at SciVerse ScienceDirect

Plant Physiology and Biochemistry 50 (2012) 24e34

Contents lists available

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

Potato cytosine methylation and gene expression changes induced by a beneficialbacterial endophyte, Burkholderia phytofirmans strain PsJN

Kedong Da a, Jerzy Nowak b, Barry Flinn a,b,*

a Institute for Sustainable and Renewable Resources, Institute for Advanced Learning and Research, 150 Slayton Avenue, Danville, VA 24540, USAbDepartment of Horticulture, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA

a r t i c l e i n f o

Article history:Received 18 August 2011Accepted 23 September 2011Available online 5 October 2011

Keywords:PotatoEndophyteBurkholderia phytofirmans strain PsJNMSAPDNA methylationGene expression

* Corresponding author. Institute for SustainableInstitute for Advanced Learning and Research, 150 S24540, USA. Tel.: þ1 434 766 6770.

E-mail address: barry.flinn@ialr.org (B. Flinn).

0981-9428/$ e see front matter � 2011 Elsevier Masdoi:10.1016/j.plaphy.2011.09.013

a b s t r a c t

Burkholderia phytofirmans strain PsJN is a highly effective plant-beneficial endophyte. We have useda combination of capillary electrophoresis and methylation-sensitive amplification length polymorphism(CE-MSAP) analysis to investigate the potato genomic DNA cytosine methylation changes that occur inresponse to PsJN bacterization. Six weeks after PsJN inoculation, over 6800 loci were identified andassessed in two in vitro grown potato varieties, the strongly-responsive Red Pontiac and the poorly-responsive Superior. Compared to non-bacterized control, bacterized Red Pontiac exhibited littlechange in the overall cytosine methylation, although methylation polymorphisms did occur. In contrast,poorly-responsive Superior exhibited significantly higher levels of overall cytosine methylation anda decrease in the number of non-methylated sites in the bacterized plants compared to controls. Superiorhad significantly higher DNA methylation and DNA hyper-methylation than Red Pontiac, suggesting thatenhanced DNA loci methylation is involved in the suppression of PsJN-induced plant growth stimulation.Several DNA fragments, corresponding to different open reading frames exhibiting methylation poly-morphisms in Red Pontiac or Superior were sequenced. Gene expression analysis of a subset of thosegenes was carried out using real time PCR. We identified several genes whose transcript levels wereeither enhanced or decreased in response to PsJN in a variety-specific way, as well as genes that werespecifically enhanced in both varieties in response to the endophyte.

� 2011 Elsevier Masson SAS. All rights reserved.

1. Introduction

Microorganisms interact with plants through a multitude ofsignals involving both partners [42]. While plant-pathogen resis-tance and susceptibility have been key research areas, somemicrobial interactions have also been recognized as beneficial toplant life and productivity, with endophytes in particular [3,42].

Endophytes are defined as fungi or bacteria that cause unap-parent and asymptomatic infections of the interior of plant organsand tissues and live there through the entire, or part of their lifecycle [60]. Due to their positive effects on host plants, plant growth-promoting endophytes (PGPEs) have high potential for use inorganic agriculture [32]. Although the mechanisms of theseplantemicrobe interactions still remain unclear, there has beenrapid progress in our understanding of the physiological and

and Renewable Resources,layton Avenue, Danville, VA

son SAS. All rights reserved.

biochemical effects of beneficial bacteria/fungi on plant growth[33,58].

Over several years, we have been researching the impact ofbacterial endophytes on potato growth and yield. Burkholderia phy-tofirmans strain PsJN [45], originally isolated and classified as a Pseu-domonas spp. contaminant from Glomus vesiculiferum-infected onionroots [36] has been shown to dramatically affect the growth of potato,tomato and grapevine plantlets. Furthermore, PsJN-bacterized potatoplantlets exhibited greater tolerance to the pathogen Rhizoctoniasolani [36]. In subsequent studies [3,15,16,36,58], PsJN has been oneofthe most effective bacterial PGPEs we have come across so far.

The potato response to PsJN is under genetic control, with somevarieties displaying the beneficial response to the endophyte, whileothers do not [5,36,37]. Using monoploid lines derived from antherculture of a diploid Solanum phureja clone, Nowak et al. [37] notedthat the monoploid lines exhibited a response to PsJN ranging fromfavorable to neutral to unfavorable, while the diploid antherdonor’s (BARD 1e3) response to bacterization was comparable tothe highly-responsive variety Red Pontiac. The assumption herewas that the response range of the monoploid population was dueto the segregation of alleles for genes involved in regulating the

Fig. 1. Growth response of the potato variety Red Pontiac to PsJN inoculationcompared to the non-bacterized control after 6 weeks of growth in vitro.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e34 25

positive or negative interaction with PsJN. However, the nature ofthis genetic control, as well as the molecular mechanisms associ-ated with these different genotypic responses were not studied.

The methylation of DNA has been detected in fungi, plants andanimals [63], where it serves as an epigenetic mechanism to regulategene expression. Cytosine residues in plant DNA are frequentlymethylated at the 5-position, yielding 5-methylcytosine (m5C), andthe ratio ofmethylated to total cytosines varies among species, rangingfrom 6% in Arabidopsis to 25% in maize [26,48]. The physiologicalfunctionofm5Chas longbeen amatter of debate, and a survey showedthat it plays a critical role in geneexpressionandepigenetic control [8].Overall, DNA methylation patterns change during plant development[10,23,28,43] and also vary in different plant organs [51,62,66].

In addition to an important role in plant development, there isa correlation between plant DNA methylation and responses toabiotic/biotic stimuli. Cold treatments, which result in a reductionin root DNA methylation [48], can also lead to the global inductionof root-expressed genes [49]. Dyachenko et al. [20] demonstrateda two-fold increase in nuclear genome cytosine methylation ofMesembryanthemum crystallinum plants when exposed to highsalinity. Cytosine methylation alterations were also found duringplant responses to pathogens [1]. In contrast to pathogen studies,little has been reported on cytosine methylation changes occurringin plants in response to beneficial microbial endophytes.

Several methods have been used to study DNA methylation,including bisulfate sequence analysis [24], restriction enzymeanalysis [9] and methylation sensitive amplification length poly-morphism (MSAP) [41,62]. MSAP is a molecular marker-basedmethodology adapted from amplified fragment length poly-morphism (AFLP) technology [56], which has proven to bea powerful tool for DNA methylation analysis.

In this study, DNA cytosine methylation changes in PsJN-inoculated potato varieties were evaluated using capillary electro-phoresis and methylation-sensitive amplification length poly-morphism (CE-MSAP) analysis. Over 6800 loci were identified andassessed for DNA methylation in PsJN-responsive and poorly-responsive potato varieties. Several of the identified polymorphicbands were sequenced and analyzed, gene expression was evalu-ated for eight of these genes using real time PCR. The effects of PsJNbacterization on plant growth, DNA methylation, and geneexpression are discussed in an attempt to elucidate the molecularmechanisms involved in this PGPEepotato interaction.

2. Results

2.1. Potato plant response to PsJN inoculation

We assessed variation in the DNA cytosinemethylation betweentwo potato varieties differing in their responsiveness to B. phyto-firmans strain PsJN (PsJN). A typical positive response to the endo-phyte, demonstrated by Red Pontiac (good responder) six weeksafter inoculation, is presented in Fig. 1. Bacterized Red Pontiacshowed significant growth increase (shoot length, shoot and rootfresh weight) over the non-bacterized controls (Fig. 2). At six weekspost-inoculation, the bacterized plants exhibited a 68% increase inshoot length,125% increase in shoot freshweight and 108% increasein root fresh weight over controls. Furthermore, the stems of thebacterized plants appeared more robust. In contrast, no significantdifferences in plant growth were recorded between bacterized andcontrol plants in the poor-responding Superior (Fig. 2).

2.2. DNA methylation profiles in PsJN-inoculated and control plants

Thirty-two pairs of primers were used with our MSAP system todetect cytosine methylation at 50-CCGG-30 loci in potato plants,

from both varieties following PsJN and control treatments. A total of3085 and 3766 MSAP fragments were amplified from Red Pontiacand Superior, respectively (Table 2), which enabled the detection ofDNA methylation patterns. Given the differences in sensitivity ofHpaII and MspI to cytosine methylation, full methylation of theinternal cytosine of 50-CCGG-30 would lead to the appearance offragments in the amplification products generated by the EcoRI/MspI digest, but not in the amplification products generated by theEcoRI/HpaII digest. Similarly, hemi-methylation of the externalcytosine at 50-CCGG-30 would lead to the appearance of fragmentsin the amplification products generated by the EcoRI/HpaII digest,but not in the amplification products generated by the EcoRI/MspIdigest.

There were clear varietal differences in cytosine methylation atsix weeks after PsJN inoculation. The percentage of DNA fragmentsexhibiting cytosine methylation in Red Pontiac and Superiorcontrol plants were, respectively, 70 and 61%, and 74 and 80% in thebacterized (Fig. 3). Moreover, a major decrease in the number ofnon-methylated fragments occurred in the bacterized Superior(Fig. 3). Hence, our detected overall cytosine methylation changesconfirmed that varietal differences exist prior to, and followingendophyte inoculation, with the poorly-responsive variety Superiorshowing increased cytosinemethylation at CCGG loci in response toPsJN.

2.3. DNA cytosine methylation type changes after PsJN inoculation

PsJN-responsive Red Pontiac exhibited a larger proportion ofsites with no change in their methylation status due to bacteriza-tion (Table 2 e Types A1 þ A2) as well as had a larger proportion ofsites showing reduced- or hypo-methylation (Hypo-M). In some

Table 1Primers used in MSAP analysis. List of AFLP primers and adapters used. DNAsequences are given in the 50e30 orientation unless otherwise indicated.

Primers/adapters Sequences (50e30)

EcoRI adapter 50-CTCGTAGACTGCGTACC-30;30-CATCTGACGCATGGTTAA-50

EcoRI þ 1 primer GACTGCGTACCAATTCþA

EcoRI þ 2 primers þAG (E1)þAC (E2)þAT (E3)þAA (E4)

HpaII/MspI adapter 50-GATCATGAGTCCTGCT-30

30-AGTACTCAGGACGAGC-50

HpaII/MspI þ 1 primer ATCATGAGTCCTGCTCGGþA

HpaII/MspI þ 3 primer þAACþAAGþACAþACCþACGþACTþATGþATT

Fig. 2. Shoot height (a), shoot fresh weight (b) and root fresh weight (c) of PsJNinoculated (bacterized) and control plantlets at 6 weeks of growth. Bars indicatestandard error (SE).

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e3426

cases undetectable CCGG site methylation in control plants wasconverted into detectable in the bacterized plants (Table 2 e TypesB1 þ B2). A slight increase in DNA fragment methylation in PsJN-treated Red Pontiac (Fig. 3) could be attributed to an increase ininternal cytosine methylation at some CCGG sites (Table 2 e TypeC1), and perhaps to the conversion of undetectable methylation atsites which became internally methylated following inoculation(Table 2 e Type B1). In contrast to Red Pontiac, Superior exhibitedincreased levels of CCGG hyper-methylation of existing methylatedsites, as well of the methylation of previously non-methylated sites.Hence, the change in overall CCGG locus methylation in the non-PsJN-responsive Superior was due to increased methylation ofloci in Superior, and more active de-methylation of loci in RedPontiac.

2.4. Analysis of polymorphic fragment sequences

In order to identify the methylation polymorphisms foundabove, variousMSAP reactions were analyzed using polyacrylamidegel electrophoresis (Fig. 4). The different polymorphic bands wereseparated, isolated, cloned and sequenced. The polymorphic frag-ment sequences were subjected to BLAST analysis against the Sol-anaceae Genomics Network (SGN) database (http://solgenomics.net/). If no significant hits were identified, they were queriedagainst NCBI’s GenBank database (http://www.ncbi.nlm.nih.gov/genbank/). A total of 162 fragments were cloned and sequenced,with 6% showing homology to PsJN (bacterial) sequences, 72%showing no identifiable homology, and 21% showing homology toputative open reading frames (ORFs). The information forsequences corresponding to 30 identified or predicted plant ORFs ispresented in Table 3. These ORFs represent different proteinproducts with a variety of functions, including signal transduction(protein kinases, serine/threonine kinase, receptor-like kinase,transcription factors, caldesmon, calmodulin), general metabolism(cytochrome P450, sesquiterpene synthase, Diminuto/Dwarf1,gibberellin 2-oxidase, senescence-related gene 1), stress response(ascorbate peroxidase, stress-responsive proline dehydrogenase,dehydrin, disease resistance protein, heat stress transcription factor8, nematode resistance-like protein), protein synthesis/degradation(ribosomal RNA gene, seven in absentia protein, serine protease)and cell wall modification (xyloglucan endotransglucosylase/hydrolase 4 and 12). When these different DNA sequences wereassessed for CCGG methylation changes that occurred in responseto PsJN inoculation, some interesting patterns were observed.Following inoculation, the identified protein kinase-associated lociexhibited no change in CCGG methylation or hypo-methylation(receptor-like kinase) in the PsJN-responsive Red Pontiac(Table 3). In contrast, these loci displayed increased methylation/hyper-methylation in the poorly-responsive Superior. Similarly,following PsJN inoculation the identified three transcription factorsequences (heat stress transcription factor 8, transcription factorB3, AT-hook motif-containing DNA binding protein) exhibitedincreased CCGG site methylation in Superior, but not/or less in RedPontiac. Almost all CCGG loci associated with the general proteinmetabolism genes exhibited hypo-methylation in Red Pontiacfollowing PsJN inoculation.

2.5. Expression of selected candidate genes to PsJN inoculation andrelationship between gene expression changes and DNA methylation

Eight sequences were selected from several of the identifiedORFs exhibiting polymorphic sequence methylation following PsJNinoculation, and their gene expression patterns evaluated usingreal time PCR (Fig. 5). The three identified protein kinases(SGN-U598659, SGN-U566915, SGN-U282798) showed very little

Table 2DNA methylation pattern and the pattern change in control- and PsJN-inoculated plants detected using 32 primer combinations.

CCGG Methylation Status inControl- and PsJN-Treated

Other Comments MethylationType

Number of Site Fragments and Percentage of Total

Red Pontiac Superior

Pattern from Control / PsJN Bands % Bands %

CmC / CmC The PsJN inoculation has no influence on methylation A1 308 9.9 97 2.6CmC / hmCC Internal methylation change to external hemi-methylation Hypo-M 38 1.2 62 1.6CmC / DBE Different eventualities including decreasing or increasing

of CCGG loci methylationHyper-M 694 22.3 998 26.5

CmC / CC De-methylation of the internal cytosine Hypo-M 121 3.9 89 2.4hmCC / CmC External hemi-methylation change to internal methylation Hyper-M 26 0.8 14 0.4hmCC / hmCC The PsJN inoculation has no influence on methylation A2 28 0.9 105 2.8hmCC / DBE Increased methylation of CCGG loci Hyper-M 285 9.2 427 11.3hmCC / CC De-hemi-methylation of the external cytosine Hypo-M 27 0.9 61 1.6DBE / CmC Different eventualities including decreasing or increasing

of CCGG loci methylationB1 172 5.5 58 1.5

DBE / hmCC Different eventualities including decreasing or increasingof CCGG loci methylation

B2 113 3.6 135 3.6

DBE / DBE e

DBE / CC Decreased methylation of CCGG loci Hypo-M 315 10.1 230 6.1CC / CmC Methylation of the internal cytosine C1 211 6.8 105 2.8CC / hmCC Hemi-methylation of the external cytosine C2 82 2.6 318 8.4CC / DBE Increased methylation of CCGG loci C3 378 12.1 713 18.9CC / CC No methylation of CCGG loci Non 316 10.1 355 9.4

Internal DNA methylation (CmCGG); External DNA hemi-methylation (hmCCGG); Methylation cannot be detected (mCCGG or mCmCGG); No-methylation (CCGG). ‘A’, DNAmethylation status has no change; ‘B’, Undetectable DNA methylation changed into detectable DNA methylation, ‘C’, methylation appeared in PsJN-inoculated plants; ‘Hyper-M’, hyper-methylation; ‘Hypo-M’, hypo-methylation; ‘Non’, no methylation change. DBE: shortcut for ‘digestion blocking events’; states which are not digested by eitherMspIor HpaII.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e34 27

difference in gene expression between control and bacterized RedPontiac plants. On the other hand, significant increase in thesegenes expression was recorded in bacterized Superior plantscompared to controls. In direct contrast, the expression of GA2-oxidase (SGN-U578575) and stress-responsive proline dehydroge-nase (SGN-U578070) increased significantly in bacterized RedPontiac, but had undetectable level of expression in control plants.Both of these genes showed little difference in expression betweencontrol and bacterized Superior plants. Expression of thesenescence-related gene 1 (SGN-U565166) and the pepper EST(SGN-U204926) was significantly reduced in bacterized Red Pon-tiac relative to control plants, while little difference in these gene’sexpression was observed between control and bacterized Superior.Interestingly, gene expression for the disease resistance protein(SGN-U330174) increased in both Red Pontiac and Superior plantsinoculated with PsJN, suggesting a generic response of both geno-types to microbial infection.

The gene expression changes following PsJN inoculation werecompared with the CCGG methylation changes for each ORF

Fig. 3. Potato genomic DNA cytosine methylation status in bacterized and controlplants. Values refer to percentage of total DNA fragments detected that were deter-mined to be either non-methylated or methylated. Bars indicate SE.

following PsJN inoculation, and no specific relationship patterncould be inferred (Table 3, Fig. 5). When considering the threeprotein kinases, the increased transcript levels in bacterizedSuperior was paralleled by increased levels of methylation for all

Fig. 4. Representative MSAP band pattern profiles in bacterized and control plants ofpotato varieties Red Pontiac and Superior. DNA was digested by EcoRI/HpaII (E/H) orEcoRI/MspI (E/M). The arrows indicate methylation status change. L represents a 50 bpDNA ladder.

Table 3Polymorphic band cloned, sequenced, gene function and corresponding DNA methylation change in PsJN-inoculated plants.

Genbank or SGN*Accession Number

Putative Identity (Strongest Plant Prediction) Methylation Status After PsJN Treatmenta

Red Pontiac Superior

SGN-U598659 Protein kinase , :

SGN-U576741 Seven in absentia (sina) protein : : ,

NR_022795.1 Ribosomal RNA gene , : :

SGN-U272126 Cell elongation protein (DWARF1/Diminuto) , ;SGN-U578575 Gibberellin 2-oxidase ; :

SGN-U284227 Ankyrin repeat family protein , :

X67599.1 Heat stress transcription factor 8 : : :

SGN-U293128 Receptor-like kinase ; : :

SGN-U565166 Senescence-related gene 1 ; : :

SGN-U330174 Disease resistance protein ; ,

SGN-U199087 Dehydrin ; :

SGN-U277320 Caldesmon , :

SGN-U295192 Expressed protein , ,

SGN-U562981 Xyloglucan endotransglucosylase/hydrolase 12 , :

SGN-U273048 Nematode resistance-like protein , : :

SGN-U277506 Predicted protein , : :

SGN-U282798 Serine/threonine protein kinase , :

SGN-U204926 Pepper EST ; :

SGN-U282191 Potato EST , :

SGN-U278294 Transcription factor B3 family , :

SGN-U578070 Stress-responsive proline dehydrogenase , :

SGN-U577672 Sesquiterpene synthase ; ,

SGN-U563508 Calmodulin , : :

SGN-U570203 AT-hook motif DNA binding protein , : :

SGN-U279872 Serine protease , ;SGN-U566915 Protein kinase , :

SGN-U292611 Cytochrome P450 family ; :

SGN-U590975 Xyloglucan endotransglucosylase/hydrolase 4 , :

SGN-U277151 Ascorbate peroxidase ; :

SGN-U281464 Potato EST , :

*SGN ¼ Solanaceae Genomics Network: http://solgenomics.net/.a : ¼ Methylation, : : ¼ Hyper-methylation, ; ¼ Hypo-methylation, , ¼ No change.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e3428

three, suggesting increased locus methylation association withincreased gene expression. In contrast, the increased gene expres-sion for GA2-oxidase and stress-responsive proline dehydrogenasein bacterized Red Pontiac was associated with either decreasedmethylation (GA2-oxidase) or no methylation change (stress-responsive proline dehydrogenase), and increased methylation inSuperior, where little gene expression change was observedfollowing PsJN inoculation. In both the senescence-related gene 1and the pepper EST, decreased gene expression in bacterized RedPontiac was associated with decreased methylation, whileincreased methylation in bacterized Superior was associated withno significant change in gene expression. Hence, results for thesefour ORFs suggested that increased methylation was associatedwith no change in gene expression. Finally, while both Red Pontiacand Superior displayed increased disease resistance protein geneexpression following bacterization, this ORF exhibited decreasedmethylation in Red Pontiac, and no change in methylation inSuperior.

3. Discussion

DNA methylation has epigenetic and mutagenic effects onvarious cellular activities, including differential gene expression,chromatin inactivation, cell differentiation and genomic imprinting[4,8,25]. Furthermore, the conversion of cytosine residues to 5-methylcytosine represents a regulator of transcriptional activity,with increasedmethylation often associated with gene silencing. Inplants, cytosine methylation occurs at several sites, with CG, CHGand CHH (where H¼ A, C or T) sequences all displayingmethylation[22]. This DNA methylation occurs frequently in plant genomes,and plays a role in plant development [4,61,64]. In Arabidopsis,a progressive increase in genome methylation occurs during

development [43] with a correlation between the degree of DNAmethylation and gene expression level [64]. In potato, de-methylation of CCGG sequences is associated with the progresstowards tuber dormancy release, preceding the transcriptionalactivity of genes associated with meristem growth [28]. There isalso a correlation between plant DNAmethylation and responses toabiotic/biotic stimuli, including plantemicrobe interactions [46,57].In this study we examined genomic DNA cytosine methylationchanges and their effects on gene expression that occurred in theresponse to inoculation of two potato varieties, a strongly-responsive Red Pontiac and a poorly-responsive Superior, witha plant-beneficial endophyte, B. phytofirmans strain PsJN. Our intentwas to begin an examination of the genetic mechanisms involved ina plant/beneficial endophyte response. Furthermore, we hope thatthe information generated may be useful in the development ofmolecular markers for the breeding of PsJN-responsiveness, andthe associated plant performance enhancement.

In this current study, PsJN significantly stimulated growth of thepotato variety Red Pontiac, but had little impact on Superior, con-firming that the level of potato response to this strain of Bur-kholderia is under genetic control [5,36,37]. The bacteriumstimulated growth responses included development of a well-branched and enlarged root system, with more root hair, andlonger, thicker and sturdier stems containing higher lignin depositsaround the vascular system [36]. Such enhancements were notapparent for the poorly-responsive varieties, like Superior. Thedifferences in response between the highly-responsive and poorly-responsive plant genotypes may be mediated by differences in PsJNtiters, which reach much higher levels in highly-responsive geno-types [37]. This has relevance, as the bacterially-produced N-acyl-L- homoserine lactones (AHLs) helpmodulate cultivar-specific plantresponses [27,53].

Fig. 5. Real-time PCR gene expression profiles of 8 genes in 6 weeks-old bacterized and control plants of Red Pontiac and Superior. Bars indicate SE. Values were normalized againstalpha-tubulin, and made relative to the Superior control treatment (set as 1).

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e34 29

Following the confirmation of differential growth responses ofthe two potato varieties to PsJN, we explored cytosine methylationdifferences between the two varieties. Several mechanisms exist toassess cytosine methylation [6], and while MSAP analysis onlyallows an examination of methylation at CCGG loci, this method-ology has been used to assess cytosine methylation changes inseveral studies [18,29,44,46,50], and at least provides us witha preliminary assessment of the changes in potato cytosine meth-ylation in response to PsJN. Our initial results using MSAP analysisindicated that cytosine methylation pattern differences existed atCCGG sites between the two varieties in the absence of PsJN (non-bacterized). The existence of DNA sequence methylation poly-morphisms between different varieties is not surprising, as this isone reflection of genetic diversity, and has been reported forClementine [21], plantain [38] and rice [2]. Fang et al. [21] identifiedcytosine methylation pattern variation between 18 Clementinecultivars, with each cultivar exhibiting specific and relatively fixedmethylated CCGG sites, and suggested that DNA methylation maybe one of the main factors contributing to differences in agronomictraits between cultivars. As MSAPs have been used as markers inthe development of linkage maps with the aim of identifying eliteSorghum genes [19], it would be interesting to assess if any of the

methylation polymorphisms encountered between non-bacterizedRed Pontiac and Superior reflect loci contributing to initial endo-phyte responsiveness or non-responsiveness.

PsJN bacterization caused distinct changes in cytosine methyl-ation patterns in the two potato varieties. The highly-responsiveRed Pontiac exhibited only slight differences in the level of meth-ylation compared to the non-bacterized control. In contrast, thepoorly PsJN-responsive Superior exhibited a significant increase incytosine methylation over control. The varietal differences weredue to a higher level of methylation of CCGG loci in Superior, andenhanced de-methylation in Red Pontiac, suggesting that the poorresponsiveness of Superior was associated with increased CCGGlocus methylation.

The significance of DNA hypo-methylation in the activation ofplant stress-responsive genes was demonstrated in tobacco uponTMV infection [57] and in rice during the development of adultplant resistance against Xanthomonas oryzae [46]. Similarly, Ara-bidopsis plants exposed to Pseudomonas syringae exhibited exten-sive genomic DNA hypo-methylation, although their response didnot cause de-methylation of 5-methylcytosine residues equally[39], suggesting some methylation specificity associated withresponse to this pathogen. While these studies targeted pathogenic

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e3430

bacteria, less is known regarding the plant cytosine methylationchanges occurring in response to beneficial bacteria.

Our studies indicated significant differences in the cytosinemethylation profiles between the two non-bacterized potato vari-eties, and further pattern variation following PsJN bacterization. Itwas interesting that the types of genes that did show cytosinemethylation changes in our PsJN-responsive and poorly-responsivevarieties also included functions similar to the few describedpreviously [46], representing signal transduction (protein kinases,serine/threonine kinase, receptor-like kinase, transcription factors,caldesmon, calmodulin), and cell wall modification (xyloglucanendotransglucosylase/hydrolase 4 and 12). In addition, we alsoidentified changes in the cytosine methylation of genes associatedwith general metabolism (cytochrome P450, sesquiterpene syn-thase, Diminuto/Dwarf1, gibberellin 2-oxidase, senescence-relatedgene 1), stress response (ascorbate peroxidase, stress-responsiveproline dehydrogenase, dehydrin, disease resistance protein, heatstress transcription 8, nematode resistance-like protein) andprotein synthesis/degradation (ribosomal RNA gene, seven inabsentia protein, serine protease). All of these functional classes ofproteins would be expected to play a role in modulating processesrequired for the observed differential growth responses ofthe responsive/non-responsive potato varieties following PsJNbacterization.

The plant response to endophytes is highly dependent on theplant genotype, and involves the modulation of a wide range ofplant genes [42]. The expression of genes involved in carbonmetabolism, nitrogen assimilation, plant growth, and plant defensewere modified following inoculation of sugarcane with beneficialnitrogen-fixing endophytes [35]. The sugarcane receptor-likekinase SHR5 was down-regulated in plants in response to thebacteria, and the stronger the host response, the more significantthe decrease in SHR5 expression [55]. In addition, Cavalcante et al.[13] revealed that a putative ethylene receptor (SCER1) and 2putative ERF transcription factors (SCERF1 and 2) were exclusivelymodulated in plants inoculated with diazotrophic endophytes.SCER1 increased significantly, as did SCERF 2, while SCERF1decreased. During the interaction of the plant growth-promotingbacterium Bradyrhizobium sp. strain ORS278 with Arabidopsis, itwas noted that only one gene, a putative defensin, showedincreased transcription after bacterial colonization [12]. In contrast,a multitude of genes involved in defense response (i.e., cytochromeP450, disease resistance family protein), metabolism (i.e., starchphosphorylase, thiamine biosynthesis family protein), proteinfolding (i.e., heat shock protein 3, luminal binding protein), DNAmetabolism (i.e., RNA helicase), signal transduction (i.e., shaggy-related protein kinase, receptor-like protein kinase) and manyother functions were down-regulated. However, these results wereassessed at 24 h post-inoculation, and most likely representedtransitional gene expression changes taking place relatively earlyafter bacterization of host plants. In contrast, our analyses wereconducted 42 days post-inoculation, after the establishment ofendophytic populations within the potato plants [37].

Apart from our current study, little work has characterized DNAmethylation/gene expression changes associated with the PsJN-plant interaction. In a microarray study using a PsJN-responsivepotato variety Russet Burbank and the poorly-responsive Bionta,Trognitz et al. [53] identified a significantly larger number of 81 up-regulated and 159 down-regulated genes in Russet Burbank than inBionta (67 and 33, respectively), indicating that a large number ofgenes are differentially expressed in potato after PsJN-inoculation.These genes included many associated with defense, cell rescueand cell cycle/DNA processing, including a calmodulin-like gene(down-regulated in Russet Burbank, up-regulated in Bionta),various proteinase inhibitors, P450 hydroxylase, PR4 and

lipoxygenase (up-regulated in Russet Burbank, down-regulated inBionta). Bionta also exhibited some up-regulation of defense genesand down-regulation of photosynthesis genes, but to a much lesserextent. We identified 30 of the many polymorphic methylated locithat changed in response to PsJN as being similarly associated withthe defense, cell rescue and cell cycle/DNA processing genesdescribed above (caldesmon, calmodulin, disease resistanceprotein, nematode resistance-like protein, heat stress transcriptionfactor 8, stress-responsive proline dehydrogenase, cytochromeP450 family, AT-hook motif DNA binding protein).

In this current study, a subset of genes selected from the poly-morphic methylated loci that changed in response to PsJN, wasassessed for this endophyte’s effects on gene expression. Genesexpected to be involved in growth and developmental signaling(kinases, GA2-oxidase, senescence-related gene 1) were differen-tially expressed in response to PsJN bacterization. The three proteinkinases, which would be expected to be involved in signal trans-duction mechanisms, were more highly expressed in the poorly-responsive variety Superior following PsJN treatment, while theyshowed no significant increase in the highly-responsive variety RedPontiac following endophyte treatment, suggesting that someincreased kinase activity is involved in the signaling associatedwith the poor response of Superior. Various papers cited abovehave commented on the induction of defense response genesfollowing endophyte inoculation. Trognitz et al. [53] reported thatboth PsJN-responsive and non-responsive potato varieties dis-played increased transcript levels for defense-related genes, andwealso observed disease resistance protein transcript increase in bothhighly-responsive and poorly-responsive potato varieties.

We also observed a significant increase in stress-responsiveproline dehydrogenase transcripts in Red Pontiac, but no signifi-cant change in Superior following bacterization. Proline dehydro-genase is involved in proline degradation, and transcript levels arerepressed during stress situations, but induced during stressrecovery [54]. Hence, these results suggest that Ped Pontiac may beable to recovermore readily from the stress of bacterial inoculation/colonization, while Superior may not, contributing to the variationsin growth response between the two varieties. In addition, we alsonoted a significant decline in the transcript levels for thesenescence-related gene 1 in Red Pontiac following PsJN inocula-tion, but no significant changes in Superior following PsJN inocu-lation. This gene product represents a member of the Fe(II)/ascorbate oxidase superfamily, originally identified as beingexpressed during growth arrest and senescence in Arabidopsis [11],but also shown to be up-regulated in response to viral inoculationin susceptible plants [59]. It is possible that the significant down-regulation in Red Pontiac is associated with enhanced stresstolerance and lack of growth inhibition, allowing better growthperformance in response to the endophyte. The remaining genethat we carried out expression analysis for encoded a GA2-oxidase,involved in GA catabolism and a reduction in active GA content. Wenoted a significant increase in GA2-oxidase transcript levels in RedPontiac after inoculation with PsJN, but no significant increase intranscripts in Superior after PsJN inoculation, suggesting anincrease in GA2-oxidase associated with the growth promotiveeffect of PsJN on Red Pontiac. However, GA2-oxidase over-expression has been reported to reduce growth and biomass [7].We are unsure as to the relevance of the increased GA2-oxidaseexpression to the enhanced growth phenotype observed with RedPontiac in response to PsJN.

To identify genes undergoing methylation status modification,we concentrated on and identified transcribed regions thatexhibited methylation variation. Using a data set consisting ofCCGG loci within the transcribed regions of several genes we couldnot find a clear relationship between locus methylation and gene

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e34 31

expression. In some cases, increased methylation within an ORFwas associated with decreased transcript levels, and in other cases,was not. However, the gene set we used for gene expression anal-ysis was rather small. Promoter or enhancer region methylation iscommonly associated with gene suppression [47,64], although lessis known regarding the overall impact of exonic or transcribedregion methylation on gene expression and plant development.Some studies have shown that a large proportion of genes show CGmethylation within transcribed regions [14,22,31], which is moreprominent than in promoter regions [64,65]. In addition, thegenome-wide analysis of Arabidopsis indicated that genes meth-ylated in their transcribed regions tended to be highly expressedand constitutively active, while promoter-methylated genes hada higher degree of tissue-specific expression [64]. Exonic methyl-ation is correlated with reduced transcription efficiency [30,65]. Ithas been suggested that gene body methylation functions inblocking spurious transcription from cryptic promoters within genebodies, which could impair normal gene regulation [52]. Zilbermanet al. [65] reported that the size of a gene had an impact on theeffect of methylation, with methylation within a longer gene moretolerable than within a shorter one, which is more prone tosilencing. Moreover, moderately transcribed genes are likely to bemethylated, while genes at either extreme least likely [65]. All ofthese results suggest that the relationship between ORF or tran-scribed region methylation change and gene expression changemay vary on a gene-by-gene basis, rather than reflecting a simpleincreased methylation equals decreased gene expression model. Inour experimental system, given the tetraploid nature of the potatovarieties, there may have been some variation in methylationbetween alleles. The total transcript levels measured in our studycould reflect transcription from up to all 4 alleles, thus we do notknow the contribution of the locus exhibiting methylation to totaltranscript levels for the genes tested.

To our knowledge, this is the first study attempting to assess ifcytosine methylation polymorphisms are associated with a plant(potato) response to the beneficial bacterial endophyte,B. phytofirmans strain PsJN. Future studies need to focus on theconfirmation of these changes in relation to full gene DNA meth-ylation status before and after PsJN inoculation as compared to theplant responses to common pathogens. Simultaneous large-scalegene expression analyses could also help to relate changes incytosine methylation to changes in transcript abundance for thevarious polymorphic loci.

We hope that the generated information will instigate futuredevelopment of molecular markers for breeding potato for bene-ficial plant-endophyte associations for the development of lowinput agricultural systems that harness the potential of its inhab-iting bacteria.

4. Material and methods

4.1. Bacterial strains, growth condition and inoculum preparation

B. phytofirmans strain PsJN was cultured on a modified bacterialculture medium (MBCM) containing 10 g/l tryptone, 10 ml/l glyc-erol, 10 g/l protease peptone #3, 1.5 g/l di-potassium phosphate,1.5 g/l magnesium sulfate, without (liquid medium), or with 7 g/lagar (solid medium). A single colony of PsJN was first cultured in2.5 ml liquid MBCM overnight at 37 �C. The culture was thentransferred to 30 ml MBCM in a 100 ml flask, and incubated forapproximately 5 h, until an OD600 of 0.5 was reached, on a shaker at230 rpm and 37 �C. The bacterial cells were harvested by centri-fugation at 3000 rpm for 5 min, and re-suspended in thesame volume of phosphate buffered saline (PBS) as in Pillay andNowak [40].

4.2. Plant material and PsJN inoculation

In vitro cultures of endophytic pathogen-free plantlets of potatovarieties Red Pontiac and Superior were used. The stock-plantswere maintained in Magenta boxes on 50 ml MS basal medium[34] in a growth chamber at 25 � 2 �C with 16 h/8 h light/darkphotoperiod and 40 mmol m�2 s�1 light intensity. Plantlets weresubcultured via single node cuttings every four weeks. Prior to PsJNinoculation shoot tips and leaveswere removed from each plantletsand three uniform nodal explants (1 cm-long) taken from eachstock plant. The nodal sections were inoculated with the bacterialsuspension in PBS for 1 min, dried on a sterile paper tower, andplaced in Magenta boxes (4 explants/box) on 50 ml MS mediumsolidified with 0.7% Sigma agar, with 40 explants total (bacterizedtreatment). In the non-bacterized control treatment explants weresubmerged in PBS and handled as above. The cultures were incu-bated in a growth chamber under the same environmental condi-tions as described for the stock plants. Bacterized and controlplantlets (10 per treatment) of each variety were harvested formethylation analysis after 6 weeks of growth. Each plantlet’s shootlength, shoot weight and root weight were recorded before anal-yses. Genomic DNA was extracted from the shoots and leaves forMSAP analysis using Carlson’s lysis buffer method, as described inCsaikl et al. [17].

4.3. Methylation-sensitive AFLP (MSAP) analysis

The protocol for MSAP included use of the isoschizomers HpaIIand MspI, instead of the commonly used MseI as ‘frequent cutter’enzymes in AFLP. The adapter and primer for the ‘rare cutter’enzyme EcoRI was the same as that used in standard AFLP analyses,while the HpaII/MspI adapter was designed according to Xiong et al.[62] as shown in Table 1. To detect MSAP, DNA restriction andligation were done concurrently and two sets of digestion/ligationreactions were carried out simultaneously. In the first reaction, 2 mlof the extracted DNA (200 ng DNA) was added to 13 ml solutioncontaining 1.5 ml of reaction buffer I, 0.25 ml (10 units) EcoRI, 0.5 ml(20 units) HpaII (New England Biolabs. Beverly MA, USA), 0.05 mlBSA, Sigma pure water 10.3 ml. The mixture was then incubated at37 �C for 3 h. The reaction was stopped by incubating at 65 �C for10 min. Adapter ligation was carried out in 20 ml volumes, whichcontained 8 ml digestion mixture, 2 ml 10X T-4 ligase buffer, 0.2 ml (5units) T4 DNA ligase (Promega. Madison WI, USA), 1 ml (5 pmol)EcoRI adapter, 2 ml (50 pmol) HpaII/MspI adapter, 6.5 ml Sigma purewater, incubated at 37 �C for 3 h, and followed by 65 �C for 10min tostop the reaction. The ligation mixture was diluted 10 times in0.1 � TE (1 mM TriseHCl, 0.1 mM EDTA, pH 8) for pre-selectiveamplification PCR. The second digestion/ligation reaction wascarried out in the same way, except that MspI was used instead ofHpaII.

Two consecutive PCRs were applied to selectively amplify theEcoRIeHpaII and EcoRIeMspI DNA fragments. The pre-selectiveamplification PCR was performed using 2 ml of the abovementioned diluted mixture added to an 18 ml mixture giving a finalconcentration of 10mMTriseHCl pH 8.3, 50mMKCl,1.5mMMgCl2,0.2 mM of each dNTP, 40 ng of EcoRI and HpaII/MspI adapter-directed primer, each possessing a single selective base EcoR-I þ one selective nucelotide (Eþ1); HpaII/MspI þ one selectivenucleotide (H/M þ 1) and 1 unit of Taq polymerase (Sigma). PCRreactions were performed with the following profile: 94 �C for 60 s,25 cycles of 30 s denaturing at 94 �C, 60 s annealing at 56 �C and60 s extension at 72 �C, ending with 10 min at 72 �C to completeextension. After checking for the presence of a smear of fragments(100e1000 bp in length) by agarose electrophoresis, the amplifi-cation product was diluted 20 times in 0.1 � TE.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e3432

Selective amplification (second PCR) of the diluted pre-amplification products was carried out using a total of 32 primercombinations obtained with four E þ 2 EcoRI primers in combi-nation with eight HpaII/MspI primers with three selective baseseach (HM þ 3) as listed in Table 1. EcoRI and HpaII/MspI adapters/primers were synthesized by Invitrogen Life Technologies (Carls-bad, CA, USA). E þ 2 primers were selected to increase yield of PCRproduct compared to E þ 3, and to generate more data during CEQ8800 genetic analysis. Selective PCR reactions were performedwiththe following profile: 94 �C for 60 s, 36 cycles of 30 s denaturing at94 �C, 30 s annealing, and 60 s extensions at 72 �C, ending with10 min at 72 �C to complete extension. Annealing was initiated at65 �C, which was then reduced by 0.7 �C per cycle over the next 12cycles and maintained at 56 �C for the subsequent 23 cycles. Afterselective amplification, the PCR products was separated into twoparts, with 3ul used for CEQ MSAP analysis, and the remainderseparated via PAGE to allow polymorphic band cloning.

CE-MSAP analysis was based on a combination of two sets ofdata generated separately by CEQ and PAGE methods. The CEQautomatically scored the presence or absence of MSAP fragments(dominant scoring) from 1 to 600 bp DNA size and identified DNApolymorphisms, while PAGE analysis was used to identify and clonepolymorphic bands.

Two plates, a sample plate and buffer plate, were used forcapillary electrophoresis analysis in CEQ. In the sample plate 40 mlsample loading solution containing 0.03 ml of dye labeled DNAfragment size 600 was first added to each well, PCR product wasdiluted with same volume of sample loading solution (2ml þ 2 ml)and 2 ul of the dilution was added to the SLS in the sample plate.Buffer plate contained 200 ml of running buffer in each corre-sponding well. CEQ operation followed the operation manual.

The PAGE gel was prepared by using UreaGel SequaGel System(National Diagnostic). A sequencing gel electrophoresis system(Gibco, Life Technologies Model SA) was used for the gel analysis.After electrophoresis the gel was stained with silver stain methoddeveloped by Caetano-Anolles and Gresshoff (Promega, Madison,WI). Genetic analyzer data and PAGE band information werecompared, polymorphic bands indicative of methylation statechange were recovered, cloned into the pGEM-T Easy vector(Promega) and sequenced in the CEQ. Sequence information wasused for BLAST analysis against the Solanaceae Genomics Network(SGN) or the National Center for Biotechnology Information (NCBI)GenBank databases. Information on corresponding genes or ESTswas collected. Eight genes/ESTs were selected for further geneexpression analysis by real time PCR.

Table 4Primers used in Real-time PCR analysis.

Primers Sequences (50e30)

Alpha-tubulin (SGN-U286734) GTGGTGATGTTGTGCCAAAGTGTGGTCAATGTCAGAGAAG

Protein kinase (SGN-U598659) CTGCATCTTATTTTGAAGCCCCCAGAGAAGGCATGGAAGAG

Serine/threonine kinase (SGN-U282798) CAGGTTGTAGGAGTTGTTGGAGAGCAAACCTGTCGATTCGT

Protein kinase (SGN-U566915) GTACAGGCTGCTTTTGCTGTTTCCAATGATGAAGCCCTTTC

Pepper EST (SGN-U204926) CCCCACCCGAAAGTAGTAGAGGATGAGCTGGAGAAACAGG

Gibberellin 2-oxidase (SGN-U578575) TGGATCGGTATTTTCTCCAAATTCTCAAACCTCCTTCACAATG

Proline dehydrogenase (SGN-U578070) TCCAAAGGTTTTTCGTGACCCGAGGTGGATACACCCGTAA

Senescence-related gene 1 (SGN-U565166) AAAGCTTCACTCTGCTTGCCCCAATCAAGCTTCTGCTCCT

Disease resistance protein (SGN-U330174) AACTCTCCTTTCATTGCGGACATTTTCTTGATTTTACAAGGCA

4.4. Real time PCR

Expression of the selected genes/EST was evaluated by Real timePCR. The RNA was extracted following the Qiagen RNeasy protocol(Qiagen, Valencia, CA). Whole plant RNA was extracted 6 weeksafter treatments. The RNA samples were quantified using a Nano-drop-1000 spectrophotometer (Thermo Fisher Scientific, Wil-mington, DE). The expression levels of genes in different RNAsamples were detected by run an agarose gel. The primers weredesigned by using the program PrimerQuest (Integrated DNATechnologies, Coralville, IA), and alpha-tubulin was used for RNAnormalization (Table 4). LightCycler RNA Master SYBR Green I(Roche Applied Science, Indianopolis, IN) was used for one-stepreal-time RT-PCR. The PCR reactions were as follows: reversetranscription, 61 �C for 20 min; denaturation, 95 �C for 30 s;amplification, 45 cycles of 95 �C for 5 s, 60 �C for 20 s and 72 �C for10 s. The relative expression levels of all the samples were calcu-lated and analyzed. The threshold cycle (Ct value) of the targetgenes and alpha-tubulin in different samples were obtained afterquantitative real-time PCR reaction. In brief, the normalizer alpha-tubulin Ct value is subtracted from the Ct of the gene of interest(target gene) to produce the dCt value of the sample. The dCt valueof the calibrator (the sample with the highest dCt value) was sub-tracted from every other sample to produce the ddCt value. Two tothe power�ddCt (2�ddCt) was taken for every sample as the relativeexpression levels.

4.5. Data analyses

Data were analyzed by using the SAS program (Cary, NC).

Acknowledgments

The authors would like to acknowledge Dr. M.J. Iqbal forcomments provided during this study. This work was supportedthrough Special Grants (2008-38891-19353 and 2009-38891-20092) from the United States Department of Agriculture, andoperating funds from the Commonwealth of Virginia to the Insti-tute for Advanced Learning and Research.

References

[1] M.E. Alvarez, F. Nota, D.A. Cambiagno, Epigenetic control of plant immunity,Mol. Plant Pathol. 11 (2010) 563e576.

[2] I. Ashikawa, Surveying CpG methylation at 50-CCGG in the genomes of ricecultivars, Plant Mol. Biol. 45 (2001) 31e39.

[3] E.A. Barka, S. Gognies, J. Nowak, J.C. Audran, A. Belarbi, Inhibitory effect ofendophyte bacteria on Botrytis cinerea and its influence to promote thegrapevine growth, Biol. Control 24 (2002) 135e142.

[4] J. Bender, DNA methylation and epigenetics, Annu. Rev. Plant Biol. 55 (2004)41e68.

[5] S. Bensalim, J. Nowak, S.K. Asiedu, A plant growth promoting rhizobacteriumand temperature effects on performance of 18 clones of potato, Am. J. PotatoRes. 75 (1998) 145e152.

[6] M. Bibikova, J.B. Fan, Genome-wide DNA methylation profiling, Wiley Inter-discip. Rev. Syst. Biol. Med. 2 (2010) 210e223.

[7] S. Biemelt, H. Tschiersch, U. Sonnewald, Impact of altered gibberellinsmetabolism on biomass accumulation, lignin biosynthesis, and photosynthesisin transgenic tobacco plants, Plant Physiol. 135 (2004) 254e265.

[8] A. Bird, DNA methylation patterns and epigenetic memory, Genes Dev. 16(2002) 6e21.

[9] A.P. Bird, E.M. Southern, Use of restriction enzymes to study eukaryotic DNAmethylation: I. The methylation pattern in ribosomal DNA from Xenopuslaevis, J. Mol. Biol. 118 (1978) 27e47.

[10] M.B. Bitonti, R. Cozza, A. Chiappetta, D. Giannino, M. Ruffini Castiglione,W. Dewitte, D. Mariotti, H. van Onckelen, A.M. Innocenti, Distinct nuclearorganization, DNA methylation pattern and cytokinin distribution markjuvenile, juvenile-like and adult vegetative apical meristems in peach (Prunuspersica (L.) Batsch), J. Exp. Bot. 53 (2002) 1047e1054.

[11] D. Callard, M. Axelos, L. Mazzolini, Novel molecular markers for late phases ofthe growthcycle of Arabidopsis thaliana cell-suspension cultures are expressedduring organ senescence, Plant Physiol. 112 (1996) 705e715.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e34 33

[12] F. Cartieaux, C. Contesto, A. Gallou, G. Desbrosses, J. Kopka, L. Taconnat,J.P. Renou, B. Touraine, Simultaneous interaction of Arabidopsis thaliana withBradyrhizobium Sp. strain ORS278 and Pseudomonas syringae pv. tomatoDC3000 leads to complex transcriptome changes, Mol. Plant Microbe Interact.21 (2008) 244e259.

[13] J.J. Cavalcante, C. Vargas, E.M. Nogueira, F. Vinagre, K. Schwarcz, J.I. Baldani,P.C. Ferreira, A.S. Hemerly, Members of the ethylene signalling pathway areregulated in sugarcane during the association with nitrogen-fixing endo-phytic bacteria, J. Exp. Bot. 58 (2007) 673e686.

[14] S.J. Cokus, S. Feng, X. Zhang, Z. Chen, B. Merriman, C.D. Haudenschild,S. Pradhan, S.F. Nelson, M. Pellegrini, S.E. Jacobsen, Shotgun bisulphitesequencing of the Arabidopsis genome reveals DNA methylation patterning,Nature 452 (2008) 215e219.

[15] S. Compant, B. Reiter, A. Sessitsch, J. Nowak, C. Clement, E.A. Barka,Endophytic colonization of Vitis vinifera L. by plant growth promotingbacterium Burkholderia sp. strain PsJN, Appl. Environ. Microbiol. 71 (2005)1685e1693.

[16] K.L. Conn, J. Nowak, G. Lazarovits, A gnotobiotic bioassay for studying inter-actions between potatoes and plant growth-promoting rhizobacteria, Can. J.Microbiol. 43 (1997) 801e808.

[17] U.M. Csaikl, H. Bastian, R. Brettschneider, S. Gauch, A. Meir, M. Schauerte,F. Scholz, C. Sperisen, B. Vornam, B. Ziegenhagen, Comparative analysis ofdifferent DNA extraction protocols: a fast, universal maxi-preparation of highquality plant DNA for genetic evaluation and phylogenetic studies, Plant Mol.Biol. Rep. 16 (1998) 69e86.

[18] A.L. Dann, C.R. Wilson, Comparative assessment of genetic and epigeneticvariation among regenerants of potato (Solanum tuberosum) derived fromlong-term nodal tissue-culture and cell selection, Plant Cell Rep. 2011 30(2011) 631e639.

[19] Y. Duan, J. Qian, Y. Sun, Z. Yi, M. Yan, Construction of methylation linkage mapbased on MSAP and SSR markers in Sorghum bicolor (L.), IUBMB Life 61 (2009)663e669.

[20] O.V. Dyachenko, N.S. Zakharchenko, T.V. Shevchuk, H.J. Bohnert, J.C. Cushman,Y.I. Buryanov, Effect of hyper-methylation of CCWGG sequences in DNA ofMesembryanthemum crystallinum plants on their adaptation to salt stress,Biochemistry 71 (2006) 461e465.

[21] J. Fang, C. Song, Y. Zheng, Y. Qiao, Z. Zhang, Q. Dong, C.T. Chao, Variation incytosine methylation in Clementine mandarin cultivars, J. Hortic. Sci. Biotech.83 (2008) 833e839.

[22] S. Feng, S.J. Cokus, X. Zhang, P.Y. Chen, M. Bostick, M.G. Goll, J. Hetzel, J. Jain,S.H. Strauss, M.E. Halpern, C. Ukomadu, K.C. Sadler, S. Pradhan, M. Pellegrini,S.E. Jacobsen, Conservation and divergence of methylation patterning inplants and animals, Proc. Natl. Acad. Sci. USA 107 (2010) 8689e8694.

[23] M.F. Fraga, R. Rodríguez, M.J. Cañal, Genomic DNA methylationede-methyl-ation during aging and reinvigoration of Pinus radiata, Tree Physiol. 22 (2002)813e816.

[24] M. Frommer, L.E. McDonald, D.S. Millar, C.M. Collis, F. Watt, G.W. Grigg,P.L. Molloy, C.L. Paul, A genomic sequencing protocol that yields a positivedisplay of 5-methylcytosine residues in individual DNA strands, Proc. Natl.Acad. Sci. 89 (1992) 1827e1831.

[25] M.L. Gonzalgo, P.A. Jones, Mutagenic and epigenetic effects of DNA methyla-tion, Mutat. Res. 386 (1997) 107e118.

[26] T. Kakutani, K. Munakata, E.J. Richards, H. Hirochika, Meiotically and mitoti-cally stable inheritance of DNA hypo-methylation induced by ddm1 mutationof Arabidopsis thaliana, Genetics 151 (1999) 831e838.

[27] I. Klein, U. von Rad, J. Durner, Homoserine lactones: do plants really listen tobacterial talk? Plant Signal. Behav. 4 (2009) 50e51.

[28] R.D. Law, J.C. Suttle, Transient decreases in methylation at 50-CCGG-30

sequences in potato (Solanum tuberosum L.) meristem DNA during progres-sion of tubers through dormancy precede the resumption of sprout growth,Plant Mol. Biol. 51 (2002) 437e447.

[29] X.L. Ll, Z.-X. Lin, Y.-C. Nie, X.-P. Guo, X.-L. Zhang, Methylation-sensitiveamplification polymorphism of epigenetic changes in cotton under salt stress,Acta Agronomica Sinica 35 (2009) 588e596.

[30] M.C. Lorincz, D.R. Dickerson, M. Schmitt, M. Groudine, Intragenic DNAmethylation alters chromatin structure and elongation efficiency inmammalian cells, Nat. Struct. Mol. Biol. 11 (2004) 1068e1075.

[31] Y. Lu, T. Rong, M. Cao, Analysis of DNA methylation in different maize tissues,J. Genet. Genomics 35 (2008) 41e48.

[32] M. Lucy, E. Reed, B.R. Glick, Applications of free living plant growth-promotingrhizobacteria, Antonie Van Leeuwenhoek 86 (2004) 1e25.

[33] C. Mei, B.S. Flinn, The use of beneficial microbial endophytes for plantbiomass and stress tolerance improvement, Recent Pat. Biotechnol. 4 (2010)81e95.

[34] T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays withtobacco tissue cultures, Physiol. Plant 15 (1962) 473e497.

[35] E.M. Nogueira, F. Vinagre, H.P. Masuda, C. Vargas, V.L.M. Pádua, F.R. Silva,R.V. Santos, J.I. Baldani, P.C.G. Ferreira, A.S. Hemerly, Expression of sugarcanegenes induced by inoculation with Gluconcetobacter diazotrophicus and Her-baspirillum rubrisubalbicans, Genet. Mol. Biol. 24 (2001) 199e206.

[36] J. Nowak, S.K. Asiedu, S. Bensalim, J. Richards, A. Stewart, C. Smith, D. Stevens,A.V. Sturz, From laboratory to applications: challenges and progress within vitro dual cultures of potato and beneficial bacteria, Plant Cell Tiss. Org.Cult. 52 (1998) 97e103.

[37] J. Nowak, R.E. Veilleux, J. Nowak, S. Turgeon, Priming for transplant stressresistance in in vitro propagation via plantlet bacterization, Acta Hort. 748(2007) 65e76.

[38] J.L. Noyer, S. Causse, K. Tomekpe, A. Bouet, F.C. Baurens, A new image ofplantain diversity assessed by SSR, AFLP and MSAP markers, Genetica 124(2005) 61e69.

[39] V. Pavet, C. Quintero, N.M. Cecchini, A.L. Rosa, M.E. Alvarez, Arabidopsisdisplays centromeric DNA hypo-methylation and cytological alterations ofheterochromatin upon attack by Pseudomonas syringae, Mol. Plant MicrobeInteract. 19 (2006) 577e587.

[40] V.K. Pillay, J. Nowak, Inoculum density, temperature, and genotype effects onin vitro growth promotion and epiphytic and endophytic colonization oftomato (Lycopersicon esculentum L) seedlings inoculated with a pseudomonasbacterium, Can. J. Microbiol. 43 (1997) 354e361.

[41] G.E. Reyna-López, J. Simpson, J. Ruiz-Herrera, Differences in DNA methyl-ation patterns are detectable during the dimorphic transition of fungi byamplification of restriction polymorphisms, Mol. Gen. Genet. 253 (1997)703e710.

[42] M. Rosenblueth, E. Martínez-Romero, Bacterial endophytes and their inter-actions with hosts, Mol. Plant Microbe Interact. 19 (2006) 827e837.

[43] L. Ruiz-Garcia, M.T. Cervera, J.M. Martinez-Zapater, DNA methylationincreases throughout Arabidopsis development, Planta 222 (2005) 301e306.

[44] T. Sasaki, R. Fujimoto, S. Kishitani, T. Nishio, Analysis of target sequences ofDDM1s in Brassica rapa by MSAP, Plant Cell Rep. 30 (2011) 81e88.

[45] A. Sessitsch, T. Coenye, A.V. Sturz, P. Vandamme, E. Ait Barka, J.F. Salles,J.D. van Elsas, D. Faure, B. Reite, B.R. Glick, G. Wang-Pruski, J. Nowak, Bur-kholderia phytofirmans sp., a novel plant-associated bacterium with plant-beneficial properties, Int. J. Syst. Evol. Microbiol. 55 (2005) 1187e1192.

[46] A.H. Sha, X.H. Lin, J.B. Huang, D.P. Zhang, Analysis of DNA methylation relatedto rice adult plant resistance to bacterial blight based on methylation-sensitive AFLP (MSAP) analysis, Mol. Genet. Genomics 273 (2005) 484e490.

[47] T. Shibukawa, K. Yazawa, A. Kikuchi, H. Kamada, Possible involvement of DNAmethylation on expression regulation of carrot LEC1 gene in its 50-upstreamregion, Gene 437 (2009) 22e31.

[48] N. Steward, M. Ito, Y. Yamaguchi, N. Koizumi, H. Sano, Periodic DNA meth-ylation in maize nucleosomes and de-methylation by environmental stress,J. Biol. Chem. 277 (2002) 37741e37746.

[49] W.R. Swindell, The association among gene expression responses to nineabiotic stress treatments in Arabidopsis thaliana, Genetics 174 (2006)1811e1824.

[50] M.P. Tan, Analysis of DNA methylation of maize in response to osmotic andsalt stress based on methylation-sensitive amplified polymorphism, PlantPhysiol. Biochem. 48 (2010) 21e26.

[51] E. Teyssier, G. Bernacchia, S. Maury, A. How Kit, L. Stammitti-Bert, D. Rolin,P. Gallusci, Tissue dependent variations of DNA methylation and endor-eduplication levels during tomato fruit development and ripening, Planta 228(2008) 391e399.

[52] R.K. Tran, J.G. Henikoff, D. Zilberman, R.F. Ditt, S.E. Jacobsen, S. Henikoff, DNAmethylation profiling identifies CG methylation clusters in Arabidopsis genes,Curr. Biol. 15 (2005) 154e159.

[53] F. Trognitz, K. Scherwinski, A. Fekete, S. Schmidt, L. Eberl, J. Rodewald, M.Schmid, S. Compant, A. Hartmann, P. Schmitt-Kopplin, B. Trognitz, A. Ses-sitsch, Interaction Between Potato and the Endophyte Burkholderia phytofir-mans. Abwehrstrategien gegen biotische Schaderreger Züchtung vonHackfrüchten und Sonderkulturen. Tagungsband der 59. Jahrestagung derVereinigung der Pflanzenzüchter und Saatgutkaufleute Österreichs, 25.e27.November 2008, Raumberg-Gumpenstein, Austria 2008 pp. 63e66.

[54] N. Verbruggen, C. Hermans, Proline accumulation in plants: a review, AminoAcids 35 (2008) 753e759.

[55] F. Vinagre, C. Vargas, K. Schwarcz, J. Cavalcante, E.M. Nogueira, J.I. Baldani,P.C. Ferreira, A.S. Hemerly, SHR5: a novel plant receptor kinase involved inplant-N2-fixing endophytic bacteria association, J. Exp. Bot. 57 (2006)559e569.

[56] P. Vos, R. Hogers, M. Blecker, M. Reijans, T.V.D. Lee, M. Hornes, A. Frijters,L. Pot, J. Peleman, M. Kuiper, M. Zabeau, AFLP: a new technique for DNAfingerprinting, Nucleic Acids Res. 23 (1995) 4407e4414.

[57] Y. Wada, K. Miyamoto, T. Kusano, H. Sano, Association between up-regulationof stress-responsive genes and hypo-methylation of genomic DNA in tobaccoplants, Mol. Gen. Genomics 271 (2004) 658e666.

[58] K. Wang, K. Conn, G. Lazarovits, Involvement of quinolinate phosphoribosyltransferase in promotion of potato growth by a Burkholderia strain, Appl.Envir. Microb. 72 (2006) 760e768.

[59] S.A. Whitham, S. Quan, H.-S. Chang, B. Cooper, B. Estes, T. Zhu, X. Wang, Y.-M. Hou, Diverse RNA viruses elicit the expression of common sets of genes insusceptible Arabidopsis thaliana plants, Plant J. 33 (2003) 271e283.

[60] D. Wilson, Endophyte: the evolution of a term, and clarification of its use anddefinition, Oikos 73 (1995) 274e276.

[61] W. Xiao, K.D. Custard, R.C. Brown, B.E. Lemmon, J.J. Harada, R.B. Goldberg,R.L. Fischer, DNA methylation is critical for Arabidopsis embryogenesis andseed viability, Plant Cell 18 (2006) 805e814.

[62] L.Z. Xiong, C.G. Xu, M.A. Saghai Maroof, Q. Zhang, Patterns of cytosinemethylation in an elite rice hybrid and its parental lines, detected bya methylation-sensitive amplification polymorphism technique, Mol. Gen.Genet. 261 (1999) 439e446.

K. Da et al. / Plant Physiology and Biochemistry 50 (2012) 24e3434

[63] A. Zemach, I.E. McDaniel, P. Silva, D. Zilberman, Genome-wide evolutionaryanalysis of eukaryotic DNA methylation, Science 328 (2010) 916e919.

[64] X. Zhang, J. Yazaki, A. Sundaresan, S. Cokus, S.W. Chan, H. Chen, I.R. Henderson,P. Shinn, M. Pellegrini, S.W. Jacobsen, J.R. Ecker, Genome-wide high-resolutionmapping and functional analysis of DNA methylation in Arabidopsis, Cell 126(2006) 1189e1201.

[65] D. Zilberman, M. Gehring, R.K. Tran, T. Ballinger, S. Henikoff, Genome-wideanalysis of Arabidopsis thaliana DNA methylation uncovers an interdepen-dence between methylation and transcription, Nat. Genet. 39 (2007) 61e69.

[66] J. Zluvova, B. Janousek, B. Vyskot, Immunohistochemical study of DNAmethylation dynamics during plant development, J. Exp. Bot. 52 (2001)2265e2273.