at SciVerse ScienceDirect

Biochimie xxx (2012) 1e7

Contents lists available

Biochimie

journal homepage: www.elsevier .com/locate/biochi

Research paper

Overexpression of four and a half LIM domains protein 2 promotesepithelial-mesenchymal transition-like phenotype in fish pre-osteoblasts

Marta S. Rafael a, Vincent Laizé a,*, Cláudia Florindo b,c, Serena Ferraresso d, Luca Bargelloni d,M. Leonor Cancela a,b,**

aCentre of Marine Sciences (CCMAR/CIMAR-LA), University of Algarve, Campus de Gambelas, 8005-139 Faro, Portugal1bDepartment of Biomedical Sciences and Medicine (DCBM), University of Algarve, Campus de Gambelas, 8005-139 Faro, PortugalcCentre for Molecular and Structural Biomedicine (CBME), Institute for Biotechnology and Bioengineering (IBB-LA), University of Algarve, Campus de Gambelas,8005-139 Faro, PortugaldDepartment of Public Health, Comparative Pathology, and Veterinary Hygiene, Faculty of Veterinary Medicine, University of Padova, Viale dell’Università 16, 35020 Legnaro, Italy

a r t i c l e i n f o

Article history:Received 29 July 2011Accepted 16 January 2012Available online xxx

Keywords:Four and a half LIM domains protein 2(FHL2)Fish bone-derived cell line (VSa16)Epithelial-mesenchymal transition (EMT)Microarray analysis

Abbreviations: ECM, extracellular matrix; EMT, eption; FHL2, four and a half LIM domains protein 2; G* Corresponding author. Tel.: þ351 289800057; fax** Corresponding author. Centre of Marine Sciencessity of Algarve, Campus de Gambelas 8005 139289800971; fax: þ351 289800076.

E-mail addresses: vlaize@ualg.pt (V. Laizé), lcance1 fcma.ualg.pt/EDGE/.

0300-9084/$ e see front matter � 2012 Elsevier Masdoi:10.1016/j.biochi.2012.01.013

Please cite this article in press as: M.S. Rafaetransition-like phenotype in fish pre-osteob

a b s t r a c t

FHL2 is a multifunctional protein involved in gene transcription regulation and cytoarchitecturemodulation that has been recently associated with epithelial-mesenchymal transition (EMT) in coloncancer. Overexpression of FHL2 in a fish pre-osteoblastic cell line promoted cell dedifferentiation andimpaired its extracellular matrix mineralization capacity. Cell cultures also acquired a novel three-dimensional structure organization, their proliferation rate was enhanced and gene expression profilewas altered in agreement with an EMT-like phenotype upon overexpression of FHL2. Altogether, ourresults provide additional support to the relevance of FHL2 for cell differentiation and its association withhallmarks of cancer phenotype.

� 2012 Elsevier Masson SAS. All rights reserved.

1. Introduction

Four and a half LIM domains protein 2 (FHL2) is a co-regulator ofgene transcription relevant for numerous signalling pathways andphysiological processes; knockout mice are viable but exhibitpathological conditions such as osteopenia, wound healing defi-ciency and cardiac hypertrophy under b-adrenergic stimulation[1e3], demonstrating how wide FHL2 action can be. FHL2 is also animportant cytoskeleton modulator, participating in signal trans-duction, cell adhesion and motility [4e7]. As for the diversity of itspartners, FHL2 can be found in both cytoplasm and nucleus [4,6,8],interacting with integrins and kinases at focal adhesions [9,10],participating in the sensor pathways for both chemical andmechanical cues [11] and shuttling into the nuclei upon Rhostimulation, thereby linking extracellular signals to transcriptional

ithelial-mesenchymal transi-AG, glycosaminoglycan.: þ351 289800069.(CCMAR/CIMAR-LA), Univer-Faro, Portugal. Tel.: þ351

la@ualg.pt (M.L. Cancela).

son SAS. All rights reserved.

l, et al., Overexpression of foulasts, Biochimie (2012), doi:1

control [6]. Overexpression of FHL2 protein has also beenfrequently associated with cancer (prostate, ovarian, breast andgastrointestinal tumours [4,9,12e14]), emphasizing the need fora better understanding of FHL2-mediated molecular actions. Thehigh conservation of protein primary and tertiary structuresthroughout vertebrate evolution has been recently demonstratedand the use of a teleost fish model as an alternative to classicalmammalian models has been validated for studies aiming atunveiling biological functions of FHL2 [15]. In this work we inves-tigated the role of FHL2 in cell differentiation during in vitromineralization using a fish pre-osteoblast cell line [16] followinga gain-of-function strategy. A global microarray analysis was thenperformed to characterize the molecular pathways affected byFHL2 overexpression.

2. Materials and methods

2.1. Establishment of cell clones overexpressing FHL2

Coding sequence of gilthead seabream FHL2 cDNA (GenBankaccession number DQ225183) was inserted into the expressionvector pcDNA3.1 (Invitrogen) and FLAG epitope (amino acidsequence is DYKDDDDK) was added at its 50-end. Construction was

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

Table 1Seabream genes and respective set of primers used for qPCR.

Gene Primer Sequence (50 to 30)

ALP SaFW_TNAP_RT CATCGCAACCCTTTTCACAGTCACCCGALP SaRV_TNAP_RT AACAGTGCCCAAACAGTGGTCCCATTAGCb-catenin Sab-catenin-01F TGGTTTGACACCGACCTGTAGGATTGb-catenin Sab-catenin-02R CGACTTGCTTTAACATTCCCGTGGCFHL2 SaFHL2-03F AAGGACCGTCACTGGCACGAGGAFHL2 SaFHL2-05R GGAGCCTGGCATGATGGTTTTCTTGFibronectin SaFibronectin-01F ATGTTGGTAGTGAATGGGAGCGGATGFibronectin SaFibronectin-02R ACTGTTTTCTGAGCGGCGGTCCCMEF2C SaMEF2C-05F CTGATGAATCGCCGACAGGCAACGMEF2C SaMEF2C-06R TTTTTCCTCCCCATCGTCCCCGTMyoD2 SaMyoD2-02F CGAGTCCAGGAGAAGCAAACGGTCMyoD2 SaMyoD2-03R CAGAGTGGCTCGTAGATGCTGTTGGGMMP9 SaMMP9-03F ACCCCCACTACCACCCCACAGCCMMP9 SaMMP9-04R TGAAAATGGTCCTTTGGGTCCTGCN-cadherin SaNcadherin-01F AGACGAGAGACCCCTCCACCCTGAN-cadherin SaNcadherin-02R TGGGGTCGTTGTCTGCTGCCTTCON SaON-realFw AGGAGGAGGTCATCGTGGAAGAGCCON SaON-realRv GTGGTGGTTCAGGCAGGGATTCTCARPL27a SaRPL27a-01F AAGAGGAACACAACTCACTGCCCCACRPL27a SaRPL27a-02R GCTTGCCTTTGCCCAGAACTTTGTAGSM22aa SaSM22a_a-01F CACTCAGTCAAGCATCCACTCTCACCCSM22aa SaSM22a_a-02R TGGACCAGTTGGACGCTTACAGGCVimentin SaVimentin-01F GGTGGATGCCCTCAAAGGAACTAATGVimentin SaVimentin-02R GATGGTGTCTTGGTAACCGCCTGTCT

M.S. Rafael et al. / Biochimie xxx (2012) 1e72

delivered into gilthead seabream pre-osteoblast VSa16 cellscultured as previously described [16] using FuGene6 (Roche).Transfected cells were cultured for 3 weeks in medium supple-mented with 300 mg/ml of geneticin (Invitrogen) then clonesresistant to antibiotic were selected, transferred to new plates andfurther cultured.

2.2. Cell proliferation

Cells were seeded in 96-wells plates at sub-confluency(1.5 � 103 cells/well) and their proliferation determined at

Fig. 1. Overexpression of FHL2 gene in gilthead seabream pre-osteoblast cells. (A)Levels of FHL2 gene expression in wild-type (WT) and FHL2 overexpressing (F2) cellsdetermined by qPCR. Values are the mean of 3 independent experiments; asteriskindicates significant difference, p < 0.05 according to Student’s t test. (B) Levels of FHL2protein production in WT and F2 cells determined by western blot analysis usinghuman polyclonal FHL2 antibody; b-actin was used as a loading control. (C) Phase-contrast micrographs of WT and F2 cells cultured in regular conditions. Bar is 100 mm.

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

appropriate times using the CellTiter 96 non-radioactive prolifer-ation assay kit (Promega).

2.3. Extracellular matrix mineralization

Extracellular matrix (ECM) mineralization was induced inconfluent cultures by supplementing medium with 50 mg/ml ofL-ascorbic acid, 10 mM b-glycerophosphate and 4 mM CaCl2 (allfrom SigmaeAldrich) as previously described [16]. Mineralizationmedium was renewed twice a week and mineral depositiondetermined at appropriate times through alizarin red S staining andspectrophotometric quantification [17].

2.4. Alkaline phosphatase activity

Cells were incubated for 30e45 min at 37 �C in a solution con-taining nitroblue tetrazolium salt (NBT, 175 mg/ml; Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, 225 mg/ml; Roche).Coloration resulting from alkaline phosphatase (ALP) activity wasevaluated by densitometry analysis of high quality pictures usingby densitometric methods using Quantity 1 software (Bio-Rad).

2.5. Collagen and glycosaminoglycan content

Cells cultured under control or mineralizing conditions werestained with either sirius red (ChromaeWaldeck [18]) to detectcollagen fibres or alcian blue 8GX (prepared in 0.1 N HCl;SigmaeAldrich) to detect glycosaminoglycans (GAGs). Collagen-bound dye was solubilized in 0.1 N NaOH and quantified by spec-trophotometry at 550 nm; GAG-bound dye was solubilized in 1%(w/v) sodium dodecyl sulfate and quantified by spectrophotometryat 350 nm.

2.6. Protein electrophoresis and western blot

Protein extractswereprepared inRIPAbuffer [19] then fractionedthrough electrophoresis on a NuPage 4e12% gradient poly-acrylamide gel (Invitrogen) andblotted onto nylonmembranes (Bio-Rad), as previously described [20]. Blots were hybridized withpolyclonal antibodies against human FHL2 (fromProf. RolandSchülelaboratory) orhuman b-actin (Santa Cruz). Immunoreactive proteinswere detected using species-specific IgG antibody (SigmaeAldrich)coupled to horseradish peroxidase and Western Lightning Chem-iluminescence Reagent Plus system (PerkineElmer).

2.7. RNA preparation

Total RNA was prepared from cell cultures using TRI Reagentsolution (Ambion). RNA integrity was evaluated using Agilent 2100Bioanalyzer and RNA integrity number (RIN) index calculated foreach sample using Agilent 2100 Expert software; only RNA sampleswith a RIN >8 were further processed.

2.8. RNA amplification, labelling and hybridization

Total RNA (200 ng) was amplified and labelled as previouslydescribed [21] then hybridized to Agilent Sureprint 4x44K Sparusaurata oligoarrays, containing probes for 19,734 unique genes [22].Agilent G2565BA DNA microarray scanner was used to scan slides(at a resolution of 5 mm) and images were analysed using the Agi-lent Feature Extraction Software 9.5.1 with default settings.

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

2.9. Microarray data normalization and statistical analysis

R statistical software (www.rproject.org) was used to analyze andnormalizemicroarraydata. Spike-in control intensities (Spike-InViralRNAs)were used to test the efficiency of the normalizationprocedure(cyclic lowess). A two-class Significance Analysis of Microarray (SAM[23]) testwas used to identify differentially expressed genes betweenF2 versuswild-type cells grownunder control conditions at T0 (initialconfluent cultures) or T4 (4weeks of cell confluence); quadruplicateswere used for each sample. False discovery rate (FDR) was set at 5%and only probes with fold change (FC) over 2 were considered.Functional annotation of differentially expressed genes was per-formed using the Database for Annotation, Visualization and Inte-grated Discovery (DAVID [24]) and only biological processeswith foldenrichment over 1.3 and p-value (ease) lower than 0.05 wereconsidered. Raw and normalized fluorescence data have beendeposited in theGEOdatabase under accessionnumbersGSM804620to GSM804635 (platform GPL6467 and series GSE32501).

2.10. Analysis of gene expression by quantitative real-time RT-PCR

Total RNA (1 mg) was treated with RQ1 RNase-free DNase I(Promega) then reverse-transcribed at 37 �C for 1 h using theMoloney-murine leukemia virus (M-MLV) reverse transcriptase,RNaseOUT (both from Invitrogen) and oligo(dT)-adapter primer[50-ACGCGTCGACCTCGAGATCGATG(T)13-30]. PCR amplification oftarget genes was performed using iCycler iQ system (Bio-Rad) andthe following conditions: an initial denaturation step at 95 �C for2 min then 40e50 cycles of amplification (one cycle: 30 s at 95 �Cand 30 s at 68 �C). PCR reaction mix consisted in reverse-

Fig. 2. Immunofluorescent detection of exogenous FHL2 and b-tubulin in wild-type and F2 cusing M2 antibody directed against FLAG epitope (red) and DAPI (blue). (B) b-tubulin is exptubulin (red) was counterstained with DAPI (blue). Microphographs were taken in random fi

colour in this figure legend, the reader is referred to the web version of this article.)

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

transcribed RNA (1:100 dilution) as template, 1X SsoFast Eva-Green supermix (Bio-Rad) and 300 nM of gene-specific primers(Table 1). Ribosomal protein L27a was used as housekeeping geneto normalize gene expression.

2.11. Immunofluorescence

Cell cultures were fixed for 15 or 30 min (for b-tubulin) withpre-warmed 4% formalin, washed 3 times with phosphate-bufferedsaline (PBS), then permeabilized with 0.5% (v/v) Triton X-100 for10 min and immunoblotted with primary antibodies: anti-flag M2monoclonal, mouse b-tubulin (both from SigmaeAldrich) andhuman phosphohistone 3 polyclonal (PH3, Upstate) diluted in 1%FBS/0.05% Tween20 in PBS (1:500 dilution for M2 and PH3, and1:200 for b-tubulin). Immunoreactive proteins were revealed usingrespective IgG-ALEXA conjugated secondary antibody (Invitrogen)diluted 1:500 in 1% FBS/0.05% Tween20 in PBS. Cell nuclei werecounterstained with 2 mg/ml of DAPI.

2.12. In vitro wound healing assay

Confluent cell cultures were wounded with a plastic pipette tipthenwashed with PBS solution to remove cell debris. Wounded cellcultures were further grown in the presence of 5 mg/ml of mito-mycin C (SigmaeAldrich) to inhibit cell proliferation. Cell repopu-lation of injury was evaluated 12 h post wound.

2.13. Analysis of cell culture three-dimensional structure

Cells were seeded in a Millicell insert (27 mm, Millipore) ata density of 2 � 105 cells/insert then cultured for 4 weeks under

ells. (A) FLAG-tagged FHL2 protein in F2 clone was determined by immunofluorescenceressed more abundantly in F2 than in wild-type (WT) cells. Immunolocalization of b-elds using the same exposure time. Bar is 20 mm. (For interpretation of the references to

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

M.S. Rafael et al. / Biochimie xxx (2012) 1e74

standard conditions. At appropriate times, cells were washed withPBS, fixed in a graded series of ethanol, dehydrated in xylene thenembedded in paraffin. Histological sections (7 mm) were preparedand stained with Harris hematoxylin-eosin (ChromaeWaldeck).

3. Results and discussion

3.1. Overexpression of FHL2 gene alters proliferation of pre-osteoblast cells

Pre-osteoblast VSa16 cells were transfectedwith pcDNA3-FLAG-FHL2 construction and clones resistant to geneticin were estab-lished. Overexpression of FHL2 gene was confirmed by qPCR andwestern blot analysis in various clones and a single clone (F2) wasselected for further analysis showing that increased levels of FHL2promoted a change in cell morphology (Fig.1AeC). Accumulation ofexogenous FHL2 protein was observed in nucleus and cytoplasm ofF2 cells (Fig. 2A) and was accompanied by a significant increase ofb-tubulin expression, a major component of the cytoskeleton: F2clone clearly exhibit a more intense tubulin staining than WT cells(Fig. 2B). While FHL2 has been previously associated with cyto-skeleton after its co-localization with actin [5] and interaction withfocal adhesion kinases [9,25,26], this is the first time that tubulin isconnected with FHL2 (over)expression, reinforcing the relevance ofFHL2 for cytoskeleton structure and organization, not only byinteraction with other proteins, but also possibly by affecting theirexpression.

F2 clone exhibited an accelerated proliferation with a 40%reduced doubling time when compared to wild-type cells (Fig. 3A).

Fig. 3. Characterization of cell growth performance upon FHL2 overexpression. (A) Cell proliindependent experiments, performed in triplicates. (B) Number of mitotic cells in WT and F2cells in the presence of mitomycin C; Bar is 100 mm. (D) Phase-contrast micrograph of WT andthree-dimensional structure after staining of cross-sections with hematoxylin-eosin (right

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

A similar effect was reported in mouse fibroblasts and myeloidprogenitor cells [27,28], where the regulatory action of FHL2 uponcell cycle genes, in particular the cyclin D1, was associated withproliferative effect. Higher expression of the mitotic marker phos-phohistone 3 (PH3) in F2 clone indicated that cell divisioncontinued upon confluence (Fig. 3B); furthermore, F2 clonerecovered more rapidly from injury than wild-type cells (Fig. 3C),forming disorganized multilayers while parental cells grew asa typical monolayer (Fig. 3D). Altogether, these results suggest thatcell contact inhibition and regulation of cell division weredramatically altered, simultaneously to a reorganization of cyto-skeleton upon FHL2 overexpression.

Global analysis of gene expression of wild-type versus F2 cellsrevealed the up-regulation of genes associated with cell prolifera-tion (e.g. cyclins D2, B1 and B3), cytoskeleton organization (e.g.actin-binding LIM protein family), macromolecular complexassembly (e.g. minichromosome maintenance complex component2), adherent junctions (e.g. caveolin 2, gap junction protein 1), andmicrotubule associated complex (kinesin motor protein 15) uponoverexpression of FHL2 (Table 2). These expression data are inagreement with morphological changes observed upon FHL2overexpression and further confirm the phenotypic transition of F2clone.

3.2. Overexpression of FHL2 gene impairs osteogenic differentiationin VSa16 cells

Mineralogenic capacity of F2 clone was investigated throughalizarin red staining of mineral deposits and measurement of

feration of wild-type (WT) and FHL2 overexpressing (F2) cells; values are the mean of 3confluent cultures using PH3 antibody; bar is 100 mm. (C) Wound healing of WT and F2F2 cell cultures grown for 4 weeks under control conditions (left panel) and respective

panel). Bar is 50 mm; In, insert; mL, cell monolayer; ML, cell multilayers.

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

Table 2Identification of putative functional categories of genes differentially expressed in F2cells, through Gene Ontology analysis using DAVID bioinformatic resources.

DOWN-regulated genes UP-regulated genes

Biological processes (BP)Apoptosis Cell cycleCell death Cytoskeleton organizationRegulation of cell motion/locomotion DNA replicationAminoacid phosphorylation DNA repairRegulation of MAPK activity Cell proliferationMuscle/myoblast differentiation Macromolecular complex assemblyHeart development Organelle fissionECM organization/structure MeiosisBlood vessel development/angiogenesis Muscle system processRegulation of bone mineralization Regulation of ubiquitinationOsteoblast differentiationRegulation of MAPK activityInflammatory responseGene expression regulationWound healingCell proliferation

Cellular component (CC)Extracellular region ChromosomeCytoplasm vesicle part Cytoskeleton

Myosin complexActin filamentAdherens junctionMicrotubule associated complex

Molecular function (MF)Binding (lipid, protein, sugar,

vitamin, promoter, iron,co-factor, cell surface)

Binding (actin, nucleotide, ADP,AND, cytoskeleton proteins,vitamin, magnesium)

Enzyme activity (alkalinephosphatase, caspase,protein dimerization)

Enzyme activity (nuclease,oxidoreductase, phosphatase,ATPase)

Diseases (Genetic Associated Database & OMIM)Cardiovascular Breast cancerHematological Colorectal cancerInfection Drug hypersensitivityBethlem myopathy* Neural tube defectsUllrich congenital muscular dystrophy* Cirrhosis*

KEGG pathwaysCoagulation cascade Cell cycleCysteine and methionine metabolism DNA replication

PPARg signalingPyrimidine metabolismMismatch repair

* From OMIM, the Online Mendelian Inheritance in Man database.

Fig. 4. Phenotypic transition in cells overexpressing FHL2. (A) Extracellular matrix(ECM) mineralization in wild-type (WT) and FHL2 overexpressing (F2) cells throughalizarin red S staining and quantification. (B) Alkaline phosphatase (ALP) activity in WTand F2 cells through NBT/BCIP staining and quantification. (C) Collagen content in WTand F2 cells through sirius red staining and quantification. (D) Glycosaminoglycansproduction in WT and F2 cells through alcian blue staining and quantification. Valuesare the mean of 3 independent experiments and represent a net increase of staining at4 weeks (control staining was subtracted). Asterisks indicate statistical significantdifferences (*p < 0.05 and **p < 0.001, Student’s t test).

M.S. Rafael et al. / Biochimie xxx (2012) 1e7 5

alkaline phosphatase activity. Both processes were inhibited(Fig. 4A and B), suggesting that pre-osteoblast cells lost part of theircapacity to differentiate into an osteogenic cell type upon FHL2overexpression. Microarray and qPCR expression data (Fig. 5 andTable 2) further confirmed the reduced expression of ALP and otherosteoblast marker genes such as bonemorphogenetic protein 2 andosteonectin (Fig. 5A). Stimulation of collagen fibre production andglycosaminoglycans content was also observed in F2 cells (Fig. 4Cand D), further evidencing a change in pre-osteoblast cell pheno-type upon FHL2 overexpression. We propose that F2 cells lost theability to commit to the osteoblastic lineage and simultaneouslyacquired an improved capacity to reorganize their ECM. FHL2overexpression in seabream pre-osteoblast cells drastically reducescells capacity to mineralize their ECM, in contradiction with resultsin mouse osteoblastic 7F2 and MC3T3 cell lines and in humanmesenchymal stem cells, where FHL2 overexpressionwas shown toimprove mineralization capacity [1,29,30]. This discrepancy may berelated to a phenotype transition/dedifferentiation associated withthe fact that VSa16 cells are only partially differentiated.

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

3.3. Epithelial-mesenchymal transition-like phenotype

To better characterize the nature of the phenotype transitionobserved in VSa16 cells upon FHL2 overexpression, gene expressionprofiles of both wild-type and F2 cells were further comparedthrough microarray analysis. As observed for bone-related genes,expression of muscle-related genes, i.e.myocyte enhancer factor 2C(MEF2C), myogenic differentiation factor 2 (MyoD2) and smoothmuscle protein 22 a_a (SM22aa) was down-regulated in F2 cells.These data discard the possibility that F2 clone could be trans-differentiating into a myoblast-like phenotype, considering thatboth myoblasts and osteoblasts have a similar mesenchymal originand that FHL2 gene expression has been previously associated toheart and skeletal muscle development in seabream [15]. Inter-estingly, microarray results at T0 and T4, validated by qPCR,revealed an up-regulation in F2 clone of the expression of a set ofgenes e b-catenin, fibronectin, matrix metallopeptidase 9, N-cad-herin and vimentin e associated with epithelial-mesenchymaltransition (EMT). Phenotypic changes observed in F2 clone arealso features of cells undergoing EMT [31] including i) dissolution ofcellecell junctions where F2 cells are not cell-contact inhibited andform irregular multilayers; ii) cytoskeletal rearrangements evi-denced by a different morphology and behaviour, including anincrease b-tubulin network, in F2 cells; iii) improved motilitysimultaneous to an enhanced growth performance of F2 cells, asevidenced during the wound healing assay; and iv) increasedsynthesis of extracellular matrix components by F2 cells such as

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

Fig. 5. Genes differentially expressed upon FHL2 overexpression in confluent cell cultures at T0 (A) and T4 (B). Expression of bone-, muscle- and EMT-related genes was determinedthrough microarray analysis of two probes (probe 1 and probe 2) and confirmed by quantitative real time PCR (qPCR; 5 replicates). Results are indicated as fold change of up ordown-regulated genes in F2 when compared to WT. ALP, alkaline phosphatase; BMP2, bone morphogenetic protein 2; ON, osteonectin; MEF2C, myocyte enhancer factor 2C; MyoD2,myogenic differentiation factor 2; SM22aa, smooth muscle protein 22a_a; bC, b-catenin; FN, fibronectin; MMP9, matrix metallopeptidase 9; NC, N-cadherin; VM, vimentin; N/C, nosignificant fold change.

M.S. Rafael et al. / Biochimie xxx (2012) 1e76

collagen fibres, which are major components of ECM, and glycos-aminoglycans, which are relevant ECM biomolecules associatedwith pathological conditions such as tumour progression andosteoarthritis [32]).

Enrichment analysis of differentially expressed genes usingDAVID bioinformatics resources identified functional categoriesover-represented in F2 cells (Table 2), confirming an increase inexpression of genes related to cell communication, which includemolecules such as b-catenin, cadherins, RhoA GTPase, slug andsnail (KEGG pathways [33]). All of them are associated witha phenotype of EMT and/or tumourigenesis and metastasisprogression [6,34]. In particular, EMT has been recently associ-ated with progression and invasion potential in colon cancerthrough the interaction of FHL2 with snail, accompanied withE-cadherin negative regulation, which represent typical EMTfeatures [14,35]. Genes related to Biological processes such as cellcycle and proliferation, cytoskeleton organization, DNA replica-tion and repair and protein complex assembly, Cellular Compo-nent such as cytoskeleton, adherens junction and microtubuleassociated complex and Molecular Function such as enzymeactivity and binding were up-regulated in F2 cells (Table 2). Incontrast, genes related to regulation of cell motility, cell deathand apoptosis (Table 2) were found to be down-regulated in F2cells, indicating that these functions might be deregulated uponoverexpression of FHL2.

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

Altogether, functional analysis of microarray data further sup-ported the hypothesis of an EMT phenotype. Moreover, whensearching for diseases associated to FHL2 overexpression, using thegenetic association and OMIM (Online Mendelian Inheritance inMan) databases, we found that breast and colorectal cancer-associated genes are up-regulated (Table 2) in agreement withprevious data showing the involvement of FHL2 in these two typesof cancer [12,14].

4. Conclusions

Using a gain-of-function strategy, we collected evidencetowards the role of the four and a half LIM domains protein 2 inpromoting the phenotypic transition of pre-osteoblast throughtranscriptional reprogramming. Gilthead seabream VSa16 cells losetheir capacity to differentiate into osteoblasts upon overexpressionof FHL2 and ECMmineralization is impaired, supported by a down-regulation of bone-related genes. Changes in phenotype and geneexpression profiles indicate a dedifferentiation of cells through anEMT mechanism, particularly evidenced through an altered cyto-skeleton organization and enhanced cell motility. Altogether, thesedata emphasise the importance of understanding the mechanismof action of FHL2 in the process of EMT, considering that it has beenrepeatedly associated with cancer diagnosis and might representan interesting target for therapeutics [4,9,12].

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013

M.S. Rafael et al. / Biochimie xxx (2012) 1e7 7

Acknowledgments

This work was partially funded by grant GOCE-CT-2004-505403(Marine Genomics Europe NoE) from the European Community 6thframework programme and by grant PEst-OE/EQB/LA0023/2011from the Portuguese Foundation for Science and Technology(FCT). Marta S. Rafael was supported by FCT PhD fellowship SFRH/BD/22695/2005. Authors would like to thank Professor RolandSchüle for providing human polyclonal FHL2 antibody.

References

[1] T. Günther, C. Poli, J.M. Müller, P. Catala-Lehnen, T. Schinke, N. Yin,S. Vomstein, M. Amling, R. Schüle, Fhl2 deficiency results in osteopenia due todecreased activity of osteoblasts, EMBO J. 24 (2005) 3049e3056.

[2] V. Wixler, S. Hirner, J.M. Müller, L. Gullotti, C. Will, J. Kirfel, T. Günther,H. Schneider, A. Bosserhoff, H. Schorle, J. Park, R. Schüle, R. Buettner, Defi-ciency in the LIM-only protein Fhl2 impairs skin wound healing, J. Cell Biol.177 (2007) 163e172.

[3] Y. Kong, J.M. Shelton, B. Rothermel, X. Li, J.A. Richardson, R. Bassel-Duby,R.S. Williams, Cardiac-specific LIM protein FHL2 modifies the hypertrophicresponse to b-adrenergic stimulation, Circulation 103 (2001) 2731e2738.

[4] J.M. Müller, U. Isele, E. Metzger, A. Rempel, M. Moser, A. Pscherer, T. Breyer,C. Holubarsch, R. Buettner, R. Schüle, FHL2, a novel tissue-specific coactivatorof the androgen receptor, EMBO J. 19 (2000) 359e369.

[5] M. Canault, E. Tellier, B. Bonardo, E. Mas, M. Aumailley, I. Juhan-Vague,G. Nalbone, F. Peiretti, FHL2 interacts with both ADAM-17 and the cytoskel-eton and regulates ADAM-17 localization and activity, J. Cell. Physiol. 208(2006) 363e372.

[6] J.M. Müller, E. Metzger, H. Greschik, A.-K. Bosserhoff, L. Mercep, R. Buettner,R. Schüle, The transcriptional coactivator FHL2 transmits Rho signals from thecell membrane into the nucleus, EMBO J. 21 (2002) 736e748.

[7] M. Johannessen, S. Moller, T. Hansen, U. Moens, M.V. Ghelue, The multifunc-tional roles of the four-and-a-half-LIM only protein FHL2, Cell. Mol. Life Sci. 63(2006) 268e284.

[8] A. Morlon, P. Sassone-Corsi, The LIM-only protein FHL2 is a serum-inducibletranscriptional coactivator of AP-1, Proc. Natl. Acad. Sci. USA 100 (2003)3977e3982.

[9] B. Gabriel, S. Mildenberger, C.W. Weisser, E. Metzger, G. Gitsch, R. Schüle,J.M. Müller, Focal adhesion kinase interacts with the transcriptional coac-tivator FHL2 and both are overexpressed in epithelial ovarian cancer, Anti-cancer Res. 24 (2004) 921e927.

[10] V. Wixler, D. Geerts, E. Laplantine, D. Westhoff, N. Smyth, M. Aumailley,A. Sonnenberg, M. Paulsson, The LIM-only protein DRAL/FHL2 binds to thecytoplasmic domain of several a and b integrin chains and is recruited toadhesion complexes, J. Biol. Chem. 275 (2000) 33669e33678.

[11] M. Hervy, L. Hoffman, M.C. Beckerle, From the membrane to the nucleus andback again: bifunctional focal adhesion proteins, Curr. Opin. Cell Biol. 18(2006) 524e532.

[12] B. Gabriel, D.C. Fischer, M. Orlowska-Volk, A. Hausen, R. Schüle, J.M. Müller,A.Hasenburg, Expressionof the transcriptional coregulator FHL2 inhumanbreastcancer: a clinicopathologic study, J. Soc. Gynecol. Investig. 13 (2006) 69e75.

[13] J. Wang, Y. Yang, H.H. Xia, Q. Gu, M.C. Lin, B. Jiang, Y. Peng, G. Li, X. An,Y. Zhang, Z. Zhuang, Z. Zhang, H.F. Kung, B.C. Wong, Suppression of FHL2expression induces cell differentiation and inhibits gastric and colon carci-nogenesis, Gastroenterology 132 (2007) 1066e1076.

[14] W. Zhang, B. Jiang, Z. Guo, C. Sardet, B. Zou, C.S.C. Lam, J. Li, M. He, H.-Y. Lan,R. Pang, I.F.N. Hung, V.P.Y. Tan, J. Wang, B.C.Y. Wong, Four-and-a-half LIMprotein 2 promotes invasive potential and epithelial-mesenchymal transitionin colon cancer, Carcinogenesis 31 (2010) 1220e1229.

[15] M.S. Rafael, V. Laizé, A. Bensimon-Brito, R.B. Leite, R. Schüle, M.L. Cancela,Four-and-a-half LIM domains protein 2 (FHL2) is associated with the devel-opment of craniofacial musculature in the teleost fish Sparus aurata, Cell. Mol.Life Sci. 69 (2012) 423e434.

[16] A.R. Pombinho, V. Laizé, D.M. Molha, S.M.P. Marques, M.L. Cancela, Develop-ment of two bone-derived cell lines from the marine teleost Sparus aurata;

Please cite this article in press as: M.S. Rafael, et al., Overexpression of foutransition-like phenotype in fish pre-osteoblasts, Biochimie (2012), doi:1

evidence for extracellular matrix mineralization and cell-type specificexpression of matrix Gla protein and osteocalcin, Cell Tissue Res. 315 (2004)393e406.

[17] C.M. Stanford, P.A. Jacobson, E.D. Eanes, L.A. Lembke, R.J. Midura, Rapidlyforming apatitic mineral in an osteoblastic cell line, J. Biol. Chem. 270 (1995)9420e9428.

[18] H. Tullberg-Reinert, G. Jundt, In situ measurement of collagen synthesis byhuman bone cells with a Sirius Red-based colorimetric microassay: effects oftransforming growth factor b2 and ascorbic acid 2-phosphate, Histochem. CellBiol. 112 (1999) 271e276.

[19] F. Poirier, D. Lawrence, P. Vigier, P. Jullien, A ts T mutant of Schmidt Ruppinstrain of Rous sarcoma virus restricted at 39.5�C for the morphologicaltransformation and the tumorigenicity of chicken embryo fibroblasts, Int. J.Cancer 29 (1982) 69e76.

[20] D.C. Simes, M.K. Williamson, J.B. Ortiz-Delgado, C.S.B. Viegas, P.A. Price,M.L. Cancela, Purification of matrix Gla protein from a marine teleost fish,Argyrosomus regius: calcified cartilage and not bone as the primary site ofMGP accumulation in fish, J. Bone Miner. Res. 18 (2003) 244e259.

[21] D.M. Tiago, V. Laizé, L. Bargelloni, S. Ferraresso, C. Romualdi, M.L. Cancela,Global analysis of gene expression in mineralizing fish bone derived cell lines:new insights into anti-mineralogenic effect of vanadate, BMC Genomics 12(2011) 310.

[22] S. Ferraresso, N. Vitulo, A.N. Mininni, C. Romualdi, B. Cardazzo, E. Negrisolo,R. Reinhardt, A.V. Canário, T. Patarnello, L. Bargelloni, Development andvalidation of a gene expression oligo microarray for the gilthead sea bream(Sparus aurata), BMC Genomics 9 (2008) 580.

[23] V.G. Tusher, R. Tibshirani, G. Chu, Significance analysis of microarrays appliedto the ionizing radiation response, Proc. Natl. Acad. Sci. USA 98 (2001)5116e5121.

[24] D.W. Huang, B.T. Sherman, R.A. Lempicki, Systematic and integrative analysis oflargegene listsusingDAVIDbioinformatics resources,Nat. Protoc.4 (2008)44e57.

[25] H.Y. Li, M. Kotaka, S. Kostin, S.M.Y. Lee, L.D.S. Kok, K.K. Chan, S.K.W. Tsui,J. Schaper, R. Zimmermann, C.Y. Lee, P.F. Kwok, M.M.Y. Waye, Translocation ofa human focal adhesion LIM-only protein, FHL2, during myofibrillogenesisand identification of LIM2 as the principal determinants of FHL2 focal adhe-sion localization, Cell Motil, Cytoskeleton 48 (2001) 11e23.

[26] J. Park, C. Will, B. Martin, L. Gullotti, N. Friedrichs, R. Buettner,H. Schneider, S. Ludwig, V. Wixler, Deficiency in the LIM-only protein FHL2impairs assembly of extracellular matrix proteins, FASEB J. 22 (2008)2508e2520.

[27] C. Labalette, Y. Nouet, J. Sobczak-Thepot, C. Armengol, F. Levillayer, M.-C. Gendron, C.-A. Renard, B. Regnault, J. Chen, M.-A. Buendia, Y. Wei, The LIM-only protein FHL2 regulates cyclin D1 expression and cell proliferation, J. Biol.Chem. 238 (2008) 15201e15208.

[28] Z. Qian, L. Mao, A.A. Fernald, H. Yu, R. Luo, Y. Jiang, J. Anastasi, P.J. Valk,R. Delwel, M.M. Le Beau, Enhanced expression of FHL2 leads to abnormalmyelopoiesis in vivo, Leukemia 23 (2009) 1650e1657.

[29] C.F. Lai, S. Bai, B.A. Uthgenannt, L.R. Halstead, P. McLoughlin, B.W. Schafer,P.H. Chu, J. Chen, C.A. Otey, X. Cao, S.L. Cheng, Four and half LIM protein 2(FHL2) stimulates osteoblast differentiation, J. Bone Miner. Res. 21 (2006)17e28.

[30] Z. Hamidouche, E. Hay, P. Vaudin, P. Charbord, R. Schüle, P.J. Marie,O. Fromigué, FHL2 mediates dexamethasone-induced mesenchymal celldifferentiation into osteoblasts by activating Wnt/b-catenin signaling-dependent Runx2 expression, FASEB J. 22 (2008) 3813e3822.

[31] D.C. Radisky, Epithelialemesenchymal transition, J. Cell Sci. 118 (2005)4325e4326.

[32] H. Järveläinen, A. Sainio, M. Koulu, T.N. Wight, R. Penttinen, Extracellularmatrix molecules: potential targets in pharmacotherapy, Pharmacol. Rev. 61(2009) 198e223.

[33] M. Kanehisa, S. Goto, S. Kawashima, Y. Okuno, M. Hattori, The KEGG resourcefor deciphering the genome, Nucleic Acids Res. 32 (2004) D277eD280.

[34] J.M. Lee, S. Dedhar, R. Kalluri, E.W. Thompson, The epithelial-mesenchymaltransition: new insights in signaling, development, and disease, J. Cell Biol.172 (2006) 973e981.

[35] W. Zhang, J. Wang, B. Zou, C. Sardet, J. Li, C.S. Lam, L. Ng, R. Pang, I.F. Hung,V.P. Tan, B. Jiang, B.C. Wong, Four and a half LIM protein 2 (FHL2) negativelyregulates the transcription of E-cadherin through interaction with Snail1, Eur.J. Cancer 47 (2010) 121e130.

r and a half LIM domains protein 2 promotes epithelial-mesenchymal0.1016/j.biochi.2012.01.013