructed threedistinct clades. The three esHIF-α proteins revealed higher identity withthe homologues of other mammals, especially esHIF-1α and esHIF-2αwith the giant panda, and esHIF-3α with the horse (Fig. 2).

3.3. Prolonged fasting increases tissue-specific expression of HIF-α isoforms

esHIF-α isoform mRNA expression levels were measured in adiposeand muscle from elephant seal pups to determine their tissue-specificexpressions in response to prolonged fasting. esHIF-1α and esHIF-2αtranscripts increased (P b 0.05) at each week across the fast over the7 week measurement period in adipose and muscle, respectively(Figs. 3 and 4A). Similarly, esHIF-1α and esHIF-2α transcripts increased(P b 0.05) 4-fold (Fig. 3) and 3.2-fold (Fig. 4A) in adipose and muscle,respectively, after 7 weeks of fasting, but did not change after 3 or5 weeks compared to week 1. Also, esHIF-1α transcript decreased(P b 0.05) 100-fold after 5 weeks of fasting compared to week 1.esHIF-3α transcripts decreased (P b 0.05) 6.9-fold in adipose after5 weeks and increased (P b 0.05) 5-fold after 7 weeks compared toweek 1 (Fig. 5). In muscle, HIF-3α transcripts decreased (P b 0.05)

Fig. 4. Mean (±s.e.m.) mRNA levels of HIF-2α in A) adipose and B) muscle, and the nuclear accumulation of HIF-2α in C) adipose and D) muscle from fasted elephant seal pups.Asterisks denote significant (P b 0.05) differences from week 1. Insets: A representative Western blot of HIF-2α nuclear accumulation.

160 J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

5.7-fold and 190-fold after 3 and 5 weeks, respectively, and increased tobasal levels after 7 weeks (Fig. 5).

3.4. Prolonged fasting increases nuclear protein content of HIF-2α

The nuclear protein content of HIF-α isoforms was measured inadipose and muscle to assess the tissue-specific expressions to relatethe changes in transcript and protein levels in response to prolongedfasting. Nuclear protein content of HIF-1α and HIF-3α was notdetected in adipose and muscle at any measurement period acrossthe 7 weeks of fasting. However, nuclear accumulation of HIF-2α inadipose and muscle increased (P b 0.05) at each week across the fastover the 7 weeks (Fig. 4B).

3.5. Prolonged fasting increases tissue-specific expression of LDH and VEGF

The HIF target genes, LDH and VEGF, were measured in adiposeand muscle to relate with the increase in nuclear protein content ofHIF-2 during the fast (Fig. 6). LDH transcript increased (P b 0.05)6-fold and 12-fold in adipose after 3 and 7 weeks, respectively, butdid no change after 5 weeks compared to 1 week. In muscle, LDHtranscript decreased (P b 0.05) 6.8-fold and 2-fold after 5 and7 weeks, respectively, compared to 1 week (Fig. 6A). VEGF transcriptsincreased (P b 0.05) 4-fold at each week across the fast over the7 weeks in adipose, whereas in muscle, they increased (P b 0.05)2.5-fold after 7 weeks compared to 1 week (Fig. 6B).

4. Discussion

The full-length cDNA sequences of three HIF-α isoforms, esHIF-1α,esHIF-2α and esHIF-3α, were identified and characterized fromnorthernelephant seal muscle. The predicted amino acid sequences of eachesHIF-α isoform are highly conserved compared to other vertebratehomologues (94–98% to HIF-1α, 87–94% to HIF-2α and 84–89% to

HIF-3α), and contain the typical domains of HIF-α proteins suggestingthat the functional attributes of HIF proteins are evolutionarily con-served among mammals despite the great variation in life historiesand behaviors. Homology of the deduced amino acid sequences ofeach esHIF-αwas relatively low (39–44%) between their full-length se-quences, but relatively high in the bHLH (73–83%) and PAS (69–73%)domains. The bHLH domain contains approximately 60 amino acidsthat are responsible for DNA binding and dimerization (Morgensternand Atchley, 1999; Voronova and Baltimore, 1990), and the PAS do-mains contain 200–300 amino acids involved in ligand binding, dimer-ization and other biological activities (Taylor and Zhulin, 1999). Thedegradation of HIF-α proteins under normoxic conditions is mediatedmainly by post-translational hydroxylation of conserved prolineslocated in the ODD domain (Bruick and McKnight, 2001; Epstein et al.,2001). The three esHIF-α proteins contain the Pro residue in their respec-tive ODD domain (residue 402, 405, and 439, respectively) suggestingthat degradation of HIF in elephant seals is likely via post-translationalhydroxylation as with other mammals. HIF-α stability is mediatedby hydroxylation of conserved Pro and Asn residues present in theiramino-terminal transactivation domain (N-TAD) and carboxyl-terminaltransactivation domain (C-TAD), respectively (Bruick and McKnight,2002; Jiang et al., 1997; Pugh et al., 1997). Each esHIF-α predicted proteinhas this Pro (residue 567, 405 and 479, respectively) and Asn (residue800, 841 and 588, respectively) in their respective N-TAD and C-TADsuggesting that mechanisms of stabilization and, thus, regulation ofHIF-α in seals are consistent with other mammals. Finally, the nuclearlocalization signal (NLS) necessary for HIF-α accumulation and translo-cation to the nucleus under hypoxic conditions is present in theN-terminal of each esHIF-α protein (residues 17–33, 14–30 and 1–16, re-spectively). The typical domains of HIF-α proteins observed in esHIF-αpredicted proteins here demonstrate that sealsmaintained the evolutionof a similar functional adaptation to hypoxia as in other vertebrates.Furthermore, the phylogenetic tree constructed in the present studydemonstrates that the HIF-α proteins were clustered with their

Fig. 5.Mean (±s.e.m.) mRNA levels of HIF-3α in A) adipose and B) muscle from fastedelephant seal pups. Asterisks denote significant (P b 0.05) differences from week 1.

161J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

respective protein homologues indicating that molecular evolution ofHIF-αmay be relatively slow among species.

The three esHIF-α mRNAs were detected and up-regulated in atissue-specific manner across the 7 weeks of fasting. Several studieshave demonstrated that HIF-α mRNA levels are expressed constitu-tively in a tissue-specific manner under normoxia and hypoxia condi-tions in mammals (Heidbreder et al., 2003; Law et al., 2006; Wieseneret al., 2003; Zhao et al., 2004), fish (Chen et al., 2012; Law et al., 2006;Shen et al., 2010; Soitamo et al., 2001) and crustaceans (Li andBrouwer, 2007; Soñanez-Organis et al., 2009). The mRNA expressionlevel of HIF-1αwas higher than that of HIF-2α and HIF-3α in adiposeandmuscle during the fast suggesting that HIF-1α is more sensitive tophysiological changes associated with prolonged fasting than the otherHIF-α isoforms. The observed tissue-specific increases in esHIF-1α, -2αand -3α mRNA levels demonstrate the responsiveness of these genesto prolonged fasting and suggest that HIF-α isoforms may contributeto the physiological regulation of metabolic functions in these tissues.Alternatively, because prolonged fasting is associated with a numberof physiological and development changes occurring simultaneouslythat were not accounted for independently, it is possible that thechanges in HIF-α isoforms were, at least in part, the result of develop-mental alterations. Regardless of the ultimate causative factor responsi-ble for the up-regulation of HIF-α, this up-regulation may ultimatelycontribute to the preparation of the seals for their ensuing diving life-style, which will be associated with frequent ischemic–reperfusionevents in peripheral tissues.

Adipose is a multifunctional tissue that participates in lipid metabo-lismand regulation of glucose homeostasis (Wronska andKmiec, 2012),

whereas skeletal muscle is a major site for the oxidation of fatty acidsand glucose, accounting for approximately 80% of insulin-stimulatedglucose uptake (Rasmussen and Wolfe, 1999; Sinacore and Gulve,1993). Another important distinction between adipose and musclewith respect to HIF-mediated functions may reside in the fact thatmuscle would bemore susceptible to ischemia-related hypoxia becauseof the high vascularization of muscle compared to adipose. Conversely,because the metabolism of the elephant seal is primarily dependenton lipid oxidation (derived from adipose), adipose in prolong-fastedseals is metabolically active. These distinctions may help explain thevariation in tissue expression of these genes during prolonged fasting.

The HIF-α genes are constitutively expressed and translated inde-pendent of altered cellular oxygen content, but regulated at the proteinlevel by post-translational modifications that tags HIF-α for their rapiddegradation (Ivan et al., 2001; Jaakkola et al., 2001; Yu et al., 2001). Thenuclear protein content of HIF-2α increased serially in adipose andmuscle over the 7 weeks of fasting, whereas HIF-1α and -3α were notdetected suggesting that HIF-2α may have a greater and preferentialcontribution to the transcriptional regulation of genes involved in themaintenance of cellular energy homeostasis during prolonged fasting.

Elephant seals remain submerged 90% of the time while at sea(Le Boeuf et al., 1996), and up to 60% of their time on land is spent insleep apneas (breath-hold episodes) (Blackwell and Le Boeuf, 1993;Castellini et al., 1988, 1994). At about week 7 of fasting (consistentwith the timing of sample collection in the present study), weanedpups increase the number and duration of apneas, and spend an averageof 12 h per day submerged in near-shore pools similar in duration totheir terrestrial sleep apneas (Thorson and Le Boeuf, 1994). Sleepapneas in seals cause periodic decreases in arterial bloodO2 or intermit-tent hypoxia (IH) (Ponganis et al., 2006, 2008; Stockard et al., 2007).Several studies have demonstrated that HIF-1α functions as a physio-logical mediator of the protective effects of ischemic preconditioning(Bergeron et al., 2000; Grimm et al., 2005; Semenza, 2000). Similarly,studies in seals suggest that apneas (resting- or submergence-induced) also contribute to preconditioning by activating the HIF-1-mediated adaptive response to hypoxia (Johnson et al., 2004, 2005;Vázquez-Medina et al., 2011; Zenteno-Savín et al., 2002). Because thetiming of the increase in the number and duration of sleep apneas infasting seals coincides with the nuclear accumulation of HIF-2α atweek 7, the activation of HIF-2 may up-regulate genes involved in theadaptive response to sleep apneas during their post-weaning fast.

HIF-1 and HIF-2 regulate several other genes associated withmaintenance of homeostasis during hypoxia including those encodingVEGF and enzymes associated with glucose transport and metabolism(i.e., LDH) (Semenza and Prabhakar, 2007). VEGF is involved in vasculardevelopment, angiogenesis and arteriogenesis (Cao, 2010; Christiaensand Lijnen, 2010; Crandall et al., 1997; Hausman and Richardson,2004), whereas LDH produces lactate from pyruvate in the last step ofanaerobic glycolysis (Markert et al., 1975). The maturation of skeletalmuscle in seal pups is important for the development of their divingcapacity, and is characterized by an increase in oxygen storage capacity(myoglobin content), acid buffering capacity, and aerobic enzymeactivities (Kanatous et al., 2002, 2008). The increase in mRNA levels ofadipose and/or muscle VEGF along with the nuclear accumulationof HIF-2α suggests that HIF-2 contributes to adipose metabolism andmuscle development by up-regulation of VEGF during prolongedfasting in elephant seals.

Fatty acid oxidation of the extensive fat stores of elephant sealaccounts for 90%–95% of their metabolic expenditures (Adams andCosta, 1993; Castellini et al., 1987; Ortiz et al., 1978) and contributesto the maintenance of their relatively high plasma glucose concentra-tions (Champagne et al., 2012; Houser et al., 2012; Keith and Ortiz,1989) during their fast. Furthermore, many of the metabolic featuresfound in fasting elephant seals are consistent with HIF upregulationincluding high rates of glycolytic flux, lactate production and pyru-vate cycling with low rates of glucose oxidation (Champagne et al.,

Fig. 6. Mean (±s.e.m.) mRNA levels of LDH in A) adipose and B) muscle, and of VEGF in C) adipose and D) muscle from fasted elephant seal pups. Asterisks denote significant(P b 0.05) differences from week 1.

162 J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

2012; Houser et al., 2012). The decrease in mRNA level of muscle LDHafter 5 and 7 weeks of fasting which suggests differential tissue-expression of LDH genes (-A, -B and -C) is known in mammals(Ebert et al., 1996; McClelland and Brooks, 2002). The increase inmRNA levels of adipose LDH is associated with the nuclear accumula-tion of HIF-2α suggesting that HIF-2 contributes to glucose metabo-lism via the up-regulation of glycolytic genes such as LDH.

In summary, we identified and characterized three distinct HIF-αisoforms (esHIF-1α, esHIF-2α and esHIF-3α) in the northern elephantseal. The comparison of esHIF-α isoforms with their respective proteinhomologues in other mammals indicates that the molecular struc-tures of these proteins are highly conserved throughout evolution,likely conferring conservation of their cellular functions in elephantseals. The results demonstrate that prolonged fasting up-regulatesHIF-1α, -2α and -3α in a tissue-specific manner in elephant sealpups. The increase in HIF-2α mRNA and nuclear accumulation inadipose and muscle along with the increase in LDH and VEGF mRNAsuggests that HIF-2α, more so than the other two isoforms, contrib-utes to metabolic adaptation to prolonged fasting. These features ofHIF activation may provide one of the principal cellular mechanismsthat elephant seals evolved to maintain their energetic metabolismas a component to their natural adaptation to prolonged fasting orto the metabolic alterations associated with sleep-induced apneas.

Funding

J.G.S.-O. is supported by a postdoctoral fellowship from the Universityof California Institute for Mexico and the United States and Mexico'sNational Council for Science and Technology (UC MEXUS-CONACYT).J.P.V.-M. is supported by fellowships from the UC MEXUS-CONACYT andThe University of California (Miguel Velez Fellowship, UC Merced GRC).R.M.O. is partially supported by a Career Development Award from theNational Institutes of Health National Heart, Lung and Blood Institute(NIH NHLBI K02HL103787). This research was funded by grants fromthe NIH NHLBI (R01HL91767) and UC MEXUS-CONACYT.

Conflict of interest

The authors declare that there are no conflicts of interest.

Acknowledgments

We thank M. Tift, J. Viscarra and R. Rodriguez for their help withsample collection.

References

Adams, S.H., Costa, D.P., 1993. Water conservation and protein metabolism in northernelephant seal pups during the postweaning fast. J. Comp. Physiol. B 163, 367–373.

Altschull, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignmentsearch tool. J. Mol. Biol. 215, 403–410.

Bergeron, M., Gidday, J.M., Yu, A.Y., Semenza, G.L., Ferriero, D.M., Sharp, F.R., 2000. Roleof hypoxia inducible factor 1 in hypoxia induced ischemic tolerance in neonatal ratbrain. Ann. Neurol. 48, 285–296.

Blackwell, S.B., Le Boeuf, B.J., 1993. Developmental aspects of sleep apnea in northernelephant seals, Mirounga angustirostris. J. Zool. 231, 437–447.

Bruick, R.K., McKnight, S.L., 2001. A conserved family of prolyl-4-hydroxylases thatmodify HIF. Science 294, 1337–1340.

Bruick, R.K., McKnight, S.L., 2002. Transcription. Oxygen sensing gets a second wind.Science 295, 807–808.

Cao, Y., 2010. Adipose tissue angiogenesis as a therapeutic target for obesity andmetabolicdiseases. Nat. Rev. Drug Discov. 9, 107–115.

Castellini, M.A., Costa, D.P., Huntley, A.C., 1987. Fatty acid metabolism in fasting elephantseal pups. J. Comp. Physiol. B 157, 445–449.

Castellini, M.A., Davis, R.W., Kooyman, G.L., 1988. Blood chemistry regulation duringrepetitive diving in Weddell seals. Physiol. Zool. 61, 379–386.

Castellini, M.A., et al., 1994. Patterns of respiration and heart rate during wakefulnessand sleep in elephant seal pups. Am. J. Physiol. Regul. Integr. Comp. Physiol. 266,R863–R869.

Champagne, C.D., Houser, D.S., Fowler, M.A., Costa, D.P., Crocker, D.E., 2012. Gluconeo-genesis is associated with high rates of tricarboxylic acid and pyruvate cycling infasting northern elephant seals. Am. J. Physiol. Regul. Integr. Comp. Physiol. 303,340–352.

Chen, N., et al., 2012. Molecular characterization and expression analysis of threehypoxia-inducible factor alpha subunits, HIF-1alpha/2alpha/3alpha of the hypoxia-sensitive freshwater species, Chinese sucker. Gene 498, 81–90.

Christiaens, V., Lijnen, H.R., 2010. Angiogenesis and development of adipose tissue.Mol. Cell. Endocrinol. 318, 2–9.

163J.G. Soñanez-Organis et al. / Gene 526 (2013) 155–163

Comerford, K.M., Wallace, T.J., Karhausen, J., Louis, N.A., Montalto, M.C., Colgan, S.P.,2002. Hypoxia-inducible factor-1-dependent regulation of the multidrug resistance(MDR1) gene. Cancer Res. 62, 3387–3394.

Crandall, D.L., Hausman, G.J., Kral, J.G., 1997. A review of the microcirculation of adiposetissue: anatomic, metabolic, and angiogenic perspectives. Microcirculation 4, 211–232.

Ebert, B.L., Gleadle, J.M., O'Rourke, J.F., Bartlett, S.M., Poulton, J., Ratcliffe, P.J., 1996.Isoenzyme-specific regulation of genes involved in energy metabolism by hypoxia:similarities with the regulation of erythropoietin. Biochem. J. 313, 809–814.

Epstein, A.C., et al., 2001. C. elegans EGL-9 and mammalian homologs define a family ofdioxygenases that regulate HIF by prolyl hydroxylation. Cell 107, 43–54.

Grimm, C., et al., 2005. Neuroprotection by hypoxic preconditioning: HIF-1 and eryth-ropoietin protect from retinal degeneration. Semin. Cell Dev. Biol. 16, 531–538.

Hausman, G.J., Richardson, R.L., 2004. Adipose tissue angiogenesis. J. Anim. Sci. 82, 925–934.Heidbreder, M., Fröhlich, F., Jöhren, O., Dendorfer, A., Qadri, F., Dominiak, P., 2003.

Hypoxia rapidly activates HIF-3α mRNA expression. FASEB J. 17, 1541–1543.Houser, D.S., Crocker, D.E., Champagne, C.D., 2012. Glucose oxidation and non-oxidative

glucose disposal during prolonged fasts of the northern elephant seal pup (Miroungaangustirostris). Am. J. Physiol. Regul. Integr. Comp. Physiol. 303, R562–R570.

Ivan, M., et al., 2001. HIFa targeted for VHL-mediated destruction by proline hydroxylation:implications for O2 sensing. Science 292, 464–468.

Jaakkola, P., et al., 2001. Targeting of HIF-a to the von Hippel–Lindau ubiquitylationcomplex by O2 regulated prolyl hydroxylation. Science 292, 468–472.

Jewell, U.R., Kvietikova, I., Scheid, A., Bauer, C., Wenger, R.H., Gassmann, M., 2001. Inductionof HIF-1α in response to hypoxia is instantaneous. FASEB J. 15, 1312–1314.

Jiang, B.H., Zheng, J.Z., Leung, S.W., Roe, R., Semenza, G.L., 1997. Transactivation andinhibitory domains of hypoxia-inducible factor 1a. Modulation of transcriptionalactivity by oxygen tension. J. Biol. Chem. 272, 19253–19260.

Johnson, P., Elsner, R., Zenteno-Savín, T., 2004. Hypoxia-inducible factor in ringed seal(Phoca hispida) tissues. Free Radic. Res. 38, 847–854.

Johnson, P., Elsner, R., Zenteno-Savín, T., 2005. Hypoxia-inducible factor 1 proteomicsand diving adaptations in ringed seal. Free Radic. Biol. Med. Res. 39, 205–212.

Kanatous, S.B., Davis, R.W., Watson, R., Polasek, L., Williams, T.M., Mathieu-Costello, O.,2002. Aerobic capacities in the skeletal muscles of Weddell seals: key to longerdive durations? J. Exp. Biol. 205, 3601–3608.

Kanatous, S.B., et al., 2008. The ontogeny of aerobic and diving capacity in the skeletalmuscles of Weddell seals. J. Exp. Biol. 211, 2559–2565.

Keith, E.O., Ortiz, C.L., 1989. Glucose kinetics in neonatal elephant seals duringpostweaning aphagia. Mar. Mamm. Sci. 5, 99–115.

Law, S., Wu, R., Ng, P., Yu, R., Kong, R., 2006. Cloning and expression analysis of two distinctHIF-alpha isoforms – gcHIF-1alpha and gcHIF-4alpha – from the hypoxia-tolerant grasscarp, Ctenopharyngodon idellus. BMC Mol. Biol. 7, 1186–1471.

Le Boeuf, B.J., Morris, P.A., Blackwell, S.B., Crocker, D.E., Costa, D.P., 1996. Diving behaviorof juvenile northern elephant seals. Can. J. Zool. 74, 1632–1644.

Li, T., Brouwer, M., 2007. Hypoxia-inducible factor, gsHIF, of the grass shrimp Palaemonetespugio: molecular characterization and response to hypoxia. Comp. Biochem. Physiol.B147, 11–19.

Markert, C.L., Shaklee, J.B., Whitt, G.S., 1975. Evolution of a gene. Multiple genes for LDHisozymes provide a model of the evolution of gene structure, function and regulation.Science 189, 102–114.

McClelland, G.B., Brooks, G.A., 2002. Changes in MCT 1, MCT 4, and LDH expression aretissue specific in rats after long-term hypobaric hypoxia. J. Appl. Physiol. 92,1573–1584.

Morgenstern, B., Atchley, W.R., 1999. Evolution of bHLH transcription factors: modularevolution by domain shuffling? Mol. Biol. Evol. 16, 1654–1663.

Nordal, R.A., Nagy, A., Pintilie, M., Wong, C.S., 2004. Hypoxia and hypoxia-induciblefactor-1 target genes in central nervous system radiation injury: a role for vascularendothelial growth factor. Clin. Cancer Res. 10, 3342–3353.

Ortiz, C.L., Costa, D., Le Boeuf, B.J., 1978. Water and energy flux in elephant seal pupsfasting under natural conditions. Physiol. Zool. 51, 166–178.

Ponganis, P.J., Stockard, T.K., Levenson, D.H., Berg, L., Baranov, E.A., 2006. Cardiac outputand muscle blood flow during rest-associated apneas of elephant seals. Comp.Biochem. Physiol. A Mol. Integr. Physiol. 144, 105–111.

Ponganis, P.J., et al., 2008. Blood flow and metabolic regulation in seal muscle duringapnea. J. Exp. Biol. 211, 3323–3332.

Prabhakar, N.R., Kumar, G.K., Nanduri, J., 2009. Intermittent hypoxia-mediated plasticity ofacute O2 sensing requires altered red-ox regulation by HIF-1 and HIF-2. Ann. N. Y.Acad. Sci. 1177, 162–168.

Prabhakar, N.R., Kumar, G.K., Nanduri, J., 2010. Intermittent hypoxia augments acutehypoxic sensing via HIF-mediated ROS. Respir. Physiol. Neurobiol. 174, 230–234.

Pugh, C.W., O'Rourke, J.F., Nagao, M., Gleadle, J.M., Ratcliffe, P.J., 1997. Activation ofhypoxia-inducible factor-1; definition of regulatory domains within the a subunit.J. Biol. Chem. 272, 11205–11214.

Rasmussen, B.B., Wolfe, R.R., 1999. Regulation of fatty acid oxidation in skeletal muscle.Annu. Rev. Nutr. 19, 463–484.

Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologistprogrammers. Methods Mol. Biol. 132, 365–386.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, N.Y.

Semenza, G.L., 1994. Transcriptional regulation of gene expression: mechanisms andpathophysiology. Hum. Mutat. 3, 180–199.

Semenza, G.L., 1998. Hypoxia-inducible factor 1: master regulator of O2 homeostasis.Curr. Opin. Genet. Dev. 8, 588–594.

Semenza, G.L., 2000. HIF-1: mediator of physiological and pathophysiological responsesto hypoxia. J. Appl. Physiol. 88, 1474–1480.

Semenza, G.L., Prabhakar, N.R., 2007. HIF-1-dependent respiratory, cardiovascular, andredox responses to chronic intermittent hypoxia. Antioxid. Redox Signal. 9, 1391–1396.

Semenza, G.L., Roth, P.H., Fang, H.M., Wang, G.L., 1994. Transcriptional regulation ofgenes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem.269, 23757–23763.

Semenza, G.L., et al., 1996. Hypoxia response elements in the aldolase A, enolase 1, andlactate dehydrogenase A gene promoters contain essential binding sites forhypoxia-inducible factor 1. J. Biol. Chem. 271, 32529–32537.

Semenza, G.L., et al., 1997. Structural and functional analysis of hypoxia-inducible factor 1.Kidney Int. 51, 553–555.

Shen, R.J., Jiang, X.Y., Pu, J.W., Zou, S.M., 2010. HIF-1α and -2α genes in a hypoxiasensitiveteleost species Megalobrama amblycephala: cDNA cloning, expression and differentresponses to hypoxia. Comp. Biochem. Physiol. B157, 273–280.

Sinacore, D.R., Gulve, E.A., 1993. The role of skeletal muscle in glucose transport, glucosehomeostasis, and insulin resistance: implications for physical therapy. Phys. Ther. 73,878–891.

Soitamo, A.J., Rabergh, C.M., Gassmann, M., Sistonen, L., Nikinmaa, M., 2001. Characteriza-tion of a hypoxia-inducible factor (HIF-1alpha) from rainbow trout. Accumulation ofprotein occurs at normal venous oxygen tension. J. Biol. Chem. 276, 19699–19705.

Soñanez-Organis, J.G., Peregrino-Uriarte, A.B., Goméz-Jiménez, S., López-Zavala, A.,Forman, H.J., Yepiz-Plascencia, G., 2009. Molecular characterization of hypoxiainducible factor-1 (HIF-1) from the white shrimp Litopenaeus vannamei and tissuespecific expression under hypoxia. Comp. Biochem. Physiol. C150, 395–405.

Stockard, T., Levenson, D., Berg, L., Fransioli, J., Baranov, E., Ponganis, P., 2007. Bloodoxygen depletion during rest-associated apneas of northern elephant seals (Miroungaangustirostris). J. Exp. Biol. 210, 2607–2617.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. Molecular Evolutionary Genetics Analysis(MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

Taylor, B.L., Zhulin, I.B., 1999. PAS domains: internal sensors of oxygen, redox potentialand light. Microbiol. Mol. Biol. Rev. 63, 479–506.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity ofprogressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Thorson, P.H., Le Boeuf, B.J., 1994. Developmental aspects of diving in northern elephantseal pups. In: Le Boeuf, B.J., Laws, R.M., Le Boeuf, B.J., Laws, R.M. (Eds.), Elephant Seals:Population Ecology, Behavior, and Physiology. University of California Press, Berkeley,CA, pp. 271–289.

Vázquez-Medina, J.P., Crocker, D.E., Forman, H.J., Ortiz, R.M., 2010. Prolonged fastingdoes not increase oxidative damage or inflammation in postweaned northernelephant seal pups. J. Exp. Biol. 213, 2524–2530.

Vázquez-Medina, J.P., Zenteno-Savín, T., Tift, M.S., Forman, H.J., Crocker, D.E., Ortiz,R.M., 2011. Apnea stimulates the adaptive response to oxidative stress in elephantseal pups. J. Exp. Biol. 214, 4193–4200.

Voronova, A., Baltimore, D., 1990. Mutations that disrupt DNA binding and dimerformation in the E47 helix–loop–helix protein map to distinct domains. Proc.Natl. Acad. Sci. U. S. A. 87, 4722–4726.

Wang, G.L., Jiang, B.H., Rue, E.A., Semenza, G.L., 1995. Hypoxia-inducible factor 1 is abasic-helix–loop–helix–PAS heterodimer regulated by cellular O2 tension. Proc.Natl. Acad. Sci. U. S. A. 92, 5510–5514.

Wenger, R.H., Gassmann, M., 1997. Oxygen(es) and the hypoxia-inducible factor-1.Biol. Chem. 378, 609–616.

Wiesener, M.S., et al., 2003. Widespread hypoxia-inducible expression of HIF-2alpha indistinct cell populations of different organs. FASEB J. 17, 271–273.

Wronska, A., Kmiec, Z., 2012. Structural and biochemical characteristics of variouswhite adipose tissue depots. Acta Physiol. 205, 194–208.

Yu, F., White, S.B., Zhao, Q., Lee, F.S., 2001. HIF-1a binding to VHL is regulated by stimulussensitive proline hydroxylation. Proc. Natl. Acad. Sci. U. S. A. 98, 9630–9635.

Zagorska, A., Dulak, J., 2004. HIF-1: the knowns and unknowns of hypoxia sensing. ActaBiochim. Pol. 51, 563–585.

Zenteno-Savín, T., Clayton-Hernandez, E., Elsner, R., 2002. Diving seals: are they amodel for coping with oxidative stress? Acta Biochim. Physiol. C133, 527–536.

Zhao, T.B., et al., 2004. Cloning of hypoxia-inducible factor 1α cDNA from a high hypoxiatolerant mammal—plateau pika (Ochotona curzoniae). Biochem. Biophys. Res. Commun.316, 565–572.