The proliferation and phenotypic expression of human osteoblasts on tantalum metal

Biomaterials 25 (2004) 2215–2227

ARTICLE IN PRESS

*Correspondin

University of A

Building, Adela

5621; fax: +618-

E-mail addres

0142-9612/$ - see

doi:10.1016/j.bio

The proliferation and phenotypic expression of human osteoblastson tantalum metal

David M. Findlaya,b,*, Katie Welldona, Gerald J. Atkinsa, Donald W Howiea,b,Andrew C.W. Zannettinoc, Dennis Bobynd

aDepartment of Orthopaedics and Trauma, University of Adelaide, Adelaide, South Australia, AustraliabDepartment of Orthopaedics and Trauma, Royal Adelaide Hospital, Level 4, Bice Building, Adelaide, South Australia, Australia

cDivision of Haematology, Institute of Medical and Veterinary Science, Adelaide, South Australia, AustraliadMontreal General Hospital and McGill University, Montreal, Que., Canada

Received 7 July 2003; accepted 7 September 2003

Abstract

Tantalum (Ta) is increasingly used in orthopaedics, although there is a paucity of information on the interaction of human

osteoblasts with this material. We investigated the ability of Ta to support the growth and function of normal human osteoblast-like

cells (NHBC). Cell responses to polished and textured Ta discs were compared with responses to other common orthopaedic metals,

titanium and cobalt–chromium alloy, and tissue culture plastic.

No consistent differences, that could be attributed to the different metal substrates or to the surface texture, were found in several

measured parameters. Attachment of NHBC to each substrate was similar, as was cell morphology, as determined by confocal

microscopy. Cell proliferation was slightly faster on plastic than on Ta at 3 days, but by 7 days neither the absolute cell numbers, nor

the number of cell divisions, was different between Ta and the other substrates. No consistent, substrate-dependent differences were

seen in the expression of a number of mRNA species corresponding to the pro-osteoclastic or the osteogenic activity of osteoblasts.

No substrate-dependent differences were seen in the extent of in vitro mineralisation by NHBC. These results indicate that Ta is a

good substrate for the attachment, growth and differentiated function of human osteoblasts.

r 2003 Elsevier Ltd. All rights reserved.

Keywords: Tantalum; Human osteoblasts; Cell attachment and proliferation; Gene expression; Mineralisation

1. Introduction

Normal human osteoblast-like cells (NHBC) can bederived from cancellous bone of human donors. NHBCdisplay the expected properties of osteoblasts (OB), interms of the profile of genes expressed and mineralisa-tion in vitro under appropriate culture conditions [1].Osteoblasts exist in two functional states; firstly, theyare capable of an anabolic, bone-forming activity, whichinvolves the expression of bone matrix proteins, includ-ing type-I collagen (COL-1) I, osteocalcin (OCN), andbone sialoprotein (BSP)-1, and the laying down ofhydroxyapatite mineral in this organic scaffold [2].

g author. Department of Orthopaedics and Trauma,

delaide, Royal Adelaide Hospital, Level 4, Bice

ide, South Australia, Australia. Tel.: +618-8222-

8232-3065.

s: [email protected] (D.M. Findlay).

front matter r 2003 Elsevier Ltd. All rights reserved.

materials.2003.09.005

Secondly, cells of the osteoblast lineage perform anessential catabolic role in the bone resorption process byrecruiting and promoting the differentiation of osteo-clast (OC) precursor cells and activating matureosteoclasts [3], at sites targeted for bone resorption.The differentiation of OC precursor cells is dependenton osteoblastic expression of an OC differentiationfactor, termed RANKL, which interacts with a receptortermed RANK on the OC precursor cells. RANKL is amembrane-associated member of the tumour necrosisfactor (TNF) ligand family [4]. A natural secretedantagonist of RANKL, termed osteoprotegerin (OPG),binds to RANKL, and inhibits both the formation andthe activation of OCs [5]. It is now clear that the localRANKL/OPG ratio determines the strength of theosteoclastogenic signal. Sub-fractionation of NHBC byFACS, on the basis of their expression of the bonemarrow stromal precursor marker, STRO-1 yields theless mature STRO-1bright cells with high proliferative

ARTICLE IN PRESSD.M. Findlay et al. / Biomaterials 25 (2004) 2215–22272216

potential and the more mature osteogenic STRO-1dull

cells [6]. Both cell populations express core bindingfactor alpha (CBFA)-1/Runx2, a transcription factoressential for expression of the osteoblast) [7,8]. Anumber of additional skeletally active molecules, suchas interleukin (IL)-11, have been shown to havepleiotropic roles in osteoblast function, with effects onboth the anabolic and catabolic activities of osteoblasts[9,10].

It is well recognised that interaction of cells with theirsubstrate is fundamental to the processes of cellulardifferentiation and function. Thus the extracellularmatrix (ECM) has been shown to influence aspects ofcellular activity including cell architecture, movement,gene expression and responses of cells to external stimuli[11]. Indeed, we, and others have reported that the ECMcomponents of bone can modulate the differentiationstate of osteoblast-like cells in vitro. In particular, weshowed that growth of osteoblasts on a type I collagenmatrix produced changes consistent with a moredifferentiated osteoblast phenotype, compared withgrowth of cells on tissue culture plastic [12]. ECM-mediated effects included changes in cell morphology[12], altered expression of membrane-bound tyrosinephosphatases [13], and changes in gene expression[14,15] and signal transduction [16]. The effects of cellsubstrate on cell behaviour are not limited to biologicalmolecules, but have also been shown with a range ofbiomaterials [17,18]. Relevant to this report, tantalum(Ta) metal has been shown to support tissue ingrowth ina number of orthopaedic implant contexts [19–21].However, osteoblast interaction with tantalum, and inparticular its effects on the phenotype and function ofhuman osteoblasts, remain to be investigated in detail.

Ta is an elemental metal that has recently gainedinterest for a variety of orthopaedic applications. Forexample, porous ‘‘trabecular’’ Ta constructs have beenshown in animal studies to be excellent scaffolds forbone ingrowth and mechanical attachment [19–21]. Theprimary aim of this study was to investigate theinteraction of human OB with Ta in a cell culturemodel. The study hypothesis was that the cellularresponse to Ta was similar to the response to thetraditional biomaterials, titanium and cobalt–chromium(Co–Cr) alloy. Since the microtexture of biomaterialshas been claimed to affect cellular response [22,23], cellculture discs of each metal were prepared with bothpolished and textured surfaces.

2. Materials and methods

Ta was compared with the response to the traditionalmetallic biomaterials, CP titanium (CP Ti) and Co–Cralloy. Each of the three metals was prepared in the formof solid discs of 22mm diameter. For each metal, two

groups of discs were prepared, one with a smoothsurface treatment and one with a microtextured surfacetreatment. The smooth surface treatment involvedprogressive polishing to a buff finish using standardcommercial techniques. For the Ta discs, the micro-textured surface treatment was created by exposingpolished discs to the same chemical vapour deposition(CVD) process used in the manufacture of trabecularmetal [19]. To establish a microtexture on the polishedTi and Co–Cr discs, they were subjected to heattreatments in a vacuum furnace as would be used forthe bonding of porous coatings to an implant substrate.This involved diffusion bonding for Ti and sinteringtemperatures for Co–Cr. The purpose of the heattreatments was to alter the polished surface of the discsby thermal etching. The metal substrates were allcompared with standard tissue culture plastic.

2.1. Surface characterisation of discs by atomic force

microscopy (AFM)

The Ta, Ti and Co–Cr cell culture discs wereexamined with AFM to provide qualitative andquantitative information on the polished and micro-textured surfaces.

2.2. Cell culture

Human osteoblast-like (bone) cells (NHBC) fromthree different individuals were grown from trabecularbone samples obtained at joint replacement surgery, orduring bone marrow donation from the iliac crest, andprocessed for culture as previously described [6]. Briefly,cells were cultured in a-MEM (Flow Laboratories,Irvine, Scotland) with 10% FCS, 0.2m l-glutamineand ascorbate 2-phosphate at 37�C/5%CO2 in air in ahumidified incubator [6]. All experiments were per-formed on first passage cells, which were enzymicallyremoved from dishes using collagenase, dispase, andtrypsin and plated onto tissue culture plastic or 22mmdiameter metal discs, in 12-well dishes. In order toperform all the experiments it was necessary to use thediscs several times, which necessitated washing in non-ionic detergent (Extran MA, Merck Pty Ltd., Kilsyth,Australia) and autoclaving. Preliminary experimentswere performed to ensure that washed discs gave resultsno different from virgin discs.

2.3. Rate and extent of cell attachment

The rate and extent of cell attachment was measuredby quantitating attached cells as a fraction of total cellsadded at 30min, 1 and 2 h. Each of the six metalsurfaces and the tissue culture plastic substrate weredivided into quadrants with a wax pen, into each ofwhich was placed 50 ml of cell suspension containing

ARTICLE IN PRESSD.M. Findlay et al. / Biomaterials 25 (2004) 2215–2227 2217

2� 104 cells. At each time point, unattached cells werewashed off in phosphate buffered saline (PBS) withvigorous pipetting, and remaining cells were thenstained with crystal violet, and quantitated by measur-ing the OD570 of the cell lysates, which correlates closelywith cell number, as we have previously described [24].

2.4. Use of confocal microscopy to assess cell morphology

Cells (4� 104) were seeded in a 400 ml droplet ontoeach of the metal discs, which were then incubated in ahumid chamber at 37�C for 1 h. After cell attachment,discs were flooded with 2ml of media. As a control, cellswere also seeded into 8-chamber plastic slides at anequivalent density to those on the metal discs. Cells wereincubated overnight, then washed twice with serum-freea-MEM and fixed with 4% paraformaldehyde for20min. The discs were then washed 3 times with PBSbefore being blocked for 1 h with 1ml of 2.5% goatserum in PBS. After washing with PBS as above, thecells were permeabilised with 1ml of 0.5% (v/v) TritonX-100 for 5min on ice. Cells were washed again andincubated with 150 ml of phalloidin-TRITC (SigmaChemical Co., St. Louis, MO, USA) at 10 mg/ml for1 h at room temperature in the dark. Cells were thenwashed and incubated with 0.8mg/ml 40, 6-diamidine-20-phenylindole dihydrochloride (DAPI, Roche Diagnos-tics, Castle Hill, NSW, Australia) in PBS for 15min at37�C. After washing the cells again in PBS they werefixed with 1ml of FACS fix (PBS+10% formalin, 20%d-glucose and 0.2% sodium azide) for 10min at roomtemperature, covered with coverslips and sealed withnail polish. Images were captured using the BioRadRadiance confocal miscoscope (Bio-Rad MicroscienceLtd., UK) equipped with three lasers, Argon ion 488 nm(14mW); Green HeNe 543 nm (1.5mW): Red Diode637 nm (5mW) outputs and Olympus IX70 invertedmicroscope. The objective used was a 40� UPLAPOwith NA=1.5 water. Phalloidin was excited with GreenHeNe 543 nm laser line and the emission was viewedthrough a long pass barrier filter (E570P). The imagedata were stored on a CD for further analysis usingConfocal Assistants software (Todd Clarke Brelje,USA).

2.5. Proliferation rate of cells

Cell proliferation was measured at days 3 and 7, usingtwo different methods: manual cell counting andstaining with the cell permeant dye, carboxyfluoresceinsuccinimidyl ester (CFSE), which partitions equallybetween daughter cells at each cell division [25]. Formeasurement of cell number by manual cell counting,cells were removed from the various surfaces withtrypsin and washed with complete media. An improvedNeubauer chamber was used to count cells, in triplicate.

Cell proliferation was also measured by irreversiblylabelling NHBC with CFSE, as we have previouslydescribed [26]. Cells were harvested and resuspended in1ml PBS/0.1% BSA, at room temperature. CFSE wasthen added to the cells and incubated at 37�C for10min. Staining was quenched by adding ice-cold media(a-MEM+ 10% FCS) and incubating on ice for 10min.The cells were then washed with media and resuspendedat a cell concentration of 2� 105 cells/ml. Four hundredmicrolitres of cell suspension was then pipetted onto themetal discs so that a liquid ‘bubble’ was formed and asmuch of the surface as possible was covered. The cellswere then incubated in a humid chamber at 37�C for 1 hto allow cell attachment to the metal surfaces beforewells were flooded with 2ml of media and furtherincubated for the times indicated.

Further analysis of the CFSE-labelled NHBC wasachieved by staining with the monoclonal antibodySTRO-1, as we have previously described [26]. For this,labelled cells were resuspended in 200 ml of blockingbuffer (10% normal rabbit serum, 5% BSA in PBS,0.1% sodium azide) containing STRO-1 antibody, orisotype-matched negative control antibody (1A6.12),and were incubated on ice for 1 h. Cells were thenwashed 3 times with Hank’s medium containing 10mm

Hepes and 0.1%w/v BSA (HHF) and incubated with a1/50 dilution of goat anti-mouse IgM (m-chain specific)phycoerythrin (PE) secondary antibody (SouthernBiotechnology Associates, Birmingham, AL) for45min on ice. The cells were again washed 3 times withHHF and fixed with 400 ml of FACS fix. Fluorescence-activated cell sorting (FACS) analysis, using a FAC-StarPLUS flow cytometer (Becton Dickinson, Sunnyvale,CA, USA), was used to determine the number of celldoublings that had occurred. Data generated wereanalysed using ModFit LT 2 software or Winmdisoftware (Becton Dickinson, Sunnyvale, CA, andUSA), as we have described previously [26].

2.6. Expression of osteogenic and osteoclastogenic genes

To determine the expression of mRNA species thatcorrespond to the pro-osteoclastogenic and the osteo-genic activity of osteoblasts, cells were lysed using 1mlper 1� 106 cells of TRIzol reagent (Life TechnologiesInc., Gaithersburg, MD, USA). Total RNA wasprepared from the dissolved cells, as per manufacturer’sinstructions.

First strand complementary DNA (cDNA) wassynthesised from 1 mg of total RNA from each sample,using a cDNA synthesis kit, as per manufacturer’sinstructions (Promega Corp., Madison, WI, USA).cDNA was then amplified by PCR to generate productscorresponding to mRNA encoding human gene pro-ducts listed in Table 1. The 20 ml amplification mixturecontained 1 U of AmpliTaq Gold DNA polymerase

ARTICLE IN PRESS

Table 1

Human sequence-specific oligonucleotide primers, designed on the basis of published sequences, and predicted PCR product sizes

Target gene Primer sequence (50–30) Annealing

temperature (�C)

Expected product

size (bp)

GAPDH S CACTGACACGTTGGCAGTGG 62 414

AS CATGGAGAAGGCTGGGGCTC

IL-11 S CACATGAACTGTGTTTGCCGCCTGG 62 291

AS TTGTCAGCACACCTGGGAGCTGTAG

RANKL S AATAGAATATCAGAAGATGGCACTC 62 668

AS TAAGGAGGGGTTGGAGACCTCG

OPG S TGCTGTTCCTACAAAGTTTACG 62 435

AS CTTTGAGTGCTTTAGTGCGTG

TNF-a S TCAGATCATCTTCTCGAACC 62 361

AS CAGATAGATGGGCTCATACC

Col-1 S AGGGCTCCAACGAGATCGAGATCCG 62 222

AS TACAGGAAGCAGACAGGGCCAACGTCG

OCN S ATGAGAGCCCTCACACTCCTC 62 289

AS CGTAGAAGCGCCGATAGGC

BSP-1 S TCAGCATTTTGGGAATGGCC 62 657

AS GAGGTTGTTGTCTTCGAGGT

CBFA1 S GtGGACGAGGCAAGAGTTTCA 62 632

AS TGGCAGGTAGGTGTGGTAGTG

Key: S, sense sequence; AS, antisense sequence; BP, base pairs.

D.M. Findlay et al. / Biomaterials 25 (2004) 2215–22272218

(Perkin Elmer, Norwalk, CT, USA), 100 ng each of the50 and 30 primers, 0.2mm dNTPs (Pharmacia Biotech,Uppsala, Sweden), 1.5mm MgCl2, 2 ml 10� reactionbuffer, and sterile DEPC–H2O. PCR was performed for23 cycles for GAPDH and 30–35 cycles for other primerpairs, such that all products could be assayed in theexponential phase of the amplification curve, in athermal cycler (Corbett Research, Melbourne, Vic.,Australia). After an initial step at 95�C for 9min toactivate the polymerase, each cycle consisted of 1min ofdenaturation at 94�C, 1min of annealing at thetemperatures indicated in Table 1, and 1min ofextension at 72�C. This was followed by an additionalextension step at 72�C for 1min. Human sequence-specific oligonucleotide primers, designed on the basis ofpublished sequences, were obtained from Life Technol-ogies, Gaithersburg, MD, USA. Primer sequences andpredicted PCR product sizes are shown in Table 1.Amplification products were resolved by electrophoresison a 2%w/v agarose gel and post stained with SYBR-1Gold (Molecular Probes, Eugene, OR, USA). Therelative amounts of the PCR products were determinedby quantitating the intensity of bands using a Fluor-Imager/Typhoon and ImageQuant software (MolecularDynamics, Sunnyvale, CA, USA). Amplified productscorresponding to OCN, OPG, RANKL, BSP-1, IL-11,

TNF-a, COL-1 and CBFA-1 mRNA are represented asa ratio of the respective PCR product/glyceraldehyde 3-phosphate dehydrogenase (GAPDH) PCR product. Toshow that there were no false-positive results, PCRreactions were carried out on reaction mixtures to whichno cDNA was added [27].

2.7. Expression of secreted OPG

Secreted OPG levels in culture supernatants, in mediaharvested from cells grown for 7 days on each substratein the proliferation experiments, were measured by anenzyme-linked immunoassay (ELISA). Nunc Maxisorp96-well ELISA plates were coated with 2 mg/ml captureantibody (monoclonal anti-human OPG Ab, MAB8051R&D Systems Inc Minneapolis, MN, USA), sealed andincubated overnight at room temperature. Plates werewashed 5 times with wash buffer (phosphate bufferedsaline (PBS) pH 7.4 with 0.05% Tween 20) and thenincubated with 100 ml/well blocking buffer (PBS pH 7.4with 1% BSA) for 1 h. Recombinant human OPG(Peprotech, Rocky Hill, NJ, USA) standards wereprepared by serial dilution of a 1mg/ml stock in media(a-MEM+10% FCS), and these and culture super-natants (diluted 1:10) were incubated on the plate for 2 hat room temperature before washing 3 times in wash


buffer. The detection antibody (biotinylated anti-humanOPG Ab, Cat. No. BAF805, R&D Systems Inc.),diluted in TBS pH 7.3 containing 0.1% BSA, was thenadded to each well and incubated for 2 h at roomtemperature. After washing, streptavidin conjugated tohorseradish peroxidase (Pierce, Rockford, IL, USA)diluted in blocking buffer was added to each well andincubated for 20min at room temperature. Substratesolution was added to each of the wells and allowed todevelop for 15mins. The reaction was stopped using0.5m sulphuric acid and the OD450nm was measured.Concentrations of the test samples were then calculatedusing a standard curve.

2.8. Mineralisation in vitro

To determine the ability of NHBC to form miner-alised matrix, a method reported previously [16] wasmodified to accommodate the use of the metal discs. Thedonor NHBs were cultured in triplicate (8� 104 cells/disc) on the various surfaces in a-MEM supplementedwith 20% FCS, l-glutamine (2mm), l-ascorbate 2-phosphate (100 mm), dexamethasone sodium phosphate(10�8

m), KH2PO4 (1.8mm), and HEPES (10mm) at37�C, 5% CO2. Medium was replaced twice weekly andincubation continued for periods of up to 7 weeks beforemeasurement of cell layer-associated Ca2+ levels.

2.9. Measurement of calcium levels

Calcium levels in the cell layer were determined fromtriplicate cultures at 2, 4, and 7 weeks [6]. The cultureswere first washed 3 times with Ca2+- and Mg2+-freePBS and calcium was then extracted using 0.6m HCl.Calcium standards were made using a 2mm and 1mm

CaCl2 stock to create a standard curve. Standards andsupernatants from cells grown on the various substrates(each 25 ml) at the different time points were placed in a96 well plates. Calcium levels were measured in acolorimetric assay using the cresolphthalein method, asper manufacturer’s instructions (TRACE Laboratories,Melbourne, VIC, Australia), and the absorbance at570 nm was measured on a MR7000 microplate reader(Dynatech Laboratories, Guernsey, Channel Islands).

3. Results

3.1. Surface characterisation of discs by AFM

AFM images of the six different cell culture discsurfaces (polished and microtextured for each of thethree metals) are illustrated in Figs. 1A–F. Roughnessmeasurements of the AFM information yielded rootmean square (RMS) values of the surface topographies,as shown in Table 2. The CVD process resulted in a

substantially rougher surface on the Ta discs comparedwith the polished Ta surface (1.12 mm versus 0.29 mm).For the Ti and Co–Cr discs, there were smallerdifferences in overall surface roughness caused by thediffusion bonding and sintering heat treatments.

3.2. Cell attachment to discs

3.2.1. Cell morphology on tantalum

Confocal microscopy showed that the human osteo-blast-like cells attached and spread on each of thesubstrates. Interestingly, the morphology of the cells wasnot obviously different when adherent to any of thethree metals and the surface texture of the metals did notmarkedly influence cell adherence or shape (Fig. 2). Inall cases, cells assumed the elongated, fibroblasticappearance typical of osteoblast-like cells plated ontotissue culture plastic.

3.2.2. Cell attachment kinetics

Experiments were performed using NHBC from threedonors. The rate of attachment to each of the substrateswas tested, with observations made at 30min, 1 and 2 h.The results for cells from one donor show that cellattachment to each of the substrates occurred rapidly,with approximately 58%, 70% and 80% of the inputcells attached to tissue culture plastic by 30min, 1 and2 h, respectively (Fig. 3). Attachment to each of theother substrates was at least as fast as on plastic and thiswas true for cells from each of the donors tested. By 2 h,no consistent differences were seen between the numberof cells adherent to any of the substrates, and there wasno evidence that attachment rate or extent wasdependent on the surface characteristics of the metalsubstrates. The results therefore indicate that, in theserum replete conditions used for these experiments,human osteoblast-like cells have a high avidity for Ta,which is similar to that for Ti or CoCr, as well as tissueculture plastic.

3.3. Cell proliferation

Cell proliferation was followed for 7 days, quantitat-ing both cell number and number of cell doublings atday 3 and day 7. Fig. 4 shows proliferation, in terms ofthe number of cells on each of the substrates, for cellsderived from one donor (Fig. 4A) and pooled data fromexperiments with 3 donors (Fig. 4B). Fig. 4 alsoindicates the cell number in the presence of colchicine,a cytoskeletal disruptor that prevents cell division,which indicates the input cell number. It can be seenthat cell number increased approximately 4-fold over a 7day culture, and this was not different for cells on any ofthe substrates. In addition, there was no evidence thatproliferation rate was dependent on the surface char-acteristics of the metal substrates. The results therefore

ARTICLE IN PRESS

Table 2

RMS values for polished versus microtextured surfaces

Surface RMS value (mm)

Ta polished 0.29

Ta CVD 1.12

Ti polished 0.37

Ti diffusion bonded 0.51

CoCr polished 0.09

CoCr sintered 0.21

Fig. 1. Atomic force micrographs. Discs were examined with AFM to provide qualitative and quantitative information on the surface topography of

the polished and microtextured metal surfaces. (A) TaP, polished tantalum; (B) TaCVD, chemical vapour deposition Ta; (C) TiP, polished titanium;

(D) TiDB, diffusion bonded Ti; (E) CoCrP, polished cobalt chrome; (F) CoCrDB, diffusion bonded cobalt chrome.


indicated that, in the serum replete conditions used forthese experiments, human osteoblast-like cells canattach and grow on polished and microtextured Ta, aswell as Ti and CoCr, and can do so to a similar extent ason tissue culture plastic.

In order to more sensitively determine the effects ofthe different substrates on cell growth, we adapted asystem that enabled the simultaneous tracking of celldivision and changes in the expression of the pre-

osteoblast cell surface marker, STRO-1, as we haverecently published [26]. The cell permeant fluorescentdye carboxyfluorescein succinimidyl ester (CFSE) allowsthe number of divisions of a labelled cell population tobe tracked by flow cytometry, as daughter cells eachreceive half of the CFSE of the parent cell [25]. Asignificant advantage of using this technique is that cellgrowth, in relation to changes in phenotype, can bemonitored in specific sub-populations, whereas moreconventional techniques measure only the averagenumber of cell divisions. Cells were simultaneouslystained for STRO-1 expression to determine whether thesubstrates might influence the degree of maturation ofhuman osteoblasts and whether there might be substratedependent changes in proliferation rate within sub-populations of these cells.

Fig. 5 shows the result of an experiment using cellsderived from one donor, of the data derived by CFSE/STRO-1 staining, after growth on plastic, polished Ta orTa CVD for 7 days. At day 3, cells were distributed

ARTICLE IN PRESS

Fig. 2. Confocal microscopy of human osteoblast-like cells plated

onto the substrates indicated. Cells on the various substrates were

stained with phalloidin and DAPI to enable fluorescent imaging of the

actin cytoskeleton or nuclei, respectively. Microphotographs are of

typical fields and were obtained, as described in the Methods, at 40�magnification. Images of cells from one donor show normal cell

morphology and indicate that the nuclei were not apoptotic. (A) TaP,

polished tantalum; (B) TaCVD, chemical vapour deposition Ta; (C)

TiP, polished titanium; (D) TiDB, diffusion bonded Ti; (E) CoCrP,

polished cobalt chrome; (F) CoCrDB, diffusion bonded cobalt

chrome; (G) Pl, tissue culture polystyrene plastic. Cells from two

other donors were morphologically similar.

0

0.2

0.4

0.6

0.8

1

TiP TiDB CoCrP

CoCrDB

TaP TaCVD

Pl

Ab

sorb

ance

(57

0nm

) 30 mins

0

0.2

0.4

0.6

0.8

1

TiP TiDB CoCrP

CoCrDB

TaP TaCVD

Pl

Ab

sorb

ance

(57

0nm

) 60 mins

0

0.2

0.4

0.6

0.8

1

TiP TiDB CoCrP

CoCrDB

TaP TaCVD

Pl

Ab

sorb

ance

(57

0nm

)120 mins

Fig. 3. Attachment of human osteoblast-like cells to tantalum and

other substrates. Cells (2� 104) from one donor were plated onto each

of the substrates and allowed to adhere for 30, 60 or 120min. Cell

attachment at each time was quantitated as described in the Methods.

Results are means7SEM of three determinations. The results indicate

similar rates of attachment of cells onto each of the substrates, with

approximately 80% of cells adherent after 120min. TiP, polished

titanium; TiDB, diffusion bonded Ti; CoCrP, polished cobalt chrome;

CoCrDB, diffusion bonded cobalt chrome; TaP, polished tantalum;

TaCVD, chemical vapour deposition Ta; Pl, tissue culture polystyrene

plastic. Results obtained for cells from two other donors gave

qualitatively similar results.

D.M. Findlay et al. / Biomaterials 25 (2004) 2215–2227 2221

between populations that had undergone 0, 1 or 2divisions (not shown) and by day 7 cells had undergone0–5 populations (Fig. 5). It was found that Ta metal ineither form delayed cell division slightly at both day 3

and 7. There were no striking differences in the numberof cell divisions, based on STRO-1 status. Thus, itappeared that, while Ta reduced slightly the entry ofcells into cell cycle, it did not influence the distributionof cells between less mature (STRO-1+) and moremature (STRO-1�) populations. The percentage of cellsthat had undergone each number of doublings wasquantitated and the data from three donors was pooled.The pooled data for day 3 is shown in Fig. 6A and forday 7 in Fig. 6B and indicate a slightly greaterpercentage of cells in the parental (no divisions) poolfor cells on Ta than for cells on plastic, and acorrespondingly greater number of cells on plastic

ARTICLE IN PRESS

0

5

10

15

20

Cel

l nu

mb

er (

x104 )

Cel

l nu

mb

er (

x104 )

Day 3 Day 7

Day 3 Day 7

0

5

10

15

20

TiP TiDB CoCr

P

CoCr

DB

TaP Ta

CVD

Pl Col

TiP TiDB CoCr

P

CoCr

DB

TaP Ta

CVD

Pl Col

(A)

(B)

Fig. 4. Proliferation of human osteoblast-like cells to tantalum and other substrates. Cells (8� 104) were plated onto each of the substrates and

incubated on the various substrates for 3 days or 7 days. Relative cell numbers at each time were quantitated as described in the Methods. Results are

means 7SEM of three determinations and are shown for cells from one donor (A) and for the pooled data of cells from three donors (B). TiP,

polished titanium; TiDB, diffusion bonded Ti; CoCrP, polished cobalt chrome; CoCrDB, diffusion bonded cobalt chrome; TaP, polished tantalum;

TaCVD, chemical vapour deposition Ta; Pl, tissue culture polystyrene plastic; Col, colchicine added to cells on plastic to represent non-proliferating

cells.


having divided once. Although seen consistently, thesedifferences for Ta, compared with plastic, did notreach significance. No important differences were foundwhen the data for cells on each of the substrates wasplotted (not shown). Thus, neither the absolute cellnumbers, nor the number of cell divisions, wassignificantly different on any of the substrates by day7 of culture.

3.4. Expression of osteogenic and osteoclastogenic genes

The expression of the following genes was investi-gated using RT/PCR: The osteoblast transcriptionfactor CBFA1; the osteoblast extracellular matrixproteins, COL-1 and OCN; the osteoblast cytokineproducts IL-11, TNF-a, RANKL, and OPG, the naturalantagonist of RANKL. These genes were expresseddifferently by cells of different donors plated ondifferent substrates for 3 or 7 days. However, therewere no consistent, substrate-dependent differences inthe expression of these genes. In particular, geneexpression of cells on the Ta substrates was very similarto that seen on tissue culture plastic. Data for cells

derived from one donor, plated on the differentsubstrates for 7 days, are shown in Fig. 7A–H. OPGprotein levels in the media collected from cells platedon the different substrates for 7 days were determinedby ELISA. There were no consistent or significantdifferences between substrates for this parameter, whichwas typically between 0.5 and 0.8 ng/ml (data notshown).

3.5. In vitro mineralisation potential of human OB on

metal substrates

NHBC from the three donors tested were found tomineralise at very different rates, as shown in Fig. 8A,which indicates the rate of accumulation of cell layercalcium over 7 weeks, for cells grown on plastic. Themineralisation data for cells derived from one donor,which accumulated most calcium in the cell layer, areshown in Fig. 8B. Small differences in the extent ofmineralisation at 7 weeks were seen for cells on thedifferent substrates and growth on the two forms of Taresulted in the greatest accumulation, although thisdifference did not achieve significance.

ARTICLE IN PRESS

Fig. 5. Cell division of human osteoblast-like cells on TaP and

TaCVD, compared with tissue culture plastic. Cells (2� 106) were

stained with CFSE, as described in the Methods, and incubated on

the various substrates for 7 days. Cells were then stained with the

antibody, STRO-1 and FACS analysis was performed to determine the

percentages of STRO-1+ and STRO-1� cells, respectively, that

remained undivided ( ) or had undergone 1, 2, 3, 4 or 5 divisions

(histograms from right to left) in each panel. The pooled data for cells

from three donors grown on Ta P, Ta CVD and Pl is presented in

Fig. 6B. TaP, polished tantalum; TaCVD, chemical vapour deposition

Ta; Pl, tissue culture polystyrene plastic.


4. Discussion

Tantalum (Ta) is a metal that has recently gainedinterest for a variety of orthopaedic implant applicationsbecause of its formulation in a porous trabecular-likestructure that is well suited for mechanical attachmentby the ingrowth of bone [19,20]. The porous form of Tareportedly offers several advantages over conventionalporous implant materials by its uniformity and structur-al continuity, strength to weight ratio, low structural

stiffness, high porosity, and high coefficient of friction[28]. Although animal studies have indicated goodbioactivity of Ta, similar to other common orthopaedicmetals [29], the interaction of osteoblasts with Ta, and inparticular the effects of Ta on the phenotype andfunction of human osteoblasts, has not previously beeninvestigated. This would seem important in view of thevery high porosity and surface area of the new porousTa implant biomaterial.

Many studies have used clonal osteoblast-like celllines to study the effect of biomaterials on osteoblasts,whereas our approach was to perform studies in primaryhuman osteoblasts derived from multiple human do-nors. The former approach ensures less variability in theresults; however, it is our experience that humanosteoblasts from different donors do show individualdifferences and we considered that experiments designedto test the biocompatibility of biomaterials should takethis variability into account. Although there was clearlydonor-to-donor variability, the results of this studyindicate that Ta is a suitable material for humanosteoblast growth and differentiated function. This issupported by the initial cell attachment to Ta, and cellmorphology on Ta, being not different from tissueculture plastic, which represents the experimental ‘‘goldstandard’’ for investigation of osteoblast biology in vitro.In addition, similar growth rate of cells on Ta as on theother substrates tested, and similar expression of anumber of genes associated with osteoblastic function,was observed. In the present study, no importantsubstrate dependent differences were recorded, althoughvarious donor-dependent differences were seen, particu-larly at the level of expression of some mRNA species.Investigation of osteoblast behaviour on Ta CVD wasimportant because this microtextured form of the metalis used in porous implant applications [19]. Interestingly,cells behaved similarly on this surface as on polished Taor plastic, suggesting that Ta CVD should allow faithfulexpression of the osteoblast phenotype when implantedsurgically.

The results reported for the present studies are largelyconsistent with other studies of osteoblasts on ortho-paedic implant metals. Similar results to those reportedhere for Ti and CoCr were found when responses ofneonatal rat calvarial osteoblasts to a variety oforthopaedic implant materials were compared in vitro.Cell attachment, proliferation, and collagen synthesiswere similar on 316L stainless steel, Ti–6Al–4V, Co–Cr–Mo, PMMA, borosilicate glass, and tissue culturepolystyrene substrates, while hydroxyapatite altered celladhesion and growth [30]. Our results are also consistentwith those reported for the growth of rat calvarialosteoblasts on two forms of titanium (commerciallypure Ti and Ti–6Al–4V alloy), compared with tissueculture plastic [31]. In that work, phenotypic expressionof the bone markers, alkaline phosphatase and

ARTICLE IN PRESS

Fig. 6. Cell division of human osteoblast-like cells on TaP and TaCVD, compared with tissue culture plastic. Cells (2� 106) were stained with CFSE,

as described in the Methods, and incubated on the various substrates for (A) 3 or (B) 7 days. Cells were then stained with STRO-1 antibody and

FACS analysis was performed to determine the percentages of STRO-1+ and STRO-1� cells, respectively, that remained undivided (parental) or had

undergone 1 (D1), 2 (D2), etc., divisions. (A) Means7SD of the pooled quantitated data for cells from three donors, at day 3. (B) Means7SD of the

pooled quantitated data for cells from three donors, at day 7. TaP, polished tantalum; TaCVD, chemical vapour deposition Ta; Pl, tissue culture

polystyrene plastic.


osteocalcin were not different between the substrates,nor was the degree of cell layer mineralisation achievedin the cultures. Spyrou et al. [32] found that the humanSaOS-2 osteosarcoma cells, described as osteoblast-like,expressed a number of cytokines in a substrate-dependent manner when plated onto several variationsof Ti and Ti alloys. In contrast, OPG expression wasvery similar on each of the substrates and on tissueculture plastic. Somewhat different results from ourswere reported from a recent study of the human fetalosteoblast cell line, 1.19, which displayed lower growthrates on CoCrMo and stainless steel than on tissueculture plastic, whereas cells on titanium grew at anidentical rate to those on plastic [33]. Measures of celldifferentiation showed only small differences in thismodel, although osteocalcin production was signifi-cantly greater on titanium than on plastic, after

particular times in culture. As in the present study, thedifferences in cell behaviour did not relate to the surfaceroughness of the substrates. This might have beenexpected, with the possible exception of the Ta CVDsubstrate, because all the surfaces were relatively smoothwhether polished or heat-treated. Previous in vitrostudies have shown that osteoblasts are more responsiveto irregular surfaces than smooth surfaces (RMSo0.5 mm) but only if the RMS roughness is greaterthan about 1 mm [34–39]. The Ta CVD surface possesseda surface roughness that was just at this threshold.

A further explanation for the lack of difference in cellbehaviour in the present report is that, despite differ-ences in chemistry and topography, the substrates wereconditioned, both by the serum proteins used in themedia and by the cells themselves producing extra-cellular matrix proteins that in turn govern the

ARTICLE IN PRESS

Fig. 8. Mineralisation of the cell layer of human osteoblast-like cells

on Ta and other substrates. Cells (8� 104) from each of the donors

were grown on each substrate for 7 weeks, as described in the Methods.

Cell layer calcium was measured at the times indicated. (A) The time

course of mineralisation for cells from each donor grown on plastic.

(B) Time course of mineralisation for cells from one donor on each of

the substrates. Results are means7SEM of three determinations. TiP,

polished titanium; TiDB, diffusion bonded Ti; CoCrP, polished cobalt

chrome; CoCrDB, diffusion bonded cobalt chrome; TaP, polished

tantalum; TaCVD, chemical vapour deposition Ta; Pl, tissue culture

polystyrene plastic.

Fig. 7. Gene expression of human osteoblast-like cells on Ta and other

substrates. Cells were grown for 7 days on each of the substrates,

before extraction of RNA, as described in the Methods. RNA was then

subjected to semiquantitative RT/PCR analysis to determine the

expression of the indicated mRNA species, relative to cells cultured on

plastic. Results were quantitated by assigning the PCR product

obtained from cells on plastic the value of 1, and expressing all other

values relative to 1. TiP, polished titanium; TiDB, diffusion bonded Ti;

CoCrP, polished cobalt chrome; CoCrDB, diffusion bonded cobalt

chrome; TaP, polished tantalum; TaCVD, chemical vapour deposition

Ta; Pl, tissue culture polystyrene plastic.


osteoblastic differentiation [11–15,40]. This suggestion isperhaps supported by a report that compared theattachment and proliferation of rat fibroblasts andUMR 106.01 osteoblast-like cells to biomaterials,including Ti 318 alloy and CoCrMo alloy. This studyfound significant substrate-dependent effects on thegrowth of fibroblasts, so that growth on Ti and CoCrwas reduced by more than one third. In contrast, theosteoblast-like cells were essentially unaffected by any ofthe substrates. In addition, although major effects onmorphology and behaviour of cells, including osteo-blasts, due to the surface roughness of the substrate,have been reported [41,42], these effects are clearlydependent on the degree of roughness and, again,

osteoblasts may be more tolerant of surface texturethan other cells. For example, cell morphology, orienta-tion, proliferation and adhesion of human gingivalepithelial cells in primary or secondary culture wereshown to be dependent on the texture of the titaniumsurface, whereas, in the same study, no such differenceswere observed for maxillar osteoblast-like cells [43].

The findings of the present study relate to humanosteoblast-like cells plated onto solid Ta and othermetals commonly used in orthopaedic devices. Asindicated above, Ta has the unique property, comparedwith other orthopaedic metals, of being suitable for theproduction of porous trabecular-like structures usingCVD techniques. It will be of great interest to performsimilar studies on these three-dimensional porous Tamaterials, now being used in orthopaedic applications,since evidence to date suggests excellent replication of

ARTICLE IN PRESSD.M. Findlay et al. / Biomaterials 25 (2004) 2215–22272226

in vivo cell behaviour when cells of various types arecultured in this material (for example, [44]). It will alsobe important to consider the effect of particulate formsof Ta on human osteoblasts and other bone cells. Todate, there is evidence that high concentrations of Taparticulates can decrease the viability of osteoblast-likecells in culture [45]. We [44,46], and others [45] haveobtained abundant evidence that wear particles gener-ated from prosthetic materials, and the dissolved ions ofsome metals, have important bioactivities. Importantly,some of these effects lead to bone erosion around metalimplants, and eventually a loss of fixation in the bone[47,48].

To conclude, this study found minor differencesbetween cells from different donors. However, attach-ment of cells to Ta was similar to that on plastic and theother orthopedic substrates, as was cell morphology.The cell proliferation rate was slightly faster on plasticthan on Ta but no consistent, substrate-dependentdifferences were seen in gene expression in the humanosteoblasts. No substrate-dependent differences wereseen in the extent of in vitro mineralisation by NHBC.These results indicate that solid Ta is a good substratefor the attachment, growth and differentiated functionof human osteoblasts.

Acknowledgements

This work was supported by a grant from ZimmerInc. GJA was supported by the National Health andMedical Research Council of Australia.

References

[1] Gronthos S, Graves SE, Ohta S, Simmons PJ. The STRO-1+

fraction of adult human bone marrow contains the osteogenic

precursors. Blood 1994;84:4164–73.

[2] Lian JB, Stein GS. Osteoblast biology. In: Marcus R, Feldman D,

Kelsey J, editors. Osteoporosis. San Diego: Academic Press; 1996.

p. 23–59.

[3] Martin TJ, Ng KW. Mechanisms by which cells of the osteoblast

lineage control osteoclast formation and activity. J Cell Biochem

1994;56:357–66.

[4] Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ,

Riggs BL. The roles of osteoprotegerin and osteoprotegerin

ligand in the paracrine regulation of bone resorption. J Bone

Miner Res 2000;15:2–12.

[5] Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K,

Fujise N, Sato Y, Goto M, Yamaguchi K, Kuriyama M, Kanno

T, Murakami A, Tsuda E, Morinaga T, Higashio K. Identity of

osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin

(OPG): a mechanism by which OPG/OCIF inhibits osteoclasto-

genesis in vitro. Endocrinology 1998;139:1329–37.

[6] Gronthos S, Zannettino AC, Graves SE, Ohta S, Hay SJ,

Simmons PJ. Differential cell surface expression of the STRO-1

and alkaline phosphatase antigens on discrete developmental

stages in primary cultures of human bone cells. J Bone Miner Res

1999;14:47–56.

[7] Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi

K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M,

Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T. Targeted

disruption of Cbfa1 results in a complete lack of bone formation

owing to maturational arrest of osteoblasts. Cell 1997;89:755–64.

[8] Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC,

Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR,

Selby PB, Owen MJ. Cbfa1, a candidate gene for cleidocranial

dysplasia syndrome, is essential for osteoblast differentiation and

bone development. Cell 1997;89:765–71.

[9] Takeuchi Y, Watanabe S, Ishii G, Takeda S, Nakayama K,

Fukumoto S, Kaneta Y, Inoue D, Matsumoto T, Harigaya K,

Fujita T. Interleukin-11 as a stimulatory factor for bone

formation prevents bone loss with advancing age in mice. J Biol

Chem 2002;277:49011–8.

[10] Shaughnessy SG, Walton KJ, Deschamps P, Butcher M, Beaudin

SM. Neutralization of interleukin-11 activity decreases osteoclast

formation and increases cancellous bone volume in ovariecto-

mized mice. Cytokine 2002;20:78–85.

[11] Adams JC, Watt FM. Regulation of development and differ-

entiation by the extracellular matrix. Development 1993;117:

1183–98.

[12] Traianedes K, Ng KW, Martin TJ, Findlay DM. Cell substratum

modulates responses of preosteoblasts to retinoic acid. J Cell

Physiol 1993;157:243–52.

[13] Southey MC, Findlay DM, Kemp BE. Regulation of membrane-

associated tyrosine phosphatases in UMR 106.06 osteoblast-like

cells. Biochem J 1995;305:485–90.

[14] Traianedes K, Findlay DM, Martin TJ, Gillespie MT. Modula-

tion of the signal recognition particle 54-kDa subunit (SRP54) in

rat preosteoblasts by the extracellular matrix. J Biol Chem 1995;

270:20891–4.

[15] Traianedes K, Martin TJ, Findlay DM. Regulation of osteopon-

tin expression by type I collagen in preosteoblastic UMR201 cells.

Connect Tissue Res 1996;34:63–74.

[16] Celic S, Chilco PJ, Zajac JD, Martin TJ, Findlay DM. A type I

collagen substrate increases PTH/PTHrP receptor mRNA ex-

pression and suppresses PTHrP mRNA expression in UMR106-

06 osteoblast-like cells. J Endocrinol 1996;150:299–308.

[17] Zreiqat H, Howlett CR. Titanium substrata composition influ-

ences osteoblastic phenotype: in vitro study. J Biomed Mater Res

1999;47:360–6.

[18] Zreiqat H, Evans P, Howlett CR. Effect of surface chemical

modification of bioceramic on phenotype of human bone-derived

cells. J Biomed Mater Res 1999;44:389–96.

[19] Bobyn JD, Stackpool GJ, Hacking SA, Tanzer M, Krygier JJ.

Characteristics of bone ingrowth and interface mechanics of a

new porous tantalum biomaterial. J Bone Jt Surg Br 1999;81:

907–14.

[20] Bobyn JD, Toh KK, Hacking SA, Tanzer M, Krygier JJ. Tissue

response to porous tantalum acetabular cups: a canine model.

J Arthroplasty 1999;14:347–54.

[21] Hacking SA, Bobyn JD, Toh K, Tanzer M, Krygier JJ. Fibrous

tissue ingrowth and attachment to porous tantalum. J Biomed

Mater Res 2000;52:631–8.

[22] Hogan ME, Degaetano DH, Klomparens KL. Effects of substrate

texture and curvature on the morphology of cultured cells.

J Electron Microsc Technol 1991;18:106–16.

[23] Hacking SA, Tanzer M, Harvey EJ, Krygier JJ, Bobyn JD.

Relative contributions of chemistry and topography to the

osseointegration of hydroxyapatite coatings. Clin Orthop

2002;405:24–38.

[24] Evdokiou A, Bouralexis S, Atkins GJ, Chai F, Hay S, Clayer M,

Findlay DM. Chemotherapeutic agents sensitize osteogenic

sarcoma cells, but not normal human bone cells, to Apo2L/

TRAIL-induced apoptosis. Int J Cancer 2002;99:491–504.


[25] Lyons AB, Hasbold J, Hodgkin PD. Flow cytometric analysis of

cell division history using dilution of carboxyfluorescein diacetate

succinimidyl ester, a stably integrated fluorescent probe. In:

Methods in cell biology, vol. 63. New York: Academic Press;

2001.

[26] Atkins GJ, Kostakis P, Pan B, Farrugia A, Gronthos S, Evdokiou

A, Harrison K, Findaly DM. Zannettino ACW: RANKL

expression is related to the differentiation state of human

osteoblasts. J Bone Miner Res 2003;89:206–14.

[27] Atkins GJ, Haynes DR, Graves SE, Evdokiou A, Hay S,

Bouralexis S, Findlay DM. Expression of osteoclast differentia-

tion signals by stromal elements of giant cell tumors. J Bone

Miner Res 2000;15:640–9.

[28] Cohen R. A porous tantalum trabecular metal: basic science. Am

J Orthop 2002;31:216–7.

[29] Matsuno H, Yokoyama A, Watari F, Uo M, Kawasaki T.

Biocompatibility and osteogenesis of refractory metal implants,

titanium, hafnium, niobium, tantalum and rhenium. Biomaterials

2001;22:1253–62.

[30] Puleo DA, Holleran LA, Doremus RH, Bizios R. Osteoblast

responses to orthopedic implant materials in vitro. J Biomed

Mater Res 1991;25:711–23.

[31] Keller JC, Stanford CM, Wightman JP, Draughn RA, Zaharias

R. Characterizations of titanium implant surfaces. III. J Biomed

Mater Res 1994;28:939–46.

[32] Spyrou P, Papaioannou S, Hampson G, Brady K, Palmer RM,

McDonald F. Cytokine release by osteoblast-like cells cultured on

implant discs of varying alloy compositions. Clin Oral Implants

Res 2002;13:623–30.

[33] Hendrich C, Noth U, Stahl U, Merklein F, Rader CP, Schutze N,

Thull R, Tuan RS, Eulert J. Testing of skeletal implant surfaces

with human fetal osteoblasts. Clin Orthop 2002;394:278–89.

[34] Bigerelle M, Anselme K, Noel B, Ruderman I, Hardouin P, Iost

A. Improvement in the morphology of Ti-based surfaces: a new

process to increase in vitro human osteoblast response. Biomater-

ials 2002;23:1563–77.

[35] Bowers KT, Keller JC, Randolph BA, Wick DG, Michaels CM.

Optimization of surface micromorphology for enhanced osteo-

blast responses in vitro. Int J Oral Maxillofac Implants

1992;7:302–10.

[36] Groessner-Schreiber B, Tuan RS. Enhanced extracellular matrix

production and mineralization by osteoblasts cultured on

titanium surfaces in vitro. J Cell Sci 1992;101:209–17.

[37] Keller JC. Tissue compatibility to different surfaces of dental

implants: in vitro studies. Implant Dent 1998;7:331–7.

[38] Kieswetter K, Schwartz Z, Hummert TW, Cochran DL, Simpson

J, Dean DD, Boyan BD. Surface roughness modulates the local

production of growth factors and cytokines by osteoblast-like

MG-63 cells. J Biomed Mater Res 1996;32:55–63.

[39] Schwartz Z, Lohmann CH, Sisk M, Cochran DL, Sylvia VL,

Simpson J, Dean DD, Boyan BD. Local factor production

by MG63 osteoblast-like cells in response to surface rough-

ness and 1,25-(OH)2D3 is mediated via protein kinase C- and

protein kinase A-dependent pathways. Biomaterials 2001;22:

731–41.

[40] Gehron Robey P, Boskey AL. The biochemistry of bone. In:

Marcus R, Feldman D, Kelsey J, editors. Osteoporosis. San

Diego: Academic Press; 1996. p. 23–59.

[41] Schmidt C, Kaspar D, Sarkar MR, Claes LE, Ignatius AA. A

scanning electron microscopy study of human osteoblast mor-

phology on five orthopedic metals. J Biomed Mater Res 2002;

63:252–61.

[42] Anselme K, Bigerelle M, Noel B, Iost A, Hardouin P. Effect of

grooved titanium substratum on human osteoblastic cell growth.

J Biomed Mater Res 2002;60:529–40.

[43] Lauer G, Wiedmann-Al-Ahmad M, Otten JE, Hubner U,

Schmelzeisen R, Schilli W. The titanium surface texture effects

adherence and growth of human gingival keratinocytes and

human maxillar osteoblast-like cells in vitro. Biomaterials 2001;

22:2799–809.

[44] Rogers SD, Howie DW, Graves SE, Pearcy MJ, Haynes DR. In

vitro human monocyte response to wear particles of titanium

alloy containing vanadium or niobium. J Bone Jt Surg Br 1997;

79:311–5.

[45] Sakai T, Takeda S, Nakamura M. The effects of particulate

metals on cell viability of osteoblast-like cells in vitro. Dent Mater

J 2002;21:133–46.

[46] Haynes DR, Hay SJ, Rogers SD, Ohta S, Howie DW, Graves SE.

Regulation of bone cells by particle-activated mononuclear

phagocytes. J Bone Jt Surg Br 1997;79:988–94.

[47] Willert HG, Buchhorn GH, Hess T. The significance of wear and

material fatigue in loosening of hip prostheses. Orthopade

1989;18:350–69.

[48] Howie DW. Tissue response in relation to type of wear

particles around failed hip arthroplasties. J Arthroplasty 1990;

5:337–48.

The proliferation and phenotypic expression of human osteoblasts on tantalum metal

Documents

Transcript of The proliferation and phenotypic expression of human osteoblasts on tantalum metal