NN

NA

Te

AnprttHsakbdma8pdgfitaoaaepAdg1liftE

Kd

*3EACctisv

Neuroscience 170 (2010) 789–799

0d

EUROPEPTIDE CODING OF SYMPATHETIC PREGANGLIONIC

EURONS; FOCUS ON ADRENALLY PROJECTING POPULATIONS

Iafiagp1mtctMpastt

mni(Aabuos(irkiitwcrqt

r(rrtct

. N. KUMAR, K. ALLEN, L. PARKER, H. DAMANHURIND A. K. GOODCHILD*

he Australian School of Advanced Medicine, Faculty of Human Sci-nces, Macquarie University, Sydney, NSW, 2109, Australia

bstract—Chemical coding of sympathetic preganglioniceurons (SPN) suggests that the chemical content of sub-opulations of SPN can define their function. Since neu-opeptides, once synthesized are transported to the axonerminal, most demonstrated chemical coding has been iden-ified using immunoreactive terminals at the target organ.ere, we use a different approach to identify and quantify theubpopulations of SPN that contain the mRNA for pituitarydenylate cyclase activating polypeptide (PACAP) or en-ephalin. Using double-labeled immunohistochemistry com-ined with in situ hybridization (ISH) we firstly identified theistribution of these mRNAs in the spinal cord and deter-ined quantitatively, in Sprague–Dawley rats, that many SPN

t the T4-T10 spinal level contain preproPACAP (PPP�,0�3%, n�3), whereas a very small percentage contain pre-roenkephalin (PPE�, 4�2%, n�4). A similar neurochemicalistribution was found at C8-T3 spinal level. These data sug-est that PACAP potentially regulates a large number ofunctions dictated by SPN whereas enkephalins are involvedn few functions. We extended the study to explore those SPNhat control adrenal chromaffin cells. We found 97�5% ofdrenally projecting SPN (AP-SPN) to be PPP� (n�4) withnly 47�3% that were PPE� (n�5). These data indicate thatdrenally projecting PACAPergic SPN regulate both adrenaldrenaline (Ad) and noradrenaline (NAd) release whereas thenkephalinergic SPN subpopulation must control a (sub)opulation of chromaffin cells – most likely those that released. The sensory innervation of the adrenal gland was alsoetermined. Of the few adrenally projecting dorsal root gan-lia (AP-DRG) observed, 74�12% were PPP� (n�3), whereas�1% were PPE� (n�3). Therefore, if sensory neurons re-ease peptides to the adrenal medulla, PACAP is most likelynvolved. Together, these data provide a neurochemical basisor differential control of sympathetic outflow particularlyhat to the adrenal medulla. © 2010 IBRO. Published bylsevier Ltd. All rights reserved.

ey words: PACAP, enkephalin, noradrenaline, adrenaline,orsal root ganglia.

Corresponding author. Tel: �61-2-9812-3550; fax: �61-2-9812-610.-mail address: ann.goodchild@asam.mq.edu.au (A. K. Goodchild).bbreviations: Ad, adrenaline; AP-SPN, adrenally projecting SPN;TB, cholera toxin B; DRG, dorsal root ganglia; IML, intermediolateralolumn of the spinal cord; -ir, immunoreactivity; ISH, in situ hybridiza-ion; NAd, noradrenaline; PACAP, pituitary adenylate cyclase activat-ng polypeptide; PPE, preproenkephalin; PPP, preproPACAP; SPN,

1ympathetic preganglionic neurons; TH, tyrosine hydroxylase; vAChT,esicular acetylcholine transporter.

306-4522/10 $ - see front matter © 2010 IBRO. Published by Elsevier Ltd. All rightoi:10.1016/j.neuroscience.2010.07.047

789

n mammals, sympathetic preganglionic neurons (SPN)re arranged in columns in a topographic and viscerotopicashion (Strack et al., 1988; Pyner and Coote, 1994b) andnnervate sympathetic postganglionic neurons that syn-pse at target organs. The exception to this is the adrenalland where innervation arises directly from a specificopulation of SPN (Strack et al., 1989; Pyner and Coote,994a). While acetylcholine is the recognized neurotrans-itter in all SPN there is a good amount of evidence that

he sub-populations of SPN contain specific sets of neuro-hemicals which may ultimately provide information aboutheir function (Gibbins, 1992; Grkovic and Anderson, 1997;urphy et al., 2003). The neuropeptides of interest, theituitary adenylate cyclase activating polypeptide (PACAP)nd enkephalin, have been identified in SPN however theize of these neuronal populations, their distributionhroughout the spinal cord and their rostrocaudal distribu-ion have not been determined.

The identification of “chemical coding” is most com-only conducted immunohistochemically at nerve termi-als of the target organ. For example specific biomarkers

dentifying distinct functional classes of cat sudomotorShafton et al., 1992), rat secretomotor (Grkovic andnderson, 1995), rat cardiac (Anderson, 1998) and catdrenal (Edwards et al., 1996) preganglionic neurons haveeen demonstrated. Identification of functional SPN pop-lations is not common as immunohistochemical detectionf neuropeptides in somata is difficult unless colchicine orimilar inhibitors of cytoplasmic transport are utilizedWooten et al., 1975). Here, we have used in situ hybrid-zation (ISH) to identify the gene expression of the neu-opeptide precursors preproPACAP (PPP) and preproen-ephalin (PPE) throughout the spinal cord and particularly

n SPN from the C8 to T10 spinal level and then specificallyn SPN that supply the adrenal gland. The advantages ofhe ISH approach firstly are the SPN somata are labeledithout any manipulation of cellular machinery which couldonfound results. Secondly, rather than identifying neu-opeptide labeling at terminal endings which are difficult touantify, we targeted the population of SPN that project tohe adrenal gland.

Noradrenaline (NAd) and adrenaline (Ad) secreting ad-enal chromaffin cells are each activated by specific stimuliVollmer et al., 1992) in line with the distinct physiologicaloles of the catecholamines produced. Ad is secreted inesponse to a reduction in blood glucose, whereas reduc-ion in blood pressure, arterial chemoreceptor activation,old exposure or hemorrhage selectively release NAd fromhe adrenal medulla (Gagner et al., 1985; Khalil et al.,

986; Vollmer, 1996; Morrison and Cao, 2000; Vollmer et

s reserved.

aaprA1

rPdcS2perPpaopnstEc(Hmctpqlaelsc

ottp(ctno

AvASSAC

(

daio

S

Ga(Ur(dmshractPTTi

Ci

Toa(T

cwUwcn1uImi((

R

TaioPcvtI(t5i(

e1

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799790

l., 2000; Cao and Morrison, 2001). For this independentctivation to occur, different central neural sympatheticathways converge on specific populations of SPN (Mor-ison and Cao, 2000) that in turn innervate either NAd ord secreting adrenal chromaffin cells (Edwards et al.,996; Morrison and Cao, 2000).

Some investigation of chemical coding in SPN withespect to PACAP and enkephalin has been conducted.ACAP mRNA and protein are expressed in the interme-iolateral column of the spinal cord where SPN are lo-ated, although the proportion and functional population ofPN has not been determined or quantified (Hannibal,002). PACAP is a potent secretagogue when applied toerfused adrenal gland or cultured chromaffin cells (Gaspot al., 1997; Tornoe et al., 2000, see; Ghzili et al., 2008 foreview). Immunohistochemical evidence indicates thatACAP is co-extensive with vesicular acetylcholine trans-orter (vAChT) in mouse adrenal medulla, although syn-pses were not demonstrated (Hamelink et al., 2002). Inne rat study PACAP immunoreactivity (-ir) was notresent in SPN although a population of PACAP-ir sensoryeurons was found (Dun et al., 1996a). Another studyuggests that PACAP-ir fibres were preferentially directedo NAd adrenal chromaffin cells (Holgert et al., 1996).nkephalin-ir was found to co-localize exclusively withholinergic fibres associated with Ad chromaffin cellsHolgert et al., 1996) confirming earlier suggestions (Pelto-uikko et al., 1985; Kent and Coupland, 1989). Further-ore, enkephalin peptide inhibits adrenomedullary cate-

holamine release in vivo (Jarry et al., 1989). Some ofhese studies have explored the co-localization of theseeptides in fibres rather than at functional synapses whereuantification is difficult, raising questions as to the actual

evel of innervation. Critically, while the spinal cord locationnd proportion of SPN innervating the adrenal gland is wellstablished (Strack et al., 1989; Pyner and Coote, 1994a),

ittle is known regarding the size or distribution of theubpopulation of SPN that innervate either type of adrenalhromaffin cell.

We aimed to (1) determine the distribution and proportionf PACAP- and enkephalin-ergic gene expression in SPN inhe thoracic spinal cord and compared these quantitatively inwo thoracic regions (C8-T3, T4-T10) and in order to com-rehensively assess the innervation of the adrenal gland we2) determined the distribution and proportion of AP-SPN thatontain PACAP- or enkephalin-ergic gene expression and (3)he distribution and proportion of adrenally projecting sensoryeurons in the dorsal root ganglia (DRG) that contain PACAPr enkephalin transcript.

EXPERIMENTAL PROCEDURES

ll experimental procedures were approved by the Macquarie Uni-ersity Animal Ethics Committee and were carried out following theustralian Code of Practice for the Care and Use of Animals forcientific Purposes. Experiments were performed on adult maleprague–Dawley rats (350–450 g) that were obtained from thenimal Resource Centre, Perth, WA, Australia and housed at theentral Animal House Facility, Macquarie University.

In the first group of animals the distribution of (PPP, n�3) or

PPE, n�5) mRNA was identified in SPN located in the interme- f

iolateral column of the spinal cord (IML). In the second group ofnimals the distribution of PPP (n�4) and PPE (n�5) mRNA was

dentified in AP-SPN and DRG. Additionally, the cholinergic naturef AP-SPN was confirmed in a single animal.

urgical procedures

roup 2 animals were anesthetized with a medetomidine/ket-mine (1 mg/50 mg/kg, i.p.) and given prophylactic analgesiaFlunixil 5 mg/kg s.c.) and antibiotic (cephazolin 0.55 g/kg i.m.).nder aseptic conditions, both adrenal glands were exposed ret-

operitoneally and each injected with 1–2 �l of cholera toxin BCTB) (1% in saline, List Biological, Campbell, CA, USA) asescribed previously (Springell et al., 2005). Once the adrenalicroinjection was complete, the wound was flushed with sterile

aline then sutured and the anesthetic reversed with atipamazoleydrochloride (3 mg/kg s.c.). The animals were left for 48 h thene-anesthetized with sodium pentobarbital (100 mg/kg i.p.). Allnimals were perfused transcardially with 150 ml ice-cold Dulbec-os modified eagle medium (DMEM pH 7.4, Sigma-Aldrich, Aus-ralia) for 4 min followed by 250 ml ice cold fixative solution (4%FA/0.1 M PB, pH 7.4) over 15 min under RNase free conditions.he spinal cord was removed in two segments (C8-T3 and T4-10, n�6) along with DRG (C8-T3 and T5-T10, n�3) and stored

n the same fixative (12–16 h, 4 °C).

ombined in situ hybridization andmmunohistochemistry

he spinal cord was divided in half sagittally and sagittal sectionsf the spinal cord (40 �m thick) together with sections of ipsilateralnd corresponding DRG were cut on a vibrating microtomeVT1200S, Leica Microsystems, North Ryde, NSW, Australia).he two spinal cord halves were processed separately.

Non-radioactive antisense and sense (control) riboprobes in-orporated with digoxigenin-11-UTP (Roche Applied Science)ere transcribed in vitro (Epicentre Biotechnologies, Madison, WI,SA) from PCR-generated, purified cDNA fragment templatesith T7 and SP6 RNA polymerase promoters. Riboprobes wereustom synthesized and validated as described previously (Stor-etta et al., 2001; Padley et al., 2007; Kumar et al., 2009). Tableoutlines the specifications for the riboprobes and antibodies

sed in this study. Free floating tissue sections were processed forSH using riboprobes targeting PPP or PPE mRNA combined withulti-fluorescence immunohistochemical (IHC) visualization (us-

ng primary antibodies targeting vAChT; tyrosine hydroxylaseTH); CTB and digoxigenin) using methods previously reportedPadley et al., 2007; Kumar et al., 2009).

iboprobe and antibody characterization

able 1 describes the primer sequences, probe length and GenBankccession number for PPE and PPP riboprobes. All primary antibod-

es used in this study feature in the Journal of Comparative Neurol-gy antibody database. In situ hybridization of digoxigenin labeledPP and PPE riboprobes was performed in spinal cord sections andompared with the distribution of vAChT-ir in the same tissue section.AChT-ir labels SPN as well as motor neurons in the spinal cord,hus providing a reference point for the distribution of PPP and PPESH in this region. The vAChT antibody was purchased from SigmaCat# V5387, Lot# 095K-4791). The immunogen is a synthetic pep-ide corresponding to the C-terminal of rat vAChT (amino acids12-530). This polyclonal antibody reacts with 70 kDa vAChT and

dentifies a single 70 kDa band on western blots of rat brain extractsmanufacturer’s information).

We used sheep anti-digoxigenin antibody from Roche Applied Sci-nce (alkaline phosphatase Fab fragments Cat# 11093274910, Lot#2930024) to detect hybridized riboprobe. Polyclonal antibodies

rom sheep show 100% reactivity with digoxigenin and digoxin, but

n(tcspscfb

LwrcaaeCm

r(irtb

D

Ps

l(b(PD

S

Awtvcdsfia

TtdcCl2(Twu

T

m

PPPP

*s

T

R

S

S

Na

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799 791

o cross-reactivity with other steroids, such as human estrogense.g. estradiol) or androgens (e.g. testosterone). After immuniza-ion with digoxigenin, sheep IgG was purified by ion exchangehromatography and the specific IgG was isolated by immuno-orption. The Fab fragments obtained by papain digestion wereurified by gel filtration, conjugated to alkaline phosphatase, andtabilized in buffer. The labeling of nucleic acids with DIG isovered by EP patents 0 324 474 and 0 371 262 as well as theollowing US patents 5.344.757, 5.354.657 and 5.702.888 ownedy Roche Diagnostics GmbH.

Polyclonal goat anti CTB was purchased from List Biologicalaboratories (Cat#703, Lot# 7032A3). Polyclonal rabbit anti CTBas purchased from Virostat (Cat# 7927, Lot# CF609) and is

ecommended for immunohistochemistry and fluorescence mi-roscopy (manufacturer’s information). CTB was injected into thedrenal gland and detected after retrograde transport from thedrenal gland to the spinal cord. CTB is not produced endog-nously in mammals and therefore not detected when goat antiTB antibody was used to process tissue from non-injected ani-als.

Monoclonal TH antisera (Sigma clone TH-2, Cat# T1299)ecognizes an epitope present in the N-terminal region of rodent�60 kDa) TH. The antibody is reactive in immunohistochemical,mmunoblotting, and immunoprecipitation protocols and cross-eacts with TH from rat. The immunohistochemical sensitivity ofhe antibody is sufficient to visualize TH-positive fibers with lowackground.

ata analysis

rocessed sections were mounted on glass slides and cover-lipped with mounting medium (Vectashield Hardset, Vector, Bur-

able 1a. Riboprobe sequence information

RNA Primer (5=–3=)*

PE (F) ATTTAGGTGACACTATAGAAGctaaatgcagctaccgcPE (R) TAATACGACTCACTATAGGGAGAttccatctcgggaacPP (F) GGATCCATTTAGGTGACACTATAGAAGttacgatcaPP (R) GAATTCTAATACGACTCACTATAGGGAGAtgcacg

Capital letters indicate T7 (attached to reverse primer) or SP6 (attacequence for the target gene product.

able 1b. Riboprobes and antibodies used

iboprobe Primary antisera (species)

tudy 1PPE Anti-DIG AP conjugate (sheep)

Anti vAChT (rabbit)PPP Anti-DIG AP conjugate (sheep)

Anti vAChT (rabbit)tudy 2PPE Anti-DIG AP conjugate (sheep)

Anti-CTB (rabbit)Anti-TH (mouse)

PPP Anti-DIG AP conjugate (sheep)Anti-CTB (rabbit)Anti-TH (mouse)

n/a Anti vAChT (rabbit)Anti-CTB (goat)

*Secondary antibodies were affinity purified.PPE, preproenkephalin; PPP, preproPACAP; DIG, digoxigenin; AP, aBT, Nitro-Blue Tetrazolium Chloride; BCIP, 5-Bromo-4-Chloro-3=–cetylcholine transporter; TH, tyrosine hydroxylase.

# All secondary antibodies were used at 1:500 dilution and sourced from Jac

ingame, CA, USA) before viewing on a fluorescence microscopeZ1, Carl Zeiss, Germany). Images were processed, adjusted forrightness and contrast and acquired using Axiovision softwareCarl Zeiss, Release 4.7.2). Data was analyzed using Graphpadrism software (Version 4.02) and figures produced using Corel-raw software (Version 12).

ampling and assessing co-localization

ll sections retrieved were analyzed. SPN cell bodies in the IMLere analyzed. Criteria used for identification were that they con-

ained vAChT-ir and were arranged in clusters as described pre-iously (Arvidsson et al., 1997). Only those SPN that could belearly delineated with nucleus and more than one proximal den-rite were counted. Co-expression of peptide mRNA was as-essed and quantified as a percentage of total SPN. The identi-cation of AP-SPN was aided by visualization of TH-ir fibers whichggregate in the IML.

Four to six sections containing DRG from C8-T3 and T5-10 spinal level were examined and analyzed from each of

hree animals and the average number of cells per group wasescribed. PPE�/CTB-ir neurons were expressed as a per-entage of adrenally projecting (CTB-ir) cells as were PPP�/TB-ir neurons. Small cells were defined as having a diameter

ess than 25 �m, medium cells with a diameter greater than5– 45 �m and large cells with diameter greater than 45 �mNicholson et al., 2003). Data are presented as mean�SEM.he area of the DRG section occupied by PPP� or PPE� cellsas assessed as a percentage of the total area of DRG cellssing MatLab software.

Riboprobe length GeneBank Accession No.

743 bp BC083563

acc 672 bp NM_016989.2tgctc

rward primer) promoter sequences. Lower case letters are the primer

tion (source) Secondary antisera�#/detection (source)

00 (Roche) NBT/BCIP (Roche)00 (Sigma) Donkey anti rabbit Cy300 (Roche) NBT/BCIP (Roche)00 (Sigma) Donkey anti rabbit Cy3

00 (Roche) NBT/BCIP (Roche)00 (Virostat) Donkey anti rabbit Cy300 (Sigma) Donkey anti mouse FITC00 (Roche) NBT/BCIP (Roche)00 (Virostat) Donkey anti rabbit Cy300 (Sigma) Donkey anti mouse FITC00 (Sigma) Donkey anti rabbit Cy300 (Sigma) Donkey anti mouse FITC

hosphatase; Cy3, indocarbocyanine; FITC, fluorescein isothiocyanate,sphate p-Toluidine Salt; CTB, Cholera toxin B; vAChT, vesicular;

ctgttctttggacggaacttatgaat

hed to fo

Dilu

1:101:8

1:101:8

1:101:501:301:101:501:30

1:81:10

lkaline pIndolypho

kson Immunoresearch.

D

S�pBnhttb

trsPue

iwhfamv

nPtcvT(tva

Fpba

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799792

RESULTS

istribution of SPN containing PPP and PPE mRNA

pinal cord sections contained clusters of SPN (vAChT-ir,25–35 �m diameter) arranged in columns as describedreviously for the IML (Arvidsson et al., 1997) (Fig. 1A1,1, C1, D1). SPN were easily distinguished from motoreurons in the ventral horn which were also vAChT-ir butad larger somata (�50 �m diameter) and were charac-

eristically covered in large vAChT-ir boutons. Control sec-ions lacking primary antibody were negative for IHC la-els.

PACAP mRNA containing (PPP�) neurons in the in-ermediate gray region of the spinal cord were largelyestricted to the IML at both rostrocaudal levels of thepinal cord (Fig. 1 A2, B2). There was also some faintPP� labeling in the dorsal horn as described previouslysing immunohistochemistry (Hannibal, 2002; Petterssont al., 2004). The ventral horn was devoid of PPP� label-

ig. 1. Distribution of PPP (left panel) and PPE (right panel) mRNA in thereganglionic neurons (SPN) (A1, B1, C1, D1) in the IML (located betwee

e seen in motor neurons of the ventral horn (bottom of B1, C1 and D1). PPP� nere distributed throughout the dorsal horn and intermediate grey zone, including th

ng. Enkephalin mRNA containing (PPE�) neurons had aider distribution in the spinal cord than PPP� neurons. Aigh density of small, densely packed PPE� neurons wasound in the dorsal horn, with a wide distribution of largernd more scattered PPE� neurons throughout the inter-ediate gray region including the IML (Fig. 1 C2, D2). The

entral horn was largely devoid of PPE� neurons.High magnification images of SPN clusters (vAChT-ir

eurons within the IML) show that many SPN containedACAP mRNA (Fig. 2 A1, 2, white arrowheads). Quanti-

ative analysis showed that the majority of vAChT-ir SPNontained PACAP mRNA at both C8-T3 (79�6%, 603AChT-ir neurons counted in three animals [n�3]) and4-T10 (80�3%, 611 vAChT-ir neurons counted, n�3)

Fig. 2 A3). Many non-vAChT-ir neurons in the region ofhe IML were PPP� (Fig. 2 A1, A2 arrow) and someAChT-ir neurons were not PPP� (Fig. 2 A1, A2, greyrrowhead). Control sections processed with sense ribo-

d at C8-T3 (top) and T4-T10 (bottom) levels. vAChT-ir marks sympatheticite lines) which are arranged in rostrocaudal columns. vAChT-ir can also

spinal corn the wh

urons are restricted primarily to the IML (A1, A2, B1, B2). PPE� neuronse IML (C1, C2, D1, D2). Scale bars�100 �m.

pA

hnpo(dv(TnrapB

AT

AIAck1se

Dc

TrwCaDcwCcta(efiicCiCea9A

FAagC and PPEP

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799 793

robes for PPP were negative for PPP ISH labels (Fig. 24, A5) as described previously (Farnham et al., 2008).

SPN that were PPE� (Fig. 2 B1, B2, white arrow-eads) were clearly distinguished from those that wereot when viewed at high power and focused in the samelane (Fig. 2 B1, B2 grey arrowheads). Clear examplesf both single- and double-labeled neurons are shownFig. 2 B1, B2). However with quantitative analysis,espite the abundance of PPE� neurons in the area,ery few SPN (vAChT-ir) were PPE� at either C8-T32.0�0.4%, 1827 vAChT-ir neurons counted, n�5) or4-T10 (4.3�1.9%, 1533 vAChT-ir neurons counted,�4) spinal levels (Fig. 2 B3). Many non-vAChT-ir neu-ons in the region of the IML were PPE� (Fig. 2 B1, B2rrow). Control sections processed with sense ribo-robes for PPE were negative for PPE ISH labels (Fig. 24, B5) as described previously (Stornetta et al., 2001).

drenally projecting SPN (AP-SPN) at C8-T3 and4-T10 spinal levels

P-SPN (CTB-ir) were co-localized with vAChT-ir in theML. In one animal 100% of AP-SPN were cholinergic.P-SPN made up 35% of all SPN at T4-T10 spinal levelompared to 8% at C8-T3 spinal level (data not shown) ineeping with that demonstrated previously (Strack et al.,988; Pyner and Coote, 1994a). From here on it is as-umed that CTB-ir neurons expressing PPE or PPP also

ig. 2. Co-localization of PPP and PPE mRNA in SPN. In this examp2) and some PPE� neurons (black, B1) in the IML co-localize witrrowheads), SPN that are not ISH positive (grey arrowheads) and ISrouped data represents the total proportion of SPN (vAChT-ir neuron8-T3 and T4-T10 spinal levels. Tissue sections processed with PPPPP (A5) and PPE (B5) ISH labels, respectively. Scale bars�50 �m.

xpress vAChT-ir. T

istribution of PACAP and enkephalin mRNAontaining adrenally projecting SPN (AP-SPN)

he rostrocaudal distribution, number and morphology ofetrogradely labelled AP-SPNs (Fig. 3) were in accordanceith previous reports (Bacon and Smith, 1988; Pyner andoote, 1994a). There were many fewer AP-SPN (CTB-ir)t C8-T3 level (56�16 cells, n�9 hemichords, Fig. 3 A2,2) compared to T4-T10 levels (481�46 cells, n�9 hemi-hords, Fig. 3 B2, E2). At T4-T10 spinal level AP-SPNere always arranged in clusters, whereas those found at8-T3 level were more sparsely distributed (Fig. 3 B2, E2ompared to A2, D2). Interestingly, this rostrocaudal dis-ribution was correlated with that for PPP and PPE mRNAt both C8-T3 (Fig. 3 A1, D1) and T4-T10 spinal levelsFig. 3 B1, E1). The TH-ir (Fig. 3 A3, B3, D3, E3) delin-ated putative SPN since dense innervation of SPN by THbres is well established (Anderson et al., 1989). As shown

n the merged images in Fig. 3, double-labeled neurons arelearly identified by the overlap of positive ISH label withTB-ir (A4, B4, D4, E4). In some cases, these neurons are

nterspersed among neurons singly labeled with eitherTB (Fig. 3 E4) or ISH label (Fig. 3 A4, B4). When thentire population of AP-SPN was counted, we found thatlmost all AP-SPN were PPP� (96�5%, C8-T3 n�4;7�5%, T4-T10, n�4, Fig. 3C) whereas about 50% ofP-SPN were PPE� (52�15%, C8-T3, n�5; 47�3%, T4-

PPP� neurons (black, A1) in the IML co-localize with vAChT-ir (red,-ir (red, B2) at T4-T10 spinal level. Double labeled neurons (whitee neurons that are not SPN (white arrows) are clearly indicated. TheIML that contain PPP (A3, �80%) and PPE (B3, �4%) mRNA in atsense riboprobes combined with vAChT-ir (A4, B4) were negative for

le, manyh vAChTH positivs) in the

10, n�5, Fig. 3F).

Dc

Psto

cis�

r

FracTd 100%) a

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799794

istribution of PACAP and enkephalin mRNAontaining adrenally projecting dorsal root ganglion

PP� cells were abundant throughout DRG, medium inize (25–40 �m diameter) and occupied 30–40% of theotal area of each DRG section (Fig. 4 A1). There were one

ig. 3. PPP (left panel) and PPE (right panel) mRNA expression inepresent C8-T3 and T4-T10 spinal levels respectively. PPP mRNA (ppositions with tyrosine hydroxylase (TH-ir, green, A3, B3) terminalso-localizes with adrenally projecting (CTB-ir, red, D2, E2) SPN that hahe merged images (D4, E4) clearly shown double labeled and singlyata shows the proportion of AP-SPN (CTB-ir) that contain PPP (C, �

r two large (�45 �m diameter), intensely stained PPP� n

ells in each section. In contrast, PPE� cells were sparsen DRG occupying�1% of the total area of each DRGection (Fig. 4 B1). All PPE� cells were very small (�20m diameter). Adrenal medullary projecting (CTB-ir) neu-

ons in the dorsal root ganglia (AP-DRG) were few in

projecting SPN (AP-SPN). Left and right column within each panel, B1) co-localizes with AP-SPN (CTB-ir, red, A2, B2) that have closeed by merged images (A4, B4). Similarly, PPE mRNA (black, D1, E1)appositions with tyrosine hydroxylase (TH-ir, green, D3, E3) terminals.eurons in the same field of view. Scale bars�20 �m. The quantitativend PPE (F, �50%) mRNA at C8-T3 and T4-T10 spinal cord levels.

adrenallyblack, A1as indicatve closelabeled n

umber (273 cells in three animals, C8-T10, Fig. 4 A2, B2)

afCpnlCc

TcmuiicasccmuaNmsr

pa

dnvvudi1I

Waeplictbd(stttaYrss

FiPS proportio(

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799 795

nd all were medium in size (25–35 �m diameter). Weound a smaller proportion of PPP� AP-DRG neurons at8-T3 spinal level (20�20%, five CTB-ir cells, n�3) com-ared to T5-T10 spinal level (74�12%, 112 CTB-ir cells,�3, Fig. 4 A3). There was a very small but similar popu-

ation of PPE� AP-DRG at both C8-T3 (4�4%, nineTB-ir cells, n�3) and T5-T10 (0.7�0.7%, 147 CTB-irells, n�3, Fig. 4 B3) spinal levels.

DISCUSSION

he major findings of this study are that �80% of SPNontain PPP mRNA whereas very few (�4%) contain PPERNA and this proportion is consistent throughout thepper and lower thoracic spinal cord. Although PPE mRNA

s relatively rare in the total SPN population they are foundn 50% of the population projecting to the adrenal gland. Inontrast, all AP-SPN contained PPP mRNA. Finally, thedrenal gland receives very limited innervation from sen-ory neurons in the DRG and 70% of these are PPP�,onfirming previous findings (Dun et al., 1996b), but fewontain PPE mRNA. These data suggest that, when theRNA is translated, biologically active PPP protein prod-cts (PACAP-27 and PACAP-38) can potentially regulatedrenal function, specifically the secretion of both Ad andAd. All PPE� AP-SPN also express PPP. These neuronsay also release PPE related protein products and we

peculate that these control the secretion of Ad, which iseleased from 75% of chromaffin cells.

Our finding of spinal cord PPP mRNA expression to beredominantly located in the IML of the spinal cord is in

ig. 4. PPP (top panel) and PPE (bottom panel) mRNA expression ins sparse in DRG at T4-T10 spinal level. Few adrenally projecting DRGPP� (A1, A2, arrowheads) and not PPP� (A1, A2, arrow) are indicatcale bars�50 �m. Grouped data are shown (A3, B3). A much larger

A3, P�0.12 (paired t-test), P�0.08 (unpaired t-test)).

greement with previous studies (Dun et al., 1996a; Beau- b

et et al., 1998). The demonstration of PPP mRNA in lowumbers of dorsal horn neurons and very low numbers ofentral horn neurons in the spinal cord also confirms pre-ious findings (Pettersson et al., 2004). While we werenable to ascribe PPP mRNA to an exact cell layer in theorsal horn, previous reports using radiolabeled ISH and

mmunohistochemistry (Dun et al., 1996a; Beaudet et al.,998; Hannibal, 2002), have observed labeling in laminaeand II of the dorsal horn.

Our data show that �80% of SPN contain PPP mRNA.hile PPP mRNA has been demonstrated in cells in or

round the IML in rat (Hannibal, 2002), mouse (Hamelinkt al., 2002) and pig (Tornoe et al., 2000), they have notreviously been identified or quantified in the SPN popu-

ation. PACAP-38 peptide was present in some cell bodiesn the thoracic lateral horn following pretreatment witholchicine (Hannibal, 2002) whereas another study failedo demonstrate the presence of the peptide in IML cellodies in untreated animals (Dun et al., 1996a). Our newata suggest that peptides encoded by PPP mRNAPACAP-27 and PACAP-38) could regulate the activity ofympathetic postganglionic neurons involved in many, al-hough not all, functions dictated by SPN at all levels of thehoracic spinal cord. Previous identification of PAC1 recep-or in the superior cervical ganglion (Beaudet et al., 1998)nd adrenal medullary chromaffin cells (Lamouche andamaguchi, 2001) provides a mechanism for PACAP, if

eleased, to exert biological actions at these postsynapticites. Furthermore it is recognized that PACAP is a potentecretogogue for adrenal medullary catecholamine (see

projecting DRG. PPP mRNA (A1) is abundant while PPE mRNA (B1)(CTB-ir, A2, B2) were seen. Adrenally projecting DRG cells that wererenally projecting DRG neurons were PPE� in this example (B1, B2).

n of adrenally projecting DRG cells were PPP� at T5-T10 than C8-T3

adrenallyneurons

ed. No ad

elow). Our observation of similar proportions of PPP�

SiWpP

pSggt1w(casaefsi(Wswn2etcekll

pSNmape(maPceaIdftSmgca

cptMntmcitctpfci

eifSFgatn(

TpwmpsHWToDietrsB

Ta

Orcopp(s(

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799796

PN at upper and lower thoracic segments reinforces thedea that PACAP influences many sympathetic functions.

hether or not the inter-segmental distribution of theseeptide fragments/products further subdivides the SPNPP� population remains to be determined.

In contrast, we have demonstrated that PPE mRNA isresent in only �4% of SPN. Our finding of PPE mRNA inPN is in accord with previous findings in sympatheticanglia of guinea-pig, human and rat where some pregan-lionic fibers are immunoreactive for enkephalin (Schul-

zberg et al., 1978; Hervonen et al., 1980; Morales et al.,995; Chanthaphavong et al., 2003) although the dataere not quantified. In agreement with previous studies

Harlan et al., 1987), we found that in the thoracic spinalord PPE� neurons are restricted to the dorsal horn, IMLnd area surrounding the central canal. We did not ob-erve a difference in the proportion of PPE� SPN at uppernd lower thoracic spinal cord, however, our finding of annriched population of PPE� AP-SPN certainly warrantsurther investigation of other functional SPN populations atpinal segmental levels. Enkephalin-ir has been describedn identified SPN following colchicine pretreatment in ratsDàlsgaard et al., 1982; Kondo et al., 1985; Hong and

eaver, 1993; Sámano et al., 2009) and quantified in aingle study where 33% of SPN from C7-T3 spinal levelere found to contain met-enkephalin however the totalumber of SPN counted was not indicated (Sámano et al.,009). Reasons for the discrepancy between our genexpression study and this peptide expression study remaino be determined, although sequential antibody stainingonducted by Sámano et al. (2009) beginning with cholin-rgic markers may have caused a high level of met-en-ephalin-ir false positives. Curiously, Sámano and col-eagues also failed to label the large number of non-cho-inergic PPE� SPN identified in the present study.

Our data demonstrate that PACAP is most likely aeptide co-transmitter, along with acetylcholine, in all AP-PN, and thus contributes to the control of both Ad andAd chromaffin cells as suggested previously in theouse (Hamelink et al., 2002) and by the potency of itsction as a secretogogue (Gaspo et al., 1997). However, arevious study indicates that NAd chromaffin cells prefer-ntially receive a greater degree of PACAP innervationHolgert et al., 1996). The anatomical arrangement of chro-affin cells in functional clusters may further support thisrgument (Iijima et al., 1992). While we have shown thatPP mRNA is expressed in all SPN, this may not indicateorresponding peptide levels in all SPN because of differ-nt rates of translation (Mikulits et al., 2000) or lack ofctual peptide release at the adrenomedullary synapse.mportantly, different processing of prepro message orifferent processing of peptide products may also accountor a discrepancy between mRNA and corresponding pep-ide levels. It is also possible that despite co-expression inPN somata, PACAP is segregated from other co-trans-itters in axon fibers and directed to sympathetic pregan-lionic varicosities that only innervate NAd chromaffinells. This concept was originally proposed by (Sámano et

l., 2006, 2009). P

We found about half of AP-SPN to be PPE�. Thisorrelates well with studies demonstrating that a subset ofreganglionic nerve fibres that are enkephalin-ir preferen-ially innervate Ad chromaffin cells (Holgert et al., 1996;urphy et al., 2003) emphasizing that secretion of Ad butot NAd can be controlled by the release of enkephalin athe adrenomedullary synapse. This indicates that Ad chro-affin cells that account for 75% of adrenal chromaffin

ells (Verhofstad et al., 1985; Parker et al., 1993) arennervated by just 50% of AP-SPN. An alternative interpre-ation would be that only a subpopulation of Ad chromaffinells is innervated by PPE� SPN. Our data also indicateshat PPE� AP-SPN are also PPP�, revealing multipleeptides may play a complex role in controlling adrenalunction, and further indicates that the remaining 25% ofhromaffin cells that secrete NAd appear to be receive

nput from 50% of AP-SPN that are PPP�/PPE�.The distribution of PPE and PPP mRNA in SPN was

xamined only in the IML and not in other SPN loci-ntercalated nucleus, central autonomic nucleus and lateraluniculus. However, these nuclei harbor less than 8% ofPN projecting to the adrenal gland (Strack et al., 1988).urthermore, only SPN projecting directly to the adrenalland were quantified in the second study. Some minordrenal projections arise from the suprarenal and paraver-ebral ganglia however these fibres innervate predomi-antly blood vessels in the adrenal cortex and medullaKesse et al., 1988; Oomori et al., 1991).

Our data indicate that DRG located at spinal segments4-T10 provide input to the adrenal gland as describedreviously (Strack et al., 1988; Zhou et al., 1991). Furthere show this originates from a small PPP but not PPERNA containing input to the rat adrenal gland. Multipleeptides including PACAP and enkephalin have been de-cribed in DRG (Senba et al., 1989; Zhou et al., 1991;eym et al., 1995; Dun et al., 1996b; Tornoe et al., 2000).e identified a larger subset of PPP� AP-DRG cells at

5-T10 spinal level than the proportion described previ-usly using immunohistochemistry (Moller et al., 1993;un et al., 1996b). The function of the peptidergic DRG

nnervation of the adrenal gland is not clear, althoughvidence indicates that under pathophysiological condi-ions, such as spinal cord injury and neuropathic pain,elease of neurotransmitter at the peripheral terminals ofensory neurons is upregulated (Hadjipavlou et al., 1998;rain and Cox, 2006).

he role of PACAP and enkephalin at thedreno-medullary synapse

ur data indicate that both PACAP and enkephalin or theirelated peptides provide significant control of Ad and NAdhromaffin cells. In light of the data presented here and bythers (Hamelink et al., 2002) PACAP is most likelyresent at all cholinergic adreno-medullary synapses androbably functions to regulate catecholamine releaseSee; Ghzili et al., 2008 for review). Splanchnic nervetimulation induces PACAP secretion in the adrenal glandLamouche and Yamaguchi, 2003). Local administration of

ACAP induces secretion of five-fold more Ad than NAd;

treaL

mlrac1afef

lYt1ba

P

Ttaurl1saitso

OfwepisotcmPsiacf

ct

AbHacc

A

A

A

B

B

B

C

C

D

D

D

E

F

G

G

G

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799 797

his release is blocked by selective blockade of PAC1eceptors but not affected by treatment with anti-cholin-rgic agents indicating a direct effect of PACAP on thedrenal medulla (Watanabe et al., 1995; Muroi et al., 2000;amouche and Yamaguchi, 2001).

Our data also indicate that PPE related peptides areost likely found in a subset of cholinergic adreno-medul-

ary synapses. Functionally, opioids control release of ad-enal catecholamines by inhibiting nicotinic receptor medi-ted secretion of catecholamines from adrenal chromaffinells at least in vitro (Marley et al., 1986; Kimura et al.,988; Jarry et al., 1989). Opioid regulation seems to oper-te to alter catecholamine release only at relatively highrequencies of splanchnic nerve stimulation in vivo (Kimurat al., 1988) consistent with the release of neuropeptidesrom dense core vesicles (Mansvelder and Kits, 2000).

SPN containing excitatory PACAP, inhibitory enkepha-in and other peptides including substance P, neuropeptide, somatostatin, neurotensin, calcitonin gene-related pep-

ide and vasoactive intestinal peptide (VIP) (Linnoila et al.,980; Kuramoto et al., 1985, 1986; Zhou et al., 1991) muste regulated exquisitely to evoke catecholamine specificnd possibly site regulated secretion from chromaffin cells.

erspectives

he results presented here indicate that multiple neuro-ransmitters can potentially be released at synapses ondrenal chromaffin cells. Differential release may occurnder different physiological circumstances as PACAP isequired for catecholamine secretion during periods of pro-onged metabolic stress (Yamaguchi and Lamouche,999; Hamelink et al., 2002) and, during severe hypoten-ion can also enhance cholinergically mediated catechol-mine release (Lamouche and Yamaguchi, 2003). PACAP

s not released under normal physiological conditions ashe antagonist PACAP-(6–38) has no effect on Ad or NAdecretion (Tornoe et al., 2000). Conditions under whichpioids are released are unknown.

CONCLUSION

ur data indicate that PACAPergic SPN regulate manyunctions dictated by the sympathetic nervous systemhereas enkephalinergic SPN control few functions. How-ver, PPE mRNA is greatly enriched in the SPN populationrojecting to the adrenal gland. Furthermore the results

ndicate a neurochemical basis for differential control ofympathetic outflow to the adrenal medulla as two groupsf SPN innervate the adrenal gland; PPP�/PPE� neurons

hat likely contribute to the innervation of Ad chromaffinells and PPP�/PPE� which appear to control NAd chro-affin cells. Our observation of many non-cholinergicACAP� and PPE� neurons in the IML indicate thatpinal interneurons with connections that can directly orndirectly affect sympathetic activity (Schramm, 2006) maylso contain these peptides. These data suggest that NAdhromaffin cells must receive PACAPergic innervation

rom SPN to control catecholamine release where as Ad

hromaffin cells are regulated by PACAPergic in additiono enkephalinergic inputs.

cknowledgments—Work in the authors’ laboratory is supportedy the NHMRC (457068), the NHF (G09S434), Hillcrest, theunter Medical Research Institute and Macquarie University. Theuthors would like to thank Melissa MJ Farnham for the generousontribution of PPP riboprobes, Peter GR Burke for helpful dis-ussion and Dr Johnson Thie for software development.

REFERENCES

nderson CR (1998) Identification of cardiovascular pathways in thesympathetic nervous system. Clin Exp Pharmacol Physiol 25:449–452.

nderson CR, McLachlan EM, Srb-Christie O (1989) Distribution ofsympathetic preganglionic neurons and monoaminergic nerve ter-minals in the spinal cord of the rat. J Comp Neurol 283:269–284.

rvidsson U, Riedl M, Elde R, Meister B (1997) Vesicular acetylcholinetransporter (VAChT) protein: a novel and unique marker for cho-linergic neurons in the central and peripheral nervous systems.J Comp Neurol 378:454–467.

acon SJ, Smith AD (1988) Preganglionic sympathetic neurones in-nervating the rat adrenal medulla: immunocytochemical evidenceof synaptic input from nerve terminals containing substance P,GABA or 5-hydroxytryptamine. J Auton Nerv Syst 24:97–122.

eaudet MM, Braas KM, May V (1998) Pituitary adenylate cyclaseactivating polypeptide (PACAP) expression in sympathetic pregan-glionic projection neurons to the superior cervical ganglion. J Neu-robiol 36:325–336.

rain SD, Cox HM (2006) Neuropeptides and their receptors: innova-tive science providing novel therapeutic targets. Br J Pharmacol147:S202–S211.

ao WH, Morrison SF (2001) Differential chemoreceptor reflex re-sponses of adrenal preganglionic neurons. Am J Physiol RegulIntegr Comp Physiol 281:R1825–R1832.

hanthaphavong RS, Murphy SM, Anderson CR (2003) Chemicalcoding of sympathetic neurons controlling the tarsal muscle of therat. Auton Neurosci 105:77–89.

àlsgaard CJ, Hökfelt T, Elfvin LG, Terenius L (1982) Enkephalin-containing sympathetic preganglionic neurons projecting to theinferior mesenteric ganglion: evidence from combined retrogradetracing and immunohistochemistry. Neuroscience 7:2039–2050.

un NJ, Miyazaki T, Tang H, Dun EC (1996a) Pituitary adenylatecyclase activating polypeptide immunoreactivity in the rat spinalcord and medulla: implication of sensory and autonomic functions.Neuroscience 73:677–686.

un NJ, Tang H, Dun SL, Huang R, Dun EC, Wakade AR (1996b)Pituitary adenylate cyclase activating polypeptide-immunoreactivesensory neurons innervate rat adrenal medulla. Brain Res716:11–21.

dwards SL, Anderson CR, Southwell BR, McAllen RM (1996) Distinctpreganglionic neurons innervate noradrenaline and adrenalinecells in the cat adrenal medulla. Neuroscience 70:825–832.

arnham MMJ, Li Q, Goodchild AK, Pilowsky PM (2008) PACAP isexpressed in sympathoexcitatory bulbospinal C1 neurons of thebrain stem and increases sympathetic nerve activity in vivo. Am JPhysiol Regul Integr Comp Physiol 294:1304–1311.

agner JP, Gauthier S, Sourkes TL (1985) Descending spinal path-ways mediating the responses of adrenal tyrosine hydroxylase andcatecholamines to insulin and 2-deoxyglucose. Brain Res 325:187–197.

aspo R, Lamarche L, De Champlain J, Yamaguchi N (1997) Canineadrenal catecholamine response to VIP is blocked by PACAP-(6-27) in vivo. Am J Physiol 272:R1606–R1612.

hzili H, Grumolato L, Thouënnon E, Tanguy Y, Turquier V, Vaudry H,

Anouar Y (2008) Role of PACAP in the physiology and pathology

G

G

G

H

H

H

H

H

H

H

H

I

J

K

K

K

K

K

K

K

K

L

L

L

M

M

M

M

M

M

M

M

N

O

P

P

P

P

P

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799798

of the sympathoadrenal system. Front Neuroendocrinol 29:128–141.

ibbins IL (1992) Vasoconstrictor, vasodilator and pilomotor pathwaysin sympathetic ganglia of guinea-pigs. Neuroscience 47:657–672.

rkovic I, Anderson CR (1995) Calretinin-containing preganglionicnerve terminals in the rat superior cervical ganglion surround neu-rons projecting to the submandibular salivary gland. Brain Res684:127–135.

rkovic I, Anderson CR (1997) Calbindin D28K-immunoreactivityidentifies distinct subpopulations of sympathetic pre- and postgan-glionic neurons in the rat. J Comp Neurol 386:245–259.

adjipavlou A, Simmons JW, Yang J, Bi L, Simmons D, Necessary J(1998) Torsional injury resulting in disc degeneration in the rabbit:II. Associative changes in dorsal root ganglion and spinal cordneurotransmitter production J Spinal Disord 11:318–321.

amelink C, Tjurmina O, Damadzic R, Young WS, Weihe E, Lee HW,Eiden LE (2002) Pituitary adenylate cyclase-activating polypeptideis a sympathoadrenal neurotransmitter involved in catecholamineregulation and glucohomeostasis. Proc Natl Acad Sci U S A99:461.

annibal J (2002) Pituitary adenylate cyclase-activating peptide in therat central nervous system: an immunohistochemical and in situhybridization study. J Comp Neurol 453:389–417.

arlan RE, Shivers BD, Romano GJ, Pfaff DW, Howells RD (1987)Localization of preproenkephalin mRNA in the rat brain and spinalcord by in situ hybridization. J Comp Neurol 258:159–184.

ervonen A, Pelto-Huikko M, Helén P, Alho H (1980) Electron-micro-scopic localization of enkephalin-like imnmunoreactivity in axonterminals of human sympathetic ganglia. Histochemistry 70:1–6.

eym C, Braun B, Klimaschewski L, Kummer W (1995) Chemicalcodes of sensory neurons innervating the guinea-pig adrenalgland. Cell Tissue Res 279:169–181.

olgert H, Holmberg K, Hannibal J, Fahrenkrug J, Brimijoin S, Hart-man BK, Hökfelt T (1996) PACAP in the adrenal gland-relationshipwith choline acetyltransferase, enkephalin and chromaffin cellsand effects of immunological sympathectomy. Neuroreport 8:297.

ong Y, Weaver LC (1993) Distribution of immunoreactivity for en-kephalin, substance P and vasoactive intestinal peptide in fibressurrounding splanchnic sympathetic preganglionic neurons in rats.Neuroscience 57:1121–1133.

ijima T Matsumoto G, Kidokoro Y (1992). Synaptic activation of ratadrenal medulla examined with a large photodiode array in com-bination with a voltage-sensitive dye. Neuroscience 51:211–219.

arry H, Dietrich M, Barthel A, Giesler A, Wuttke W (1989) In Vivodemonstration of a paracrine, inhibitory action of met-enkephalinon adrenomedullary catecholamine release in the rat. Endocrinol-ogy 125:624–629.

ent C, Coupland R (1989) Localisation of chromogranin A and B,met-enkephalin-arg6–gly7–leu8 and PGP9.5-like immunoreactiv-ity in the developing and adult rat adrenal medulla and extra-adrenal chromaffin tissue. J Anat 166:213–225.

esse WK, Parker TL, Coupland RE (1988) The innervation of theadrenal gland. I. The source of pre- and postganglionic nerve fibresto the rat adrenal gland. J Anat 157:33–41.

halil Z, Livett BG, Marley PD (1986) The role of sensory fibres in therat splanchnic nerve in the regulation of adrenal medullary secre-tion during stress. J Physiol 370:201–215.

imura T, Katoh M, Satoh S (1988) Inhibition by opioid agonists andenhancement by antagonists of the release of catecholaminesfrom the dog adrenal gland in response to splanchnic nerve stim-ulation: evidence for the functional role of opioid receptors. J Phar-macol Exp Ther 244:1098–1102.

ondo H, Kuramoto H, Wainer BH, Yanaihara N (1985) Evidence forthe coexistence of acetylcholine and enkephalin in the sympatheticpreganglionic neurons of rats. Brain Res 335:309–314.

umar NN, Ferguson J, Padley JR, Pilowsky PM, Goodchild AK(2009) Differential muscarinic receptor gene expression levels in

the ventral medulla of spontaneously hypertensive and Wistar-

Kyoto rats: role in sympathetic baroreflex function. J Hypertens27:1001–1008.

uramoto H, Kondo H, Fujita T (1985) Substance P-like immunoreac-tivity in adrenal chromaffin cells and intra-adrenal nerve fibers ofrats. Histochem Cell Biol 82:507–512.

uramoto H, Kondo H, Fujita T (1986) Neuropeptide tyrosine(NPY)-like immunoreactivity in adrenal chromaffin cells and intraadrenalnerve fibers of rats. Anat Rec 214:321–328.

amouche S, Yamaguchi N (2001) Role of PAC1 receptor in adrenalcatecholamine secretion induced by PACAP and VIP in vivo. Am JPhysiol Regul Integr Comp Physiol 280:R510–R518.

amouche S, Yamaguchi N (2003) PACAP release from the canineadrenal gland in vivo: its functional role in severe hypotension.Am J Physiol Regul Integr Comp Physiol 284:R588–R597.

innoila RI, Diaugustine RP, Hervonen A, Miller RJ (1980) Distributionof [Met5]- and [Leu5]-enkephalin-, vasoactive intestinal polypep-tide- and substance P-like immunoreactivities in human adrenalglands. Neuroscience 5:2247–2259.

ansvelder HD, Kits KS (2000) Calcium channels and the release oflarge dense core vesicles from neuroendocrine cells: spatial orga-nization and functional coupling. Prog Neurobiol 62:427–441.

arley PD, Mitchelhill KI, Livett BG (1986) Effects of opioid peptidescontaining the sequence of Met5-enkephalin or Leu5-enkephalinon nicotine-induced secretion from bovine adrenal chromaffincells. J Neurochem 46:1–11.

ikulits W, Pradet-Balade B, Habermann B, Beug H, Garcia-Sanz J,Mullner E (2000) Isolation of translationally controlled mRNAs bydifferential screening. FASEB J 14:1641–1652.

oller K, Zhang YZ, Håkanson R, Luts A, Sjölund B, Uddman R,Sundler F (1993) Pituitary adenylate cyclase activating peptide is asensory neuropeptide: immunocytochemical and immunochemicalevidence. Neuroscience 57:725–732.

orales M, Holmberg K, Xu Z, Cozzari C, Hartman B, Emson P,Goldstein M, Elfvin L, Hökfelt T (1995) Localization of cholineacetyltransferase in rat peripheral sympathetic neurons and itscoexistence with nitric oxide synthase and neuropeptides. ProcNatl Acad Sci U S A 92:11819–11823.

orrison SF, Cao WH (2000) Different adrenal sympathetic pregan-glionic neurons regulate epinephrine and norepinephrine secre-tion. Am J Physiol Regul Integr Comp Physiol 279:R1763–R1775.

uroi M, Funahashi H, Zhou CJ, Ohtaki H, Arimura A, Shioda S (2000)PACAP receptor expression in the rat adrenal medulla by in situhybridization and immunocytochemistry. Ann N Y Acad Sci921:349–351.

urphy SM, McAllen R, Campbell GD, Howe PR, Anderson CR (2003)Re-establishment of neurochemical coding of preganglionic neu-rons innervating transplanted targets. Neuroscience 117:347–360.

icholson R, Small J, Dixon AK, Spanswick D, Lee K (2003) Serotoninreceptor mRNA expression in rat dorsal root ganglion neurons.Neurosci Lett 337:119–122.

omori Y, Okuno S, Fujisawa H, Ono K (1991) Immunoelectron mi-croscopic study of tyrosine hydroxylase immunoreactive nervefibers and ganglion cells in the rat adrenal gland. Anat Rec229:407–414.

adley JR, Kumar NN, Li Q, Nguyen TBV, Pilowsky PM, Goodchild AK(2007) Central command regulation of circulatory function mediatedby descending pontine cholinergic inputs to sympathoexcitatory ros-tral ventrolateral medulla neurons. Circ Res 100:284–291.

arker T, Kesse W, Mohamed A, Afework M (1993) The innervation ofthe mammalian adrenal gland. J Anat 183:265–276.

elto-Huikko M, Salminen T, Hervonen A (1985) Localization of en-kephalins in adrenaline cells and the nerves innervating adrenalinecells in rat adrenal medulla. Histochem Cell Biol 82:377–383.

ettersson LME, Heine T, Verge VMK, Sundler F, Danielsen N (2004)PACAP mRNA is expressed in rat spinal cord neurons. J CompNeurol 471:85–96.

yner S, Coote JH (1994a) A comparison between the adult rat and

neonate rat of the architecture of sympathetic preganglionic neu-

P

S

S

S

S

S

S

S

S

S

S

T

V

V

V

V

W

W

Y

Z

N. N. Kumar et al. / Neuroscience 170 (2010) 789–799 799

rones projecting to the superior cervical ganglion, stellate ganglionand adrenal medulla. J Auton Nerv Syst 48:153–166.

yner S, Coote JH (1994b) Evidence that sympathetic preganglionicneurones are arranged in target-specific columns in the thoracicspinal cord of the rat. J Comp Neurol 342:15–22.

ámano C, Zetina ME, Cifuentes F, Morales MA (2009) Segregation ofmet–enkephalin from vesicular acetylcholine transporter and cho-line acetyltransferase in sympathetic preganglionic varicositiesmostly lacking synaptophysin and synaptotagmin. Neuroscience163:180–189.

ámano C, Zetina ME, Marín MA, Cifuentes F, Morales MA (2006)Choline acetyl transferase and neuropeptide immunoreactivitiesare colocalized in somata, but preferentially localized in distinctaxon fibers and boutons of cat sympathetic preganglionic neurons.Synapse 60:295–306.

chramm L (2006) Spinal sympathetic interneurons: their identificationand roles after spinal cord injury. Prog Brain Res 152:27–37.

chultzberg M, Hökfelt T, Lundberg J, Terenius L, Elfvin L, Elde R(1978) Enkephalin-like immunoreactivity in nerve terminals in sym-pathetic ganglia and adrenal medulla and in adrenal medullarygland cells. Acta Physiol Scand 103:475–477.

enba E, Yanaihara C, Yanaihara N, Tohyama M (1989) Proenkepha-lin opioid peptide product in the sensory ganglia of the rat: adevelopmental immunohistochemical study. Brain Res Dev BrainRes 48:263–271.

hafton AD, Oldfield BJ, McAllen RM (1992) CRF-like immunoreac-tivity selectively labels preganglionic sudomotor neurons in cat.Brain Res 599:253–260.

pringell DA, Powers-Martin K, Phillips JK, Pilowsky PM, GoodchildAK (2005) Phosphorylated extracellular signal-regulated kinase1/2 immunoreactivity identifies a novel subpopulation of sympa-thetic preganglionic neurons. Neuroscience 133:583–590.

tornetta RL, Schreihofer AM, Pelaez NM, Sevigny CP, Guyenet PG(2001) Preproenkephalin mRNA is expressed by C 1 and non-C 1barosensitive bulbospinal neurons in the rostral ventrolateral me-dulla of the rat. J Comp Neurol 435:111–126.

track AM, Sawyer WB, Marubio LM, Loewy AD (1988) Spinal originof sympathetic preganglionic neurons in the rat. Brain Res

455:187–191.

track AM, Sawyer WB, Platt KB, Loewy AD (1989) CNS cell groupsregulating the sympathetic outflow to adrenal gland as revealed bytransneuronal cell body labeling with pseudorabies virus. BrainRes 491:274–296.

ornoe K, Hannibal J, Jensen TB, Georg B, Rickelt LF, AndreasenMB, Fahrenkrug J, Holst JJ (2000) PACAP-(1–38) as neurotrans-mitter in the porcine adrenal glands. Am J Physiol EndocrinolMetab 279:E1413–E1425.

erhofstad AAJ, Coupland RE, Parker TR, Goldstein M (1985) Immu-nohistochemical and biochemical study on the development of thenoradrenaline- and adrenaline-storing cells of the adrenal medullaof the rat. Cell Tissue Res 242:233–243.

ollmer RR (1996) Selective neural regulation of epinephrine andnorepinephrine cells in the adrenal medulla-cardiovascular impli-cations. Clin Exp Hypertens 18:731–751.

ollmer RR, Balcita-Pedicino JJ, Debnam AJ, Edwards DJ (2000)Adrenal medullary catecholamine secretion patterns in rats evokedby reflex and direct neural stimulation. Clin Exp Hypertens22:705–715.

ollmer RR, Baruchin A, Kolibalpegher SS, Corey SP, Stricker EM,Kaplan BB (1992) Selective activation of norepinephrine-secretingand epinephrine-secreting chromaffin cells in rat adrenal-medulla.Am J Physiol 263:R716–R721.

atanabe T, Shimamoto N, Takahashi A, Fujino M (1995) PACAPstimulates catecholamine release from adrenal medulla: a novelnoncholinergic secretagogue. Am J Physiol Endocrinol Metab269:E903–E909.

ooten GF, Kopin IJ, Axelrod J (1975) Effects of colchicine andvinblastine on axonal transport and transmitter release in sympa-thetic nerves. Ann N Y Acad Sci 253:528–534.

amaguchi N, Lamouche S (1999) Enhanced reactivity of the ad-renal medulla in response to pituitary adenylate cyclase activat-ing polypeptide 1–27 (PACAP) during insulin-induced hypogly-cemia in anesthetized dogs. Can J Physiol Pharmacol 77:819 – 826.

hou XF, Oldfield BJ, Livett BG (1991) Substance P-containing sen-sory neurons in the rat dorsal root ganglia innervate the adrenal

medulla. J Auton Nerv Syst 33:247–254.

(Accepted 22 July 2010)(Available online 29 July 2010)