Molecular Microbiology (2004)

52

(4), 1013–1028 doi:10.1111/j.1365-2958.2004.04038.x

© 2004 Blackwell Publishing Ltd

Blackwell Science, LtdOxford, UKMMIMolecular Microbiology0950-382XBlackwell Publishing Ltd, 2004

? 2004

52

410131028

Original Article

Resistance of T4 early promoters to AsiAG. Orsini

et al

.

Accepted 15 January, 2004. *For correspondence. E-mailakolb@pasteur.fr; Tel. (+33) 1 45 68 86 44; Fax (+33) 1 45 68 89 60.

Phage T4 early promoters are resistant to inhibition by the anti-sigma factor AsiA

Gilbert Orsini,

1

Sébastien Igonet,

2

Carole Pène,

3

Bianca Sclavi,

4

Malcolm Buckle,

4

Marc Uzan

3

and Annie Kolb

1

*

1

Unité des Régulations Transcriptionnelles, Département de Microbiologie Fondamentale et Médicale and

2

Unité d’Immunologie Structurale, Département de Biologie Structurale et Chimie, URA 2185 du CNRS, Institut Pasteur, F-75724 Paris Cedex 15, France.

3

Institut Jacques Monod, UMR 7592 CNRS-Universités Paris 6 and Paris 7, 2 place Jussieu, 75251 Paris Cedex 05, France.

4

Enzymologie et Cinétique Structurale, UMR 8532 du CNRS, LBPA, Ecole Normale Supérieure de Cachan, 94235 Cachan, France.

Summary

Phage T4 early promoters are transcribed

in vivo

and

in vitro

by the

Escherichia coli

RNA polymeraseholoenzyme E

ssss

70

. We studied

in vitro

the effects of theT4 anti-

ssss

70

factor AsiA on the activity of several T4early promoters. In single-round transcription, pro-moters motB, denV, mrh.2, motA wild type and UPelement-deleted motA are strongly resistant to inhibi-tion by AsiA. The

aaaa

-C-terminal domain of E

ssss

70

is cru-cial to this resistance. DNase I footprinting of E

ssss

70

andE

ssss

70

AsiA on motA and mrh.2 shows extended con-tacts between the holoenzyme with or without AsiAand upstream regions of these promoters. A TG

ÆÆÆÆ

TCmutation of the extended

----

10 motif in the motA UPelement-deleted promoter strongly increases suscep-tibility to inhibition by AsiA, but has no effect on themotA wild-type promoter: either the UP element or theextended

----

10 site confers resistance to AsiA. Potas-sium permanganate reactivity shows that the twostructure elements are not equivalent: with AsiA, themotA UP element-deleted promoter opens moreslowly whereas the motA TC promoter opens like thewild type. Changes in UV laser photoreactivity at posi-tion +4 on variants of motA reveal an analogous dis-tinction in the roles of the extended

----

10 and UPpromoter elements.

Introduction

When bacteriophage T4 infects

Escherichia coli

, the bac-terial RNA polymerase E

s

70

holoenzyme (subunit compo-sition

a

2

bb¢w

s

70

) immediately initiates transcription fromapproximately 40 T4 early promoters that contain

-

10 and

-

35 recognition sequences (Liebig

et al

., 1989; Luke

et al

.,2002; Miller

et al

., 2003). Subsequent activation of the T4middle promoters requires the host holoenzyme E

s

70

together with two T4 early gene products, the proteinsMotA and AsiA (Ouhammouch

et al

., 1994; 1995; Hinton

et al

., 1996; Luke

et al

., 2002). Middle promoters containa

-

10 sequence recognized by E

s

70

; however, the

-

35upstream promoter element is replaced by the MotA box,a 9 bp motif centred around

-

30, which is the DNA bindingsite for the transcriptional activator MotA (Hinton, 1991;Schmidt and Kreuzer, 1992). The co-activator AsiA hasbeen the first protein reported to display an anti-

s

activity(Stevens, 1973; Hughes and Mathee, 1998; Helmann,1999). AsiA strongly inhibits E

s

70

-directed transcriptionfrom

-

10/

-

35

E. coli

promoters (Adelman

et al

., 1997;Severinova

et al

., 1998). Binding of AsiA has been mappedwithin

s

70

region 4, the major AsiA binding site beingrestricted to

s

70

region 4.2 (Severinova

et al

., 1996; Colland

et al

., 1998; Severinov and Muir, 1998; Minakhin

et al

.,2001; 2003). This has led to the notion that the binding of

s

70

region 4.2 to the

-

35 hexamer or to AsiA is mutuallyexclusive, thus explaining the inhibition of transcription byAsiA (Severinova

et al

., 1996; Colland

et al

., 1998; Sev-erinov and Muir, 1998). A corollary of this proposal is thefinding that transcription from promoters lacking a

-

35motif and having the extended

-

10 sequence 5

¢

-TG-3

¢

isfairly insensitive to inhibition by AsiA (Pahari and Chatterji,1997; Colland

et al

., 1998; Severinova

et al

., 1998).In addition to the

-

10 and

-

35 hexamers, T4 earlypromoters are very strong promoters that contain severalimportant features. Most of them are characterized by (i)an ‘extended

-

10’ consensus sequence; (ii) a highly con-served

-

35 sequence 5

¢

-GTTTACA-3

¢

; and (iii) a series ofA- and T-rich tracts upstream of the

-

35 region, the UPelements (Liebig

et al

., 1989; Ross

et al

., 1993; Miller

et al

., 2003). In certain bacterial promoters, UP elementshave been shown to interact with the

a

-C-terminal domain(CTD) of E

s

70

, and some UP elements affect DNA curva-ture (Miller

et al

., 2003; Ross

et al

., 2003). Soon after T4infection, utilization of early promoters is abruptly turned

1014

G. Orsini

et al.

© 2004 Blackwell Publishing Ltd,

Molecular Microbiology

,

52

, 1013–1028

off (Broida and Abelson, 1985; Sanson and Uzan, 1993),and it has been shown recently that this transcriptionshutoff also occurs unabated

in vivo

in the absence ofAsiA, strongly suggesting that,

in vivo

, AsiA is not respon-sible for the abrupt inhibition of T4 early promoters (Peneand Uzan, 2000). This finding raises the issue of the effectof AsiA on the activity of phage T4 early promoters. Here,we have analysed

in vitro

the transcription activity of sev-eral T4 early promoters when AsiA is bound to E

s

70

.Indeed, previous studies have provided evidence thattranscription from the T4 early promoters motA and P15.0(called mrh.2 in this work) is inhibited by AsiA (Ouham-mouch

et al

., 1995; Adelman

et al

., 1997). Further analy-sis leads us to show that, in fact, these and other T4 earlypromoters are strongly resistant to inhibition of transcrip-tion initiation by AsiA. Using reconstituted RNA poly-merase and mutated versions of cloned T4 earlypromoters, we have analysed the multiple contributions tothis biologically significant resistance of these promotersto inhibition by AsiA, the T4 anti-

s

70

factor.

Results

The T4 early promoters: analysing the effect of AsiA on transcription of the total T4 genome

In a first approach to analysing the effect of AsiA on T4early promoters, wild-type T4 DNA was transcribed bypurified

E. coli

RNA polymerase in the absence or pres-ence of AsiA. The activity of 10 individual early promoters(shown in Fig. 1) was assessed by measuring the RNAaccumulation by primer extension. T4 DNA contains glu-

cosylated hydroxymethyl cytosine (HMC-glu) instead ofunmodified cytosine (Kutter and Wiberg, 1969). As the

lac

UV5 promoter, taken as a control promoter sensitive toAsiA, is carried by unmodified DNA, we extended ouranalysis by comparing the results obtained with HMC-gluT4 DNA and with cytosine-containing T4 DNA. The resultsof this analysis are shown on the left side of Fig. 1. Underconditions in which the

lac

UV5 promoter is almost totallyinhibited by AsiA (4% of residual activity), the T4 earlypromoters were found to be only moderately sensitive toAsiA. However, they did not respond in the same mannerwhether or not the template was modified. With cytosine-containing DNA, there was a clear trend towards allevia-tion or suppression of this inhibition for nine out of the 10promoters analysed. As an example, with cytosine-containing DNA, promoters motA and nrdC.4 were totallyinsensitive to AsiA. As shown below, this conforms closelyto the results obtained using this class of promoters whenstudied by single-round transcription assay. The increasedsensitivity of early promoters to AsiA with HMC-glu T4DNA is consistent with the suggestion that hydroxymeth-ylation and glucosylation of T4 DNA tend to decrease theaffinity of RNA polymerase (RNAP) for promoter sites(Gram

et al

., 1984).

Run-off transcription from, and open complex formation at several T4 early promoters are resistant to inhibition by AsiA

Promoters motA and mrh.2 were chosen in previousattempts to evaluate the effects of AsiA on the activity of

Fig. 1.

List of promoter sequences and results of the primer extension experiments. The names of the promoters are listed in the left column. On the right are the sequences of the promoters aligned on the

-

35 consensus motif. The

-

10 and

-

35 boxes are underlined as well as the extended

-

10 motif. On the left side, the two columns of figures show the results of the detection by primer extension of the corresponding transcript synthesized from wild-type T4 DNA (HMC-glu) or cytosine-containing T4 DNA as a template. The data represent residual activities expressed as a percentage of the control without AsiA. Each experiment was performed in duplicate (in triplicate for motB and nrh.2 with HMC-glu DNA), and the average values are shown together with the observed variations.

Residual activity

(% of control)

HMC-glu Cytosine

T4 DNA T4 DNA

_______________________

-60 -50 -40 -30 -20 -10 +1

• • • • • • •

motB 35.9±4.2 40.3±6 CTCGTAGTGCAGTGGTAGCTATTTTGAATTAATAGTTTACAAACTCTTGGGACCAGAGTATAATGGTCCCGTGGAGTA

ModB 25.5±11.5 48.3±5.7 CTTGGGCTCCCTGGGCAAAATAATTCAAAAAGTTGTTTACTTTCCTTTCTAACGATGATATGATAGCTTCTGAAGTAT

mrh.2 50±3.3 75±1 GGACTCCTTCGGGAGTCCTTTTTTCATTTAAATGGTTTACTTTCCAAAATGAGTATGGTATAATAGAATTATCTTATA

dmd 33.5±1.5 62.6±1.5 AGTTAGATGCTTTGGCGAATGAATTAAAATTTTAGTTTACAAGCTGACAAGACTATGGTATAGTAGTCTTGTCGGTTA

imm.1 58.9±15.2 82±8 CCTTTGGATTCCCTAAAAATTTTTTCACAAAACTGTTTACAAGACTGTTCTTCCATGGTACTATACAACTATCAACTA

nrdC.4 52.9±3 111.5±11 CTAAACTGAACAATGCACTAAATGCACTGAACTAGTTTACTTTGCCACAAGGATGTGGTATAATGTTCTTACTTTCTA

denV 21.2±2.5 35.6±5.1 TCGAAGCAGCTAAAGCAATTAAAGATAAATAACAGTTTACAATCTCCTGTAGGTATGATACTATAGACCTATCAACTA

motA 47.1±2 107±11 CCCTTTTTTATTTTAAAAATTTTTTCACAAAACGGTTTACAACCAAAGCATACTGTGGTACTATACAACTATCAACTA

motA(del) n.d. n.d. CCGTAGCAGGAGGTCTTCTTGCGTTCGGAATTCGGTTTACAACCAAAGCATACTGTGGTACTATACAACTATCAACTA

tRNA.4 59.5±3.5 33.5±0.5 TAAAAATCTTTTGTAATAAATATTTCACAAAGTTGTTTACATAGGGTTTTAGCTGTGATACTATTACCCTATCAACTA

cef 32±4 88.5±26.5 CTCTATGCATAAAGTTTAAATTTTTCATAAAACTATATACATCAGTAGTTGATTATGGTACTATATCAATATCAACTA

lacUV5 4.3±0.5 ATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGA

Resistance of T4 early promoters to AsiA

1015

© 2004 Blackwell Publishing Ltd,

Molecular Microbiology

,

52

, 1013–1028

T4 early promoters (Ouhammouch

et al

., 1995 Adelman

et al

., 1997). Here, we used promoters motA, motB, denVand mrh.2 contained in DNA fragments obtained by poly-merase chain reaction (PCR) amplification. We also con-structed a ‘deleted’ version of the motA promoter in whichthe sequence immediately upstream of the

-

35 hexamerwas replaced by a phage M13-derived sequence. InFig. 2A and B, we show that single-round run-off tran-scription initiating at these promoters is strongly resistantto inhibition by AsiA. Remarkably, the deleted version ofthe motA promoter reacts like its wild-type counterpart.The results obtained with all these T4 promoters contrastwith the behaviour of two

-

10/

-

35

E. coli

promoters,

lac

UV5 and RNA I (Fig. 2B).Promoters mrh.2 and motA were chosen for additional

experiments to characterize these observations further.Analysis of gel retardation experiments showed that,with promoter motA, binding of AsiA to E

s

70

only slightlydecreases RNAP apparent affinity for the promoter. Athigh polymerase concentration,

ª

75% of promoter occu-pancy is observed in the presence of AsiA comparedwith in its absence (Fig. 3A). Furthermore, in the caseof promoter mrh.2, binding of AsiA causes no detectablemodification of apparent affinity or decrease in promoteroccupancy (Fig. 3B). DNase I footprinting experimentsperformed with promoter fragments labelled on the non-template strand showed that the holoenzyme E

s70AsiAcomplex very efficiently protects both mrh.2 and motApromoter DNA, whereas a pattern of DNase I digestionindicative of naked DNA is observed when lacUV5 DNAis incubated with the preformed holoenzyme Es70AsiAcomplex (Fig. 3C). Moreover, the digestion patternsobserved with both mrh.2 and motA show two hypersen-sitive bands in the -25 and -35 region of these promot-ers when Es70 is previously complexed with AsiA(Fig. 3C, compare the lanes without and with AsiA in themotA-NT and mrh.2-NT footprints). This supports thepresence of AsiA within the open complex formed atthese promoters, as these bands are not seen in thedigestion patterns obtained with the holoenzyme alone,and AsiA alone does not contain any nuclease activity.The DNase I footprints of Es70 alone on promoterslacUV5, mrh.2 and motA show some difference in theupstream region (Fig. 3C). With lacUV5, full protectionby Es70 does not extend beyond position -49 on thenon-template strand. In contrast, with motA, protectionextends further upstream, and some hypersensitivebands are generated by the holoenzyme up to positions-55 and -56 (shown in Fig. 3C by thick bars on the leftside of the motA gel). These hypersensitive bands indi-cate a widening of the minor groove in DNA and couldreflect interactions between RNAP a-CTD and theupstream sequences of these promoters (Ross et al.,1993; Gourse et al., 2000). When promoter mrh.2 is

labelled at the 5¢ end of the template strand (see thefootprint mrh.2-T in Fig. 3C), these interactions aremuch more clearly visible in the footprint afforded byEs70 alone. Indeed, in this case, a series of DNase I

Fig. 2. Effect of AsiA on the transcription activity of lacUV5 and several T4 early promoters.A. Single-round transcription at different promoters in the presence of increasing [AsiA]/[RNAP] ratios.B. Histogram showing the relative levels of run-off transcripts obtained with -10/-35 promoters and the T4 early promoters used in this work, in the presence of a ratio [AsiA]/[RNAP] = 3. Essentially the same results were observed with ratios of 6 and 9 (data not shown).

lac UV5

den V

mot A wt

0 0 1.5 3 6 9

0 0 3 6 9

0 0 3 6 9

A

promoter tested (+/- AsiA)

B

1016 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

hypersensitive sites centred around positions -26, -36,-45, -58 and -67 alternate with DNA protected regions.As shown below, we observed a similar pattern ofDNase I upstream hypersensitive bands when the full-length motA wild-type promoter (motA wt) was 32P-labelled at the 5¢ end of the template strand (see Fig. 5).In the case of the galP1 promoter, an alternating patternof protected and hypersensitive sites has been inter-preted as indicating a wrapping of upstream promoterDNA around Es70 (Attey et al., 1994; Minakhin and Sev-erinov, 2003).

Thus, the DNase I footprints of Es70 and of theEs70AsiA complex on motA wt and mrh.2 strongly sug-gest contacts between the holoenzyme with or withoutAsiA and the upstream regions of these promoters. Asshown below, these contacts are a major structuralbasis for the resistance of these promoters to inhibi-tion by AsiA. However, run-off transcription from pro-moter motA deleted is also strongly resistant to AsiA;therefore, other factors must contribute to this effect.Hence, what are the respective roles of theseelements?

Fig. 3. Open complex formation on mrh.2 and motA wt promoters.A and B. Analysis of gel retardation experiments performed with motA wt (A) and mrh.2 (B). Open symbols: ratio [AsiA]/[RNAP] = 5. The fraction of open complex is plotted as a function of [RNAP].C. DNase I footprints with lacUV5, motA wt and mrh.2 ([AsiA]/[RNAP] = 3). G+A = sequencing ladder. lacUV5 and motA wt promoter fragments were 32P end-labelled at the non-template strand. With promoter mrh.2 are shown the footprints observed with 32P end-labelled non-template strand (NT) and template strand (T). The bars on the lefthand side of the motA wt (NT) and mrh.2 (NT) gels indicate hypersensitive bands generated by RNA polymerase alone in the upstream region of the promoters.

C

RNAP

AsiA

++

+ ---

G+A

mrh.2(T)

.-50

.-60

.-70

.-40

.-30

.-20

.-10

.+1

.+10

.+20

RNAP

AsiA

++

+ ---

G+A

lac UV5(NT)

.-50

.-40

.-30

.-20

.-10

.+1

.+10

.+20

.+30

RNAP

AsiA

++

+ ---

G+A

mrh.2(NT)

.-50

.-60

.-40

.-30

.-20

.-10

.+1

.+10

.+20

.+30

RNAP

AsiA

++

+ ---

G+A

motA(NT)

.-50

.-40

.-30

.-20

.-10

.+1

.+10

.+20

.+30

Resistance of T4 early promoters to AsiA 1017

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

Role of the upstream region and the extended -10 TG motif in the resistance to inhibition by AsiA

To determine the role of the RNAP a-CTD in the resis-tance to inhibition by AsiA, we used a mutant of RNAP inwhich both a-CTDs are deleted (Kolb et al., 1993). Usingthe abortive initiation assay, we compared the behaviourof this a-CTD-deleted enzyme with that of wild-type RNAPin reactions performed in the presence or absence of AsiAwith lacUV5 and several T4 early promoters. Figure 4shows that, with all the T4 early promoters chosen for thisexperiment, deletion of the a-CTDs strongly increasesinhibition of open complex formation by AsiA and resultsin promoters almost as sensitive to AsiA as lacUV5. Inter-estingly, the same result was observed with promotermotA deleted. We must conclude that, in spite of the non-specific upstream sequence introduced in the construc-tion of this promoter, upstream promoter–RNAP contactsmediated through the a-CTDs contribute significantly tothe resistance of this promoter to inhibition by AsiA, astheir deletion suppresses most of this property. This indi-cates that non-specific promoter upstream contacts withthe a-CTDs of Es70 are sufficient to confer AsiA resistanceto this promoter. Promoters mrh.2 and motA wt are clas-sical T4 early promoters as they both contain an ‘extended-10’ TG motif and an UP element (see Fig. 1): bothsequence elements are considered to be important con-tributors to the strength of these promoters (Liebig et al.,1989; Miller et al., 2003) as well as other E. coli promoters(Ross et al., 1993; Barne et al., 1997). We wished toexamine the role of these sequence elements in the resis-

tance to AsiA. The availability of the motA deleted versionin our initial collection of promoters (Fig. 1) prompted usto use mrh.2, motA wt and motA deleted in site-directedmutagenesis experiments to substitute a -5¢TC3¢– for the-5¢TG3¢– of the promoters, previously cloned in a pUC19vector upstream of the rrnBT1T2 transcription termina-tors. This gave us six versions of the cloned promoters,three having the extended -10 TG motif and three withthe TC mutation (hereafter termed TC). Table 1 summa-rizes the results of run-off transcription analysis of thesepromoters in the presence of a high [AsiA]/[RNAP] ratio(7:1). Promoters motA TC and mrh.2 TC performedessentially like their wild-type counterparts. PromotermotA deleted/TG was resistant to AsiA inhibition, in con-trast to the double mutant motA deleted/TC, which was assensitive to AsiA as the bacterial promoters lacUV5 andRNA I. Table 1 also shows that essentially the same run-off transcription results were observed with all the clonedfragments, irrespective of the supercoiled versus linearform of the DNA, thus suggesting that the property ofresistance to AsiA is not related to the coiled state of thesepromoters. The two versions of promoter motA deletedwere used next together with promoter motA wt in DNaseI footprinting experiments performed with DNA fragmentslabelled on the template strand. Figure 5 shows thatreplacing the wild-type upstream sequence of motA by a‘random’ phage M13 sequence results in a shortening ofthe pattern observed with RNAP alone as the hypersen-sitive bands are not visible beyond bases -36, -38 inmotA deleted, compared with bases -45, -46 and-61, -63 on motA wt. Moreover, and in line with the run-off results in Fig. 2B, although RNAP is fully capable ofprotecting motA deleted/TG in the presence of AsiA, theenzyme offers no protection at all on motA deleted/TC atthe two [AsiA]/[RNAP] ratios tested. These results indicatethat either structural determinant alone, the ‘extended-10’ TG motif or the UP element, is sufficient to protecttranscription initiated at promoters motA or mrh.2 against

Fig. 4. Effect of the a-CTD deletion in RNAP on the resistance of four promoters to inhibition by AsiA. Abortive initiation was used to determine the percentage of residual activities ([AsiA]/[RNAP] = 5) on the indicated promoters using native RNAP (open bars) and RNAP with a-CTD deleted (filled bars).

lac UV5 den V mot wt mot del

rela

tive

tran

scrip

tion

activ

ity (%

)

Table 1. Run-off transcription analysis of T4 and E. coli promoterscloned in the pJCD01 vector.

PromoterLinear PCRfragment Supercoiled plasmid

mrh.2 wt 91.2 100 ± 5mrh.2 TC 90.8 90.8 ± 17motA wt 79 81 ± 0.4motA TC 89 78.4 ± 1.8motA deleted 69 82.7 ± 0.9motA deleted TC 13 17.1 ± 1.7lacUV5 20 9.4 ± 0.4RNA I – 13.6 ± 2.3

Residual activities of the run-off transcription reactions carried out onthe linear DNA fragments or the supercoiled plasmids in the presenceof AsiA (sevenfold molar excess over RNAP) are expressed as apercentage of the controls without AsiA.

1018 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

inhibition by AsiA. When both protective elements aresuppressed, as with motA deleted/TC, transcription isstrongly inhibited, and no open complex can be formedon this promoter in the presence of AsiA. In this case, the-35 consensus sequence of the promoter cannot interactwith Es70 with AsiA bound to s70 region 4, resulting in theexpected inhibited pattern, characteristic of ‘simple’-10/-35 bacterial promoters.

Laser UV photofootprinting of RNAP–motA promoter interactions with or without AsiA

Laser UV footprinting has been used to study interactionsbetween RNAP and the T4 middle promoter PrIIB2 in thepresence of the T4 proteins MotA and AsiA during tran-scription initiation (Adelman et al., 1998). We applied thisapproach to understand better the events accompanyingopen complex formation at promoter motA in the presenceof AsiA. We first analysed primer extension patternsobserved at equilibrium after open complex formation onmotA wt and motA TC. At both promoters, the -35 regionis very similar to that seen at lacUV5, and the resultingphotoreactivity resembles that already reported (Buckleet al., 1991; 1999), in which, on naked DNA, three adja-cent thymines at positions -34, -35 and -36 on the non-template strand form cyclobutane dimers that in turn lead

to two terminations at positions -33 and -34 after primerextension using Klenow fragment (see Fig. 1). In opencomplexes formed at promoter lacUV5, the termination atposition -33 increases as a result of the formation of adirect contact between the sigma subunit and thymine-34, and the termination at position -34 decreasesbecause of perturbations in the local structure of the DNA(Buckle et al., 1991; 1999). In the two versions of the motApromoter studied here, the equivalent adjacent thyminesare at positions -33, -34 and -35, thus producing twoterminations at positions -32 and -33 (see Fig. 6A). RNApolymerase alone slightly increases the intensity of thesignal at -33. However, the signal at position -32 wasconsiderably increased as observed in lacUV5 (Fig. 6Aand B, graphs a and c), suggesting that the sigma subunitis making a direct contact with the base at position -33.In contrast, when AsiA was bound to RNAP, there was nosuch dramatic increase in the intensity of the -32 signalon the non-template strand (Fig. 6A and B, graphs b andd). This suggests that AsiA severely disrupts the interac-tion between the -35 hexamer of the promoter and s70

region 4. Also evident on the line graphs in Fig. 6B is thesubtle perturbation of the photoreactivity patterns at base-47 (indicated by an arrow). This photochemical changeoccurs in a thymine-rich upstream region of the promoter(see Fig. 1) and is most probably a reflection of the inter-actions between the UP element and RNAP involving thea-CTD.

Other photochemical signals resulting from the pres-ence of RNAP at these two promoters occurred at posi-tion -7 and +4 (see Fig. 6A). By analogy with thesituation at lacUV5, the signal at -7 may represent adirect contact, presumably involving the sigma subunit,and the signal at +4 may be associated with the localmelting of the DNA in the open complex (Buckle et al.,1991). AsiA did not affect either of these signals in a finalopen complex.

Kinetics of open complex formation at the variant motA promoters monitored by KMnO4 reactivity and UV laser photoreactivity

KMnO4 probing was used to monitor open complex forma-tion on the three ‘active’ versions of promoter motA in thepresence of AsiA. At equilibrium at 37∞C, and in accor-dance with the run-off results in Fig. 2, two strong KMnO4-sensitive bands centred around base +1 were detected inthe open complexes formed in the presence of AsiA onpromoters motA wt, motA TC and motA deleted/TG (datanot shown). We next sought to measure the rate of forma-tion of these KMnO4-sensitive bands, presumably reflect-ing differences in the ease with which each version ofthe promoter is able to overcome the structural blockimposed by AsiA bound to Es70. Figure 7 shows the

Fig. 5. DNase I footprints with or without AsiA on promoter motA wt compared with motA del TG and motA del TC ([AsiA]/[RNAP] = 3 and 6). Promoter fragments were 32P end-labelled at the template strand.

RNAP

[AsiA] /[RNAP]

G+A

G+A

+ + + + + + + + +

3x 6x 3x 6x 3x 6x

–80

–70–60

–50

–40

–30

–20

–10

–1

+10

+20

mot A wt mot A del TG mot A del TC

Resistance of T4 early promoters to AsiA 1019

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

Amot A wt mot A TC

RNAP

AsiA

+

– + – – + –

+ – + + –

–61–56

–44

–33–32

–26

+4

–7

ref

B

–56

–56

–44

–44

–32

–32

ref–26

ref–26

ref–26

ref–26

–32–56 –44

–32

–56 –44

Fig. 6. UV photofootprinting of RNAP complexes formed at equilib-rium with and without AsiA at two variants of the motA promoter ([AsiA]/[RNAP] = 3).A. Primer extension gel analysis along laser-irradiated DNA in com-plexes formed at motA wt and motA TC. The numbers on the left indicate the modified bases on the non-template strand.B. Line graphs used to monitor alterations in the photoreactivity of the DNA bases between positions -26 and -56. For each graph, the pixel intensities were normalized with respect to the intensity of a reference band, marked ‘ref’ at position -26 in (A). For the sake of clarity, graphs a and b show separately the scans of the patterns obtained with motA wt ± AsiA, and graphs c and d show the results obtained with motA TC ± AsiA (red line: with RNAP; black line: naked DNA).

1020 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

time-dependent variation in the signal corresponding tothese KMnO4-sensitive bands. In all cases, the amplitudeof this signal reaches an equilibrium value equal to 1. Withpromoters motA wt (Fig. 7B) and motA TC (Fig. 7A), in thepresence of a threefold excess of AsiA, the signal was toofast to follow in the time scale of these manual mixingexperiments and immediately reached its equilibriumvalue. In contrast, under the same conditions, openingof motA deleted/TG was much slower, and the kineticswas fitted to a single exponential with a time con-stant of 8.8 min corresponding to a rate constantk = 1.9 ± 0.5 ¥ 10-3 s-1 (Fig. 7B).

We used UV laser photofootprinting to identify tran-sient signals evolving at different rates following whichpromoter was used. The signals described above at base-32 and upstream were not helpful as they all appearedtoo fast to follow in manual mixing experiments. However,the signal at base +4 evolved over a time scale commen-surate with the manual mixing dead time and followeddistinct kinetics with different promoters. Figure 8A and Bshows the kinetic analysis of the signal at base +4 fol-lowed and quantified using the same versions of themotA promoter as in the KMnO4 experiment describedabove (Fig. 7). In the absence of AsiA, formation of anopen complex at all the three variants of motA gave asignal that was quickly attenuated. The correspondingfast process was completed after 50 s with an associatedtime constant of 15 s or less. In the presence of AsiA,essentially the same kinetics was observed with promot-ers motA wt (Fig. 8C) and motA TC (Fig. 8B). In contrast,with promoter motA deleted, the presence of AsiA elic-ited a signal with a final amplitude very close to thatobserved without AsiA, with a first-order constantk = 0.011 ± 0.002 s-1, i.e. a time constant of 91 s(Fig. 8C). Thus, suppressing the extended -10 TG motifhas no detectable effect on the evolution rate of the sig-nal at base +4 in the presence of AsiA as we observedessentially the same rate constants with motA TC andwith motA wt. However, the signal is slowed down sixfoldwhen the UP element is suppressed in spite of the main-tained extended -10 motif. This illustrates the differentialeffect of the two elements of promoter motA in the stabi-lization of the AsiA-containing holoenzyme on the path-way to the open complex. Either of these elements alonesuffices to confer resistance to AsiA in open complexformation, but kinetic analysis of discrete photochemicalsignals reveals differences in the relative effectiveness ofthe extended -10 motif and the UP element.

Interestingly, in the most unfavourable case, that of pro-moter motA deleted in the presence of AsiA, we observeda time constant of ª9 min at 37∞C for promoter openingusing permanganate probing (Fig. 7B). This suggests thatthe reactivity changes detected by laser UV footprintingat base +4, with a much shorter time constant of ª1.5 min,

corresponds to events occurring before the formation of afully strand-dissociated complex during the developmentof RNAP–AsiA–promoter interactions. The rate with whichthis event is detected is highly sensitive to promoter struc-ture, and this sensitivity is revealed by the transcriptionalregulator AsiA.

Hence, a kinetic analysis shows that the UP element ismuch more effective than the extended -10 TG motif inhelping the RNAP bound to promoter motA to overcomethe structural block brought about by AsiA and quickly toform an open complex.

Discussion

The T4 anti-sigma factor AsiA strongly binds the s70 sub-

Fig. 7. Time course of promoter motA opening with and without AsiA probed by KMnO4 reactivity. Filled symbols: values with AsiA. Open symbols: values without AsiA. Variants of the motA promoter used: mot TC (A), mot wt (B, triangles) and mot deleted TG (B, circles). The promoter and RNAP without or with AsiA ([AsiA]/[RNAP] = 3) were mixed at 37∞C at time zero, and the indicated time point aliquots were probed with KMnO4. Samples were analysed as described in Exper-imental procedures. Fractional saturation shown on the ordinates corresponds to the percentage of open complex determined as described previously (Orsini et al., 2001).

Resistance of T4 early promoters to AsiA 1021

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

unit of E. coli RNA polymerase. Analysis of the mecha-nism of action of AsiA led us to study in detail theinteraction between the Es70AsiA complex and the-10/-35 bacterial promoter lacUV5. We have shown pre-viously that, in the presence of potassium glutamate, asalt enhancing intermolecular interactions, Es70AsiA couldslowly form an active open complex at lacUV5, thus indi-cating that, under these experimental conditions, AsiA didnot totally block the ability of the promoter to bindEs70AsiA (Orsini et al., 2001). A very similar situation wasdescribed recently with a derivative of the T4 middle pro-moter PUVSX constructed to contain a perfect -35 hexamerinstead of the motA box of the T4 middle promoters (Palet al., 2003). Based on the strength of this and otherpromoters, it was suggested that strong promoters, includ-

ing the T4 early promoters, are able to form stable com-plexes with Es70AsiA more readily than weak ones (Palet al., 2003).

Here, using in vitro transcription, we have analysed theeffect of AsiA on the activity of several T4 early promoters.In single-round transcription experiments, all the selectedpromoters showed a marked resistance to AsiA, withresidual activities in the 80–95% range, which is clearlydifferent from the levels observed with lacUV5 and RNA Iused as sensitive controls (Fig. 2A and B). However, thisobservation, which is a major finding of this work, appearsto contradict our previous observations with the motA andmrh.2 promoters (Ouhammouch et al., 1995; Adelmanet al., 1997). Detection of transcripts by primer extensionshowed that motA was inhibited by AsiA (Ouhammouch

Fig. 8. Formation of open complexes at promoter motA and its variants with and without AsiA: time course of events at position +4 analysed by UV laser photofootprinting.A. Primer extension gel analysis between positions +4 and +11 of laser UV-irradiated DNA in complexes formed at motA wt, motA TC and motA deleted.B and C (the open and closed symbols show values with and without AsiA respectively).B. Kinetic analysis of the signal at position +4 in promoter mot TC.C. Kinetic analysis of the signal at position +4 in promoter motA wt (triangles) and promoter motA deleted (circles).

0 .3 1 2 5 .3 1 2 5

- AsiA + AsiA

mot A wt

+4

+11

A

- AsiA + AsiA

mot A TC

+4

+11

0 .3 1 2 3 10 .3 1 2 3 5 10 0

- AsiA + AsiA

mot A deleted

+4

+11

0 .3 1 2 5 10 15 .3 1 2 5 10 15

1022 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

et al., 1995), and AsiA was shown to prevent the formationof an open complex on mrh.2 (Adelman et al., 1997). Howcan we explain these apparent discrepancies?

Here, with the same experimental method and condi-tions as those used previously (Ouhammouch et al.,1995), we have analysed by primer extension the tran-scripts initiated at 10 different T4 early promoters. Usingwild-type (HMC-glu) T4 DNA as a template, quantificationof the primer extension results showed that, indeed, in thepresence of AsiA, all the promoters were inhibited, withinhibitions ranging from 47% (nrdC.4) to 79% (denV).Here, motA was found to be inhibited by AsiA, essentiallyas reported previously (Ouhammouch et al., 1995). How-ever, a different situation was observed when we usedcytosine-containing T4 DNA as a template. With sevenpromoters out of the 10 selected, inhibition levels weresignificantly decreased relative to those obtained withwild-type T4 DNA, resulting for example in 4% inhibitionfor motA and no detectable inhibition for nrdC.4 (Fig. 1).Furthermore, using cytosine-containing T4 DNA allowedus to show that lacUV5 was almost totally inhibited (96%).We therefore conclude that the chemical modificationexisting in wild-type T4 DNA is responsible for an impor-tant amplifying effect on the sensitivity of the T4 earlypromoters to inhibition by AsiA.

In conclusion, with promoter motA, we show that thiseffect, linked to the chemical modification that is charac-teristic of wild-type T4 DNA, is the origin of the differencebetween, on the one hand, the straightforward single-round transcription results presented here, obtained withclassical cytosine-containing DNA fragments or plasmidsand, on the other hand, our previous primer extensionmeasurements (Ouhammouch et al., 1995) and, indeed,the results presented here comparing the modified andunmodified T4 DNA (Fig. 1).

Similarly, we reported previously (Adelman et al., 1997)that Es70AsiA could not produce a footprint on DNA con-taining promoter mrh.2, a result that apparently contra-dicts the gel retardation results and the DNase I footprintspresented here (see Fig. 3B and C). However, in the pro-cedure followed by Adelman et al. (1997), the complexesformed at 37∞C with Es70AsiA on promoter mrh.2 werefirst challenged with the non-specific competitor poly-(dI–dC) and then separated from free 5¢ end-labelled DNA byelectrophoresis for 2 h at 6∞C on native polyacrylamidegels before DNase I digestion. In the present experimentswith DNase I, we did not use the challenge step or theelectrophoresis at 6∞C, and all manipulations were per-formed at 37∞C. However, heparin challenge was used inthe gel retardation assays (see Experimental procedures),and Es70AsiA performed exactly like Es70 in the case ofmrh.2 DNA (see Fig. 3B). It is therefore highly probablethat, in the Adelman et al. (1997) experimental set up,especially during the electrophoresis step at 6∞C, the

Es70AsiA–mrh.2 complex dissociated, whereas the binarycomplex Es70–mrh.2 resisted this treatment. We are there-fore led to conclude that the experimental conditions usedin our previous attempts obscured the fact that promotersmotA and mrh.2, like all the other T4 early promotersstudied here, are markedly resistant to inhibition by AsiA.

Having ascertained that, under our in vitro experimentalconditions, certain promoters possessed an inherentresistance to AsiA inhibition, we then set about address-ing the question as to whether there is a single discrimi-natory factor that confers this resistance or if there areseveral parameters acting in a synergistic or additive fash-ion. The strength of a promoter derives from the contribu-tions of several elements such as the UP region and theextended -10 TG sequence. In a study of T4 early pro-moter strength in vivo, these two promoter elements havebeen shown to bring important contributions to thestrength of this class of promoters (Sommer et al., 2000).Our present in vitro analysis shows clearly that the UPinteractions mediated through the a-CTDs are crucial toconferring resistance to AsiA inhibition. From a structuralviewpoint, it is worth noting that DNase I hypersensitivity(Figs 3C and 5) and UV laser-induced photoreactivity inthe UP region seen at motA (Fig. 6A) and mrh.2 (data notshown) reflect changes in the local architecture in theseregions and do not necessarily report the precise locationof a physical interaction with a protein. Consequently, thechanges induced by the presence of RNA polymerase inthese patterns, notably in the regions around -47, maycorrespond to subtle rearrangements of the DNA occa-sioned by alterations in the nature of the a-CTD interac-tions in this element. It is extremely interesting thereforeto note that the change in laser UV photoreactivity atposition -47 at motA in the presence of RNA polymeraseis maintained in the presence of AsiA, but that the DNaseI hypersensitive bands seen at -45 at mrh.2 in the pres-ence of RNA polymerase are lost in the presence of AsiA(see Fig. 3C). An important difference between these twopromoter sequences resides in the UP region, which isparticularly rich in stretches of A in motA and, conversely,impoverished in stretches of A in mrh.2 (see Fig. 1). It istempting to speculate that AsiA bound to RNA polymerasealters the a-CTD interactions in the UP element but that,unless these interactions are completely abolished, theycan still favour the formation of an open complex. Anillustration of this point is provided by the stronglyincreased sensitivity of a-CTD-deleted Es70 to AsiA inhi-bition (see Fig. 4). Upon deletion of the a-CTD, AsiA-resistant promoters with full Es70 become more sensitiveby a factor of 3–5. The utmost importance of the a-CTDprotein element is such that this strong increase in sensi-tivity to AsiA is expressed even in the context of promotermotA deleted, in which the promoter–RNAP upstreamcontacts are most likely to be non-specific. This therefore

Resistance of T4 early promoters to AsiA 1023

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

raises the question as to how AsiA affects the pathwayleading to open complex formation.

KMnO4 allows time-resolved probing of thymineunstacking which, to a first approximation, may be indic-ative of DNA opening. At equilibrium, the final KMnO4

signal was equal for the three active promoters studiedhere (Fig. 7A and B). This signal appeared too rapidly tofollow on the motA wt and motA TC promoters in thepresence of AsiA. In contrast, it appeared much moreslowly at motA deleted/TG (t = 8.8 min, Fig. 7B), againshowing that, in the presence of AsiA, RNA polymerasehas difficulty in forming a kinetically competent complexat this UP-deleted promoter.

However, KMnO4 reactivity simply monitors the avail-ability of unstacked thymines, and the motA deleted/TGpromoter may impose kinetic restraints at any point alongthe pathway towards the formation of an open complex.We used time-resolved UV laser photofootprinting. As forKMnO4, we were limited by the manual mixing timeswhich, in the case of the UV laser photofootprints,excluded rapid signals in the UP and -35 regions. How-ever, the photochemical changes centred on position +4followed distinct kinetics. This position is at the leadingedge of the putative locally melted region in an opencomplex and thus, a priori, changes in photoreactivity mayresult from the separation of the DNA strands. It is there-fore curious that the rates of change associated with thissignal were in all cases faster than the KMnO4 signals,which were also supposed to be indicative of basepairopening. One explanation for this difference is that thephotoreactivity is indicative of a base state before open-ing, whereas KMnO4 reaction requires full unstacking andsolvent accessibility before oxidation. It is thus likely thatthe two techniques are sensing DNA opening, but thatphotoreactivity is more sensitive and reports a transitionbefore full opening of the DNA. Indeed, this idea is sup-ported by the fact that monitoring photoreactivity at posi-tion +4 allowed the effect of the UP deletion to bedifferentiated from that of the extended -10 TG motif asthe UP-deleted motA promoter gave a rate of +4 photore-activity change slowed down sevenfold in the presence ofAsiA compared with that of motA wt.

The above results strongly suggest that inhibition byAsiA occurs before the formation of an open complex. Inclassical models of promoter recognition, DNA openingalways takes place subsequent to upstream events (Bucand McClure, 1985; Roe et al., 1985; Buckle et al., 1999).In the simplest of these models, an optimal helical registerbetween the -35 and -10 regions is postulated to facilitateDNA melting (Buckle et al., 1999). Thus, the nature of thephasing between contacts in the upstream regions and inthe downstream -10 region would play a pivotal role in apathway leading to DNA opening. UP elements are notpresent at the lacUV5 promoter and, thus, the s70 subunit

plays a major catalytic role precisely through helical reg-ister-directed interactions between the -35/-10 regionsand the s70 region 4 and s70 region 2 domains (Buckleet al., 1999). One function of AsiA may be to modulate thecapacity of s70 to act in this phasing process. The helicalregister between the -35 and -10 regions is crucial indetermining the interactions with the s70 region 4 and s70

region 2. In other terms, the spatial orientation of interac-tions with the -35 and -10 regions on the DNA is goingto be sensitive to changes in the distance between the -35 and -10 domains. Consequently, the s70 region 4/s70

region 2 spacer acts as a sensor of the helical registerwithin this region (Dombroski et al., 1996). Perturbing thes70 4.1–4.2/b flap helix interactions indirectly reduces theability of the s70 region 4 to interact with the -35 region(Simeonov et al., 2003) and, hence, would compromisethis sensor function. This perturbation may, however, becompensated for, either by altering the nature of theupstream contact, i.e. replacing the contact at the -35hexamer by a functionally similar contact such as an UPelement interaction, or by altering the flexibility of thespacer region between the two contact points. Here, flex-ibility is related in some way to the presence of theextended -10 TG motif, which is practically ubiquitous inthe sequences of phage T4 early as well as middle pro-moters (Miller et al., 2003). Besides, the TG motif providesa supplementary contact site for RNAP: genetic and struc-tural studies fully support the proposal that the extended-10 TG motif is recognized by s70 region 3.0 (Murakamiet al., 2002; Sanderson et al., 2003). The effect of thesecompensatory mechanisms, which involve either the UPelement or the TG motif, would explain our observations.

We now consider the wider biological context ofphage T4 infecting E. coli. It has been assumed thatAsiA is responsible for the abrupt inhibition of T4 earlypromoter activity that takes place shortly after infection(Brody et al., 1995; Hughes and Mathee, 1998; Sev-erinova et al., 1998). However, eliminating gene asiAhas no consequence on the activity and regulation ofthe early promoters, indicating that an AsiA-independentcircuit is responsible for turning off T4 early promoters(Pene and Uzan, 2000). We have analysed the effect ofAsiA on the activity of these promoters in vitro. Theresults of the primer extension experiments reportedhere (Fig. 1) show that, for an AsiA/RNA polymeraseratio of 5, AsiA exercises only a partial inhibition onthese promoters. However, after T4 infection, AsiA con-centration in the cell reaches a level comparable to thatof s70 (Kolesky et al., 1999). Therefore, it is likely that,under the natural conditions of infection, early promotersare much less inhibited by AsiA, if at all. The resultsreported in this work, together with the persistence of astrong shut off of early promoters in the absence of afunctional asiA gene, rule out the idea that AsiA is

1024 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

responsible for the turn off of T4 early promoters (Peneand Uzan, 2000).

Immediately after T4 infection, the C-terminal domain ofone of the two a subunits of host RNA polymerase is ADP-ribosylated, following the injection along with phage DNAof an ADP-ribosyltransferase, the product of gene alt(Miller et al., 2003). This covalent modification should notprevent the other a subunit from contacting the UP ele-ment when present on the DNA and, hence, should notcontribute to shutting off early promoters, as suggestedby experiments using an RNA polymerase in which the C-terminal domain of one a subunit was deleted (Estremet al., 1999). Indeed, cloned T4 early promoters wereshown to be either unaffected or slightly stimulated by thismodification (Koch et al., 1995). In addition, a mutationalanalysis of T4 early promoters showed that the A-rich UPelement around position -42 contributes to the stronginteraction with this modified RNA polymerase (Sommeret al., 2000). A few minutes after infection, both a subunitsare ADP-ribosylated as a result of the synthesis of anotherADP-ribosyltransferase, the product of gene modA.Because this gene is highly toxic for the cell, Miller et al.(2003) concluded that it is responsible for the inhibition ofpromoters carrying UP elements. However, a total dele-tion of this gene and of the region around has no conse-quence on the shut off of early promoters (Pene and

Uzan, 2000). Moreover, our in vitro assays show that thepromoter motA deleted TG, which is devoid of the UPelement, remains resistant to AsiA inhibition. Both obser-vations strongly suggest that ADP-ribosylation of theRNAP a subunits is not a determining factor in the shutoffof T4 early promoters.

Experimental procedures

T4 promoters and DNA fragments

Promoter activities were measured with promoter-containingDNA fragments obtained by PCR amplification using wild-type T4 DNA and Pfu Turbo DNA polymerase. PromotersmotA, motB, mrh.2 and denV were prepared as 396 bp DNAfragments yielding 104 or 109 nucleotide transcripts. ThelacUV5 promoter followed by terminators carried on eithersupercoiled plasmid or a 665 bp PCR fragment was used asa control sensitive to AsiA (Orsini et al., 2001)

The motB, mrh.2 and denV fragments were synthesizedfrom wild-type T4 phage using the following couples of prim-ers A and B (motB), C and D (mrh.2) and E and F (denV)respectively (Table 2).

The motA fragment was synthesized from phageM13HDL161.1 RF DNA, using primers G and H (Liebig et al.,1989). An upstream deleted version of the motA wt promoterwas constructed in which the sequence immediatelyupstream of the -35 hexamer was replaced by phage M13

Table 2. Oligonucleotides used in this work.

Name Extra-name Sequence Usage

A motB 5¢ AAACTATTATGGAAGGGTATCATCAT Cloning from T4B motB 3¢ TTTTCCTGCTGCTTTAGAACGGG Cloning from T4C mrh.2 5¢ CATTTGAGCAGAAATTAGATGGAAA Cloning from T4D mrh.2 3¢ GACCATGGTTGTAGTTCATATTTC Cloning from T4E denV 5¢ TTAGAAGCCGCTGTAAATAAAAAGG Cloning from T4F denV 3¢ AAAAACACGCGGCAATTCACGATA Cloning from T4G in 5¢ motA prox CGGAACCACCATCAAACAG Cloning from T4H in 3¢ motA prom3¢ CAGGGCTGGAATGTGTAAG Cloning from T4I -35motA CGGAATTCGGTTTACAACCAAAG Cloning from T4J +30motA CAATTCCCGGGGATCCGTC Cloning from T4L motA dist CGTTCTTTAATAGTGGACTC Cloning from T4K78 mrh.2-EcoRI CCGGAATTCTGGCGCTCATTACCAGAC CloningK79 mrh.2-BamHI CCGGGATCCAACGATTTAACATAGTACTC CloningK85 Mut-motA CAACCAAAGCATACTGTCGTACTATACAACTATCAACTACTG MutagenesisK86 Mut-mrh.2 CAACCAAAGCATACTGTCGTACTATACAACTATCAACTACTG MutagenesisK74 5¢ motA 189 TTCAACGTGTTATCATGACA GTTAT PCR labellingK75 3¢ motA 189 GATGTAAGTTACTTTAGACATTTTC PCR labellingK72 5¢ mrh.2185 AACGTACTGAATGGATTGCTGC PCR labellingK73 3¢ mrh.2185 AATCTTCATTTGGTTTAATCCAAC PCR labellingK93 mot5¢ GGTTTAGGCGTTGTTCCAGCCG PCR labellingL12 mot3¢ GCAGTTCCCTACTCTCTGCAGG PCR labellingM mobB CTTCCATACATTGCCAAAG RTN motB CTTAAGCTGAATGCTTACAACTTCG RTO dmd GAACGTCATCTTTCATC RTP denV CACGAACACGTTTACCGTTAGCAAC RTQ motA CGTAGCAGTTTTTTCATTCAGAAC RTR cef TTCATCATTAGTGCAATTCTGAAC RTS ORF mrh.2 GTAGACCATGGTTGTAGTTC RTT ORF tRNA.4 CTGCTGTAGTTAATAATCCGC RTU ORF imm.1 CCTACATCAGACTGATTTAC RTV ORF nrdC.4 CTATTGAGCCACTGATTG RT

Resistance of T4 early promoters to AsiA 1025

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

sequence (Fig. 1). First the EcoRI–BamHI fragment fromM13HDL161.1 RF DNA, which contains the whole motA pro-moter, was replaced by a shorter EcoRI–BamHI PCR frag-ment obtained using the same template (M13HDL161.1 RFDNA) with the following primers: I, homologous to thesequence immediately 3¢ of the -35 region and carrying anon-coding EcoRI site; and J, a 3¢ primer complementary tothe region encompassing the BamHI site. Secondly, the motAdeleted promoter fragment used for transcription assays wasgenerated from the recombinant phage carrying the deletionusing primers F and a new 5¢ primer L, located 97 nucleotidesupstream of the first on the M13 phage genome.

The motA wt, motA deleted and mrh.2 DNA fragmentswere inserted into the pJCD01 cloning vector upstream ofthe rrnB T1 and T2 terminators (Marschall et al., 1998).Derived from the motA wt and motA deleted DNA frag-ments, BamHI–AluI fragments were inserted between theBamHI and PvuII restriction sites of the vector. At the endsof the mrh.2 DNA fragment, EcoRI and BamHI restrictionsites were created using primers K78 and K79, and theBamHI–EcoRI derivative of this new fragment was insertedbetween the BamHI and EcoRI restriction sites of thepJCD01 vector. Once obtained, the cloned motA and mrh.2inserts were subjected to site-directed mutagenesis to sub-stitute a -5¢TC3¢– for the ‘extended -10’ motif (-5¢TG3¢–) ofthese promoters using the Quikchange multisite-directedmutagenesis kit (Stratagene) with primers K85 and K86.DNA sequencing (GenomeExpress) verified the sequencesof all the inserted fragments.

Primer K74 was 5¢ end-labelled with T4 polynucleotidekinase and [g-32P]-ATP and used with unlabelled primer K75and wild-type T4 DNA to prepare by PCR a 189 bp motA wtfragment labelled at the 5¢ end of its non-template strand.This fragment was used in the gel retardation and DNase Ifootprinting experiments. The same protocol was repeatedusing primers K72 and K73 to obtain a 185 bp mrh.2 frag-ment similarly labelled. The 220 bp lacUV5 fragmentlabelled at the 5¢ end of the non-template strand and usedfor DNase I footprinting was prepared as described previ-ously (Orsini et al., 2001). The wild-type, TC and deletedversions of the motA fragment used in the DNase I experi-ment in Fig. 5 were prepared by PCR with primers K93 andL12 labelled at its 5¢ end using as template the pJCD01vector harbouring the corresponding version of thepromoter.

Purified proteins and standard reaction conditions

Escherichia coli RNA polymerase holoenzyme was purifiedaccording to the method of Burgess and Jendrisak (1975).Using the abortive initiation assay with the lacUV5 fragment(2 nM), the activity of the RNA polymerase preparation wasfound to be 50%. T4 AsiA was purified as described previ-ously (Adelman et al., 1997). The a-D235 RNA polymerasecore enzyme was a gift from Dr Evelyne Richet. Using theoverproducing strain M5219/pMRG8, s70 was purifiedaccording to published procedures (Gribskov and Burgess,1983). All experiments were performed in standard buffercontaining 40 mM Hepes (pH 8.0), 10 mM MgCl2,500 mg ml-1 bovine serum albumin, 1 mM dithiothreitol and100 mM KCl.

Transcription assays

Run-off transcription assay (single round) was performedwith 40–60 nM RNA polymerase and 2–4 nM promoter DNAin the presence of the indicated molar excess of AsiA overRNA polymerase concentration (Orsini et al., 2001). AsiA andRNA polymerase were incubated for 15 min at room temper-ature. Template was added to allow open complex formationat 37∞C for 20 min, followed by the addition of nucleotidesand heparin (final concentrations 100 mM ATP, 100 mM CTP,100 mM GTP, 10 mM UTP, 0.5 mCi of [a-32P]-UTP and100 mg ml-1 heparin). Elongation reactions lasted 10 min andwere stopped by mixing equal volumes of reaction mixtureswith formamide containing 20 mM EDTA, 1% SDS and xylenecyanol blue. After heating at 90∞C, the samples were electro-phoresed on a 7% polyacrylamide sequencing gel, and thetranscripts were quantified with a PhosphorImager.

Abortive initiation of transcription was performed asdescribed using a fixed time assay of 15 and 30 min (Adel-man et al., 1997; Orsini et al., 2001). With promoters denVand motA, synthesis of ApUpC from the ApU primer and theCTP substrate was followed, whereas ApA and UTP wereused with lacUV5.

Multiple-round transcription was used to accumulate phageT4 early transcripts. The reactions were carried out at 37∞Cduring 30 min in standard buffer containing 100 mM eachribonucleoside triphosphate with 40 nM RNA polymerase. Inthe case of the motA wt promoter, using a twofold lowerconcentration of RNA polymerase did not affect the inhibitionlevel by AsiA. The templates were either wild-type T4 DNA(containing glucosyl-hydroxymethyl cytosines) or unmodifiedT4 DNA (0.1 nM genome DNA, i.e. about 12 mg ml-1) (Kutterand Wiberg, 1968). The latter was prepared from the quintu-ple mutant denAnd28, DdenBrIIH23, 56amE51, 42amN55,balc propagated on E. coli B837 (r–

B, sup∞). When required,AsiA was added in fivefold excess relative to RNA poly-merase. Accumulation of the lac transcript was monitored asa control, using the appropriate lacUV5 promoter. The reac-tions were stopped by heating the samples at 90∞C for 5 min.Transcription products were subsequently analysed by primerextension using murine Moloney leukaemia virus reversetranscriptase (SuperScript II from Invitrogen) and the 32P-5¢-labelled specific primers indicated in Table 2.

To minimize the source of variability among samples to becompared, transcripts were reverse transcribed directly aftertranscription, without further treatment. Primers were addedin excess relative to the target RNA. Annealing conditionswere as described previously (Uzan et al., 1988). The reac-tions were run for 50 min at 42∞C. Under these conditions,the yield of cDNA was proportional to the volume of transcrip-tion mix added to the reaction. The labelled cDNA productswere separated on polyacrylamide gels and quantified with aPhosphorImager. All primer extension reactions were dupli-cated except with motB and mrh.2 on HMC-glu DNA, whichwere done in triplicate.

Gel retardation assays

Using the 5¢-labelled motA and mrh.2 fragments, gel retarda-tion experiments were performed in the absence and thepresence of AsiA previously bound to RNA polymerase.

1026 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

When present, AsiA was at a fivefold molar excess over thehighest holoenzyme concentration used (0.9 nM; see Fig. 4Aand B). RNA polymerase was incubated in standard bufferfor 20 min at 37∞C with 0.005 nM DNA fragment. Heparin wasthen added at 75 mg ml-1, and the samples were subse-quently loaded on a 5% native polyacrylamide gel preparedin Tris borate–EDTA buffer. Electrophoresis was carried outat 120 V at room temperature. The dried gels were scannedand analysed with a PhosphorImager using the IMAGEQUANT

software. The fraction of open complex formed at eachholoenzyme concentration was determined by the ratiobetween the retarded (bound) species and the total radioac-tivity (free DNA fragment + bound species).

DNase I footprinting

Complexes between the labelled promoters (4 nM final con-centration) and RNA polymerase (60 nM final concentration)were formed during 20 min at 37∞C. When present, AsiA waspreincubated with the holoenzyme (at a threefold or sixfoldmolar excess) during 15 min at room temperature (Hintonand Vuthoori, 2000). The complexes were then treated withDNase I and analysed as described previously (Orsini et al.,2001).

Potassium permanganate reactivity

To monitor the time course of promoter opening, kinetics ofKMnO4 reactivity were measured in the complexes formedbetween RNA polymerase (without or with AsiA at a threefoldmolar excess) and three versions of the motA promoter: wt,deleted and extended -10 TC (Fig. 7A and B). DNA andholoenzyme concentrations were the same as thosedescribed for DNase I footprinting. Time point aliquots weretreated for 30 s with 2 mM KMnO4 (15 s with naked DNA),then with 0.32 M b-mercaptoethanol to stop the reaction.Samples were processed using a standard protocol, and thereaction products were separated on a 7% polacrylamidesequencing gel as described previously (Orsini et al., 2001).The intensities of the KMnO4 reactive bands identified inequilibrium conditions were quantified as a function of timeas described previously (Orsini et al., 2001).

Laser UV photofootprinting

Complexes between RNAP and DNA with and without AsiAwere formed under the conditions described above. A rapid(5 ns) single pulse of high-intensity, laser UV light (266 nm)that induces inherent photomodifications of the DNA wasused to irradiate complexes (Buckle et al., 1991). These mod-ifications were detected by primer extension analysis asdescribed previously (Buckle et al., 1991; Adelman et al.,1998; Pemberton et al., 2002). Primers complementary to theDNA template (generally 20 bases 3¢ downstream to theregion of interest) were 5¢ end-labelled with [g-32P]-ATP andT4 polynucleotide kinase (Amersham Biosciences). Prema-ture termination sites were identified by comparison with theappropriate dideoxy sequencing reactions, after their co-elec-trophoresis on 7% polyacrylamide gels alongside the primerextension reaction products (data not shown). Complexes

formed at equilibrium (20 ml) were irradiated directly inEppendorf tubes. For time course experiments, at time zero,one volume of plasmid DNA at 37∞C was added to onevolume of the protein-containing solution equilibrated at37∞C, and 20 ml aliquots were irradiated at specific times.

Analysis and quantification of the gel results used to con-struct Figs 6B, 7A and B and 8B and C were performed byexporting the PhosphorImager data as a Microsoft EXCEL

worksheet into ORIGIN, version 5.0 (Microcal Software) asdescribed previously (Buckle et al., 1991; Adelman et al.,1998; Pemberton et al., 2002). In the case of laser UV foot-printing, this procedure allows the baseline photoreactivity tobe superimposed and protein occupancy to be determinedaccurately by comparison of modifications with an irradiatedDNA control.

Acknowledgements

We thank E. Richet for the gift of the a-D235 RNA poly-merase. This work was supported by the ‘Action IncitativeConcertée 2000: Biophysique de la Matière Complexe’ fromthe Ministère de l’Education Nationale de la Recherche et dela Technologie.

References

Adelman, K., Orsini, G., Kolb, A., Graziani, L., and Brody,E.N. (1997) The interaction between the AsiA protein ofbacteriophage T4 and the sigma70 subunit of Escherichiacoli RNA polymerase. J Biol Chem 272: 27435–27443.

Adelman, K., Brody, E.N., and Buckle, M. (1998) Stimulationof bacteriophage T4 middle transcription by the T4 pro-teins MotA and AsiA occurs at two distinct steps in thetranscription cycle. Proc Natl Acad Sci USA 95: 15247–15252.

Attey, A., Belyaeva, T., Savery, N., Hoggett, J., Fujita, N.,Ishihama, A., and Busby, S. (1994) Interactions betweenthe cyclic AMP receptor protein and the alpha subunit ofRNA polymerase at the Escherichia coli galactose operonP1 promoter. Nucleic Acids Res 22: 4375–4380.

Barne, K.A., Bown, J.A., Busby, S.J., and Minchin, S.D.(1997) Region 2.5 of the Escherichia coli RNA polymerasesigma70 subunit is responsible for the recognition of the‘extended-10’ motif at promoters. EMBO J 16: 4034–4040.

Brody, E.N., Kassavetis, G.A., Ouhammouch, M., Sanders,G.M., Tinker, R.L., and Geiduschek, E.P. (1995) Oldphage, new insights: two recently recognized mechanismsof transcriptional regulation in bacteriophage T4 develop-ment. FEMS Microbiol Lett 128: 1–8.

Broida, J., and Abelson, J. (1985) Sequence organizationand control of transcription in the bacteriophage T4 tRNAregion. J Mol Biol 185: 545–563.

Buc, H., and McClure, W.R. (1985) Kinetics of open com-plex formation between Escherichia coli RNA polymeraseand the lac UV5 promoter. Evidence for a sequentialmechanism involving three steps. Biochemistry 24: 2712–2723.

Buckle, M., Geiselmann, J., Kolb, A., and Buc, H. (1991)Protein-DNA cross-linking at the lac promoter. NucleicAcids Res 19: 833–840.

Resistance of T4 early promoters to AsiA 1027

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

Buckle, M., Pemberton, I.K., Jacquet, M.A., and Buc, H. (1999)The kinetics of sigma subunit directed promoter recognitionby E. coli RNA polymerase. J Mol Biol 285: 955–964.

Burgess, R.R., and Jendrisak, J.J. (1975) A procedure for therapid, large-scale purification of Escherichia coli DNA-dependent RNA polymerase involving polymin P precipita-tion and DNA-cellulose chromatography. Biochemistry 14:4634–4638.

Colland, F., Orsini, G., Brody, E.N., Buc, H., and Kolb, A.(1998) The bacteriophage T4 AsiA protein: a molecularswitch for sigma 70-dependent promoters. Mol Microbiol27: 819–829.

Dombroski, A.J., Johnson, B.D., Lonetto, M., and Gross, C.A.(1996) The sigma subunit of Escherichia coli RNA poly-merase senses promoter spacing. Proc Natl Acad Sci USA93: 8858–8862.

Estrem, S.T., Ross, W., Gaal, T., Chen, Z.W., Niu, W.,Ebright, R.H., and Gourse, R.L. (1999) Bacterial promoterarchitecture: subsite structure of UP elements and interac-tions with the carboxy-terminal domain of the RNA poly-merase alpha subunit. Genes Dev 13: 2134–2147.

Gourse, R.L., Ross, W., and Gaal, T. (2000) UPs and downsin bacterial transcription initiation: the role of the alphasubunit of RNA polymerase in promoter recognition. MolMicrobiol 37: 687–695.

Gram, H., Liebig, H.D., Hack, A., Niggemann, E., and Ruger,W. (1984) A physical map of bacteriophage T4 includingthe positions of strong promoters and terminators recog-nized in vitro. Mol Gen Genet 194: 232–240.

Gribskov, M., and Burgess, R.R. (1983) Overexpression andpurification of the sigma subunit of Escherichia coli RNApolymerase. Gene 26: 109–118.

Helmann, J.D. (1999) Anti-sigma factors. Curr Opin Microbiol2: 135–141.

Hinton, D.M. (1991) Transcription from a bacteriophage T4middle promoter using T4 motA protein and phage-modi-fied RNA polymerase. J Biol Chem 266: 18034–18044.

Hinton, D.M., and Vuthoori, S. (2000) Efficient inhibition ofEscherichia coli RNA polymerase by the bacteriophage T4AsiA protein requires that AsiA binds first to free sigma70.J Mol Biol 304: 731–739.

Hinton, D.M., March-Amegadzie, R., Gerber, J.S., andSharma, M. (1996) Characterization of pre-transcriptioncomplexes made at a bacteriophage T4 middle promoter:involvement of the T4 MotA activator and the T4 AsiAprotein, a sigma 70 binding protein, in the formation of theopen complex. J Mol Biol 256: 235–248.

Hughes, K.T., and Mathee, K. (1998) The anti-sigma factors.Annu Rev Microbiol 52: 231–286.

Koch, T., Raudonikiene, A., Wilkens, K., and Ruger, W.(1995) Overexpression, purification, and characterizationof the ADP-ribosyltransferase (gpAlt) of bacteriophage T4:ADP-ribosylation of E. coli RNA polymerase modulates T4‘early’ transcription. Gene Expr 4: 253–264.

Kolb, A., Igarashi, K., Ishihama, A., Lavigne, M., Buckle, M.,and Buc, H. (1993) E. coli RNA polymerase, deleted in theC-terminal part of its alpha-subunit, interacts differentlywith the cAMP-CRP complex at the lacP1 and at the galP1promoter. Nucleic Acids Res 21: 319–326.

Kolesky, S., Ouhammouch, M., Brody, E.N., and Geidus-chek, E.P. (1999) Sigma competition: the contest between

bacteriophage T4 middle and late transcription. J Mol Biol291: 267–281.

Kutter, E.M., and Wiberg, J.S. (1968) Degradation of cytosin-containing bacterial and bacteriophage DNA after infectionof Escherichia coli B with bacteriophage T4D wild type andwith mutants defective in genes 46, 47 and 56. J Mol Biol38: 395–411.

Kutter, E.M., and Wiberg, J.S. (1969) Biological effects ofsubstituting cytosine for 5-hydroxymethylcytosine in thedeoxyribonucleic acid of bacteriophage T4. J Virol 4: 439–453.

Liebig, H.D., Ruger, W., Gram, H., Hack, A., and Niggemann,E. (1989) Bacteriophage T4 early promoter regions. Con-sensus sequences of promoters and ribosome-bindingsites. A physical map of bacteriophage T4 including thepositions of strong promoters and terminators recognizedin vitro. J Mol Biol 208: 517–536.

Luke, K., Radek, A., Liu, X., Campbell, J., Uzan, M.,Haselkorn, R., and Kogan, Y. (2002) Microarray analysisof gene expression during bacteriophage T4 infection.Virology 299: 182–191.

Marschall, C., Labrousse, V., Kreimer, M., Weichart, D., Kolb,A., and Hengge-Aronis, R. (1998) Molecular analysis of theregulation of csiD, a carbon starvation-inducible gene inEscherichia coli that is exclusively dependent on sigma sand requires activation by cAMP-CRP. J Mol Biol 276:339–353.

Miller, E.S., Kutter, E., Mosig, G., Arisaka, F., Kunisawa, T.,and Ruger, W. (2003) Bacteriophage T4 genome. Micro-biol Mol Biol Rev 67: 86–156.

Minakhin, L., and Severinov, K. (2003) On the role of theEscherichia coli RNA polymerase s70 region 4.2 and asubunit C-terminal domains in promoter complex forma-tion on the extended -10 galP1 promoter. J Biol Chem 11:11.

Minakhin, L., Camarero, J.A., Holford, M., Parker, C., Muir,T.W., and Severinov, K. (2001) Mapping the molecularinterface between the sigma (70) subunit of E. coli RNApolymerase and T4 AsiA. Expressed protein ligation, anovel method for studying protein–protein interactions intranscription. J Mol Biol 306: 631–642.

Minakhin, L., Niedziela-Majka, A., Kuznedelov, K., Adelman,K., Urbauer, J.L., Heyduk, T., and Severinov, K. (2003)Interaction of T4 AsiA with its target sites in the RNApolymerase sigma70 subunit leads to distinct and oppositeeffects on transcription. J Mol Biol 326: 679–690.

Murakami, K.S., Masuda, S., Campbell, E.A., Muzzin, O., andDarst, S.A. (2002) Structural basis of transcription initia-tion: an RNA polymerase holoenzyme–DNA complex. Sci-ence 296: 1285–1290.

Orsini, G., Kolb, A., and Buc, H. (2001) The Escherichia coliRNA polymerase–anti-sigma 70 AsiA complex utilizesalpha-carboxyl-terminal domain upstream promoter con-tacts to transcribe from a -10/-35 promoter. J Biol Chem276: 19812–19819.

Ouhammouch, M., Orsini, G., and Brody, E.N. (1994) TheasiA gene product of bacteriophage T4 is required formiddle mode RNA synthesis. J Bacteriol 176: 3956–3965.

Ouhammouch, M., Adelman, K., Harvey, S.R., Orsini, G., andBrody, E.N. (1995) Bacteriophage T4 MotA and AsiA pro-

1028 G. Orsini et al.

© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 1013–1028

teins suffice to direct Escherichia coli RNA polymerase toinitiate transcription at T4 middle promoters. Proc NatlAcad Sci USA 92: 1451–1455.

Pahari, S., and Chatterji, D. (1997) Interaction of bacterioph-age T4 AsiA protein with Escherichia coli sigma70 and itsvariant. FEBS Lett 411: 60–62.

Pal, D., Vuthoori, M., Pande, S., Wheeler, D., and Hinton,D.M. (2003) Analysis of regions within the bacteriophageT4 AsiA protein involved in its binding to the sigma70subunit of E. coli RNA polymerase and its role as a tran-scriptional inhibitor and co-activator. J Mol Biol 325: 827–841.

Pemberton, I.K., Muskhelishvili, G., Travers, A.A., andBuckle, M. (2002) FIS modulates the kinetics of successiveinteractions of RNA polymerase with the core andupstream regions of the tyrT promoter. J Mol Biol 318:651–663.

Pene, C., and Uzan, M. (2000) The bacteriophage T4 anti-sigma factor AsiA is not necessary for the inhibition of earlypromoters in vivo. Mol Microbiol 35: 1180–1191.

Roe, J.H., Burgess, R.R., and Record, M.T., Jr (1985)Temperature dependence of the rate constants of theEscherichia coli RNA polymerase–lambda PR promoterinteraction. Assignment of the kinetic steps correspondingto protein conformational change and DNA opening. J MolBiol 184: 441–453.

Ross, W., Gosink, K.K., Salomon, J., Igarashi, K., Zou, C.,Ishihama, A., et al. (1993) A third recognition element inbacterial promoters: DNA binding by the alpha subunit ofRNA polymerase. Science 262: 1407–1413.

Ross, W., Schneider, D.A., Paul, B.J., Mertens, A., andGourse, R.L. (2003) An intersubunit contact stimulatingtranscription initiation by E coli RNA polymerase: interac-tion of the alpha C-terminal domain and sigma region 4.Genes Dev 17: 1293–1307.

Sanderson, A., Mitchell, J.E., Minchin, S.D., and Busby, S.J.(2003) Substitutions in the Escherichia coli RNA poly-

merase sigma70 factor that affect recognition of extended-10 elements at promoters. FEBS Lett 544: 199–205.

Sanson, B., and Uzan, M. (1993) Dual role of the sequence-specific bacteriophage T4 endoribonuclease RegB inmRNA inactivation and mRNA destabilization. J Mol Biol233: 429–446.

Schmidt, R.P., and Kreuzer, K.N. (1992) Purified MotA pro-tein binds the -30 region of a bacteriophage T4 middle-mode promoter and activates transcription in vitro. J BiolChem 267: 11399–11407.

Severinov, K., and Muir, T.W. (1998) Expressed protein liga-tion, a novel method for studying protein–protein interac-tions in transcription. J Biol Chem 273: 16205–16209.

Severinova, E., Severinov, K., Fenyo, D., Marr, M., Brody,E.N., Roberts, J.W., et al. (1996) Domain organization ofthe Escherichia coli RNA polymerase sigma 70 subunit. JMol Biol 263: 637–647.

Severinova, E., Severinov, K., and Darst, S.A. (1998) Inhibi-tion of Escherichia coli RNA polymerase by bacteriophageT4 AsiA. J Mol Biol 279: 9–18.

Simeonov, M.F., Bieber Urbauer, R.J., Gilmore, J.M., Adel-man, K., Brody, E.N., Niedziela-Majka, A., et al. (2003)Characterization of the interactions between the bacte-riophage T4 AsiA protein and RNA polymerase. Biochem-istry 42: 7717–7726.

Sommer, N., Salniene, V., Gineikiene, E., Nivinskas, R., andRuger, W. (2000) T4 early promoter strength probed in vivowith unribosylated and ADP-ribosylated Escherichia coliRNA polymerase: a mutation analysis. Microbiology 146:2643–2653.

Stevens, A. (1973) An inhibitor of host sigma-stimulated coreenzyme activity that purifies with DNA-dependent RNApolymerase of E. coli following T4 phage infection. Bio-chem Biophys Res Commun 54: 488–493.

Uzan, M., Favre, R., and Brody, E. (1988) A nuclease thatcuts specifically in the ribosome binding site of some T4mRNAs. Proc Natl Acad Sci USA 85: 8895–8899.