Published Ahead of Print 17 October 2012. 10.1128/JCM.02118-12.

2013, 51(1):46. DOI:J. Clin. Microbiol. Amonsin and Srinand SreevatsanEnomoto, Richard J. Webby, Marie R. Gramer, Alongkorn Manoosak Wongphatcharachai, Ping Wang, Shinichiro Influenza H3N2 VirusesNeutralizing DNA Aptamers against Swine

http://jcm.asm.org/content/51/1/46Updated information and services can be found at:

These include:

SUPPLEMENTAL MATERIAL Supplemental material

REFERENCEShttp://jcm.asm.org/content/51/1/46#ref-list-1at:

This article cites 55 articles, 18 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses

Manoosak Wongphatcharachai,a,b,c Ping Wang,c Shinichiro Enomoto,c Richard J. Webby,e Marie R. Gramer,c Alongkorn Amonsin,a,b

Srinand Sreevatsanc,d

Emerging and Re-Emerging Infectious Diseases in Animals, Research Unit, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailanda; Department ofVeterinary Public Health, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailandb; Department of Veterinary Population Medicine, College ofVeterinary Medicine, University of Minnesota, St. Paul, Minnesota, USAc; Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University ofMinnesota, St. Paul, Minnesota, USAd; Infectious Diseases, St. Jude Children’s Research Hospital, Memphis, Tennessee, USAe

Triple reassortant influenza A viruses (IAVs) of swine, particularly the North American H3N2 subtype, circulate in swine herdsand may reassort and result in the emergence of novel zoonotic strains. Current diagnostic tools rely on isolation of the viruses,followed by serotyping by hemagglutination or genome sequencing, both of which can be expensive and time-consuming. Thus,novel subtype-specific ligands and methods are needed for rapid testing and subtyping of IAVs in the field. To address this need,we selected DNA aptamers against the recombinant HA protein from swine IAV H3 cluster IV using systematic evolution of li-gands by exponential enrichment (SELEX). Four candidate aptamers (HA68, HA7, HA2a, and HA2b) were identified and charac-terized. The dissociation constants (Kd) of aptamers HA68, HA7, HA2a, and HA2b against recombinant H3 protein were 7.1,22.3, 16.0, and 3.7 nM, respectively. The binding site of HA68 to H3 was identified to be between nucleotide residues 8 and 40. Allaptamers inhibited H3 hemagglutination. HA68 was highly specific to all four lineages within the North American H3N2 sub-type. Further, the other three aptamers specifically identified live viruses belonging to the phylogenetic clusters I, II/III, and IVespecially the virus that closely related to the recent H3N2 variant (H3N2v). Aptamer HA68 was also able to bind and detectH3N2v isolated from recent human cases. In conclusion, we provide subtype-specific aptamers against H3N2 IAVs of swine thatcan now be used in rapid detection and typing protocols for field applications.

Influenza is an acute contagious disease caused by viruses belong-ing to the family Orthomyxoviridae. This family of viruses con-

tains five genera: influenza viruses A, B, and C, thogotovirus, andisavirus (1). All influenza pandemics in human have been causedby genus influenza virus A. Moreover, influenza A viruses (IAVs)have been reported to infect a wide range of animal species includ-ing humans (2–6). Based on the antigenic properties of hemagglu-tinin (HA) and neuraminidase (NA) genes, IAVs can be dividedinto 17 HA and 9 NA subtypes (7).

IAVs of swine were first isolated from pigs in 1930 and identi-fied as H1N1 (8). IAV is not only an important cause of respiratorydisease for the swine industry throughout the world but also rep-resents an important public health concern. Since human, avian,and swine IAVs can all replicate in pigs to various levels, swine hasbeen implicated as a species that can generate novel viruses withwide host ranges (9–11). Pigs also can be infected with many sub-types of IAVs; however, three major subtypes (H1N1, H1N2, andH3N2) are endemic in swine populations globally (6, 10, 12).

Since 1998, triple reassortant IAV H3N2 were identified inNorth America and then have been circulating in swine herdsworldwide (13, 14). Phylogenetic analysis of HA gene of H3N2IAV from swine in North America describe their origin as comingfrom distinct human-to-swine transmission events and resultingin three genetic and antigenic clusters, namely, clusters I, II, andIII (13, 15). Cluster III viruses were the most common in NorthAmerica in the early 21st century. By 2005, cluster IV viruses thatemerged as possible vaccine escape variants of cluster III havesince become dominant in pig populations (16–18).

In 2011, novel reassortant H3N2 variant (H3N2v) IAVs con-taining internal genes of the 2009 pandemic H1N1 have been re-ported in pigs (19). In the same year, the Centers for DiseaseControl and Prevention (CDC) reported two pediatric cases ofH3N2v. This virus has been identified as “novel reassortant” be-

cause their genomes contain seven gene segments of triple reas-sortant H3N2 circulating in North America swine since 1998 andmatrix gene of the 2009 pandemic H1N1 (20).

Current diagnostic tools for IAVs rely on isolation of virus,followed by serotyping via hemagglutination or genome sequenc-ing, both of which can be expensive and time-consuming (21).Thus, novel subtype-specific ligands and methods are needed forrapid testing and subtyping of IAVs. Although antibodies havebeen made for a wide range of applications and have become theindispensable agents for most diagnostic tests, they have inherentlimitations. The process of antibody production starts in animalsor cell cultures that are demanding and costly to maintain. Frozenstocks of antibodies might lose their activity over time for no ap-parent reason. The performance of the same antibody may havebatch-to-batch variation. Moreover, antibodies are sensitive tohigh temperature and irreversible after denaturation; thus, theyhave a limited shelf-lives and are not suitable for transport at am-bient temperatures (22).

Aptamers are short, unique, single-stranded nucleic acid li-gands that can bind specifically to their target molecules. They canbe completely selected and characterized from complex synthetic

Received 8 August 2012 Returned for modification 10 September 2012Accepted 9 October 2012

Published ahead of print 17 October 2012

Address correspondence to Srinand Sreevatsan, sreev001@umn.edu.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.02118-12.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JCM.02118-12

The authors have paid a fee to allow immediate free access to this article.

46 jcm.asm.org Journal of Clinical Microbiology p. 46–54 January 2013 Volume 51 Number 1

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

libraries by an in vitro process called “systematic evolution of li-gands by exponential enrichment” (SELEX) (23, 24). This processstarts with random oligonucleotides flanked with primer-bindingregions for PCR amplification.

In the present study, high-affinity DNA aptamers against re-combinant HA protein from H3 cluster IV IAV of swine wereselected and characterized. Several studies of aptamers for IAVshave been reported (25–28). However, these studies did not dem-onstrate that these aptamers could be applied for heterologousviral subtype. This is the first report of DNA aptamers for IAVsdemonstrating homologous and heterologous viral subtype spec-ificity. Furthermore, our study shows that selected candidatesbind directly to virus, suggesting that these ligands can be trans-lated into a rapid testing device for both laboratory and field use.

MATERIALS AND METHODSRandomized single-stranded DNA library, aptamers, and primers. Thesingle-stranded DNA library (WAP40) consisting of randomized 40-merDNA sequence flanked by constant primer-binding regions, primers(sense strand [WP18] and antisense strand [WP20]), and aptamers weresynthesized by Integrated DNA Technologies, Inc. (Coralville, IA). Se-quences of primers and DNA library are shown in Table 1.

Recombinant His6-tagged H3 hemagglutinin protein. RecombinantHis6-tagged H3 hemagglutinin protein from an H3N2 strain A/swine/Minnesota/SG-00235/2007 (swH3) was cloned and expressed in a bacu-lovirus system in our laboratory. To verify that the recombinant swH3protein was a functional protein, we performed a hemagglutination (HA)test parallel with the corresponding swH3 virus, and the results were sim-ilar. The recombinant swH3 protein was used as a template for the selec-tion and characterization of the DNA aptamers. To test the specificity ofaptamers, the reference recombinant HA proteins in different subtypes ofIAVs obtained from Biodefense and Emerging Infections Research (BEI)resources were used. Detailed descriptions of the recombinant HA pro-teins used in the present study are provided in Table 2.

Preparation of recombinant swH3 protein and Ni-NTA magneticagarose bead matrix. Approximately 100 �l of Ni-NTA magnetic agarosebeads (Qiagen, Hilden, Germany) was separated from solution by usingmagnetic apparatus. The beads were washed three times with 500 �l of 50mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, 0.005% Tween 20 (pH8.0) (washing buffer) and then conjugated with recombinant swH3 pro-tein in 500 �l of 50 mM NaH2PO4, 300 mM NaCl, and 20 mM imidazole(pH 8.0) (binding buffer) at 4°C with gentle shaking. After 48 h of incu-bation, protein-bead matrix was washed three times with 500 �l of wash-ing buffer. After washing, the protein-bead matrix was stored at 4°C andused within a day. In subsequent iterations of SELEX, the recombinantswH3 protein was gradually reduced from 30 to 0.4 �g.

Negative selection. Negative selection was performed in every itera-tion of SELEX to remove any nonspecific candidates that bind to theNi-NTA magnetic agarose beads. The aptamer library was denatured at95°C for 10 min and then incubated at room temperature for 10 min prioruse. Three sets of �100 �l of Ni-NTA beads were prepared by separating

them from solution by using a magnetic separation apparatus and threewashes with 500-�l portions of washing buffer. The denatured aptamerlibrary was added to Ni-NTA beads in 500 �l of 50 mM NaH2PO4–50 mMNaCl–20 mM imidazole pH 8.0 (interaction buffer), followed by incuba-tion at room temperature for 30 min in a rotisserie shaker. After the thirdnegative selection, the unbound library was subjected to positive SELEXagainst H3.

SELEX. The aptamer library was conjugated with protein-bead matrixin 500 �l of interaction buffer, followed by incubation at room tempera-ture using a rotisserie shaker. After 1 h of incubation, the unbound libraryor poor binders were removed by 11 wash steps with 1� phosphate-buffered saline (PBS) containing 0.05% Tween 20 (1� PBST). Protein-bound aptamers were recovered with 100 �l of nuclease-free water andthen subjected to PCR. PCR was performed to amplify all protein-boundaptamer candidates. Briefly, 3 �l of protein-bound aptamers were mixedwith 5 pmol of forward primer (WP18) and biotinylated reverse primer(Bio-WP20), 2� HotStarTaq DNA polymerase (Qiagen), and nuclease-free water (final volume, 50 �l). PCR was performed using the followingconditions: 95°C for 15 min, followed by 15 cycles of 95°C for 30 s, 63°Cfor 30 s, and 72°C for 30 s, and finally 72°C for 7 min. Amplicons fromPCR were then used as a template for asymmetric-touchdown PCR toenrich for the sense strand to be applied back in the next round of SELEX.Briefly, 2 �l of amplicons was mixed with 30 pmol of WP18 and 1.2 pmolof Bio-WP20 (forward primer/reverse primer ratio of 25:1). TouchdownPCR conditions used were 95°C 15 min, followed by 9 cycles of 95°C for 15s, 72°C for 15 s (gradually decreasing by 1°C each cycle), and 72°C for 15s, followed by 11 cycles of 95°C for 15 s, 63°C for 15 s, and 72°C for 15 s,and a final extension at 72°C for 3 min. Approximately 400 �l of ampli-cons from asymmetric-touchdown PCR was purified by MiniElute PCRpurification kit (Qiagen) and then eluted with 60 �l of nuclease-free wa-ter. Subsequent rounds of SELEX were performed only with the sensestrand aptamers. To remove the antisense strand, PCR amplicons werepurified by heat denaturing and quick chilling on ice and then mixturewith Dynal M280 streptavidin super-paramagnetic beads (Invitrogen/Dy-nal AS, Oslo, Norway) for 15 min. The SELEX process was repeated 15times. The binding affinity and the specificity of aptamer candidates wereinvestigated by chemiluminescent electromobility shift analysis (Light-Shift chemiluminescent EMSA kit; Pierce, Rockford, IL) before cloningand sequencing.

Counter-SELEX to remove any His tag binding candidates. Duringthe last two rounds of SELEX (i.e., rounds 14 and 15), His6-tagged recom-binant nucleoprotein (rNP) from an H1N1 virus, A/swine/Minnesota/07002083/2007 (swH1), was used for counter-SELEX to remove any non-specific candidates that bound to the His6-tagged portion of the protein. Aprotein-bead matrix was prepared according to the same procedures used

TABLE 1 Sequences of primers and DNA library used in this study

Name Sequence (5=–3=)WAP40 GTGCAGTCAAAGACGTCC-N(40)-

GGCAATCGCACTTCATGGTCWP18 GTGCAGTCAAAGACGTCCWP20 GGCAATCGCACTTCATGGTCBio-WP18 Biotin-GTGCAGTCAAAGACGTCCBio-WP20 Biotin-GGCAATCGCACTTCATGGTCM13F GTTTTCCCAGTCACGACM13R CAGGAAACAGCTATGAC

TABLE 2 Detailed descriptions of the recombinant HA proteins used inthis study

Protein Influenza virus origin Sourcea

H3 (template) A/swine/Minnesota/SG-00235/07(H3N2)

This study

H1 A/Solomon Islands/3/06 (H1N1) NR-15170 (BEI)H2 A/Singapore/1/57 (H2N2) NR-2668 (BEI)H3 A/Uruguay/716/07 (H3N2) NR-15168 (BEI)H5 A/Hong Kong/156/97 (H5N1) NR-652 (BEI)H5 A/bar-headed goose/Qinghai/1A/05

(H5N1)NR-9666 (BEI)

H6 A/teal/Hong Kong/W312/97 (H6N1) NR-653 (BEI)H7 A/Netherlands/219/03 (H7N7) NR-2633 (BEI)H7 A/Canada/rv444/04 (H7N3) NR-12073 (BEI)H9 A/Hong Kong/1073/99 (H9N2) NR-654 (BEI)His6-tagged NP A/swine/Minnesota/07002083/07

(H1N1)This study

a BEI, Biodefense and Emerging Infections Research.

DNA Aptamers against Swine Influenza H3N2 Viruses

January 2013 Volume 51 Number 1 jcm.asm.org 47

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

for the recombinant swH3 protein. The aptamer pool was incubated withrNP at room temperature for 1 h, and then the supernatant was collectedusing a magnetic apparatus. The supernatant containing aptamer candi-dates was then submitted to positive SELEX.

Cloning and sequencing of the aptamer candidates. PCR ampliconscontaining the enriched aptamer pools of rounds 8 and 15 were purifiedby using a MiniElute PCR purification kit (Qiagen). The purified ampli-cons were cloned into TA vector (pCR2.1-TOPO) and then transformedinto chemically competent TOP10 Escherichia coli cell by heat shock at42°C according to the manufacturer’s recommendations (TOPO TAcloning kit; Invitrogen, Carlsbad, CA). Transformed E. coli cells wereplated on Luria-Bertani agar containing ampicillin (50 �g/ml) and X-Gal(5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside). White colonies ofE. coli cells were chosen and amplified by PCR with M13 primers. PCRamplicons were then submitted to the Biomedical Genomics Center at theUniversity of Minnesota (BMGC; St. Paul, MN) for sequencing using theSanger sequencing method (ABI Prism 3730xl DNA analyzer). The DNAsequences were analyzed, and a phylogenetic tree was prepared to identifyredundancy in the selected pool using MEGA4 (29). Selected aptamersequences were further analyzed for secondary structure prediction usingthe Mfold web server (30).

EMSA. Selected aptamer sequences were synthesized and labeled withbiotin (5=), while amplicons containing enriched aptamer pool were am-plified by PCR with 5=-biotin-labeled forward primer (Bio-WP18). Ap-tamer-protein binding assay was analyzed by using a LightShift chemilu-minescent electrophoretic mobility shift assay (EMSA) kit (Pierce) inaccordance with the manufacturer’s instructions with a few modifica-tions. Briefly, selected aptamers (20 fmol) were added to recombinantswH3 protein in 1� binding buffer and nuclease-free water (final volume,20 �l), followed by incubation at room temperature for 30 min. Thesamples were loaded onto an 8% native polyacrylamide gel (Bio-Rad,Hercules, CA) in 0.5� Tris-borate-EDTA buffer. Electrophoresis was per-formed at 80 V for 60 min, and then the samples were electrotransferred toa positively charged nylon membrane (Biodyne B; 0.45-�m pore size;Biodyne, Pensacola, FL). The membrane was processed and developedwith a chemiluminescent nucleic acid detection module (Pierce) in accor-dance with the manufacturer’s instructions. Reactions on the membranewere then visualized and imaged with the LabWorks 4.5 imaging system(UVP Products, Upland, CA).

HA inhibition test. HA inhibition (HI) was performed to prove thatthe selected aptamers recognized the active site of the HA protein of swH3IAV and could inhibit the viral infectivity. Turkey red blood cells (RBC)were diluted to 0.5% in PBS. The HA test was performed in a microtiter96-well plate with 50-�l samples containing virus and 50 �l of 0.5% RBC.The samples were incubated at room temperature for 30 to 45 min, andthe agglutination of RBC was inspected. HI was performed with 500 pmolof each aptamer added to the virus before the addition of the RBC, fol-lowed by incubation at room temperature for 30 min.

DNase I footprinting assay. A DNase I footprinting assay was per-formed to identify the binding site(s) of the selected aptamer (31, 32). Therecombinant swH3 protein (4 to 6 �g) was mixed with 1 pmol of HA68labeled with 6-carboxyfluorescein (FAM) at the 5= end in 1� bindingbuffer (LightShift; Pierce), nuclease-free water was added to a final vol-ume 50 �l, followed by incubation at room temperature for 1 h. Afterincubation, the samples were treated with 0.2 U of DNase I (amplifica-tion-grade; Invitrogen), followed by incubation at 37°C for 5 min. Toinactivate the DNase I, 2 mM EDTA was added to each sample, followedby incubation at 70°C for 10 min. Recombinant protein from an H1N1human influenza virus (A/Solomon Islands/3/06 [human H1]) was usedas a negative control and treated under identical conditions. A negativecontrol (without protein) was applied using nuclease-free water in placeof protein. After the reaction, the samples were purified by using a Min-iElute PCR purification kit (Qiagen) and eluted with 14 �l of nuclease-free water. Approximately 12 �l of purified samples were submitted to theBMGC for fragment analysis on a 3130XL genetic analyzer. The binding

region of aptamer was analyzed by Peak Scanner software (v.1.0; AppliedBiosystems, Foster City, CA) with Liz500 as an internal size standard.

Specificity of each aptamer against recombinant HA proteins of dif-ferent subtypes of IAVs. The aptamer dot blot assay was modified andperformed to test the specificity of each aptamer by using recombinantHA proteins in different subtypes of IAVs from the BEI resource: H1, H2,H3, H5, H6, H7, and H9 (Table 2). Each protein was diluted with nucleasefree-water to a concentration of 50 ng/�l, and 2 �l each was blotted ontonitrocellulose membrane (Protran; Whatman/Pierce). The membranewas blocked with 5% fish gelatin (Sigma, St. Louis, MO) in 1� PBST at4°C. After 12 h of incubation, the membrane was incubated with 5=digoxigenin (DIG)-labeled aptamer at the final concentration 100 nM in1% fish gelatin at room temperature with gentle shaking for 1 h and thenwashed five times with 1� PBST in 5-min increments. The membrane wasincubated with peroxidase-conjugated IgG fraction monoclonal mouseanti-DIG (Jackson Immunoresearch Laboratories, Inc., West Grove, PA)in 1:12,500 dilutions in 1% fish gelatin in 1� PBST at room temperaturefor 30 min. The membrane was then washed once with 1� PBS anddeveloped with luminal enhancer and stable peroxide solution in a 1:1dilution (LightShift; Thermo) at room temperature for 5 min. The mem-brane was visualized and imaged by LabWorks 4.5 software (UVP Prod-ucts).

Binding affinity of selected aptamers. The recombinant swH3 pro-tein was prepared at a concentration 25 ng/�l by dilution with 50 mMTris–250 mM NaCl (pH 8.2) (protein buffer). Nitrocellulose membranes(Protran) were blotted with 2 �l of the protein (50 ng) in triplicate anddried at room temperature for 1 h. The membranes were blocked with 5%fish gelatin in 1� PBST at 4°C. After 12 h of incubation, the membraneswere incubated with different concentrations of 5= Bio-aptamer in 2-folddilutions (1 to 1,024 nM) in 1% fish gelatin in 1� PBST at room temper-ature for 1 h with gentle shaking. The membranes were washed with 1�PBST for 5 min with gentle shaking. After five washes, the membraneswere incubated with NeutrAvidin protein and horseradish peroxidase(Thermo) conjugated in 1:12,500 dilutions in 1% fish gelatin in PBST atroom temperature for 30 min. The membranes were washed once with 1�PBS and developed with luminol enhancer and stable peroxide solution in1:1 dilution (LightShift) at room temperature for 5 min. The membraneswere visualized and imaged by LabWorks 4.5 software. The chemilumi-nescence intensity was calculated by using ImageJ 1.45s software. Thedissociation constant (Kd) was calculated based on a nonlinear regressionequation.

Influenza live virus detection by aptamer dot blot assay. All pro-cesses involving work with live viruses were performed in a class II bio-safety cabinet. IAV isolates from North American swine belonging to phy-logenetic lineages of H3 were obtained from the University of MinnesotaVeterinary Diagnostic Laboratory (UMVDL) as blind samples in minimalessential medium (MEM). AIV H3N2 in allantoic fluid was used as therepresentative for H3 cluster I (A/mallard/South Dakota/SE128/2007)(33). Detailed descriptions of the reference viruses used in the presentstudy are given in Fig. 1 and Table 3. Samples containing live viruses werecentrifuged at full speed (13,000 rpm) for 5 min prior use. Then, 2 �l ofeach culture (supernatant) was blotted onto the nitrocellulose mem-branes in triplicate (Protran). The membranes were dried at room tem-perature for 1 h and blocked with 5% fish gelatin (Sigma) in 1� PBST at4°C. After 12 h of incubation, denatured sheared salmon sperm DNA(Ambion, Austin, TX) was added to the membranes with blocking bufferat a concentration of 10 ng/�l, followed by incubation at room tempera-ture for 20 min. Membrane was incubated with DIG-aptamers (100 nM)in 1% fish gelatin at room temperature for 1 h and then washed five timeswith 1� PBST. The washing and developing steps were performed asdescribed above.

RESULTSSelection of DNA aptamers against recombinant swH3 protein.Sequencing of 80 transformants containing aptamer inserts

Wongphatcharachai et al.

48 jcm.asm.org Journal of Clinical Microbiology

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

(round 8) revealed a tendency toward sequence saturation, andthus seven additional iterations of SELEX were performed. After15 rounds of SELEX, enriched aptamer pool showed high affinityagainst recombinant swH3 protein by gel shift assay (data notshown). Sequencing of 95 transformants containing aptamer in-serts (round 15) were performed. DNA sequences and the percentredundancy of each sequence from the aptamer pool of round 15of SELEX are shown in Table 4. The sequence similarities werecompared, and five aptamer candidates from the selected pool

were chosen for further characterization based on the differencesin nucleotides (Fig. 2). DNA sequences of the enriched aptamerpool of rounds 8 and 15 were also compared to show the evolu-tionary change in the sequences (see Fig. S1 in the supplementalmaterial). Secondary structure predictions of five selected DNAsequences are shown in Fig. S2 in the supplemental material. Byaptamer dot blot assay, four aptamer candidates were shown to bespecific to recombinant swH3 protein, and one (HA1c) did notbind to any proteins.

Specificity of four candidate aptamers. An aptamer dot blotassay was performed to test the specificity of the selected fouraptamers. The results show that all aptamers are highly specific toH3 subtype compared to 10 other recombinant HA proteins rep-resenting seven different HA subtypes (Fig. 3).

Aptamer binding to recombinant swH3 protein. AptamersHA68 and HA7 were chosen to test using EMSA to show thataptamer specificity was for recombinant swH3 protein and not foran extraneous His6-tagged recombinant protein (rNP). The re-sults show that the aptamers specifically recognized recombinantswH3 protein in a dose-dependent fashion (Fig. 4).

HI results. Since the aptamers were enriched and selected byusing recombinant protein, we wanted to show that these ap-tamers can bind to live virus. An HI assay was performed toshow the neutralization activity and specificity of the four se-lected aptamers to the HA protein of A/swine/Minnesota/SG-

FIG 1 Phylogenetic clusters of IAV H3 subtypes used for aptamer specificitytesting. The relative phylogenetic positions of HA sequences of archived IAVsfrom North American swine (blue) used for aptamer dot blot assay are shown.Isolates were obtained from the UMDLV. The H3 IAV used for SELEX isindicated in pink and belongs to cluster IV.

TABLE 3 Detail descriptions of reference influenza live viruses used in this study and results of each aptamer detected by aptamer dot blot assay

Sampleno. Samplea Subtype

HA titer(U/50 �l) H3 cluster(s)

Dot blot result for each aptamer

HA68 HA7 HA2a HA2b

1 A/swine/MN/SG235/07 H3N2 64 IV � � � �2 A/swine/MN/00395/04 H3N1 2 IV � – – –3 A/swine/MN/3-70733/11 H3N2 6 IV � �/– �/– �/–4 A/swine/MN/A01116195/11 H3N2 16 IV � � � �5 A/swine/NC/A01076178/1 H3N2 32 II or III � �/– �/– �/–6 A/swine/Canada/03004/10 H3N2 16 Outlier � – – –7 A/swine/NC/02881/09 H3N2 16 II or III � � �/– �8 A/swine/MN/SG239/07 H1N2 16 – – – –9 A/mallard/SD/SE-00128/07 H3N2 4 I � � � �10 A/blue-winged teal/LO/SG-00163/07 H4N8 16 – – – –11 MEM � 10% FBS Negative – – – –a Archived H3N2 IAVs from North American swine (samples 2 to 7) were provided by the UMVDL. MEM, minimal essential medium; FBS, fetal bovine serum.

TABLE 4 DNA sequences and number of clones from the aptamer poolof the 15th round of SELEX

Aptamera Aptamer sequenceb (5=–3=)No. ofcolonies

HA68* ACTCCGTCATCTTTAGTGGCCCCAATGTCGTTATCACCGA 68HA7* CACTCCGTCACTTTAGTGGATCTTTATAAAACCGATGCTG 7HA2a* GCCACTCCGTCACTTTAGTGGTTTTTTTTATAAATGCTTC 2HA2b* TACTCCGTCACTTTAGTGGATATAACAACCTCCCTATGGG 2HA2c ACTCCGTCATCTTTAGCGGCCCCAATGTCGTTATCACCGA 2HA1a CACTCCGTCACTTTAGTGGATTTTTATAAAGCCGATGCTG 1HA1b ACTCCGTCATCTTTAGTGGCCCCAATGTCGCTATCACCGA 1HA1c CGATCAAGACAGAAGAGGTGATAACTCCGTCACTTTAGTG 1HA1d ACTCCGTCATCTTTAGTGGCCCCAATGTCGTCATCACCGA 1HA1e ACTCCGTCATCTTTAGTGGCCCCAATGTCATTATCACCGA 1HA1f ACTCCGTTATCTTTAGTGGCCCCAATGCCGTTATCACCGA 1HA1g ACTCCGTCATCTTTAGTGGCCCCAGTGTCGTTATCACCGA 1

a *, Aptamer candidates selected for further characterization.b Each sequence is 40 bases long.

DNA Aptamers against Swine Influenza H3N2 Viruses

January 2013 Volume 51 Number 1 jcm.asm.org 49

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

00235/2007 (H3N2) compared to no inhibition of the unse-lected library (WAP40). At a concentration of 2.5 �M, the fouraptamers HA68, HA7, HA2a, and HA2b were able to com-pletely inhibit the agglutination of RBC at 16, 8, 16, and 4 HA

U/50 �l, respectively (Fig. 5). In addition, we show that none ofselected aptamers bound to a heterologous virus (A/swine/Minnesota/SG-00239/2007 [H1N2]). The result indicates thatthe aptamers bind specifically to HA protein likely at or around

FIG 2 DNA sequences from enriched aptamer pool of the 15th iteration of SELEX were aligned by using CLUSTAL W to identify redundancy in the selected sequencemotifs. The sequence similarity was compared, and five sequences representative of redundant clusters were chosen for further characterizations (red arrows).

FIG 3 Aptamer dot blot assay performed to test the specificity of the four candidate aptamers. Sample 1, A/swine/Minnesota/SG235/2007 (H3N2); 2, A/SolomonIslands/3/2006 (H1N1); 3, A/Singapore/1/1957 (H2N2); 4, A/Uruguay/716/2007 (H3N2); 5, A/Hong Kong/156/1997 (H5N1); 6, A/bar-headed goose/Qinghai/1A/2005(H5N1); 7, A/teal/Hong Kong/W312/1997 (H6N1); 8, A/Canada/rv444/2004 (H7N3); 9, A/Netherlands/219/2003 (H7N7); 10, A/Hong Kong/1073/1999; 11, NPprotein of A/swine/MN/07002083/2007 (H1N1). Detailed descriptions of each sample are shown in Table 2. Abbreviations: a, avian; h, human; s, swine.

Wongphatcharachai et al.

50 jcm.asm.org Journal of Clinical Microbiology

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

the receptor-binding site (34, 35) of H3N2 IAV of swine and donot bind to the H1N2 IAV of swine.

Determination of the dissociation constants (Kd) of each ap-tamer. To describe the strength of the binding affinity betweenaptamer and recombinant swH3 protein, dissociation constants(Kd) of each aptamer were calculated from the dot blot chemilumi-nescence intensities based on a nonlinear regression analysis. A con-centration of each aptamer that saturates 50% of binding sites on thetarget protein was determined as the Kd. The results of the bindingcurve were fit to a modified equation (36) as follows: AB � (ABmax

[A])/(Kd � [A]). In this modified equation, AB represents the frac-tion bound as measured by the chemiluminescence intensity, [A] isthe concentration of the aptamer, and Kd is the dissociation constant.The binding affinities of HA2b, HA68, HA2a, and HA7 were 3.7, 7.1,16.0, and 22.3 nM, respectively (Fig. 6).

Binding region of aptamer HA68 to recombinant swH3 pro-tein. A DNase I footprinting assay was performed to identify thebinding region of the aptamer to the recombinant swH3 protein.In the present study, HA68 was chosen for this purpose. The bind-ing region of HA68 was identified to be between aptamer residues8 and 40 (Fig. 7). An identical result was obtained using recombi-nant human H3 protein derived from A/Uruguay/716/2007

(H3N2). In addition, HA68 did not bind to recombinant humanH1 protein (A/Solomon Islands/2/2006 [H1N1]) (see Fig. S3 inthe supplemental material).

Use of aptamers to detect influenza live viruses. A dot blotassay was performed to show the aptamer could be used to detectlive viruses. Archived H3N2 IAVs from North American swinewere provided by the UMVDL and used as representatives of eachH3 cluster. The results showed that HA68 was able to bind to alllineages of the H3 subtype unequivocally, whereas the other threeaptamers specifically identified H3 live viruses belonging to thephylogenetic clusters I, II/III, and IV, especially the virus that isclosely related to the recent H3N2v (sample 4 in Fig. 1 and 8). It islikely that this application was affected by the virus titer in thecultured samples (see Fig. S4 in the supplemental material). Asample of H3N2v obtained from the CDC also tested positive in adot blot assay, suggesting the possible application of selected ap-tamers in detecting zoonotic transmission.

DISCUSSION

Neutralizing DNA aptamers with high affinity against HA proteinof H3N2 IAVs of swine origin were developed, and the methodsfor selection and characterization were also described. In the pres-

FIG 4 Two selected aptamer candidates, HA68 and HA7, were screened by using EMSA.

FIG 5 An HI test was performed to show the neutralization activity and specificity of selected aptamers to the HA protein of A/swine/Minnesota/SG-00235/2007(H3N2).

DNA Aptamers against Swine Influenza H3N2 Viruses

January 2013 Volume 51 Number 1 jcm.asm.org 51

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

ent study, four aptamer candidates were identified and character-ized by using the SELEX method. The results of the aptamer dotblot assay showed that selected DNA aptamers can be used todetect and differentiate the subtypes of IAVs. Furthermore, allfour aptamers showed an inhibitory effect of in vitro viral infec-tivity by HI test, suggesting that the aptamers were capable ofbinding to HA protein likely at or around the receptor-bindingsite required for penetration into the host cells of H3N2 IAVs (34,35). This ability may apply to further study for therapeutic poten-tial for the selected aptamers.

Since 1998, H3N2, initially isolated from North American

swine, has become endemic in pig populations. Although pigs canbe infected with many subtypes of IAVs, H1N1 and H3N2 are themost important and the most frequently isolated from pigs world-wide (12). Currently, most diagnostic tools rely on HI and virusisolation, both of which are time-consuming and require exten-sive laboratory resources, including RBCs or embryos from spe-cific-pathogen-free chicken and cell-culturing facilities (21).

On the other hand, aptamers show promise as ideal candidatesfor molecular targeting applications. Aptamers can be chemicallysynthesized, and all processes were performed by in vitro tech-niques. Aptamers can be applied on a wide range of matrices for a

FIG 6 The dissociation constant (Kd) of each DNA aptamer was used to describe the strength of the binding affinity between aptamer and recombinant swH3protein. The Kd was calculated from the dot blot chemiluminescence intensity based on a nonlinear regression equation.

FIG 7 The aptamer binding site of HA68 was identified by a DNase I footprinting assay. (Upper right panel) FAM-HA68 was reacted with recombinant swH3protein (blue peaks) or recombinant human H1 protein (pink peaks). (Lower right panel) Nucleotide sequence chromatogram. (Left panel) Secondary structureprediction of HA68 and putative binding sites.

Wongphatcharachai et al.

52 jcm.asm.org Journal of Clinical Microbiology

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

primary clinical specimen. This addresses the primary advantageof an aptamer over an antibody, since the former can reduce thephysiological variations from animals and replace animal systems(37). Moreover, aptamers can be easily and inexpensively synthe-sized without batch-to-batch variation (37, 38). They are also sta-ble during long-term storage and easy to transport at an ambienttemperature. Similar to antibodies, aptamers can also be labeledwith reporter molecules such as fluorescein, biotin, and digoxige-nin, which increases their applicability for further applications(39–45). DNA and RNA aptamers have shown similar functionand performance in terms of affinity and specificity (46). RNAmolecules are susceptible to enzymatic degradation but can bestabilized by base modifications. DNA aptamers are easier to pre-pare, are stable, and can be amplified in one step by PCR andmanipulated for the selection process. Current applications areprimarily DNA based (47).

IAVs attach to host cells via sialic acid receptor. This receptor isalso found on the RBC of several species of animals. Turkeys,guinea pigs, type O-human blood, and chicken RBC are tradition-ally used for HI tests (48–50). Due to the presentation of sialic acidreceptor on RBC, IAVs can agglutinate RBC (34). Since the ap-tamers in the present study weren developed based on recombi-nant swH3 protein, HI tests were performed to show that theaptamers bound specifically to viral HA protein.

IAVs have been identified in mixed infections due to thegenomic heterogeneity identified by next-generation sequencingand exhibit significant genetic diversity (51, 52). HA protein is thepart of the virus that is recognized by the host immune system.Thus, incremental variations largely result in antigenic drift (51,53, 54), and ligands with high precision would be necessary toaccurately detect infecting viruses.

Several studies of aptamers for IAVs have been reported, e.g.,RNA aptamers for H5N2 (55) and H9N2 (56), DNA aptamers forhuman H1N1, H2N2, and H3N2 (28), and an RNA aptamer todistinguish between pathogenic human H3N2 and other patho-genic viruses from low-pathogenicity viruses (27). However, thesereports have not demonstrated that these aptamers could be usedto determine homologous and heterologous viral subtypes. In thepresent study, high-affinity DNA aptamers against SIV H3N2

were selected and characterized. The results of aptamer-dot blotassays showed that these aptamers can be used to detect and dif-ferentiate IAV subtypes. Aptamer HA68 has shown high sensitiv-ity and binding affinity to all H3 clusters in the study. Three otheraptamers (HA7, HA2a, and HA2b) have shown high sensitivityand specificity to clusters I, II/III, and IV, especially the virus thatis closely related to the recent H3N2v (sample 4 in Fig. 1 and 8).Moreover, our results show that selected aptamers, especiallyHA68, bind not only to H3 IAV of swine but also human H3 andavian H3 (Fig. 3 and 8). For future applications, HA68 can be usedto detect and subtype H3N2 IAVs, and other aptamers may beused to determine the phylogenetic cluster.

ACKNOWLEDGMENTS

This study was funded by College of Veterinary Medicine, University ofMinnesota, funds awarded to S.S. We acknowledge a Chulalongkorn Uni-versity Dutsadi Phiphat scholarship providing financial support to M.W.

REFERENCES1. Krossoy B, Hordvik I, Nilsen F, Nylund A, Endresen C. 1999. The

putative polymerase sequence of infectious salmon anemia virus suggestsa new genus within the Orthomyxoviridae. J. Virol. 73:2136 –2142.

2. Amonsin A, Payungporn S, Theamboonlers A, Thanawongnuwech R,Suradhat S, Pariyothorn N, Tantilertcharoen R, Damrongwanta-napokin S, Buranathai C, Chaisingh A, Songserm T, Poovorawan Y.2006. Genetic characterization of H5N1 influenza A viruses isolated fromzoo tigers in Thailand. Virology 344:480 – 491.

3. Amonsin A, Songserm T, Chutinimitkul S, Jam-On R, Sae-Heng N,Pariyothorn N, Payungporn S, Theamboonlers A, Poovorawan Y. 2007.Genetic analysis of influenza A virus (H5N1) derived from domestic catand dog in Thailand. Arch. Virol. 152:1925–1933.

4. Lvov DK, Zdanov VM, Sazonov AA, Braude NA, Vladimirtceva EA,Agafonova LV, Skljanskaja EI, Kaverin NV, Reznik VI, Pysina TV,Oserovic AM, Berzin AA, Mjasnikova IA, Podcernjaeva RY, KlimenkoSM, Andrejev VP, Yakhno MA. 1978. Comparison of influenza virusesisolated from man and from whales. Bull. World Health Organ. 56:923–930.

5. Taubenberger JK, Morens DM. 2010. Influenza: the once and futurepandemic. Public. Health Rep. 125:16 –26.

6. Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y. 1992.Evolution and ecology of influenza A viruses. Microbiol. Rev. 56:152–179.

7. Tong S, Li Y, Rivailler P, Conrardy C, Castillo DA, Chen LM, RecuencoS, Ellison JA, Davis CT, York IA, Turmelle AS, Moran D, Rogers S, Shi

FIG 8 An aptamer dot blot assay was performed to detect archived IAV isolates from North American swine in different phylogenetic lineages of H3 (samples1 to 7 and sample 9). SwH1N2 IAV (sample 8), AIV H4N8 (sample 10), and 10% fetal bovine serum (FBS) in MEM (sample 11) were used as negative controls.The numbers on the left side of the figure are the virus titers (in HA U/50 �l). Abbreviations: a, avian; s, swine; Dig, digoxigenin labeled.

DNA Aptamers against Swine Influenza H3N2 Viruses

January 2013 Volume 51 Number 1 jcm.asm.org 53

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from

M, Tao Y, Weil MR, Tang K, Rowe LA, Sammons S, Xu X, Frace M,Lindblade KA, Cox NJ, Anderson LJ, Rupprecht CE, Donis RO. 2012.A distinct lineage of influenza A virus from bats. Proc. Natl. Acad. Sci.U. S. A. 109:4269 – 4274.

8. Shope RE. 1931. Swine influenza. III. Filtration experiments and etiology.J. Exp. Med. 54:373–385.

9. Ito T, Couceiro JN, Kelm S, Baum LG, Krauss S, Castrucci MR,Donatelli I, Kida H, Paulson JC, Webster RG, Kawaoka Y. 1998.Molecular basis for the generation in pigs of influenza A viruses withpandemic potential. J. Virol. 72:7367–7373.

10. Kida H, Ito T, Yasuda J, Shimizu Y, Itakura C, Shortridge KF, KawaokaY, Webster RG. 1994. Potential for transmission of avian influenza vi-ruses to pigs. J. Gen. Virol. 75(Pt 9):2183–2188.

11. Ma W, Lager KM, Vincent AL, Janke BH, Gramer MR, Richt JA. 2009.The role of swine in the generation of novel influenza viruses. ZoonosesPublic Health 56:326 –337.

12. Brown IH. 2000. The epidemiology and evolution of influenza viruses inpigs. Vet. Microbiol. 74:29 – 46.

13. Webby RJ, Swenson SL, Krauss SL, Gerrish PJ, Goyal SM, Webster RG.2000. Evolution of swine H3N2 influenza viruses in the United States. J.Virol. 74:8243– 8251.

14. Zhou NN, Senne DA, Landgraf JS, Swenson SL, Erickson G, Rossow K,Liu L, Yoon KJ, Krauss S, Webster RG. 2000. Emergence of H3N2reassortant influenza A viruses in North American pigs. Vet. Microbiol.74:47–58.

15. Richt JA, Lager KM, Janke BH, Woods RD, Webster RG, Webby RJ.2003. Pathogenic and antigenic properties of phylogenetically distinct re-assortant H3N2 swine influenza viruses cocirculating in the United States.J. Clin. Microbiol. 41:3198 –3205.

16. Gramer MR, Lee JH, Choi YK, Goyal SM, Joo HS. 2007. Serologic andgenetic characterization of North American H3N2 swine influenza A vi-ruses. Can. J. Vet. Res. 71:201–206.

17. Olsen CW, Karasin AI, Carman S, Li Y, Bastien N, Ojkic D, Alves D,Charbonneau G, Henning BM, Low DE, Burton L, Broukhanski G.2006. Triple reassortant H3N2 influenza A viruses, Canada, 2005. Emerg.Infect. Dis. 12:1132–1135.

18. Vincent AL, Ma W, Lager KM, Janke BH, Richt JA. 2008. Swine influenzaviruses a North American perspective. Adv. Virus Res. 72:127–154.

19. Liu Q, Ma J, Liu H, Qi W, Anderson J, Henry SC, Hesse RA, Richt JA,Ma W. 2011. Emergence of novel reassortant H3N2 swine influenza vi-ruses with the 2009 pandemic H1N1 genes in the United States. Arch.Virol. 157:555–562.

20. CDC. 2011. Swine-origin influenza A (H3N2) virus infection in two chil-dren—Indiana and Pennsylvania, July-August 2011. MMWR Morb. Mor-tal. Wkly. Rep. 60:1213–1215.

21. World Health Organization. 2002. Laboratory procedures: WHO man-ual on animal influenza diagnosis and surveillance. 2002:15– 66.

22. Jayasena SD. 1999. Aptamers: an emerging class of molecules that rivalantibodies in diagnostics. Clin. Chem. 45:1628 –1650.

23. Ellington AD, Szostak JW. 1990. In vitro selection of RNA molecules thatbind specific ligands. Nature 346:818 – 822.

24. Tuerk C, Gold L. 1990. Systematic evolution of ligands by exponentialenrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science249:505–510.

25. Cheng C, Dong J, Yao L, Chen A, Jia R, Huan L, Guo J, Shu Y, Zhang Z.2008. Potent inhibition of human influenza H5N1 virus by oligonucleotidesderived by SELEX. Biochem. Biophys. Res. Commun. 366:670–674.

26. Cui ZQ, Ren Q, Wei HP, Chen Z, Deng JY, Zhang ZP, Zhang XE. 2011.Quantum dot-aptamer nanoprobes for recognizing and labeling influenzaA virus particles. Nanoscale 3:2454 –2457.

27. Gopinath SC, Misono TS, Kawasaki K, Mizuno T, Imai M, Odagiri T,Kumar PK. 2006. An RNA aptamer that distinguishes between closelyrelated human influenza viruses and inhibits haemagglutinin-mediatedmembrane fusion. J. Gen. Virol. 87:479 – 487.

28. Jeon SH, Kayhan B, Ben-Yedidia T, Arnon R. 2004. A DNA aptamerprevents influenza infection by blocking the receptor binding region of theviral hemagglutinin. J. Biol. Chem. 279:48410 – 48419.

29. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evo-lutionary genetics analysis (MEGA) software, version 4.0. Mol. Biol. Evol.24:1596 –1599.

30. Zuker M. 2003. Mfold web server for nucleic acid folding and hybridiza-tion prediction. Nucleic Acids Res. 31:3406 –3415.

31. Wang P, Hatcher KL, Bartz JC, Chen SG, Skinner P, Richt J, Liu H,

Sreevatsan S. 2011. Selection and characterization of DNA aptamersagainst PrP(Sc). Exp. Biol. Med. (Maywood) 236:466 – 476.

32. Zianni M, Tessanne K, Merighi M, Laguna R, Tabita FR. 2006. Identi-fication of the DNA bases of a DNase I footprint by the use of dye primersequencing on an automated capillary DNA analysis instrument. J.Biomol. Tech. 17:103–113.

33. Ramakrishnan MA, Wang P, Abin M, Yang M, Goyal SM, Gramer MR,Redig P, Fuhrman MW, Sreevatsan S. 2010. Triple reassortant swineinfluenza A (H3N2) virus in waterfowl. Emerg. Infect. Dis. 16:728 –730.

34. Hirst GK. 1941. The agglutination of red cells by allantoic fluid of chickembryos infected with influenza virus. Science 94:22–23.

35. Weis W, Brown JH, Cusack S, Paulson JC, Skehel JJ, Wiley DC. 1988.Structure of the influenza virus haemagglutinin complexed with its recep-tor, sialic acid. Nature 333:426 – 431.

36. Lamont EA, He L, Warriner K, Labuza TP, Sreevatsan S. 2011. A singleDNA aptamer functions as a biosensor for ricin. Analyst 136:3884 –3895.

37. Luzi E, Minunni M, Tombelli S, Mascini M. 2003. New trends in affinitysensing: aptamers for ligand binding. Trends Anal. Chem. 22:810 – 818.

38. Tuerk C. 1997. Using the SELEX combinatorial chemistry process to findhigh-affinity nucleic acid ligands to target molecules. Methods Mol. Biol.67:219 –230.

39. Brody EN, Gold L. 2000. Aptamers as therapeutic and diagnostic agents.J. Biotechnol. 74:5–13.

40. Bunka DH, Stockley PG. 2006. Aptamers come of age at last. Nat. Rev.Microbiol. 4:588 –596.

41. Javier DJ, Nitin N, Levy M, Ellington A, Richards-Kortum R. 2008.Aptamer-targeted gold nanoparticles as molecular-specific contrastagents for reflectance imaging. Bioconjug. Chem. 19:1309 –1312.

42. Sassolas A, Blum LJ, Leca-Bouvier BD. 2011. Optical detection systemsusing immobilized aptamers. Biosens. Bioelectron 26:3725–3736.

43. Stojanovic MN, de Prada P, Landry DW. 2001. Aptamer-based foldingfluorescent sensor for cocaine. J. Am. Chem. Soc. 123:4928 – 4931.

44. Syed MA, Pervaiz S. 2010. Advances in aptamers. Oligonucleotides 20:215–224.

45. Yan X, Cao Z, Lau C, Lu J. 2011. DNA aptamer folding on magneticbeads for sequential detection of adenosine and cocaine by substrate-resolved chemiluminescence technology. Analyst 135:2400 –2407.

46. Gold L, Polisky B, Uhlenbeck O, Yarus M. 1995. Diversity of oligonu-cleotide functions. Annu. Rev. Biochem. 64:763–797.

47. Breaker RR. 1997. DNA aptamers and DNA enzymes. Curr. Opin. Chem.Biol. 1:26 –31.

48. Ito T, Suzuki Y, Mitnaul L, Vines A, Kida H, Kawaoka Y. 1997. Receptorspecificity of influenza A viruses correlates with the agglutination of eryth-rocytes from different animal species. Virology 227:493– 499.

49. Kayali G, Setterquist SF, Capuano AW, Myers KP, Gill JS, Gray GC.2008. Testing human sera for antibodies against avian influenza viruses:horse RBC hemagglutination inhibition versus microneutralization as-says. J. Clin. Virol. 43:73–78.

50. Louisirirotchanakul S, Lerdsamran H, Wiriyarat W, Sangsiriwut K, Chai-choune K, Pooruk P, Songserm T, Kitphati R, Sawanpanyalert P, KomoltriC, Auewarakul P, Puthavathana P. 2007. Erythrocyte binding preference ofavian influenza H5N1 viruses. J. Clin. Microbiol. 45:2284–2286.

51. Lauring AS, Andino R. 2010. Quasispecies theory and the behavior ofRNA viruses. PLoS Pathog. 6:e1001005. doi:10.1371/journal.ppat.1001005.

52. Ramakrishnan MA, Tu ZJ, Singh S, Chockalingam AK, Gramer MR,Wang P, Goyal SM, Yang M, Halvorson DA, Sreevatsan S. 2009. Thefeasibility of using high-resolution genome sequencing of influenza A vi-ruses to detect mixed infections and quasispecies. PLoS One 4:e7105. doi:10.1371/journal.pone.0007105.

53. Bean WJ, Schell M, Katz J, Kawaoka Y, Naeve C, Gorman O, WebsterRG. 1992. Evolution of the H3 influenza virus hemagglutinin from humanand nonhuman hosts. J. Virol. 66:1129 –1138.

54. Zhang W, Jiang Q, Chen Y. 2007. Evolution and variation of the H3 geneof influenza A virus and interaction among hosts. Intervirology 50:287–295.

55. Park SY, Kim S, Yoon H, Kim KB, Kalme SS, Oh S, Song CS, Kim DE.2011. Selection of an antiviral RNA aptamer against hemagglutinin of thesubtype H5 avian influenza virus. Nucleic Acid Ther. 21:395– 402.

56. Choi SK, Lee C, Lee KS, Choe SY, Mo IP, Seong RH, Hong S, Jeon SH.2011. DNA aptamers against the receptor binding region of hemaggluti-nin prevent avian influenza viral infection. Mol. Cells 32:527–533.

Wongphatcharachai et al.

54 jcm.asm.org Journal of Clinical Microbiology

on Decem

ber 30, 2012 by guesthttp://jcm

.asm.org/

Dow

nloaded from