The determinant step in ergot alkaloid biosynthesis by an endophyte of perennial ryegrass
-
Upload
independent -
Category
Documents
-
view
6 -
download
0
Transcript of The determinant step in ergot alkaloid biosynthesis by an endophyte of perennial ryegrass
Fungal Genetics and Biology 41 (2004) 189–198
www.elsevier.com/locate/yfgbi
Fungal Genetics and Biology 41 (2004) 189–198Fungal Genetics and Biology 41 (2004) 189–198
The determinant step in ergot alkaloid biosynthesisby an endophyte of perennial ryegrass
Jinghong Wang,a Caroline Machado,a Daniel G. Panaccione,b Huei-Fung Tsai,a,1
and Christopher L. Schardla,*
a Department of Plant Pathology, University of Kentucky, Lexington, KY 40546-0312, USAb Division of Plant and Soil Sciences, West Virginia University, Morgantown, WV 26506-6058, USA
Received 29 March 2003; accepted 6 October 2003
Abstract
Many cool-season grasses harbor fungal endophytes in the genus Neotyphodium, which enhance host fitness, but some also
produce metabolites—such as ergovaline—believed to cause livestock toxicoses. In Claviceps species the first step in ergot alkaloid
biosynthesis is thought to be dimethylallyltryptophan (DMAT) synthase, encoded by dmaW, previously cloned from Claviceps
fusiformis. Here we report the cloning and characterization of dmaW from Neotyphodium sp. isolate Lp1, an endophyte of perennial
ryegrass (Lolium perenne). The gene was then disrupted, and the mutant failed to produce any detectable ergovaline or simpler ergot
and clavine alkaloids. The disruption was complemented with the C. fusiformis gene, which restored ergovaline production. Thus,
the biosynthetic role of DMAT synthase was confirmed, and a mutant was generated for future studies of the ecological and ag-
ricultural importance of ergot alkaloids in endophytes of grasses.
� 2003 Elsevier Inc. All rights reserved.
1. Introduction
Fungal endophytes in the genus Neotyphodium (sex-
ual state¼Epichlo€ee) form symbiotic and often mutual-
istic associations with cool-season grasses (subfamily
Po€ooideae). Their hosts include several important forage
and turf grasses, to which the endophytes confer en-
hanced resistance to insect and mammalian herbivores,
as well as enhanced drought tolerance, nematode resis-tance, mineral uptake, competitiveness, growth, and
fecundity (Clay and Schardl, 2002; Malinowski and
Belesky, 2000). Endophytic Neotyphodium spp. inhabit
apoplasts of their hosts, colonize all aerial tissues in-
cluding shoot and floral meristems, leaves, culms, sto-
lons, and seeds, and in the case of the asexual
endophytes, can only be transmitted vertically by sys-
* Corresponding author. Fax: 1-859-323-1961.
E-mail addresses: [email protected], [email protected] (C.L.
Schardl).1 Present address: NIAID, National Institutes of Health, Bldg. 10,
Rm. 11C304, 10 Center Drive, MSC 1882, Bethesda, MD 20892-1882,
USA.
1087-1845/$ - see front matter � 2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.fgb.2003.10.002
temic infection of embryos and seedlings (Freeman,1904; Sampson, 1937). Benefits conferred to plants are
partially due to production by endophytes of biologi-
cally active alkaloids (Bush et al., 1997). Profiles of al-
kaloids vary among endophyte species and genotypes,
and altogether four alkaloid classes are known from
Neotyphodium spp. Of these, the ergot alkaloids and
lolitrems (indolediterpenes) cause neurotoxic effects on
grazing or granivorous vertebrates, peramine (a pyrrol-opyrazine) is an insect feeding deterrent, and lolines
(saturated 1-aminopyrrolizidines) are insecticidal (Bush
et al., 1997; Wilkinson et al., 2000).
Endophytes in forage grasses have elicited consider-
able ambivalence because, on the one hand they can
greatly enhance long-term persistence of pasture stands
subject to biotic or abiotic stress factors, whereas on the
other hand they can cause episodes of toxicosis to live-stock andwildlife (Thompson and Stuedemann, 1993). In
the United States, cattle and horses grazed on tall fescue
with the endophyte Neotyphodium coenophialum exhibit
symptoms of toxicosis including poor weight gain, low
fertility, agalactia, fat necrosis, and, in extreme cases,
gangrene and death (Thompson and Stuedemann, 1993).
190 J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198
Consequently, annual economic losses to the US beefindustry were estimated in 1990 at $600 million (Hove-
land, 1993), with undetermined but substantial losses in
dairy, horses, and sheep as well. The symptoms are
reminiscent of poisoning by the infamous ergot fungus,
Claviceps purpurea (Raisbeck et al., 1991), which is a
relative of the Neotyphodium spp. (Kuldau et al., 1997).
Much of the biological activity of ergot is associated with
the ergopeptines, abundant and particularly potentpeptide derivatives of lysergic acid. For this reason, er-
govaline, the ergopeptine produced by Neotyphodium
spp., has been the subject of considerable research and is
thought to be a significant factor in toxicoses associated
with endophyte-infected ryegrasses and fescues (Bacon et
al., 1986; Cross, 2003). However, the roles of the simpler
lysergic acid derivatives and the clavines (which include
lysergic acid precursors and other derivatives) have notbeen assessed due to the technical challenges of alkaloid
purification or other means of conducting controlled
experiments. Endophytes mutated in specific biosyn-
thetic genes would provide raw material for controlled
tests to determine the roles of ergot alkaloids in livestock
toxicosis and other ecological factors.
Ergot alkaloid biosynthesis in Claviceps species (ergot
fungi) involves multiple steps, most of which have beenelucidated (Tudzynski et al., 2001). Mothes et al. (1958)
proposed that the ergoline ring system was derived from
prenylated tryptophan. Gr€ooger et al. (1960, 1959), and
Birch et al. (1960) demonstrated incorporation of radio-
labeled tryptophan and mevalonate into the ergoline ring
system. Heinstein et al. (1971) partially purified a dim-
ethylallyl-pyrophosphate: LL-tryptophan dimethylallyl
transferase (DMAT synthase) from a Claviceps sp. Thisactivity, which yields dimethylallyltryptophan (DMAT;
Fig. 1), was proposed to be the first pathway specific step
in alkaloid biosynthesis. DMAT synthase also has been
implicated as a key regulatory step for the pathway (Floss
et al., 1974; Krupinski et al., 1976).
Gebler and Poulter (1992) purified DMAT synthase
from Claviceps fusiformis and characterized it as a ho-
modimer of 52-kDa subunits. Tsai et al. (1995) thencloned the dmaW gene encoding this enzyme, and
expressed it in yeast to confirm the biochemical activity
Fig. 1. Activity of DMAT synthase. The 4-position of the tryptophan
aromatic ring system is prenylated by electrophilic substitution (Gebler
et al., 1992).
of the gene product. Tudzynski et al. (1999) identified arelated gene in a likely ergot alkaloid biosynthesis gene
cluster in C. purpurea strain P1.
Here we employed a Neotyphodium sp. endophyte of
perennial ryegrass (Lolium perenne) to conduct a genetic
test of the hypothesis that DMAT synthase is required
for ergot alkaloid production. We cloned and disrupted
dmaW in Neotyphodium sp. isolate Lp1, complemented
the mutant with the C. fusiformis gene, and introducedthe wild type, dmaW disruptant and complemented
strains into ryegrass plants to test for expression of
clavine and ergot alkaloids.
2. Materials and methods
2.1. Biological materials
Neotyphodium sp. Lp1, a natural hybrid of Neoty-
phodium lolii and Epichlo€ee typhina (Schardl et al., 1994),
was isolated by the method of Latch et al. (1984), as
modified by Schardl and An (1993), from surface-ster-
ilized leaf sheaths of infected L. perenne (perennial rye-
grass). Claviceps purpurea ATCC 20102 was obtained
from the American Type Culture Collection (Manassas,VA, USA; note that Accession No. 20102 has since been
reassigned by ATCC). The fungal cultures were rou-
tinely maintained on potato dextrose agar (PDA; Difco,
Detroit, MI, USA) plates at 21 �C in the dark.
Endophyte-minus seed of the tetraploid perennial
ryegrass (L. perenne) cultivar, Rosalin, was generously
provided by Dr. Kenneth Hignight (Advanta Seeds
Pacific, Albany, OR, USA). Symbiota of perennialryegrass with the wild type and other fungal strains in
this study were generated and maintained as previously
described (Panaccione et al., 2001).
Fungal DNA was isolated as previously described
(Byrd et al., 1990).
2.2. Southern-blot analysis
Hybridization probes were prepared by PCR with
dTTP partly substituted with hapten-labeled dUTP
(135 lM dTTP and 15 lM digoxigenin-dUTP; Roche–
Boehringer, Indianapolis, IN, USA) (Gebeyehu et al.,
1987). Genomic DNA was digested with restriction en-
donucleases as indicated, separated by agarose gel
electrophoresis, and transferred onto nylon membrane
(Hybond-N+; Amersham–Pharmacia Biotech, Piscata-way, NJ, USA) by the alkaline-blot method (Ausubel et
al., 2001). Blots were prehybridized, then hybridized at
42 �C with denatured probe, in 50% formamide, 6�sodium chloride/sodium citrate solution (SSC), 5�Denhardt�s solution (Ausubel et al., 2001), 0.1% sodium
dodecylsulfate (SDS), 0.1% sodium diphosphate, 50mM
Tris(hydroxymethyl)aminomethane (Tris)–HCl, pH 7.5,
J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198 191
and 100 lg/ml denatured herring sperm DNA. Themembranes were then washed in 300ml of 2� SSC, 0.1%
SDS at room temperature for 5min, at 55 �C for 20min,
and at 55 �C for 30min. Immunological detection em-
ployed anti-digoxigenin antibody conjugated to alkaline
phosphatase and CSPD substrate (Roche–Boehringer).
The filters were exposed to double emulsion film (Bio-
Max Light-2, Sigma Chemical, St. Louis, MO, USA) to
record the chemiluminescent signal.
2.3. Sequence determinations and alignments
Cosmid and plasmid DNA templates were isolated by
using the Wizard Plus Maxipreps DNA Purification
System (Promega, Madison, WI, USA). Approximately
1 lg cosmid DNA or 200 ng plasmid DNA was used as
template in each sequencing reaction. PCR fragmentswere cleaned using Qiagen PCR purification kit (Qiagen,
Valencia, CA, USA), then 200–400 ng was used as se-
quencing templates. Sequencing reactions were carried
out by the Sanger random chain termination method
with BigDye Terminator Cycle Sequence Kit (Applied
Biosystems, Foster City, CA, USA), according to
manufacturer�s suggestions.Deduced amino acid sequences were aligned by using
Pileup, implemented in Seqweb Version 1.1 [Genetics
Computer Group (GCG), Wisconsin Package]. The
parameter settings of gap creation penalty and gap ex-
tension penalty were 8 and 2, respectively.
2.4. Cosmid library construction and screening
DNA was prepared from C. purpurea ATCC 20102,partially digested with MboI, and fragments of ca. 30–
50 kb isolated as described previously (Byrd et al., 1990).
The fragments were half-filled with dATP and dGTP.
Cosmid vector pMOcosX (Orbach, 1994) was digested by
XhoI, and then half-filled with dCTP and dTTP. Vector
and inserts were mixed at approx. 1:1 molar ratio, and
ligated with T4 DNA ligase. In vitro packaging of the li-
gation mix and transfection of Escherichia coli were car-ried out using Gigapack III XL packaging extract
(Stratagene Cloning Systems, La Jolla, CA, USA). Each
ampicillin-resistant colony was used to inoculate 200 lllibrary broth [a 9:1 mix of LB broth and 10� freezer
medium consisting of 360mM K2HPO4, 132mM
KH2PO4, 17mM Na-citrate, 4mM MgSO4, 68mM
(NH4)2SO4, and 44% glycerol] in a well of a 96-well mi-
crotitre plate, and grownovernightwith gentle shaking.Atotal of 3840 clones were arrayed and stored at )80 �C.
The C. purpurea cosmid library was screened as fol-
lows: a pool of all clones from each 96-well plate was
inoculated into LB with 100 lgml�1 ampicillin, and
grown overnight at 30 �C with vigorous shaking. Cells
were collected and cosmid DNAwas prepared byWizard
Plus Minipreps DNA Purification System (Promega).
The pooled cosmid DNAs were slot-blotted (Ausubel etal., 2001) onto a Hybond-N+ nylon membrane. The
probe was a digoxigenin-labeled full-length copy of
dmaW from C. fusiformis, generated by PCR using, as
template, pKAES132 (Tsai et al., 1995), and as primers,
50-GCGTCGACACGATGATGACAAAA GC-30 and
50-GCGTCGACGCAAAGACCCTTGACAT-30. Probepreparation and hybridization protocols were as de-
scribed above. Positive plates, then positive rows of thoseplates, then the positive clones were identified.
2.5. Amplification and cloning dmaW and flanking DNA
Sequence comparison of dmaW from C. fusiformis
ATCC 26245 (Tsai et al., 1995) and C. purpurea ATCC
20102 (this work) revealed potentially conserved amino
acid sequences, and degenerate oligonucleotide primersdeg1, deg2, deg3, and deg4 were designed based on those
regions (Fig. 2, Table 1). The primers were used in PCR
with genomic DNA of Neotyphodium sp. Lp1 as tem-
plate. Each 50 ll reaction mixture contained 200 ng
fungal genomic DNA template, 200 lM each dNTP,
2 lM each of two degenerate primers, 1�PCR buffer
(Applied Biosystems), and 2.5U TaqGold DNA poly-
merase (Applied Biosystems). Reaction mixtures wereheld at 93 �C for 9min, followed by 95 �C for 3min, then
subjected to 35 cycles of 94 �C for 45 s, 53 �C for 45 s,
72 �C for 80 s; then a final 5min incubation at 72 �C. ThePCR products were electrophoresed in low-melting-
temperature agarose (BioWhittaker Molecular Appli-
cations, Rockland, ME, USA), and fragments of the
expected sizes were excised. The gel slices were melted,
and 2 ll of each was used as template in a second roundof PCR with similar temperature cycling and variants of
the degenerate primers incorporating restriction endo-
nuclease cleavage sites as follows: deg1-EcoRI and deg2-
EcoRI had 50-CGGAATTC extensions; deg3-XbaI and
deg4-XbaI had 50-CGTCTAGA extensions. The ampli-
fication products were digested with EcoRI and XbaI,
gel purified, cloned into pBluescriptKS(+) (Stratagene
Cloning Systems, La Jolla, CA, USA), and sequenced.The 50- and 30-portions and flanking regions of dmaW
from Neotyphodium sp. Lp1 were amplified by cassette-
mediated PCR, with the Panvera (Madison, WI, USA)
LA-PCR kit, according to manufacturer�s suggestions.
Sequences of the dmaW-specific primers are available
from the authors on request.
2.6. Gene expression in yeast and enzyme activity assay
Coding sequences of dmaW from C. purpurea and
Neotyphodium sp. Lp1 were cloned into yeast expression
vector pMDM281, then yeast was transformed, grown,
induced and extracted, and DMAT Synthase activity
assays were conducted as previously described (Tsai
et al., 1995).
Fig. 2. Pileup alignment of amino acid sequences deduced from dmaW
of C. fusiformis (Cf), C. purpurea (Cp), and Neotyphodium sp. (Lp1).
Dots in sequences indicate alignment gaps, implying deletion or in-
sertion events in evolution of these genes. The consensus sequence
(Con) is in bold, and identifies positions identical in all confirmed
active dmaW genes; dashes indicate nonidentical positions. Conserved
intron positions (^) are: intron 1 after the second position of codon
397 in the alignment; intron 2 after the first position of codon 438.
Underlined sequences indicate regions on which degenerate primers
were designed, based on identity or near identity between Cf and Cp.
GenBank Accession Nos. for the nucleotide sequences are AY259837–
AY259840, AY262013, and AY262014.
192 J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198
2.7. Generation and complementation of the dmaW
knockout
A targeting vector for gene disruption was con-
structed as follows: a 3.0-kb fragment containing 50-flanking sequence up to, but not including the dmaW
start codon, was amplified by PCR using primer SacII-Ns-dmaW()3011/)2981)d and BamHI-Ns-dmaW()1/)30)u, then cloned into pBluescriptKS(+) that was cut
with SacII and BamHI. PCR amplification with primer
Ns-dmaW(84.3/94.2)d and SalI-Ns-dmaW(3415/3383)u,
followed by digestion with BamHI and SalI, yielded a
3.1-kb fragment containing the Lp1 dmaW starting from
codon 114 into the 30-flanking region. This fragment was
then cloned adjacent to the 50-flanking sequence betweenthe BamHI and SalI sites. A cassette containing a hy-
gromycin resistance gene (hph) and controlling se-
quences (Panaccione et al., 2001) was cloned into the
BamHI site between the two dmaW-flanking fragments.
The resulting construct, pKAES170, was linearized with
SalI prior to introduction into Lp1 by transformation
(cleavage of the other end with SacII was impractical
due to a SacII site in the hph).Protoplasts of Neotyphodium sp. Lp1 were prepared
as described by Murray et al. (1992), except that the
mycelium was treated with 1.3mgml�1 Novozyme and
20mgml�1 glucanase. Then protoplasts were trans-
formed with the linearized construct by electroporation
as described by Tsai et al. (1992). After electroporation,
aliquots of the mixture were each mixed with 5ml
molten regeneration medium (Panaccione et al., 2001)and poured onto a regeneration medium plate contain-
ing hygromycin B (CalBiochem, La Jolla, CA, USA) at
300 lgml�1. The plates were incubated at 21 �C for 3–4
weeks and viable fungal colonies were transferred to
PDA with hygromycin B (200 lgml�1) for sporulation
and single-spore isolation. Hygromycin-resistant trans-
formants were screened for homologous recombination
by PCR using primers Ns-dmaW(31/37.2)d and Ns-dmaW(278/273.2)u. Clones that did not yield amplifi-
cation products were further analyzed by Southern-blot
analysis using, as probe, a mixture of two fragments
from the Neotyphodium sp. Lp1 dmaW region. These
fragments were amplified and labeled with digoxigenin
by PCR with the following primers (Table 1):
Ns-dmaW(44.2/38)u and Ns-dmaW()476/)457)d for
the probe just upstream of the dmaW coding region; andNs-dmaW(146/152.2)d and Ns-dmaW(445.1/438.3)u for
the coding sequence.
In the complementation vector construct,
pKAES157, dmaW cDNA from C. fusiformis was placed
under control of the promoter of the E. typhina b-tu-bulin gene (tub2; Tsai et al., 1992) by a PCR procedure
similar to that used previously for a Protub2-fusion to
Fusarium solani khs (Li et al., 1995). The product (Ptub2–dmaW) included the 230 bp 50 to the translational start
of tub2, followed by the dmaW coding and 30-untrans-lated sequences from pKAES132 (Tsai et al., 1995). The
product was cloned into pCB1004 (Carroll et al., 1994)
to generate pKAES157. Protoplasts from the dmaW
knockout mutant were prepared as described by Murray
et al. (1992) except that mycelium was treated with
Table 1
Primers used in this study
Primer name Sequencea Targetb Positionc
deg1 GARCARMGNYTNTGGTGGCA Cp dmaW-1 cd 25.1/31.2
deg2 GGNATHTTYAARAARCAYAT Cp dmaW-1 cd 56.1/62.2
deg3 ARNGTCCANARRTCYTCCAT Cp dmaW-1 cd 283.1/277.2
deg4 TANACYTGNGGYTCNGGCAT Cp dmaW-1 cd 350.1/344.2
SacII-Ns-dmaW(-3011/-2981)d GCCCGCGGAGTATAGTATAATATATAACCCTTATTATAC Ns dmaW nt )3011/)2981BamHI-Ns-dmaW()1/)30)u GCGGATCCTGTGAAGAAGAGGACGAGCGTAATAGCCCT Ns dmaW nt )1/)30Ns-dmaW(84.3/94.2)d CGGAACCCCGTTTGAGCTAAGTCTTAATTG Ns dmaW cd 84.3/94.2
SalI-Ns-dmaW(3415/3383)u GCGTCGACGCTAACTACTAGTTATCTTATTATAAAGATACC Ns dmaW nt +3415/+3383
Ns-dmaW(31/37.2)d CACAGCACGGCGCCAATGTT Ns dmaW cd 31.1/37.2
Ns-dmaW(278/273.2)u CGCTGGCAACGAGACCATTC Ns dmaW cd 278.3/273.2
Ns-dmaW(44.2/38)u GCAGTTTGGAGTATCTTTTG Ns dmaW cd 44.2/38.1
Ns-dmaW()476/)457)d TCTATGTCAGAATCGTACCG Ns dmaW nt )476/)457Ns-dmaW(146/152.2)d CAAGAGCTTACACTTGACGC Ns dmaW cd 146.1/152.2
Ns-dmaW(445.1/438.3)u CTCGCCGGCATGCGTCAAAA Ns dmaW cd 445.1/438.3
a Sequences written 50–30. R¼A or G; M¼A or C; Y¼T or C; H¼A, T, or C; N¼A, G, C, or T.bAbbreviations used: Cp, Claviceps purpurea ATCC 20102, Ns, Neotyphodium sp. Lp1.cAll codon (cd) or nucleotide (nt) positions relative to the likely start codon, indicated as 50-end/30-end of the oligonucleotide.
J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198 193
10mgml�1 Novozyme. The protoplasts were cotrans-
formed, by electroporation (Tsai et al., 1992), with
pKAES157 (linearized) in a 1:1 molar ratio with pAN8-
1 (Mattern et al., 1988), and transformants were selected
with 74 lgml�1 phleomycin (Sigma). The transformantswere screened by PCR with primers targeted to the ends
of the Ptub2–dmaW construct.
2.8. Alkaloid analyses
All analyses were conducted on pseudostems of
symbiota or uninfected plants of cv. Rosalin. Ergova-
line, and ergine (the simple amide of lysergic acid) wereanalyzed by high-pressure liquid chromatography
(HPLC) with fluorescence detection, employing a pro-
tocol adapted from Spiering et al. (2002). Briefly, 50mg
of freeze-dried and milled pseudostems were extracted in
0.5ml of 2-propanol–water–lactic acid (50:50:1) con-
taining ergotamine tartrate as internal standard (at
1.111 lgml�1). Samples were agitated on a vortex mixer
for 1min, then left to stand in the dark at room tem-perature for 2 h before solid material was pelleted by
centrifugation at 6000g for 10min. Extract (20 ll) wasanalyzed on a Jasco HPLC (model PU-980 program-
mable pump with gradient maker LG-980-02) equipped
with a Phenomenex Prodigy reverse-phase C18 column
(150mm� 4.6mm, 5 lm i.d.) and Shimadzu model 551
fluorescence detector set with excitation and emission
wavelengths of 310 and 410 nm, respectively. Injectedsamples were subjected to a gradient in which mobile
phases A (15% acetonitrile + 85% aqueous 0.1M am-
monium acetate) and B (75% acetonitrile + 25% aqueous
0.1M ammonium acetate) were mixed as follows: 0min,
100% A+0% B; 25min, 85% A+15% B; 45min, 50%
A+50% B; 50min, 30% A+70% B; 55min, 0%
A+100% B; 60min, 0% A+100% B; and 65min, 100%
A+0% B. Flow rate was 1mlmin�1.
Chanoclavine was analyzed from crude extracts
(prepared as described above) by liquid chromatogra-
phy–electrospray ionization mass spectrometry (LC–
MS) as described by Panaccione et al. (2003). Ions with
a m/z of 257 ([chanoclavine I +H]þ and isomers) weredetected with the deflector voltage set at 45V for mini-
mal fragmentation, and monitored in selected ion mode.
Lolitrems were extracted and analyzed by a modifi-
cation of the isocratic HPLC method of Gallagher et al.
(1985). Lolitrems were separated on an Alltech (Deer-
field, IL, USA) Alltima silica column (150mm� 4.6mm,
5 lm particle size) with a mobile phase of dichlorome-
thane–acetonitrile–water (86:14:0.1) applied at1mlmin�1, and detected by fluorescence (excitation at
265 nm and emission at 440 nm).
3. Results
3.1. The dmaW gene of Claviceps purpurea
A cosmid library of genomic DNA from C. purpurea
ATCC 20102 was constructed and screened with a C.
fusiformis dmaW probe. Three clones (26A07, 27A01,
and 29A05) were identified that had overlapping geno-
mic segments. The dmaW-related sequence in those
cosmids, designated C. purpurea dmaW-1, was deter-
mined to be nearly identical to that previously reported
for C. purpurea P1 (Tudzynski et al., 1999).Previously, the identity of the C. fusiformis dmaW
gene product had been established by expression in
yeast, whereby the enzyme was assayed by measuring
tryptophan-dependent generation of nonvolatile label
from [3H]DMAPP (Tsai et al., 1995). The same ap-
proach was applied to C. purpurea dmaW-1. The coding
sequence, with introns removed, was cloned into a yeast
expression system. Extracts from transformed, induced
Table 2
DMAT synthase activities from Claviceps spp. dmaW coding regions
expressed in yeast
Gene origin Construct Orientation Sp. act.a
C. fusiformis pKAES135 + 170� 13
N/A Vector N/A )13� 3
C. purpurea pKAES155 ) 13� 4
C. purpurea pKAES153 + 145� 10
C. purpurea pKAES154 + 262� 6
a pmolmin�1 mg�1.
Fig. 3. (A) dmaW segments from Neotyphodium sp. Lp1, PCR-am-
plified using degenerate primer deg1 with deg4 (lane 1), and deg1 with
deg3 (lane 2). (B) Southern-blot analysis demonstrating that ergova-
line-producing endophytes possessed sequences that cross-hybridized
with Neotyphodium sp. Lp1 dmaW. Lanes contained genomic DNA
from Neotyphodium lolii e45 (lane 1), Epichlo€ee typhina ATCC 200736
(lane 2), Neotyphodium sp. Lp1 (lane 3), Neotyphodium sp. e41 (lane 4;
from a Mediterranean tall fescue), N. coenophialum ATCC 90664 (lane
5), Neotyphodium uncinatum CBS 102646 (lane 6), Epichlo€ee baconii
ATCC 200745 (lane 7), E. baconii ATCC 90167 (lane 8), and Epichlo€eefestucae ATCC 90660 (lane 9). Detection (+) or lack of detection ()) ofergovaline in symbiota with the each endophyte is indicated, and is
based on this or other studies (see text). The two bands in lane 5 arise
from the two alleles in N. coenophialum.
194 J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198
yeast cells had substantial DMAT synthase activities,
not significantly different from those directed by the C.
fusiformis dmaW sequence in the same system (Table 2),
demonstrating that C. purpurea dmaW-1 encoded an
active enzyme.
3.2. dmaW from Neotyphodium sp. Lp1
An alignment of the deduced products of C. purpurea
dmaW-1 and C. fusiformis dmaW showed several puta-tively conserved blocks of amino acids (Fig. 2). Four of
these blocks—EQRLWWH (positions 25–31), GI-
FKKHI (positions 56–62), MEDLWTL (positions 285–
291), and MPEPQVY (positions 352–358)—were chosen
as the basis to design degenerate primers deg1, deg2,
deg3, and deg4, respectively (Table 1). These primers
were then used to PCR-amplify putative dmaW seg-
ments from Neotyphodium sp. Lp1, yielding fragmentswith the expected sizes (Fig. 3A). A 783-bp fragment
was amplified by PCR with primers deg1 and deg3, and
a 984-bp fragment was obtained with primers deg1 and
deg4. Neither PCR involving deg2 gave the expected
product. The 783-bp fragment was cloned and se-
quenced, revealing one continuous open reading frame.
The gene was then completely sequenced by a series of
cassette-mediated PCR walks into the genome 50 and 30
of the known 783-bp sequence, then the amplified
fragments were sequenced directly. The deduced amino
acid sequence of dmaW from Neotyphodium sp. Lp1
(Fig. 2) had 65% identity to that of C. purpurea and 60%
identity to that of C. fusiformis. The positions of two
putative introns (Fig. 2) were similar to those in the
homologs from Claviceps spp.
The number of dmaW alleles in each of eight Neoty-
phodium spp. and 10 Epichlo€ee spp. isolates was investi-
gated by Southern analysis of genomic DNAs digested
with restriction endonucleases EcoRI (Fig. 3B), PstI,
HindIII, SalI, XhoI, and XbaI (data not shown). The
results indicated only one dmaW allele in Neotyphodium
sp. Lp1. Other endophytes had zero, one or two alleles
in evidence (Fig. 3B). Those with no dmaW alleles had
previously tested negative for ergovaline, whereas thoseshowing strong hybridization to dmaW were known to
produce ergovaline in symbio (Bush et al., 1997; Leu-
chtmann et al., 2000). Only one isolate (E. baconii
ATCC 200745) showed faint hybridization, and its al-
kaloid profile was unknown.
A functional test of the Neotyphodium sp. Lp1 dmaW
coding sequence was conducted by expression in yeast,
similar to the tests of C. fusiformis dmaW (Tsai et al.,
1995) and C. purpurea dmaW (described above). How-
ever, no significant activity was detected in experiments
with the endophyte dmaW sequence.
3.3. dmaW knockout and complementation
A construct (pKAES170) for disrupting dmaW in
Neotyphodium sp. Lp1 was generated by substituting a
hygromycin phosphotransferase (hph) gene cassette for
341 bp of the gene from the start codon to the first
BamHI site (Fig. 4A). The resulting plasmid was thenintroduced into the endophyte by electroporation, and
transformants were screened by a negative PCR test for
homologous recombination; the test employed two
dmaW-specific primers, one of which was complemen-
tary to the region deleted in the mutant construct. Out
of 125 transformants screened, one failed to yield a PCR
product and was, therefore, a candidate knockout mu-
tant. In a Southern analysis (Fig. 4) 1.8- and 4.7-kbEcoRI fragments from the mutant hybridized with the
dmaW probe, but only the expected 4.1-kb fragment was
Fig. 4. (A) Maps of the wild type dmaW locus, targeting vector
(knockout construct) and expected map of the locus following dis-
ruption. Vertical lines indicate EcoRI sites, and double-headed arrows
indicate expected EcoRI fragments with sizes given in kb. (B) South-
ern-blot analysis indicating successful knockout of dmaW in Neoty-
phodium sp Lp1. Lanes contain total DNA of the wild type endophyte
(wt; lane 1), two single-spore isolates of the disruptant (dmaW ko;
lanes 2 and 3), and an Lp1 transformant with ectopic integration of the
vector (ec; lane 4). DNAs were digested with EcoRI. (In wt lanes,
bands above the main band are from incomplete digests.) The blot was
probed with a mixture of two labeled fragments, one extending from
476 bp upstream of the start codon to codon 44, and the other from
codons 146 to 445. Replacement of the 4.1-kb EcoRI fragment with
1.8- and 4.7-kb fragments indicated disruption of the gene.
Fig. 5. HPLC determinations of ergovaline (42.3min) and its stereo-
isomer ergovalinine (51.4min) in perennial ryegrass without endophyte
(e-), or symbiotic with wild type Neotyphodium sp. Lp1 (wt), the dmaW
knockout mutant (ko) or the mutant complemented with a construct
encoding C. fusiformis DMAT synthase (ct). Detection was by fluo-
rescence with excitation at 310 nm and emission at 410 nm. Asterisks
mark the positions or expected positions of ergovaline and its stereo-
isomer ergovalinine.
J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198 195
observed in the wild type. These results indicated that
dmaW was replaced with the mutant dmaW, and that
both the 30- and 50-flanking regions were intact in the
mutant, hereafter designated dmaW ko.To complement the dmaW ko mutant, the C. fusi-
formis gene was placed under the control of an E.
typhina b-tubulin gene (tub2) promoter in the plasmid
construct pKAES157, which was then introduced into
the dmaW ko. Out of 20 independent transformants
screened, six possessed pKAES157 integrated in the
genome. The pKAES157 transformants are collectively
designated dmaW ct hereafter.Grass-endophyte symbiota were established consist-
ing of Lp1 wild type (wt), dmaW ko or dmaW ct in
perennial ryegrass cv. Rosalin. The frequencies of en-
dophyte infection after inoculation of perennial ryegrass
were 16.6, 13.5, and 18% for wt, dmaW ko, and dmaW
ct, respectively, suggesting that compatibility with the
host was uncompromised by the prior manipulations. Ina previous study (Panaccione et al., 2001), �Rosalin�plants were generated with a knockout mutation of lpsA
(lpsA ko), believed to encode the penultimate step in
ergovaline biosynthesis. To obtain endophyte-minus
controls, uninfected �Rosalin� seeds were grown and
seedlings remained uninoculated. The resulting plants
were tested by tissue-print immunoblot (Gwinn et al.,
1991), confirming that they lacked any Neotyphodium
endophyte.
Plants infected with the wild type Neotyphodium sp.
Lp1 accumulated high concentrations of ergovaline
(range from 4.6 to 7.8 lg g�1 dry weight of infected tis-
sue) and lesser amounts of the simple amide of lysergic
acid, ergine (range from 0.27 to 0.63 lg g�1). Plants with
dmaW ko, as well as endophyte-minus plants, had no
detectable ergovaline (Fig. 5) or ergine (lysergic acidamide; data not shown). Chanoclavine, the first accu-
mulating intermediate of the pathway, was detected
qualitatively by LC–MS in symbiota containing Lp1 or
its lpsA knockout derivative (blocked at a step down-
stream of chanoclavine), but not in the dmaW ko-in-
fected or endophyte-minus perennial ryegrass (Fig. 6).
Chanoclavine I standard co-chromatographed with the
257m/z molecular ion detected in Lp1 and the lpsA
knockout (Fig. 6). The series of nearly co-migrating
species are likely to be one or more of the four described
stereoisomers of chanoclavine I. Additional alkaloid
analyses (not shown) demonstrated that the clavines,
agroclavine, and its oxidized derivative setoclavine, were
readily detectable in Lp1-containing symbiota but not in
symbiota containing the dmaW ko.
Five of the dmaW ct transformants were introducedinto perennial ryegrass, and the symbiota tested for
Fig. 6. LC–MS determination of chanoclavine accumulation in sym-
biota with wt or genetically modified Neotyphodium sp. Lp1. A broad
peak containing chanoclavine isomers was evident in symbiota with
wt, as well as with a mutant Lp1 in which the lysergyl peptide syn-
thetase gene lpsA was knocked out (lpsA ko), but was absent in sym-
biota with the dmaW knockout (dmaW ko). Electrospray ionization
was in the positive mode and detection was by selected ion monitoring
at m=z ¼ 257. Chanoclavine I was used as standard. The shoulders
preceding the chanoclavine I peaks in the wt and lpsA ko symbiota
were likely due to one or more of the four stereoisomers of chano-
clavine (Gr€ooger and Floss, 1998). Int., relative intensity.
196 J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198
ergot alkaloids. Each symbiotum possessed a small but
clearly identifiable amount of ergovaline and its isomer
ergovalinine (mean of 0.15 lg g�1 dry wt infected plant
material measured as both isomers). Small peaks cor-
responding to ergine and chanoclavine I were detectable
in some but not all symbiota with dmaW ct, indicatingthat these alkaloids were present in quantities near the
limits of detection of the assays. This observation is not
surprising considering that ergine accumulation is vari-
able but commonly detected in Lp1-containing symbiota
at concentrations that are approx. 4% of the measured
concentration of ergovaline (Panaccione et al., 2003).
Therefore, concentrations of ergine in symbiota with the
complemented endophyte, which contained an averageof 0.15 lg g�1 ergovaline, frequently would be below the
0.01 lg g�1 limit of detection of this assay.
Isoprene and indole are components common to er-
got alkaloids and lolitrems, and lolitrem B has been
reported in very low amounts in ryegrass plants symbi-
otic with Lp1 (Bush et al., 1997). Therefore, we tested
whether elimination of the ergot alkaloid pathway
caused reallocation of precursors into lolitrem B. Inboth the wild type and dmaW ko symbiota lolitrem B
was undetectable (data not shown), indicating that such
reallocation had not occurred.
4. Discussion
This study constitutes the first genetic test of the roleof DMAT synthase in ergot alkaloid biosynthesis.
Feeding experiments in Claviceps spp. fermentation
cultures have demonstrated that mevalonate and tryp-
tophan are precursors to the ergot and clavine alkaloids,so DMAT synthase was predicted to play a role as the
determinant step in the pathway (Lee et al., 1976). Un-
der a variety of induction and suppression conditions
DMAT synthase activity correlates with production of
ergopeptine or clavine alkaloids in Claviceps spp. cul-
tures (Krupinski et al., 1976). Previously, the dmaW
gene of C. fusiformis was demonstrated to encode au-
thentic DMAT synthase (Tsai et al., 1995). Here weestablished that DMAT synthase is indeed required for
the biosynthesis of ergovaline (the main product of the
ergot alkaloid pathway in endophytes), ergine (an al-
ternate product of the pathway), and chanoclavine (a
critical early intermediate). We eliminated the dmaW
homolog identified in the endophyte strain Lp1, and
observed that the mutant (dmaW ko) produced none of
these metabolites under the conditions conducive forproduction by the wild type, i.e., when symbiotic with
perennial ryegrass. We then demonstrated that the C.
fusiformis dmaW complemented the dmaW ko and re-
stored production of ergovaline.
The C. purpurea gene cloned from isolate P1 (closely
related to that of ATCC 20102) had previously been
proposed as a functional DMAT synthase gene based on
its location near the apparent lysergyl peptide synthe-tase-encoding gene, cpps1 (Tudzynski et al., 1999).
However, Southern-blot analysis (not shown) indicated
that ATCC 20102 and other C. purpurea isolates had
two or more loci with dmaW-related sequences (and it is
also conceivable that divergent paralogs were unde-
tected), so it was essential to show the function of the
cloned gene. We demonstrated, by expression of C.
purpurea dmaW cDNA in yeast, that this gene encodedactive DMAT synthase. This information was critical
for our effort to obtain endophyte homologs of the
Claviceps spp. dmaW genes by a strategy based on
identification of putatively conserved regions in C. fu-
siformis and C. purpurea. Since DMAT synthase con-
tains no known domains or signatures reminiscent of
other prenyl transferases, only comparison of known
dmaW genes could suggest possible conserved regions;the comparison would have been invalid if one of the
genes were nonfunctional.
Once the putative endophyte homolog was identified,
its function was tested by gene knockout. This approach
had the following advantages: (1) the gene cloned from
Neotyphodium sp. Lp1 was demonstrated to encode
DMAT synthase, since the corresponding ko mutant
was complemented by a gene that was previously dem-onstrated to encode this enzyme and (2) the test pro-
vided a definitive confirmation that DMAT synthase is
required for ergot alkaloid production in the endophyte.
The complementation of dmaW ko with the C. fusi-
formis gene provided confirmatory evidence that the
mutation was indeed responsible for loss of ergovaline
production. HPLC analysis of symbiota with the
J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198 197
complemented strains (dmaW ct) indicated definitivepeaks with the retention times of both ergovaline and its
isomer, ergovalinine, whereas these peaks were com-
pletely absent in the endophyte-minus plants and from
symbiota with dmaW ko mutants (see Fig. 5). An at-
tempt to complement with the native endophyte gene
was unsuccessful because no stable co-transformants
were obtained. No further attempts were made with the
endophyte gene in light of the successful complementa-tion by C. fusiformis dmaW. The latter was the most
thoroughly characterized of the dmaW genes with re-
spect to the enzyme activity of the gene product and
authentication of the enzyme product (Tsai et al., 1995).
Thus, the complementation specifically confirmed that
the enzyme, DMAT synthase, was necessary for ergot
alkaloid production.
Two results were unexpected. First, the level of ex-pression of ergovaline and other ergot alkaloids in the
complemented strains (dmaW ct) was very low. It is
possible that the low ergot alkaloid levels were due to
poor expression (or poor stability) of the C. fusiformis
protein in the dmaW ct transformants. The promoter
used to express the C. fusiformis gene was from the b-tubulin gene of E. typhina, one of the ancestors of
Neotyphodium sp. Lp1. Furthermore, this promoter hadpreviously been used to drive hph expression in vectors
used for N. coenophialum transformation (Tsai et al.,
1992). We chose to use this promoter rather than the
native promoter from C. fusiformis because we had no
prior information that the native promoter would be
appropriately regulated in the endophyte. We can only
speculate why there was low expression of DMAT
synthase in dmaW ct. A possibility is that there wasselection against constitutive expression in the trans-
formants. Such selection may be expected if constitutive
expression caused depletion of cellular pools of essential
metabolites (tryptophan and DMAPP), or if the enzyme
product, DMAT, was toxic to the fungus. It is possible
that for this reason the only dmaW ct transformants that
were obtained were those that, perhaps due to positional
effects, produced very low levels of the enzyme.The second unexpected result was that the coding
region of Neotyphodium sp. Lp1 dmaW, placed into the
yeast expression system, failed to give detectable DMAT
synthase activity. Again, we can only speculate on pos-
sible reasons. It is possible, for example, given the con-
siderable sequence differences from the Claviceps spp.
genes, that mRNA from the endophyte gene, or the
protein product was unstable in the yeast system. Al-ternatively, the assay conditions, which had been de-
signed for the C. fusiformis enzyme (Gebler and Poulter,
1992), might have been unsuitable for the endophyte
DMAT synthase. Also it should be noted that the entire
coding sequence and approximately 300 bp of 30-un-translated region was cloned into the vector in the
construct of C. purpurea dmaW, whereas the endophyte
gene construct did not include the 30-untranslated re-gion. So, it is conceivable that the native dmaW 30-un-translated region may be important for the stability of
the mRNA. Whatever the reason for this result, the
genetic analyses employing gene knockout and com-
plementation definitively demonstrated function of the
endophyte dmaW gene.
Eliminating from endophytes of forage grasses the
factors responsible for fescue toxicosis is a long-termresearch goal. Although Neotyphodium spp. endophytes
provide profound benefits and play important roles in
grass protection and fitness, ergot alkaloids are generally
anti-mammalian and are thought to be a major cause of
livestock toxicosis. Modified endophytes incapable
of producing ergot alkaloids will allow definitive tests of
ergot alkaloid effects on livestock, as well as the means
to determine whether ergot alkaloids play other roles ingrass fitness and protection. By eliminating the first
enzyme in the pathway, and thus all ergot alkaloids, the
dmaW knockout described here provides a particularly
valuable tool for assessing the contribution of these
metabolites to the various endophyte-associated traits.
Moreover, the dmaW ko strain may serve as a standard,
against which can be compared strains that contain later
blocks in the pathway (e.g., in the lysergyl peptide syn-thetase (Panaccione et al., 2001)) and, thus produce
some subset of the ergot alkaloids.
Acknowledgments
We thank Alfred D. Byrd and Walter Hollin for
technical assistance. Alkaloid analyses were conducted
during a visit by D.G.P. to AgResearch Grasslands,
Palmerston North, New Zealand, in collaboration with
Brian Tapper, Geoff Lane, Elizabeth Davies, and Karl
Fraser. Authentic standards of ergot alkaloids were
provided by Forrest Smith (Auburn University) and
Miroslav Flieger (Czech Academy of Science). Thiswork was supported by Grant 2001-35319-10930 from
the United States Department of Agriculture National
Research Initiative. This is publication No. 03-12-113 of
the Kentucky Agricultural Experiment Station, pub-
lished with approval of the director.
References
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman,
J.G., Smith, J.A., Struhl, K., 2001. Current Protocols in Molecular
Biology. John Wiley & Sons, New York.
Bacon, C.W., Lyons, P.C., Porter, J.K., Robbins, J.D., 1986. Ergot
toxicity from endophyte-infected grasses: a review. Agronomy J.
78, 106–116.
Birch, A.J., McLoughlin, B.J.H.S., 1960. The biosynthesis of the ergot
alkaloids. Tetrahedron Lett. 7, 1–3.
198 J. Wang et al. / Fungal Genetics and Biology 41 (2004) 189–198
Bush, L.P., Wilkinson, H.H., Schardl, C.L., 1997. Bioprotective
alkaloids of grass–fungal endophyte symbioses. Plant Physiol.
114, 1–7.
Byrd, A.D., Schardl, C.L., Songlin, P.J., Mogen, K.L., Siegel, M.R.,
1990. The b-tubulin gene of Epichlo€ee typhina from perennial
ryegrass (Lolium perenne). Curr. Genet. 18, 347–354.
Carroll, A.M., Sweigard, J.A., Valent, B., 1994. pCB1004. Fungal
Genet. Newslett. 41, 22–23.
Clay, K., Schardl, C., 2002. Evolutionary origins and ecological
consequences of endophyte symbiosis with grasses. Am. Nat. 160,
S99–S127.
Cross, D.L., 2003. Ergot alkaloid toxicity. In: White Jr., J.F., Bacon,
C.W., Hywel-Jones, N.L., Spatafora, J.W. (Eds.), Mycology.
Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Biocon-
trol and Cultural Impacts, vol. 19. Marcel-Dekker Inc, New York
and Basel, pp. 475–494.
Floss, H.G., Robbers, J.E., Heinstein, P.F., 1974. Regulatory control
mechanisms in alkaloid biosynthesis. Rec. Adv. Phytochem. 8,
141–178.
Freeman, E.M., 1904. The seed fungus of Lolium temulentum L., the
darnel. Philos. Trans. R. Soc. Lond. B 196, 1–27.
Gallagher, R.T., Hawkes, A.D., Stewart, J.M., 1985. Rapid determi-
nation of neurotoxin lolitrem B in perennial ryegrass by high-
performance liquid chromatography with fluorescence detection. J.
Chromatogr. 321, 217–226.
Gebeyehu, G., Rao, P.Y., SooChan, P., Simms, D.A., Klevan, L.,
1987. Novel biotinylated nucleotide analogs for labeling and
colorimetric detection of DNA. Nucleic Acids Res. 15, 4513–4534.
Gebler, J.C., Poulter, C.D., 1992. Purification and characterization of
dimethylallyltryptophan synthase from Claviceps purpurea. Arch.
Biochem. Biophys. 296, 308–313.
Gebler, J.C., Woodside, A.B., Poulter, C.D., 1992. Dimethylallyltry-
ptophan synthase. An enzyme catalyzed electrophilic aromatic
substitution. J. Am. Chem. Soc. 114, 7354–7360.
Gr€ooger, D., Floss, H.G., 1998. Biochemistry of ergot alkaloids—
achievements and challenges. Alkaloids 50, 171–218.
Gr€ooger, D., Mothes, K., Simon, H., Floss, H.G., Weygand, F., 1960.€UUber den Einbau von Mevalons€aaure in das Ergonlinsystem der
Clavin-Alkaloide. Z. Naturforsch. Teil B 15, 141–143.
Gr€ooger, D., Wendt, H.J., Mothes, K., Weygand, F., 1959. Untersuch-
ungen zur Biosynthese der Mutterkornalkaloide. Z. Naturforsch.
Teil B 14, 355–358.
Gwinn, K.D., Shepard-Collins, M.H., Reddick, B.B., 1991. Tissue
print-immunoblot: an accurate method for the detection of
Acremonium coenophialum in tall fescue. Phytopathology 81, 747–
748.
Heinstein, P.F., Lee, S.-L., Floss, H.G., 1971. Isolation of dimethyl-
allylpyrophosphate: tryptophan dimethylallyl transferase from the
ergot fungus (Claviceps spec.). Biochem. Biophys. Res. Commun.
44, 1244–1251.
Hoveland, C., 1993. Importance and economic significance of the
Acremonium endophytes to performance of animals and grass
plants. Agric. Ecosyst. Environ. 44, 3–12.
Krupinski, V.M., Robbers, J.E., Floss, H.G., 1976. Physiological study
of ergot: Induction of alkaloid synthesis by tryptophan at
enzymatic level. J. Bacteriol. 125, 158–165.
Kuldau, G.A., Liu, J.-S., White Jr., J.F., Siegel, M.R., Schardl, C.L.,
1997. Molecular systematics of Clavicipitaceae supporting mono-
phyly of genus Epichlo€ee and form genus Ephelis. Mycologia 89,
431–441.
Latch, G.C.M., Christensen, M.J., Samuels, G.J., 1984. Five endo-
phytes of Lolium and Festuca in New Zealand. Mycotaxon 20, 535–
550.
Lee, S.-L., Floss, H.G., Heinstein, P., 1976. Purification and properties
of dimethylallylpyrophosphate:tryptophan dimethylallyl transfer-
ase, the first enzyme of ergot alkaloid biosynthesis in Claviceps sp.
SD 58. Arch. Biochem. Biophys. 177, 84–94.
Leuchtmann, A., Schmidt, D., Bush, L.P., 2000. Different levels of
protective alkaloids in grasses with stroma-forming and seed-
transmitted Epichlo€ee /Neotyphodium endophytes. J. Chem. Ecol.
26, 1025–1036.
Li, D., Chung, K.R., Smith, D.A., Schardl, C.L., 1995. The Fusarium
solani gene encoding kievitone hydratase, a secreted enzyme that
catalyzes detoxification of a bean phytoalexin. Mol. Plant–Microbe
Interact. 8, 388–397.
Malinowski, D.P., Belesky, D.P., 2000. Adaptations of endophyte-
infected cool-season grasses to environmental stresses: mechanisms
of drought and mineral stress tolerance. Crop Sci. 40, 923–940.
Mattern, I.E., Punt, P.J., van den Hondel, C.A.M.J.J., 1988. A vector
of Aspergillus transformation conferring phleomycin resistance.
Fungal Genet. Newslett. 35, 25.
Mothes, K.V., Weygand, F., Gr€ooger, D., Grisebach, H., 1958.
Untersuchungen zur Biosynthese der Mutterkorn-Alkaloide. Z.
Naturforsch. Teil B 13, 41–44.
Murray, F.R., Latch, G.C.M., Scott, D.B., 1992. Surrogate transfor-
mation of perennial ryegrass, Lolium perenne, using genetically
modified Acremonium endophyte. Mol. Gen. Genet. 233, 1–9.
Orbach, M.J., 1994. A cosmid with a HyR marker for fungal library
construction and screening. Gene 150, 159–162.
Panaccione, D.G., Johnson, R.D., Wang, J.H., Young, C.A., Dam-
rongkool, P., Scott, B., Schardl, C.L., 2001. Elimination of
ergovaline from a grass–Neotyphodium endophyte symbiosis by
genetic modification of the endophyte. Proc. Natl. Acad. Sci. USA
98, 12820–12825.
Panaccione, D.G., Tapper, B.A., Lane, G.A., Davies, E., Fraser, K.,
2003. Biochemical outcome of blocking the ergot alkaloid pathway
of a grass endophyte. J. Agric. Food Chem. 51, 6429–6437.
Raisbeck, M.F., Rottinghaus, G.E., Kendall, J.D., 1991. Effects of
naturally occurring mycotoxins on ruminants. In: Smith, J.E.,
Henderson, R.S. (Eds.), Mycotoxins and Animal Foods. CRC
Press, Boca Raton, Florida, pp. 647–677.
Sampson, K., 1937. Further observations on the systemic infection of
Lolium. Trans. Br. Mycol. Soc. 21, 84–97.
Schardl, C.L., An, Z., 1993. Molecular biology and genetics of
protective fungal endophytes of grasses. In: Setlow, J.K. (Ed.),
Genetic Engineering, Principles and Methods, vol. 15. Plenum
Press, New York, pp. 191–212.
Schardl, C.L., Leuchtmann, A., Tsai, H.-F., Collett, M.A.,Watt, D.M.,
Scott, D.B., 1994. Origin of a fungal symbiont of perennial ryegrass
by interspecific hybridization of a mutualist with the ryegrass choke
pathogen, Epichlo€ee typhina. Genetics 136, 1307–1317.
Spiering, M.J., Davies, E., Tapper, B.A., Schmid, J., Lane, G.A., 2002.
Simplified extraction of ergovaline and peramine for analysis of
tissue distribution in endophyte-infected grass tillers. J. Agric.
Food Chem. 50, 5856–5862.
Thompson, F.N., Stuedemann, J.A., 1993. Pathophysiology of fescue
toxicosis. Agric. Ecosyst. Environ. 44, 263–281.
Tsai, H.-F., Siegel, M.R., Schardl, C.L., 1992. Transformation of
Acremonium coenophialum, a protective fungal symbiont of the
grass Festuca arundinacea. Curr. Genet. 22, 399–406.
Tsai, H.-F., Wang, H., Gebler, J.C., Poulter, C.D., Schardl, C.L.,
1995. The Claviceps purpurea gene encoding dimethylallyltrypto-
phan synthase, the committed step for ergot alkaloid biosynthesis.
Biochem. Biophys. Res. Commun. 216, 119–125.
Tudzynski, P., Correia, T., Keller, U., 2001. Biotechnology and
genetics of ergot alkaloids. Appl. Microbiol. Biotechnol. 57, 593–
605.
Tudzynski, P., H€oolter, K., Correia, T., Arntz, C., Grammel, N., Keller,
U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps
purpurea. Mol. Gen. Genet. 261, 133–141.
Wilkinson, H.H., Siegel, M.R., Blankenship, J.D., Mallory, A.C.,
Bush, L.P., Schardl, C.L., 2000. Contribution of fungal loline
alkaloids to protection from aphids in a grass–endophyte mutual-
ism. Mol. Plant–Microbe Interact. 13, 1027–1033.