Neuronal Nitric Oxide Synthase Modulates Maturation of Human Dendritic Cells

The Journal of Immunology

Neuronal Nitric Oxide Synthase Modulates Maturation ofHuman Dendritic Cells

Henric S. Adler,*,1 Alexandra Simon,†,1 Edith Graulich,* Alice Habermeier,†

Nicole Bacher,* Andreas Friebe,‡ Ellen I. Closs,†,2 and Kerstin Steinbrink*,2

Dendritic cells (DCs) are the most potent APCs of the immune system. Understanding the intercellular and intracellular signaling

processes that lead to DC maturation is critical for determining how these cells initiate T cell-mediated immune processes. NO

synthesized by the inducible NO synthase (iNOS) is important for the function of murine DCs. In our study, we investigated

the regulation of the arginine/NO-system in human monocyte-derived DCs. Maturation of DCs induced by inflammatory cytokines

(IL-1b, TNF, IL-6, and PGE2) resulted in a pronounced expression of neuronal NOS (nNOS) but only minimal levels of iNOS and

endothelial NOS were detected in human mature DCs. In addition, reporter cell assays revealed the production of NO by mature

DCs. Specific inhibitors of NOS (N-nitro-L-arginine methyl ester) or of the NO target guanylyl cyclase (H-(1,2,4)-oxadiazolo [4,3-a]

quinoxalin-1-one) prevented DC maturation (shown by decreased expression of MHC class II, costimulatory and CD83 molecules

and reduced IL-12 production) and preserved an immature phenotype, indicating an autocrine effect of nNOS-derived NO on

human DC maturation. Notably, inhibitor-treated DCs were incapable of inducing efficient T cell responses after primary culture

and generated an anergic T cell phenotype. In conclusion, our results suggest that, in the human system, nNOS-, but not iNOS-

derived NO, plays an important regulatory role for the maturation of DCs and, thus, the induction of pronounced T cell res-

ponses. The Journal of Immunology, 2010, 184: 6025–6034.

Nitric oxide, a free radical gas, is known as an importantregulator and mediator of a wide range of physiologicalprocesses, including blood vessel relaxation, neurotrans-

mission, inflammation, apoptosis, cytotoxicity and immune pro-cesses (1–3). In the latter, NO exerts a protective function againstvarious infections through its cytotoxic activity. In the murine im-mune system, NO is also involved in the regulation of adaptiveimmunity by affecting the balance between Th1/Th2 responses orother T cell-regulated immune processes (2, 4, 5). However, the roleof NO in adaptive immunity in humans is less clear. Increased ex-pression of NO synthase (NOS) has been demonstrated in psoriasis,an inflammatory skin disease characterized by skin-homing T cellsof a Th1/Th17 phenotype (6–9).Dendritic cells (DCs) are the most potent APCs playing a pivotal

role in the induction of T cell-mediated immune responses (10, 11).Certain cytokines, pathogen-derived compounds, and soluble me-diators have been shown to induce maturation and differentiation of

immature DCs (iDCs) into mature APCs (12, 13). Analyses of thecomplex network of immune mechanisms resulting in maturationof human DCs are critical for the understanding of DC-initiatedT cell response.Data concerning the impact of NO on DC function are contro-

versial. In human DCs, it has been demonstrated that exogenousNO affects their function partly via NO-guanylyl cyclase (NO-GC),a target of NO signaling (14–16). The endogenous production of NOcan be catalyzed by three different NOS isoforms (inducible [iNOS],endothelial [eNOS], and neuronal [nNOS] NO synthase) that all op-erate in the immune system (17). The nNOS and eNOS isoforms arethus not restricted to neurons and endothelial cells, respectively. Theyare also referred to as constitutive isoforms, because unlike iNOS,they are primarily regulated by Ca2+ influxes and subsequent bindingof calmodulin (17, 18). However, it has been shown that the expres-sion of both “constitutive” isoforms is also highly regulated (19).The prominent NOS isoform in murine DCs is iNOS. Its ex-

pression is induced during activation of DCs by pathogens orcytokines (20–22). In contrast, results concerning the expressionand regulation of iNOS and the production of NO during thematuration of human DCs are controversial (9, 14, 23, 24).So far, the expression of eNOS and nNOS in human DCs and

a possible function of autocrine NO during the maturation anddifferentiation had not been examined. In our study, we founda prominent nNOS expression and related NO production in humanmonocyte-derived DCs after cytokine-induced maturation. Use ofspecific inhibitors of NOS or the NO-GC, a target of NO activationin DCs, revealed that nNOS-mediated NO synthesis is critical forfull maturation and differentiation of DCs, which in turn hasa strong impact on subsequent efficient T cell activation.

Materials and MethodsCulture medium

IMDM supplemented with 2.5% autologous plasma was used for generationof DCs. T cells were cultured and stimulated in X-VIVO-20 (both fromCambrex, Taufkirchen, Germany). A673 cells were grown in Iscove’s

*Department of Dermatology and †Institute of Pharmacology, University of Mainz,Mainz; and ‡Institute of Physiology, University of Wurzburg, Wurzburg, Germany

1H.S.A. and A.S. contributed equally to this work.

2E.I.C. and K.S. contributed equally to this work as senior authors.

Received for publication April 27, 2009. Accepted for publication March 26, 2010.

This work was supported by grants from the German Research Foundation (SFB548/B6, Transregio 52/A7, STE791/4-5, and STE/5-1 to K.S.; SFB 553/B4 andCl100/4-3 to E.I.C.) and intramural grants from the University of Mainz (Natur-wissenschaftlich-Medizinisches Forschungszentrum to E.I.C. and K.S.).

Address correspondence and reprint requests to Dr. Kerstin Steinbrink, Department ofDermatology, University of Mainz, Langenbeckstrasse 1, D-55131 Mainz, Germany.E-mail address: [email protected]

Abbreviations used in this paper: CAT, cationic amino acid transporter; DC, dendriticcell; eNOS, endothelial NO synthase; iDC, immature dendritic cell; iNOS, inducibleNO synthase; L-NAME, N-nitro-L-arginine methyl ester; LS, Locke’s solution; mDC,mature dendritic cell; MFI, mean fluorescence intensity; NO-GC, NO-guanylyl cy-clase; nNOS, neuronal NO synthase; NOS, NO synthase; ODQ, H-(1,2,4)-oxadiazolo[4,3-a] quinoxalin-1-one.

Copyright� 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901327

mailto:[email protected]

modified DMEM supplemented with 10% FBS and 4 mM glutamine,ECV304 cells in DMEM, supplemented with 4 mmol/l glutamine and 10%FBS, and RFL-6 cells in F-12 medium with 15% FBS and 4 mM gluta-mine. HUVECs were expanded in Earl’s medium 199 supplemented with20% FBS penicilline, streptomycine, and 5.3 mmol/l glutamine.

Cell lines

The human cell line A673 (neuroepithelioma, established from a patientwith a possible primary rhabdomyosarcoma) expressing nNOS, the humancell line ECV304 (a variant of the T-24 bladder carcinoma cell line) asa negative control for nNOS expresion, and the rat lung fibroblast cell lineRFL-6 were obtained from American Type Culture Collection (Manassas,VA). HUVECs were isolated as previously described (25), expanded onfibronectin-coated dishes and used in the third passage. All cell lines wereregularly tested for mycoplasma infection using DAPI (Roche MolecularBiochemicals, Mannheim, Germany). No contamination could be detected.For incubation of cells with amino acids, only the L-isomers were used.

Abs

For flow cytometry, Abs against human CD2 (6F10.3), CD14 (RM052),CD19 (J4.119), CD80 (MAB104), CD83 (HB15A) (all Beckmann Coulter,Krefeld, Germany), CD86 (BU63, Serotec, Oxford, U.K.), HLA-DR (YD1/63.4.10, Serotec), nNOS (nNOS-AB, A-11, Santa Cruz Biotechnology,Santa Cruz, CA), CD40 (5c3), CD208-APC (110-1112) (all Becton Dick-inson), CCR7-APC (150503; R&D Systems, Wiesbaden, Germany), mouse(MOPC-31-C, MOPC-173, 27-35), and rat (R35-95, MOPC-21) subclass-specific isotypes (all Beckmann Coulter) were used. Conjugated secondaryreagents: FITC-conjugated goat–anti–rat-IgG (Biozol, Eching, Germany),PE-conjugated donkey anti–mouse-IgG (Jackson ImmunoResearch Labo-ratories, Suffolk, U.K.), for myeloid DC: anti–CD1c-PE (M241, Ancell,Cologne, Germany). Staining of MACS-sorted T cells: FITC-conjugatedCD4 (13B8.2) or CD8 (B9.11), FITC-conjugated mouse-IgG (697.1Mc7)(all Beckmann Coulter).

Generation of DCs

DCswere generated as described (26). PBMCswere isolated frombuffy coatsusing Ficoll gradients and suspended in culture dishes for 45 min. Non-adherent cells were rinsed off the plates and remaining cells were cultured in3 ml IMDM supplemented with 400 U/ml GM-CSF (Leukine, Berlex,Richmond, CA), 1000 U/ml IL-4 (Strathmann, Hamburg, Germany), and2.5% autologous plasma. At day 6, nonadherent cells were collected, re-suspended in IMDM supplemented with 2.5% autologous plasma, 400 U/mlGM-CSF, and 1000 U/ml IL-4, and additionally stimulated with 2.5 ng/mlIL-1b, 2.5 ng/ml TNF-a, 250 U/ml IL-6 (Strathmann), and 0.5 mg/ml PGE2

(Minprostin, Pharmacia-Upjohn, Erlangen, Germany) for 2 d to inducemature DCs (mDCs). In some experiments, IFN-g 100U/ml (Strathmann) or/and LPS 100 ng/ml (Sigma-Aldrich, St. Louis, MO) were used.

H-(1,2,4)-oxadiazolo [4,3-a] quinoxalin-1-one (ODQ) (50–200 mm) orN-nitro-L-arginine methyl ester (L-NAME) (0.1-9.0 mM) (both Alexis, SanDiego, CA) were added to the DC culture in concentrations as indicated.Viabilitiy of DCs was tested by propidium-iodide staining in every ex-periment. Analyses revealed a slightly higher percentage of dead cells afterinhibitor treatment (L-NAME, 11.47 6 3.52%; ODQ, 19.78 6 7.42%) ascompared with control DCs (7.73 6 4.64%) that was adjusted by using thesame number of viable DCs in coculture experiments with T cells.

MyeloidDCswere obtained from peripheral blood using the BDCA-1+ DCisolation kit (Milteny Biotec, Bergisch-Galdbach, Germany) according to themanufacturer’s protocol. Purity (.85%) was controlled by flow cytometry(CD1c+, HLA-DR+, lineage2, CD86+, CD832). Maturation was induced by2.5 ng/ml IL-1b, 2.5 ng/ml TNF-a, 250 U/ml IL-6 (Strathmann), and 0.5 mg/ml PGE2 (Minprostin, Pharmacia-Upjohn). In some experiments, DCs wereadditionally stimulated with IFN-g 100 U/ml (Strathmann) and LPS 100 ng/ml (Sigma-Aldrich).

Isolation of CD4+CD45RA+ T cells

CD4+CD45RA+ T cells were prepared from buffy coats using Naive CD4+

T Cell Isolation Kit II (MACS systems; Milteny Biotec) (purity .95%).

Induction of an allogeneic T cell response by DCs andrestimulation experiments

DCs and CD4+CD45RA+ T cells were prepared as described previously.For primary culture, 5 3 105 of the respective DCs per well in 3 mlX-VIVO 20 supplemented with 0.5% autologous plasma and 2 U/ml IL-2in 6-well-plates were cultured with 5 3 106 CD4+CD45RA+ T cells ob-tained from a second unrelated donor for 4 d. For proliferation experi-ments, serial dilutions starting at 0.25 3 104 of the respective DCs as

indicated were cultured with 0.25 3 105 CD4+CD45RA+ in 200 mlX-VIVO 20 supplemented with 0.5% autologous plasma and 2 U/ml IL-2for 4 d, and proliferation was measured at day 4 by [3H]thymidine in-corporation. For restimulation experiments, 0.25 3 105 T cells werestimulated with anti-CD3 (0.5 mg/ml) and anti–CD28-mAb (1 mg/ml).T cell proliferation was detected 72 h after activation.

Flow cytometric analysis

Phenotype of DCs was analyzed by flow cytometry (FACScalibur, Cellquestsoftware, Becton Dickinson, Heidelberg, Germany). Intracellular stainingwas performed by use of Cytofix/Cytoperm Kit (Becton Dickinson).

Cytokine analysis

For assessment of cytokine production, supernatants were collected aftercoculture of DCs and T cells after 4 d of primary culture, or 24 and 72 h afterrestimulation and stored at 270˚C. The amounts of IL-2, IFN-g, IL-5, andIL-13 were assessed by ELISA, using commercially available Abs andstandards according to the manufacturer’s protocols (BD Pharmingen,Heidelberg, Germany). For assessment of IL-10 production, human IL-10ELISAwas used (Immunotools, Friesoithe, Germany). For analysis of DCscytokine profile, supernatants were harvested at day 8 of culture andELISA for IL-10 (Immunotools), IL-12p40, IL-12p70 (Becton Dickinson)and IL-23 (BioSource International, Camarillo, CA) production wereperformed, according to the manufacturer’s protocols.

Immunoblotting

Membranes were probed with anti–nNOS-Ab (Clone: pAb, BD TransductionLaboratories, Heidelberg, Germany) and anti-eIF2Bε (H290; Santa Cruz Bio-technology) overnight at 4˚C. Detection was performed by incubation with HRP-conjugated Abs (goat anti-rabbit, Cell Signaling Technology, Frankfurt, Ger-many). Proteins were visualized by ECL Plus (Amersham Pharmacia, Freibrug,Germany) using Hyperfilm (Amersham).

RNA isolation

RNA was isolated by use of RNeasy Mini Kit (Qiagen, Hilden, Germany)according to the instructions of the manufacturer and quantified by theabsorption at 260 nm. Total RNA from human brain tissue was obtainedfrom Clontech Laboratories (Mountain View, CA).

Quantitative RT-PCR

One-step RT-PCRwas performedwith the QuantiTect RT/PCRKit (Qiagen)in 25 ml reactions in a 96-well spectrofluorometric thermal cycler (iCycler,Bio-Rad, Munchen, Germany) (dNTPs 400 mmol/l each). For real-timePCR (MgCl2, 5.3 mmol/l, 94˚C 15 s, 60˚C 60 s), the oligonucleotides aslisted below served as sense and antisense primers (0.8 mmol/l each), re-spectively. Taqman hybridization probes (0.4 mmol/l, Table I) were double-labeled with FAM as the reporter fluorophore and carboxytetramethyl-rhodamine (TAMRA) as the quencher. Fluorescence was monitored at each60˚C annealing/extension step.

RFL-6 reporter cell assay

RFL-6 reporter cells were grown to confluence in 6-well plates (diameter35 mm) and washed twice in Locke’s solution (LS; composition, 154 mmol/lNaCl; 5.6 mmol/l KCl; 2 mmol/l CaCl2; 1 mmol/l MgCl2; 10 mmol/lHEPES; 3.6 mmol/l NaHCO3; and 5.6 mmol/l glucose). RFL-6 cells werethen preincubated 30 min in LS supplemented with 200 U/ml superoxidedismutase (RocheMolecular Biochemicals,Mannheim, Germany), 50mM3-isobutyl-1-methylxanthine, and 100 mM ODQ (where indicated). DCs wereincubated for 10min in 100mMarginine and 200U/ml superoxide dismutase.For NO measurement, DCs (4 3 106 per well) were transferred onto trans-well-plates and incubated for 4 min on the RFL-6 reporter cells at 37˚C.

After the 4-min incubation, the DC-containing transwells and the LSwere removed from the RFL-6 cells, 1 ml ice-cold sodium acetate buffer(20 mmol/l, pH 4.0) was added and the cells were rapidly frozen in liquidnitrogen. The cGMP content of the RFL-6 cells was determined by RIAas described previously (27). Basal cGMP values measured in RFL-6cells incubated under the same conditions but not exposed to DCs weresubtracted from the experimental values. In some experiments, ODQ(100 mM) was used to demonstrate the functional relevance and specificityof the results. DCs were collected and used for RNA isolation.

Statistical analyses

Statistical significances of differences between experimental groups wereevaluated by repeated measure ANOVA and Dunnett’s multiple comparisontest with the GraphPadPrism 5 software package (GraphPad, San Diego,CA). Values of p , 0.05 were considered significant.

6026 NEURONAL NOS IN HUMAN DCs

ResultsRegulation of NOS isoform expression during maturation ofmonocyte-derived DCs

We generated human DCs from peripheral monocytic progenitorcells according to a protocol that has been established some yearsago enabling the reproducible generation of large amounts ofdonor-specific myeloid DC under GMP-conditions and opening theway for the clinical use of DCs as natural adjuvants in clinicalvaccination trials (13, 28).Involvement of NO in DC-related immune processes has been

described in both, the murine and human system, but so far,no information was available on the regulation, expression, andfunction of NOS isoforms in the course of maturation. Thus, weaddressed the question if human DCs express any of the threeNOS isoforms, eNOS, nNOS, or iNOS during maturation. Wefound a moderate expression of eNOS but only minimal levels ofiNOS or nNOS mRNA in iDCs at day 6 of culture (Fig. 1A). Incontrast, a high nNOS expression was observed in mDCs at day8 accompanied by only minimal levels of eNOS and iNOS (Fig.1A). Kinetic analyses revealed detectable nNOS expression atday 6 that was found to increase 250-fold at day 8 during DCmaturation (related to nNOS expression in human brain tissue[100%]) (Fig. 1B). Our experiments demonstrated a completedownregulation of eNOS in mDCs and a small induction (3-fold)of iNOS mRNA during maturation of human DCs treated withcytokines (Fig. 1A) or other immune mediators (LPS alone, LPSand IFN-g; data not shown). However, absolute iNOS expressionwas very low; maximal levels of iNOS were 500-fold lower thanmaximal levels of nNOS in mDCs (day 8). Considering theminimal expression of iNOS and eNOS, we assume no majorcontribution of these isoforms to total NO production in mDCs(Fig. 1A).Myeloid DCs from blood of healthy donors have been charac-

terized as immature APCs (10, 11). RT-PCR analyses revealed thatneither iNOS nor nNOS isoforms were detected in myeloid im-mature CD1c+ DCs obtained directly from peripheral blood (datanot shown). Maturation of myeloid DCs in the presence of a cy-tokine mixture (IL-1b, TNF-a, IL-6, PGE2 6 IFN-g/LPS) did notinduce a significantly increase in nNOS expression (data notshown), indicating that nNOS-related pathways may not contrib-ute to myeloid DC function.

Production of NO by human mDCs

NO has been reported to be a versatile player of the immune systemwith various effects on several immune cells, including DCs andT cells (2). Our experiments revealed the novel finding of an in-creased and high expression of nNOS in human mDCs. Thus, inour study, we focused on the analyses of the functional relevanceof this observation.

To verify the high expression of nNOS mRNA in mDCs on theprotein level, Western blot and flow cytometry experiments wereperformed. In accordance to RT-PCR results, we found a very lowexpression of nNOS in iDCs and a high expression in mDCs,suggesting a functional role of nNOS during the final phase of DCmaturation (Fig. 2A, 2B).To determine whether mDCs produce bioactive NO, we in-

cubated these cells in transwells with a confluent layer of RFL-6reporter cells. The latter express high amounts of the NO-GC andthus produce cGMP proportional to the amount of NO they areexposed to (27). Notably, mDCs induced significant amounts ofcGMP in reporter cells (Fig. 2C). The mDC-induced cGMP pro-duction was completely inhibited by treatment with a specificinhibitor of NO-GC (ODQ), demonstrating specificity of the re-sults (Fig. 2C). In contrast, in experiments using iDCs, which didnot express nNOS, we found a significantly reduced NO pro-duction as compared with mDCs (data not shown). These datademonstrate relevant NO production by mDCs, indicating thatnNOS is functionally active in these cells.

Unaltered expression of arginase and cationic amino acidtransporters during differentiation of human DCs

An important factor that may determine NOS activity is the avail-ability of its substrate, L-arginine. Arginine is provided to cells byspecific carrier proteins. Among these, the so called cationic aminoacid transporters (CATs) are considered to be the major route ofuptake in most cells and tissues (29, 30). Individual CAT isoformshave been postulated to be important for the substrate supply of thedifferent NOS isoforms: CAT-1 for eNOS, CAT-2B for iNOS, andCAT-3 for nNOS. To find out if changes in NOS expression wereaccompanied by changes in transporter expression, we quantifiedCAT mRNA by quantitative RT-PCR. DCs exhibited a strong ex-pression of human CAT-1 mRNA. CAT-2B expression was in therange of 20–30% of CAT-1 (Fig. 3A). In contrast, no substantialexpression of the low affinity splice variant CAT-2A (data notshown) and only a very low expression of CAT-3 were found. Thisexpression pattern did not change during DC differentiation andmaturation (Fig. 3A).Substrate supply to NOS may be limited by other arginine-

consuming enzymes through competition for the common substratearginine (31). In murine DCs, it has been speculated that arginaseparticipates in the regulation of NO synthesis (32). However, inhuman DCs, no arginase expression or activity has been detected(33). In accordance with these findings, we found only very lowexpression or modulation of arginase I or II at any time point ofDC culture (Fig. 3B).Our data indicate that modulation of arginine supply by mem-

brane transport or consumption by arginase does not play an im-portant role in the maturation and NO-related processes in humanmonocyte-derived DCs.

Table I. Primer pairs for RT-PCR analyses

Gene Sense Strand (59–39) Antisense Strand (59–39) TaqMan Probe (59–39) 6FAM-[TAMRA]

eNOS GTGGCTGTCTGCATGGACCT CCACGATGGTGACTTTGGCT AGTGGAAATCAACGTGGCCGTGCTGCnNOS GGTGGAGATCAATATCGCGGTT CCGGCAGCGGTACTCATTCT TTGTTGACCATCACTCCGCCACCGAiNOS TGCAGACACGTGCGTTACTCC GGTAGCCAGCATAGCGGATG TGGCAAGCACGACTTCCGGGTGArginase I ACAGTTTGGCAATTGGAAGCA CAGTGTGAGCATCCACCCAG CTCTGGCCATGCCAGGGTCCACArginase II CTACAGGATAAGGTACCACAACTCCC GGTCCACGTCTCTCAGACCAAT TTCCTGGATCAAACCTTGTATCTCTTCTGCAAGTCAT-1 CTTCATCACCGGCTGGAACT GGGTCTGCCTATCAGCTCGT AATCCTCTCCTACATCATCGGTACTTCAAGCGTCAT-2A TTCTCTCTGCGCCTTGTCAA TCTAAACAGTAAGCCATCCCGG TCTGGGCTCTATGTTTCCTTTACCCCGAACAT-2B TTCTCTCTGCGCCTTGTCAA CCATCCTCCGCCATAGCATA TGGATCCATTTTCCCAATGCCTCGTCAT-3 GGCCTCCTGTTCCGTGTACTT TGAGGTCCACAAGATCAGTGAGTT ATCCACACCGGCACACGCACCGAPDH AGCCTCAAGATCATCAGCAATG CACGATACCAAAGTTGTCATGGA CTGCACCACCAACTGCTTAGCACCC

The Journal of Immunology 6027

Inhibition of NOS results in diminished maturation of human DCs

To elucidate the functional relevance of nNOS in DC immunology,we performed inhibition experiments by culturing DCs in thepresence of the NOS-specific inhibitor L-NAME during days 1–6(generation of iDC, Fig. 4A), days 6–8 (maturation of mDC, Fig.4B), or the total culture period (days 1–8, Fig. 4C). If given at days1–6 of DC differentiation, when no nNOS expression was de-tectable, the treatment with L-NAME did not change the pheno-type and maturation state of iDCs as assessed by the expressionpattern of MHC class II, the costimulatory molecules CD80 andCD86 and the human DC maturation marker CD83 (Fig. 4A, 4D).In contrast, NOS inhibition during cytokine-induced DC matura-tion (day 6–8), when a strong nNOS expression developed, in-duced an impaired maturation and differentiation of mDCs asdemonstrated by a more immature phenotype with reduced ex-pression of critical features of maturation (CD80, CD83, andHLA-DR) (Fig. 4B, 4D). Similar results were obtained when NOSwas inhibited during the entire culture period (days 1–8, Fig. 4C,4D). Analyses of the viability of DCs after L-NAME treatmentrevealed slightly higher numbers of dead cells as compared withcontrol DCs, indicating only a low toxicity of the inhibitor, even inthe highest concentration used (see Materials and Methods).Statistical analyses revealed a significant reduction in the ex-

pression of CD80, CD83 and the additionally analyzed moleculeCD208/DC-LAMP (a membrane protein specifically expressed inthe later stages of maturation) in DCs generated in the presence ofL-NAME during day 6–8 of culture (Fig. 4E). The percentageof CD40 and chemokine receptor CCR7-positive DCs was un-affected by L-NAME treatment (Fig. 4E).DC-related cytokines are critically involved in the induction and

polarization of resulting T cell responses. IL-12 is known to berequired for Th1/Tc1 cell development and T cell activation, IL-10

has been shown to have immunosuppressive functions and mayplay a pivotal role in the induction and function of regulatoryT cells and IL-23 contributes to the generation of Th17 T cells (34).To evaluate the cytokine profile of mDCs after inhibition of

nNOS activity during maturation, supernatants of DCs were ana-lyzed for IL-12p40, IL-12p70, IL-10, and IL-23. No significantproduction of IL-12p40 was observed in iDCs (data not shown) incontrast to mDCs producing high amounts of this cytokine (Fig.4F). The levels of IL-12p40 were significantly reduced in ex-periments where the nNOS activity was blocked by the inhibitorL-NAME during maturation (Fig. 4F). Induction of IL-12p70,IL-10, and IL-23 secretion was not observed in any of the ap-proaches performed with iDCs and mDCs (data not shown).Thus, we found an impaired DC maturation after inhibition of

nNOS, indicating that nNOS-derived NO contributes to maturationof human monocyte-derived DCs.

The effect of NO on human DC maturation is cGMP-dependent

Effects of NO are known to be mediated through both, cGMP-dependent and -independent signaling pathways. In humanDCs, the

FIGURE 2. nNOS protein expression and NO production in human

mDCs. A, Lysates of DC populations were used for Western blot analysis

performed as described in Materials and Methods. A673 neuroepithelioma

cells were used as positive, ECV304 epithelial cells as negative controls

for nNOS expression. Control of protein loading was assessed by ex-

pression of elFB2ε. Results of one of three independent experiments are

demonstrated. B, iDCs and mDCs were analyzed for nNOS expression by

flow cytometry. One of five independent experiments is shown. C, Bio-

active NO production by mDCs was indirectly assessed as amounts of

cGMP produced in RFL-6 reporter cells. For NO measurement, DCs were

transferred onto transwell-plates and incubated on the RFL-6 reporter

cells. cGMP was detected by RIA. Some experiments were performed in

the presence of a specific inhibitor (ODQ) to demonstrate the functional

relevance and specificity of the results (n = 6–10).

FIGURE 1. RNA expression profile of NOS isoforms in human DCs,

iDCs, and mDCS were generated as described. A, Expression of eNOS,

iNOS, and nNOS in iDCs (d6) and mDCs (d8). Relative expression of

eNOS, iNOS, and nNOS was normalized to GAPDH and values were

multiplied by 103. Expression of GAPDH did not differ in mDCs and

iDCs. B, Kinetic experiments analyzed the expression of nNOS over the

total period of DC culture. Expression of nNOS in iDCs and mDCs was

related to nNOS expression in human brain tissue (100%). Columns in-

dicate means 6 SEM (n $ 6).


presence of NO-GC and NO-stimulated cGMP generation has beenreported (35–37). To determine whether the effect of NO on DCmaturation is mediated by cGMP, DCs were treated with the NO-GC–specific inhibitor ODQ during generation of iDCs (days 1–6 ofculture, Fig. 5A), during the maturation phase (mDCs, days 6–8,Fig. 5B), or the total culture period (days 1–8, Fig. 5C). Flow cy-tometry analysis revealed that during generation of iDC (day 1–6 ofculture) inhibition of cGMP production had no effect (Fig. 5A, 5D).In contrast, DC maturation was markedly inhibited in experimentswhere the NO-GC–specific inhibitor ODQ was present during DCmaturation as shown by reduced expression of costimulatorymolecules CD80 and CD86, as well as MHC class II and CD83(Fig. 5B–D). Extensive additional analyses of six unrelated donorsvery clearly illustrated that ODQ blocked the maturation of humanDCs, demonstrated by a significantly reduced expression of CD80,CD83, CCR7, and CD208 on inhibitor-treated DCs. In addition, theamount of surface molecules of CD40, CD80, CD83, and CD86,depicted as mean fluorescence intensity (MFI), was reduced onDCs generated in the presence of ODQ (Fig. 5E).The viability of DCs after treatment with the NO-GC inhibitor

ODQ was only slightly decreased, even in the presence of thehighest concentration used, excluding a toxic effect of the inhibitoron DCs (see Materials and Methods).Furthermore, a diminished production of IL-12p40 after NO-GC

inhibition was observed (Fig. 5F). No secretion of the Th1/Tc1-inducing cytokine IL-12p70, the immunosuppressive cytokineIL-10 or IL-23 was detected in control or inhibitor-treated DCs(data not shown). These results are in line with our data obtainedfrom NOS inhibition experiments, indicating that nNOS-derivedautocrine NO and activation of NO-CG is required for APCmaturation during the final phase of culture when a strong nNOSexpression and significant NO production is observed.

Inhibition of NO signaling in DCs during maturation impairestheir capacity for efficient T cell activation

In the murine system, low NO concentrations were shown topreferentially induceTh1 immune responses, whereas high amountsof NO are immunosuppressive (4, 38). It has been reported that NO

acts directly on DC and/or T cells and in synergy with IL-12 pro-duced by APCs (2).To evaluate the role of nNOS-derived NO during DC maturation

for subsequent T cell stimulation, we performed allogeneic co-culture experiments with CD4+CD45RA+ T cells and DCs, whichhad been pretreated with the NOS-specific inhibitor L-NAME(L-NAME DCs) or the NO-GC–specific inhibitor ODQ (ODQDCs) during maturation (days 6–8) when nNOS is highly ex-pressed (Figs. 1B, 2A). Primary culture with L-NAME DCs as wellas ODQ DCs resulted in a significantly impaired DC-inducedT cell proliferation as compared with untreated mDCs (Fig. 6A,6B). At primary culture, we did not find significant alterations inthe secretion of IFN-g (Th1 cytokine) or IL-5/IL-13 (Th2 cyto-kines) by stimulation with inhibitor-treated DCs as compared withuntreated mDCs (data not shown).To analyze the differentiation of T cell populations primed by

L-NAME DCs and ODQ DCs, we performed restimulation ex-periments. In contrast to T cells cocultured with untreated mDCs,we observed a significant reduction in proliferation of T cellsprimarily activated by either L-NAMEDCs or ODQDCs (Fig. 6C).This is an indication for the induction of a state of T cell anergy.To formally prove T cell hyporesponsiveness and to excludea higher rate of apoptosis in T cells induced by inhibitor-treatedDCs, high amounts of IL-2 (100 U/ml) were added in the re-stimulation experiments. The addition of IL-2 completely over-came the anergic state and restored proliferation to the extent ofcontrol effector T cells generated by primary activation withmDCs (Fig. 6D). These data confirm the result of anergy inductionas IL-2 is known to overcome the anergic state of T cells.Analyses of the T cell cytokine profile revealed a significant

reduction in IFN-g, IL-5, and IL-13 in culture supernatants ofT cells induced by inhibitor-treated DCs in contrast to controlT cells generated by primary activation with mDCs (Fig. 6E).IL-10 has been described to be involved in the induction andfunction of tolerogenic DCs and anergic and regulatory T cells(26, 39, 40), yet no relevant levels of this cytokine were detectedat restimulation regardless of the conditions of primary activation(data not shown).These results demonstrate that T cell populations primed by DCs

in which NO production had been inhibited during final maturation,display features of anergic T cells, such as low proliferation andreduced cytokine secretion.

DiscussionDCs are the most potent APCs, and play important roles both inimmunity and tolerance induction. In the last decade, protocolsfor the generation of human monocyte-derived DCs have beenestablished, allowing for analysis of the immunological features ofthese important APC populations and the successful translation ofthis knowledge into DC-targeted vaccination studies in variousdiseases (28, 41, 42).The major and novel finding of our study is that human

monocyte-derived DCs express nNOS on maturation and thatnNOS-derived NO increases DCmaturation in an autocrine fashionthat leads to efficient T cell activation. Many studies have docu-mented important regulatory effects of NO in murine models ofinflammation and infections. However, the role of NO in adaptiveimmunity in humans is less clear. Clinical studies have demon-strated that NO is increased in psoriasis suggesting that NO may beinvolved in T cell-related immune responses in humans (6–9). Inpsoriasis, iNOS-expressing DCs were found, and treatment withan anti–CD11a-mAb strongly reduced infiltration by these DCs inpatients clinically responding to this agent (7). However, the

FIGURE 3. No alteration of CAT-1, -2 and -3 and arginase I and II ex-

pression during human DCmaturation. DCs were generated from peripheral

blood as described in Materials and Methods. RT-PCR was performed and

mRNA expression of CAT-1, -2B and -3 (A) and arginase I and II (B) in iDCs

(day 6 of DC culture) and mDCs (day 8) relative to GAPDH was analyzed

and values were multiplied by 103. Expression of GAPDH did not differ in

mDCs and iDCs. Columns indicate means 6 SEM (n = 5–7).


FIGURE 4. nNOS-related NO is involved in maturation of human DCs. A–D, iDCs and mDCs were generated as described in Materials and Methods.

The NOS specific inhibitor L-NAME was added at the indicated concentrations and time intervals (A, day 1–6; B, day 6–8; C, day 1–8). Phenotype of DCs

was analyzed by flow cytometry. A–C, Percentage of HLA-DR-CD80, -CD83, and -CD86 double-positive cells and MFI of costimulatory molecules and

CD83 are demonstrated as dot blots. Similar results were obtained in five independent experiments. D, MFI of CD80, CD83, and CD86 expression of DCs

from one representative experiment plotted against the respective concentration of L-NAME (n = 5). E and F, DCs were generated as described in the

presence or absence of 9 mM L-NAME as indicated and the phenotype was analyzed by flow cytometry. E, Pooled data of the percentage of positive DCs

and the respective MFI of CD40, CD80, CD83, CD86, CCR7, and CD208 of six independent experiments are shown, the respective median and range are

given and the significance is indicated. pp # 0.05. F, Levels of IL-12p40 were assessed in supernatants of different DC populations. Pooled data of four

independent experiments are shown (mean 6 SD, pp # 0.05).


authors did not show if iNOS expressing DCs produce significantamounts of NO in vivo or in vitro. In our study, we found onlyvery low levels of iNOS mRNA in DCs, indicating that inmonocyte-derived DCs iNOS does not play a major role. This is

supported by data from Paolucci et al. (35), who did neither detectany iNOS protein in immature nor TNF-a matured humanmonocyte-derived DCs. In contrast, significant levels of nNOS(500-fold more than iNOS and comparable to nNOS expression in

FIGURE 5. NO-induced signaling in human DCs is guanylyl cyclase dependent. A–D, ODQ, a specific NO-GC inhibitor, was added to DC culture in

various concentrations as indicated and during different periods (A, day 1–6; B, day 6–8; C, day 1–8). Untreated (medium) DCs served as controls. A–C,

Percentage of HLA-DR-CD80, -CD83, and -CD86 double-positive DCs and MFI of costimulatory molecules and CD83 are demonstrated by dot blots. D,

MFI of CD80, CD83, and CD86 plotted against the respective concentrations of ODQ present during the indicated culture period (one representative

experiment of five). E and F, DCs were generated as described in the presence or absence of 200 mM ODQ and the phenotype was analyzed by flow

cytometry. E, Pooled data of the percentages of positive DCs and the respective MFI of CD40, CD80, CD83, CD86, CCR7, and CD208 of six independent

experiments are shown, the respective median and range are given and the significance is indicated. pp # 0.05; ppp # 0.01. F, Levels of IL-12p40 were

assessed in supernatants of different DC populations. Pooled data of four independent experiments are shown (mean 6 SD, ppp # 0.01).


brain tissue) were expressed in mDCs after maturation with TNF-a, IL-6, IL-1, and PGE2. High nNOS expression was verified onthe protein level and by production of bioactive NO. In addition,myeloid DCs directly purified from the blood of control in-dividuals and characterized as a population of immature humanDCs did not express nNOS, confirming our data that nNOS wasonly expressed by mDCs.High levels of bioactive NO was detected only in supernatants of

mDCs but not in iDCs. These data are in line with the work ofFernandez-Ruiz et al. (23) demonstrating that monocyte-derivedDCs generated from healthy volunteers produce NO. They detectediNOS expression in iDCs and mDCs and thus concluded that iNOSwas responsible for NO secretion by human DCs (23). However,they did not analyze the expression of the two other isoforms, eNOSor nNOS. Another group reported no detectable NO production ofhuman DCs, neither CD34+-derived nor immature monocyte-derived DCs that supports our finding that in iDCs, expressing low

amounts of nNOS, no relevant production of NO is detectable, andthat nNOS-derived NO provides for maturation-related processes(14). In addition, we used the RFL-6 reporter cell assay to measurebioactive NO, a method at least 100 times more sensitive than theGriess reagent used by Nishioka et al. (14).Our discovery of endogenous NO production through nNOS in

mDCs suggests an autocrine function through activation of theNO–GC pathway present in these cells as reported by Paolucciet al. (35, 36). In fact, inhibition of either NOS or the downstreameffector NO-GC reduced the maturation of DCs, indicatinga critical role for endogenous nNOS-derived NO, and NO-inducedcGMP, respectively, in DC maturation. These results are in linewith reports by others showing increased maturation of human DCsinduced by exogenous NO, reflected by high expression of matu-ration-specific surface molecules and cytokine production, such asIL-12 (14, 24, 36). Furthermore, Paolucci et al. (35) found that NOinhibits TNF-regulated endocytosis of human DCs. However, they

FIGURE 6. Inhibition of NO signaling during mat-

uration of DCs impaires their efficacy for T cell acti-

vation. A and B, DCs treated with L-NAME (9000 mM)

or ODQ (200 mM) during the maturation period of

culture (days 6–8) or untreated control DCs were co-

cultured with CD4+CD45RA+ T cells for 4 d in pri-

mary cultures. T cell proliferation was assessed by [3H]

thymidine incorporation after 96 h of primary culture.

A, Pooled data of primary proliferation of seven in-

dependent experiments (ratio of DCs to T cells is 1:20)

are shown. Proliferation is expressed as relative pro-

liferation, normalized to the proliferation of CD4+

CD45RA+ T cells, stimulated by control mDCs (= 100).

Median and range are given and significance is in-

dicated. ppp # 0.01; pppp # 0.001. B, One represen-

tative proliferation experiment of seven is depicted.

The mDCs L-NAME- and ODQ-treated DCs were

used in indicated numbers. C and D, After primary

culture with mDCs, L-NAME DCs, or ODQ DCs,

T cells were restimulated with anti-CD3/anti-CD28,

and T cell proliferation was determined. C, Pooled

relative proliferation data of five experiments (nor-

malized to proliferation of T cells generated by pri-

mary culture with mDCs (= 100). Median and range

are given and the significance is indicated. ppp # 0.01;

pppp # 0.001. D, The effect of high-dose IL-2 (100 U/

ml) on T cell proliferation at restimulation (anti-CD3/

anti-CD28) was analyzed. One representative experi-

ment of five is shown. E, T cells were restimulated

(anti-CD3/anti-CD28) for 24 h and cell culture super-

natants were subsequently analyzed by ELISA for

IFN-g, IL-5, and IL-13. One representative experiment

of four is shown. pppp # 0.001. The respective pri-

mary activation of T cells in A–E was as indicated.


did not detect any endogenous NO production of DCs and thusassumed that at the site of inflammation, exogenous NO may workthrough cGMP and prolong the ability of human DCs to internalizeAgs (35).Some studies demonstrate that cytokine- or pathogen-induced

maturation of murine DCs correlates with endogenous iNOS ex-pression and NO production, indicating that iNOS expressionincreases during maturation of murine DCs (27, 43). In addition,treatment of DCs with NO donors or overexpression of iNOS inDCs induced maturation of murine DCs as shown by enhancedsurface expression of MHC class II and costimulatory molecules.Consistently, NO donor-treated murine DCs were capable of en-hancing T cell proliferation (21). These observations inmurine DCsare consistent with our results demonstrating that endogenous NOalso induces the maturation of human DC. However, a differentNOS isoform appears to play a role in the human system; nNOS, butnot iNOS-derived, NO seems to be critical for maturation of humanmonocyte-derived DCs. These still somehow controversial resultsof NO impact on immune responses may be due to differences inthe properties of murine and human DCs and of various DC sub-populations.NO is synthesized by NOS using arginine as substrate. Some

studies report that arginase activation can limit the availability ofarginine as a substrate for NOS and thereby negatively regulate itsenzymatic activity (31). In our study, we found very low levels ofarginase I and II and no maturation-dependent regulation of theexpression of either arginase isoforms or of the arginine trans-porters CAT1 and -2B in human DCs. These results indicate thatneither arginine supply by membrane transport nor metabolism byarginase is regulated by maturation-dependent processes in humanDCs. However, we did not analyze if arginine concentrations inDCs were unaltered during maturation. In contrast, Fernandez-Ruiz et al. (23) detected arginase II but not arginase I isoforms inhuman mononcytes and DCs but they did not find a maturation-related regulation of the enzymes either.In this study, we describe that autocrine NO is involved in human

DC maturation resulting in increased IL-12 production by mDCsand a strong subsequent T cell activation. Furthermore, DCsmatured under conditions of nNOS inhibition induced an anergicT cell population characterized by low proliferation and reducedIFN-g, IL-5, and IL-13 secretion. This indicates that DCs afternNOS inhibition exhibit a tolerogenic phenotype that prevents thegeneration of effector T cells by induction of anergy.In our study, we used two different blocking reagents to analyze

the impact of autocrine NO production on DC maturation und APCfunction: 1) the NOS-specifc inhibitor L-NAME, and 2) the NO-GC–specific inhibitor ODQ. To further prove the functional rele-vance of our data in a more sophisticated setting, we performedknock-down experiments by transfection of DCs with nNOS-specific small interfering RNA (siRNA). Transfection of siRNAresulted in a partial reduction of nNOS protein and mRNA levelsup to 60%. However, no significant changes in NO productionwere found and, consequently, an unaffected DC phenotype wasobserved (data not shown).Previous studies in the murine system have shown that NO

exhibits a biphasic function in immune regulation and immunehomoeostasis; high concentrations of NO induce apoptosis inT cells or suppress T cell proliferation, whereas low amounts ofNO preferentially activate Th1 cells by upregulation of cGMPthat selectively induces the expression of IL-12Rb2 (4, 38, 43–45).In our study, inhibition of NOS by L-NAME during cocultureof mDCs and T cells did not result in a modulated or diminishedT cell activation, excluding a direct effect of human mDC-derivedNO on T cell activation (data not shown).

Understanding the immune mechanisms that result in maturationof human DCs is important for determining how these cells initiateT cell-related immune processes. Our study indicates that, in con-trast to the murine system, in human mDCs nNOS but not iNOSexpression is crucial for their Ag-presenting function and T cellstimulatory capacity. As a novel finding,we demonstrate that humannNOS-derived NO, critically involved in autocrine DC maturationand DC-mediated induction of T cell activation, contributes to thefine-tuning of immune processes in health and disease. Thesefindingsmaybeof relevance for thedevelopment of therapeutic toolstargeting NOS-related pathways in DCs to modulate the resultingimmune response.

AcknowledgmentsWe thank Drs. E. von Stebut-Borschitz and C. Becker for critical reading of

the manuscript and Gilles Spoden for help with small interfering RNA

experiments.

DisclosuresThe authors have no financial conflicts of interest.

References1. Nathan, C., and Q. W. Xie. 1994. Nitric oxide synthases: roles, tolls, and con-

trols. Cell 78: 915–918.2. Bogdan, C. 2001. Nitric oxide and the immune response. Nat. Immunol. 2: 907–

916.3. Niedbala, W., B. Cai, and F. Y. Liew. 2006. Role of nitric oxide in the regulation

of T cell functions. Ann. Rheum. Dis. 65: 37–40.4. Niedbala, W., X. Q. Wei, C. Campbell, D. Thomson, M. Komai-Koma, and

F. Y. Liew. 2002. Nitric oxide preferentially induces type 1 T cell differentiationby selectively up-regulating IL-12 receptor b 2 expression via cGMP. Proc. Natl.Acad. Sci. USA 99: 16186–16191.

5. MacMicking, J. D., R. J. North, R. LaCourse, J. S. Mudgett, S. K. Shah, andC. F. Nathan. 1997. Identification of nitric oxide synthase as a protective locusagainst tuberculosis. Proc. Natl. Acad. Sci. USA 94: 5243–5248.

6. Suschek, C. V., O. Schnorr, and V. Kolb-Bachofen. 2004. The role of iNOS inchronic inflammatory processes in vivo: is it damage-promoting, protective, oractive at all? Curr. Mol. Med. 4: 763–775.

7. Lowes, M. A., F. Chamian, M. V. Abello, J. Fuentes-Duculan, S. L. Lin,R. Nussbaum, I. Novitskaya, H. Carbonaro, I. Cardinale, T. Kikuchi, et al. 2005.Increase in TNF-a and inducible nitric oxide synthase-expressing dendritic cellsin psoriasis and reduction with efalizumab (anti-CD11a). Proc. Natl. Acad. Sci.USA 102: 19057–19062.

8. Guttman-Yassky, E., M. A. Lowes, J. Fuentes-Duculan, J. Whynot, I. Novitskaya,I. Cardinale, A. Haider, A. Khatcherian, J. A. Carucci, R. Bergman, and J. G. Krueger.2007. Major differences in inflammatory dendritic cells and their products distinguishatopic dermatitis from psoriasis. J. Allergy Clin. Immunol. 119: 1210–1217.

9. Nestle, F. O., D. H. Kaplan, and J. Barker. 2009. Psoriasis. N. Engl. J. Med. 361:496–509.

10. Ardavın, C., G. Martınez del Hoyo, P. Martın, F. Anjuere, C. F. Arias, A. R. Marın,S. Ruiz, V. Parrillas, and H. Hernandez. 2001. Origin and differentiation of den-dritic cells. Trends Immunol. 22: 691–700.

11. Steinman, R. M. Dendritic cells: understanding immunogenicity. 2007. Eur. J.Immunol. l37: S53-60.

12. Ardavın, C. 2003. Origin, precursors and differentiation of mouse dendritic cells.Nat. Rev. Immunol. 3: 582–590.

13. Jonuleit, H., U. Kuhn, G. Muller, K. Steinbrink, L. Paragnik, E. Schmitt, J. Knop,and A. H. Enk. 1997. Pro-inflammatory cytokines and prostaglandins inducematuration of potent immunostimulatory dendritic cells under fetal calf serum-free conditions. Eur. J. Immunol. 27: 3135–3142.

14. Nishioka, Y., H. Wen, K. Mitani, P. D. Robbins, M. T. Lotze, S. Sone, andH. Tahara. 2003. Differential effects of IL-12 on the generation of alloreactiveCTL mediated by murine and human dendritic cells: a critical role for nitricoxide. J. Leukoc. Biol. 73: 621–629.

15. Fernandez-Ruiz, V., A. Gonzalez, and N. Lopez-Moratalla. 2004. Effect of nitricoxide in the differentiation of human monocytes to dendritic cells. Immunol.Lett. 93: 87–95.

16. Morita, R., T. Uchiyama, and T. Hori. 2005. Nitric oxide inhibits IFN-a pro-duction of human plasmacytoid dendritic cells partly via a guanosine 39,59-cyclicmonophosphate-dependent pathway. J. Immunol. 175: 806–812.

17. Stuehr, D. J. 1999. Mammalian nitric oxide synthases. Biochim. Biophys. Acta1411: 217–230.

18. Alderton, W. K., C. E. Cooper, and R. G. Knowles. 2001. Nitric oxide synthases:structure, function and inhibition. Biochem. J. 357: 593–615.

19. Forstermann, U., J. P. Boissel, and H. Kleinert. 1998. Expressional control of the‘constitutive’ isoforms of nitric oxide synthase (NOS I and NOS III). FASEB J.12: 773–790.


20. Lu, L., C. A. Bonham, F. G. Chambers, S. C. Watkins, R. A. Hoffman,R. L. Simmons, and A. W. Thomson. 1996. Induction of nitric oxide synthase inmouse dendritic cells by IFN-gamma, endotoxin, and interaction with allogeneicT cells: nitric oxide production is associated with dendritic cell apoptosis. J.Immunol. 157: 3577–3586.

21. Huang, D., D. T. Cai, R. Y. R. Chua, D. M. Kemeny, and S. H. Wong. 2008.Nitric-oxide synthase 2 interacts with CD74 and inhibits its cleavage by caspaseduring dendritic cell development. J. Biol. Chem. 283: 1713–1722.

22. Serbina, N. V., T. P. Salazar-Mather, C. A. Biron, W. A. Kuziel, and E. G. Pamer.2003. TNF/iNOS-producing dendritic cells mediate innate immune defenseagainst bacterial infection. Immunity 19: 59–70.

23. Fernandez-Ruiz, V., N. Lopez-Moratalla, and A. Gonzalez. 2005. Production ofnitric oxide and self-nitration of proteins during monocyte differentiation todendritic cells. J. Physiol. Biochem. 61: 517–525.

24. Bagley, K. C., S. F. Abdelwahab, R. G. Tuskan, and G. K. Lewis. 2006. Choleratoxin indirectly activates human monocyte-derived dendritic cells in vitrothrough the production of soluble factors, including prostaglandin E(2) and nitricoxide. Clin. Vaccine Immunol. 13: 106–115.

25. Lindemann, S., C. Gierer, and H. Darius. 2003. Prostacyclin inhibits adhesion ofpolymorphonuclear leukocytes to human vascular endothelial cells due to ad-hesion molecule independent regulatory mechanisms. Basic Res. Cardiol. 98: 8–15.

26. Adler, H., S. Kubsch, E. Graulich, S. Ludwig, J. Knop, and K. Steinbrink. 2007.Activation of MAP kinase p38 is critical for the regulatory function of anergicT cells induced by tolerogenic dendritic cells. Blood 109: 4351–4359.

27. Ishii, K., H. Sheng, T. D. Warner, U. Forstermann, and F. A. Murad. 1991. Asimple and sensitive bioassay method for detection of EDRF with RFL-6 rat lungfibroblasts. Am. J. Physiol. 261: H598–H603.

28. Steinman, R. M., and J. Banchereau. 2007. Taking dendritic cells into medicine.Nature 449: 419–426.

29. Closs, E. I. 2002. Expression, regulation and function of carrier proteins forcationic amino acids. Curr. Opin. Nephrol. Hypertens. 11: 99–107.

30. Closs, E. I., J. P. Boissel, A. Habermeier, and A. Rotmann. 2006. Structure andfunction of cationic amino acid transporters (CATs). J. Membr. Biol. 213: 67–77.

31. Bronte, V., and P. Zanovello. 2005. Regulation of immune responses by L-arginine metabolism. Nat. Rev. Immunol. 5: 641–654.

32. Munder, M., K. Eichmann, J. M. Moran, F. Centeno, G. Soler, and M. Modolell.1999. Th1/Th2-regulated expression of arginase isoforms in murine macro-phages and dendritic cells. J. Immunol. 163: 3771–3777.

33. Munder, M., F. Mollinedo, J. Calafa, J. Canchado, C. Gil-Lamaignere, J.M. Fuentes, C. Luckner, G. Doschko, and G. Soler, K. Eichmann K, F. M. Muller,A. D. Ho, M. Goerner, and M. Modolell. 2005. Arginase I is constitutively ex-pressed in human granulocytes and participates in fungicidal activity. Blood 105:2549–2556.

34. Zhu, J., and W. E. Paul. 2008. CD4 T cells: fates, functions, and faults. Blood112: 1557–1569.

35. Paolucci, C., P. Rovere, C. De Nadai, A. A. Manfredi, and E. Clementi. 2000.Nitric oxide inhibits the tumor necrosis factor a -regulated endocytosis of humandendritic cells in a cyclic GMP-dependent way. J. Biol. Chem. 275: 19638–19644.

36. Paolucci, C., S. E. Burastero, P. Rovere-Querini, C. De Palma, S. Falcone,C. Perrotta, A. Capobianco, A. A. Manfredi, and E. Clementi. 2003. Synergismof nitric oxide and maturation signals on human dendritic cells occurs througha cyclic GMP-dependent pathway. J. Leukoc. Biol. 73: 253–262.

37. Moncada, S., and E. A. Higgs. 1995. Molecular mechanisms and therapeuticstrategies related to nitric oxide. FASEB J. 9: 1319–1330.

38. Niedbala, W., X. Q. Wei, D. Piedrafita, D. Xu, and F. Y. Liew. 1999. Effects ofnitric oxide on the induction and differentiation of Th1 cells. Eur. J. Immunol.29: 2498–2505.

39. Steinbrink, K., M. Wolfl, H. Jonuleit, J. Knop, and A. H. Enk. 1997. Induction oftolerance by IL-10-treated dendritic cells. J. Immunol. 159: 4772–4780.

40. Vignali, D. A., L. W. Collison, and C. J. Workman. 2008. How regulatory T cellswork. Nat. Rev. Immunol. 8: 523–532.

41. Steinbrink, K., K. Mahnke, S. Grabbe, A. H. Enk, and H. Jonuleit. 2009. My-eloid dendritic cell: From sentinel of immunity to key player of peripheral tol-erance? Hum. Immunol. 70: 289–293.

42. Eksioglu, E. A., S. Eisen, and V. Reddy. 2010. Dendritic cells as therapeuticagents against cancer. Front. Biosci. 15: 321–347.

43. Bonham, C. A., L. Lu, Y. Li, R. A. Hoffman, R. L. Simmons, andA. W. Thomson. 1996. Nitric oxide production by mouse bone marrow-deriveddendritic cells: implications for the regulation of allogeneic T cell responses.Transplantation 62: 1871–1877.

44. Williams, M. S., S. Noguchi, P. A. Henkart, and Y. Osawa. 1998. Nitric oxidesynthase plays a signaling role in TCR-triggered apoptotic death. J. Immunol.161: 6526–6531.

45. van der Veen, R. C., T. A. Dietlin, L. Pen, and J. D. Gray. 1999. Nitric oxideinhibits the proliferation of T-helper 1 and 2 lymphocytes without reduction incytokine secretion. Cell. Immunol. 193: 194–201.


Neuronal Nitric Oxide Synthase Modulates Maturation of Human Dendritic Cells

Documents

Transcript of Neuronal Nitric Oxide Synthase Modulates Maturation of Human Dendritic Cells