Vol. 83 No. 4 April 1997

ORAL AND MAXILLOFACIAL PATHOLOGY Editor: Carl M. Allen

Mutated and wild-type p53 expression and HPV integration in proliferative verrucous leukoplakia and oral squamous cell carcinoma

R a j a r a m O o p a l a k r i s h n a n , B D S , a C h r i s t o p h e r M, W e g h o r s t , PhD, b

T e r e s a A. L e h m a n , P h D , c R i c h a r d J. Ca lver t , M D , d G a u t a m Bi jur , BS, e

C a r o l L. K, Sabour in , P h D , f Susan R. M a l l e r y , D D S , PhD,g D a v i d E. Schul le r , M D , h

and G a r y D. Stoner , P h D , i C o l u m b u s , Ohio , and Laure l , Md .

THE OHIO STATE UNIVERSITY, BIOSERVE BIOTECHNOLOGIES, AND U.S. FOOD AND DRUG

ADMINISTRATION

The frequencies of overexpression and mutation in the p53 tumor suppressor gene were examined in proliferative verrucous leukoplakia and oral squamous cell carcinoma with immunohistochemistry and single-strand conformation polymorphism analysis of DNA fragments amplified by polymerase chain reaction. Ten samples each of normal oral mucosa, proliferative verrucous leukoplakia, and squamous cell carcinoma were immunostained with antibodies against p53 protein; 8 of 10 cases of proliferative verrucous leukoplakia cases and 7 of 10 cases of oral squamous cell carcinoma were positive for p53 protein. Minimal staining was observed in normal oral tissues. The quantified labeling indexes demonstrated a range that corresponded to lesion progression. Single-strand conformation polymorphism analysis revealed p53 gene mutations within exons 5 to 8 in 40% (4 of 10) of the squamous cell carcinoma samples. Two of the 4 mutated squamous cell carcinoma samples lacked p53 expression. No p53 mutations were detected in proliferative verrucous leukoplakia tissues. Human papillomavirus 16 was identified in 2 of 7 p53 positive oral squamous cell carcinoma samples. Human papillomavirus 16 and 18 were identified in two of eight p53 positive proliferative verrucous [eukoplakia samples. One p53 negative squamous cell carcinoma sample was positive for human papillomavirus 16 and had a mutation in exon 6 of the p53 gene. Human papillomavirus infection along with p53 expression plays a yet to be defined role in the pathogenesis of a limited number of cases of proliferative verrucous leukoplakia and squamous cell carcinoma, p53 Immunohistochemistry, p53 gene mutations, and human papillomavirus infection prevalence do not provide a means to differentiate between leukoplakia and carcinoma and do not provide a predictive test for progression of leukoplakia to carcinoma. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1997;83:471-7)

This work was supported in part by grants CA 16058-20 from The Ohio State University (GDS), IRGI 6-34 from American Cancer Society (CMW) and IR43CA62715-01 (TAL). Some tissues used for HPV analysis were provided by the Cooperative Human Tis- sue Network (CHTN) funded by NCI. aResearch Associate, Department of Pathology and Laboratory of Cancer Chemoprevention and Etiology, The Ohio State University. bAssistant Professor, School of Public Health and Laboratory of Cancer Chemoprevention and Etiology, The Ohio State University. CDirector, Research and Development, Bioserve Biotechnologies. aResearch Medical Officer, Office of Special Nutritionals, Clinical Research and Review of Staff, U.S. Food and Drag Administration. eResearch Assistant, Department of Pathology and Laboratory of

Cancer Chemoprevention and Etiology, The Ohio State University. fResearch Scientist, School of Public Health and Laboratory of Cancer Chemoprevention and Etiology, The Ohio State University. gAssistant Professor, Department of Maxillofacial Surgery/Pathol- ogy, College of Dentistry, The Ohio State University. hprofessor and Chairperson, Department of Otolaryngology, The Ohio State University. iprofessor, School of Public Health, and Director, Laboratory of Cancer Chemoprevention and Etiology, The Ohio State University. Received for publication Oct. 28, 1996; returned for revision Feb. 26, 1996 and May 21, 1996; accepted for publication Oct. 14, 1996. Copyright © 1997 by Mosby Year Book, Inc. 1079-2104/97/$5.00 + 0 7/14/78679

471

472 Gopalakrishnan et al. ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY April 1997

Thep53 gene is located at chromosome band 17p13.1 in the human genome. It contains 11 exons encoding a 53 kD nuclear phosphoprotein that is associated with cell cycle regulation, cellular differentiation, suppression of abnormal cell proliferation and tumor development, and structurally resembles a transcrip- tional activating factor. 1 Wild-type p53 negatively regulates cell growth and division by blocking dam- aged cells in the G1/S phase of the cell cycle, thus al- lowing the cells to undergo DNA repair or enter ap- optosis. 2

Frequent mutations in the p53 gene are observed in cancers of the colon, breast, cervix, lung, esophagus, liver, and prostate. 2 In fact, the p53 gene is the most frequently mutated tumor suppressor gene detected in human cancer. 1, 3, 4 Most of the mutations in the p53 gene are single missense base substitutions in exons 5 through 8.5, 6 Allelic loss, insertions, deletions, and nonsense mutations have also been reported. 1, 7 Cells that express mutated p53 proteins are not blocked at the GI/S phase of the cell cycle and thus cannot un- dergo repair or enter apoptosis. The mutant p53 pro- tein can function as an oncogene, which results in immortalization and transformation, and exerts a transdominant negative effect by forming oligomeric complexes with wild-type p53 proteins. The resulting inactive complex can cooperate with oncogenes such as ras and lead to cellular transformation.

Recently, a specific epithelial preneoplastic process in the oral cavity termed proliferative verrucous leu- koplakia (PVL) has been identified and has an in- creased frequency of malignant transformation to squamous cell carcinoma (SCC). 8, 9 PVL is a slow- growing progressive form of oral leukoplakia that be- gins as a simple hyperkeratosis but can become mul- tifocal and develop into SCC if left untreated. 8, 9 The lesion occurs predominantly in elderly women; 60% of whom have associated tobacco use. 8 PVL has a high recurrence rate and is typically resistant to all treatment modalities, such as, surgery, radiation, chemotherapy, and laser excision. Because of its multifocal presenta- tion, several biopsies are required to exclude invasive SCC. Diagnosis of PVL often occurs at an advanced stage when the lesions are refractory to treatment. This accounts for the poor prognosis in PVL patients. PVL behaves in a more aggressive fashion than other forms of leukoplakia. The association of human papilloma- virus (HPV) 16 infection in the pathogenesis of PVL has been reported, l° HPV in cervical carcinoma cell lines inactivates wild type p53 and may lead to-trans- formation.a i Thus the presence of p53 gene alterations coupled with HPV infection may play a role in the pathogenesis of PVL.

Identification of genetic alterations in PVL may

allow for the early diagnosis and treatment of Oral cancer development. 12, 13 We analyzed p53 protein expression and gene mutations in normal oral mu- cosa, PVL, and SCC with the use of immunohis- tochemistry and polymerase chain reaction single- strand conformation polymorphism (PCR-SSCP) techniques. These samples were also examined for the presence of HPV sequences.

MATERIAL and METHODS Subjects and materials

Surgical specimens from 10 cases of PVL, oral SCC, and normal oral mucosa were studied. Multiple serial sections from formalin-fixed, paraffin-embed- ded tissue were cut using sterile disposable blades to prevent contamination during DNA isolation. Repre- sentative sections were immunostained for p53 pro- tein. The immunostained sections were then used as a template for isolation of DNA from unstained slides.

Immunohistochemical analysis Immunohistochemical detection of p53 protein was

carried out by a standard avidin-biotin peroxidase procedure. DO-7 and CM- 1 that detect wild-type and mutant forms of human p53 protein (Novocastra Laboratories, Ltd., Newcastle, U.K.) were used at a dilution of 1:100 and 1:1000; respectively. A micro- wave antigen retrieval procedure was used (Biogen- ex, San Ramon, Calif.).

Image analysis The labeling index (LI) was calculated for all the

normal, PVL, and oral SCC cases immunostained for p53 protein with a Roche Image Analyzer (RIAS, Roche, Eldon College, N.C.). LI was quantitated on the basis of relative nuclear positive staining area and relative negative nuclear staining area. Calibration of thresholds for positive staining and negative staining was set interactively. Three calibration fields were chosen, one area with visually high staining, one area with intermediate staining, and one area with low staining. Random high-power fields were chosen, and all epithelial cells in the field were evaluated, irre- spective of the cell layer. Approximately 250 nuclei were segmented and quantitated for each case. Over- lapping nuclei were rejected. Cells that had a relative positive area greater than 23.25% and a relative neg- ative area less than 72% were considered positive for p53 protein. These values were determined and con- firmed through the RIAS software by cell by cell analysis.

ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY Gopalakrishnan et al. 473 Volume 83, Number 4

Table I. p53, HPV L1 consensus and [3-globin oligonucleotide primers

p53 Exon 5 5'-TCA ACT CTG TCT CCT TCC TCT Upstream TCC T-3'

5'-CTG GGC AAC CAG CCC TGT CGT-3'

p53 Exon 6 5'-TTG CTC TTA GGT CTG GCC CC-3'

5'-CAG ACC TCA GGC GGC TCA TA-3'

p53 Exon 7 5'-TAG GTT GGC TCT GAC TGT ACC-3'

5'-TGA CCT GGA GTC TTC CAG TGT-3'

P53 Exon 8 5'-AGT GGT AAT CTA CTG GGA CGG-3'

5'-ACC TCG CTT AGT GCT CCC TG-3'

Li Myl 1" 5'-GCM CAG GGW CAT AAY AAT GG-3'

L1 My09* 5'-CGT CCM ARR GGA WAC TGA TC-3'

[3-globin 5'-GAA GAG CCA AGG ACA GGT GH20 AC-3'

[3-globin 5'-CAA CTT CAT CCA CGT TCA PC04 CC-3'

Downstream

Upstream

Downstream

Upstream

Downstream

Upstream

Downstream

Upstream

Downstream

Upstream

Downstream

*MM = A and C; R = A and G; W = A and T; Y = C and T.

Statistical analysis Statistical comparisons among LI means of normal

oral mucosa, PVL, and oral SCC were made with one-way A N O V A and Newman-Keuls analysis.

Table II. Oligonucleotide subtype specific probes

Nucleodde sequence HPV probe (5'- > Y ) HPV subtype

MY14 MY95 MY133 MY130 WD74

CATACACCTCCAGCACCTAA 16 GATATGGCAGCACATAATGAC 16 GTAACATCCCAGGCAATTG 16 GGGCAATATGATGCTACCAAT 18 GGATGCTGCACCGGCTGA 18

Table III. p53 and HPV analysis in PVL and oral SCC

Normal Oral tissue PVL SCC

Immunohistochemistry p53 Expression 0/10 8/10 7/10 Labeling Index 2.46 _+ 1.28 31.92 _+ 22.18 49.01 + 32.44

SSCP p53 exon 0/10 0/10 4/10 mutations

HPV infection Type 16 1/10 1/10 3/10 Type 18 0/10 1/10 0/10

p53 IHC and 0/10 0/10 2/10 mutations

p53 IHC and HPV 0/10 2/10 2/10 infection

p53 IHC, mutations 0/10 0/10 0/10 and HPV

HPV, Human papilloma virus. IHC, Immunohistochemistry.

DNA extraction from paraffin sections D N A extraction was performed as previously de-

scribed.14 Serial 5 ~ sections were microdissected with the immunostained sections used as a template. Regions that had immunostained positively and neg- atively were carefully separated and analyzed indi- vidually. With SCC, different morphologic patterns of tumor islands were selected on the basis of a high tumor cell:stromal cell ratio with avoidance of in- flammatory cells, necrosis, or ulceration. With PVL and normal oral mucosa, D N A isolation was re- stricted to the epithelial layer while avoiding the un- derlying submucosa.

Deparaffinized scraped samples were vortexed gently for 20 minutes, then spun for 5 minutes at 8000g in a microcentrifuge. The pellet was suspended in 150 ~1 of 100% ethanol and vortexed gently for 20 minutes, then the suspension was centrifuged for 5 minutes. The dried pellet was resusPended in 100 gl of digestion buffer (50 mM Tris, pH 8.5, 1 mM EDTA, 0.5% Tween 20) containing 200 ng/ml of proteinase K, and the suspension was incubated at 55°C for 48 hours. The suspension was then incubated at 95°C for 10 minutes to inactivate proteinase K and

centrifuged at 8000g for 1 minute. The supernatant was used as the D N A template for PCR.

Polymerase chain reaction The p53 primers shown in Table ! were partially

intron based. PCRs were performed with standard techniques. 14 The samples were amplified in dupli- cate, and each set o f reactants contained a negative no-template control. The PCR products were ana- lyzed with acrylamide gels and stained with ethidium bromide.

Cold-single strand conformation polymorphism (Cold-SSCP) analysis

The nonradioactive SSCP procedure was used as previously described] 4' 15 SSCP bands were visual- ized by silver staining (Novex, San Diego, Calif.). Gastric adenocarcinomas known to have p53 gene mutations 14 were used as positive controls and were included in each SSCP gel.

HPV analysis PCR-Southern hybridization was used to determine

the presence of HPV in all the PVL, oral SCC, and nor-

474 Gopalakrishnan et al. ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY April 1997

Fig. 1. Immunohistochemistry for p53 protein (DO-7) in normal oral mucosa, PVL, and oral SCC. Normal oral mucosa shows no staining (A) and oral SCC shows increased staining in lesional cells (B), PVL (C and D) exhibits moderate staining in the basal and suprabasal cells. (Original magnification x400.)

mal oral mucosal samples using standard techniques. 16 PCR co-amplification assays were performed with HPV L1 region consensus primers (MY11/MY09) 16 and [3-globin primers (GH20]PC04) 16 (Table I). HeLa cell (ATCC CCL 2) genomic DNA was used as an HPV positive/[3-globin positive control, and Calul (ATCC HTB 54) genomic DNA was used as an HPV negative/ [3-globin positive control.

HPV subtyping HPV subtyping was performed by dot blot hybrid-

ization. Probes for HPV 16 (MY14, MY95, and MY133) and HPV18 (MY130 and WD74) (Table ii)16, 17 were used.

RESULTS Detection of p53 overexpression by immunohistochemistry

Discrete granular staining in the epithelial cell nu- clei was evaluated as positive and regarded as dem- onstration of aberrant accumulation of p53 (Fig. 1). Immunohistochemical analyses for p53 protein in normal oral mucosa, PVL, and oral SCC are shown in Table III. Eight of 10 PVL and 7 of 10 oral SCC stained positive for p53 protein. No differences were observed between the two antibodies with respect to the number of positive cases or staining intensity.

Minimal to no staining was observed in normal oral mucosa. Interestingly, the staining for p53 protein in PVL specimens was restricted to the basal and the intermediate suprabasal layers of the epithelium, whereas in SCCs the staining tended to be diffuse. A difference in p53 protein staining intensity was also observed between oral SCC and PVL tissues, with the oral SCCs staining more intensely than PVL (Fig. 1). The more dysplastic regions of PVL demonstrated enhanced staining relative to the less dysplastic lesional areas.

The mean LI of p53 stained normal samples were considered negative even though very minimal stain- ing was seen in a few cases (Table III). The mean LI for PVL and oral SCC cases were 31.92% and 49.01%, respectively (Table III). The labeling in- dexes between normal oral mucosa and oral SCC and normal oral mucosa and PVL were significantly dif- ferent (p < 0.01); whereas those between PVL and oral SCC were not significantly different.

Detection of mutations in p53 by SSCP analysis To screen for the presence of mutations in PVL,

oral SCC, and normal oral mucosa, exons 5 through 8 of the p53 gene were evaluated individually by cold-SSCP analysis (Table III). Of the 10 oral SCC

ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY GopaIakrishnan et al. 47,5 Volume 83, Number 4

samples, 4 exhibited additional bands demonstrating different single-stranded conformations (SCC 2, 4, and 8 in exon 6; SCC 1 in exon 7; Fig. 2). In addi- tion, 2 of the 4 p53 mutation positive oral SCC cases did not show p53 protein expression by immunohis- tochemistry (SCC 2 and 8; Table III).

No positive SSCP band shifts were detected in any of the 10 PVL and 10 normal oral mucosal samples screened for mutations in exons 5 through 8. Because no mutations were identified in PVL and p53 gene mutations have already been well characterized in oral SCCs, further analysis to identify specific muta- tions was not performed.

HPV analysis in PVI_ Three of i0 oral SCC cases (SCC 3, 6, and 8; Ta-

ble III) were positive for HPV 16. HPV 16 was iden- tified in 1 PVL sample (PVL 2; Table III) and HPV 18 was identified in another PVL case (PVL 4; Table III). Both the HPV positive PVLs (PVL 2 and 4; Ta- ble III) and 2 of 3 HPV positive oral SCC cases (SCC 3 and 6; Table III) showed p53 protein accumulation without p53 mutations. One of the 10 normal oral mucosal samples showed the presence of HPV 16; however, there was no p53 accumulation identified.

DISCUSSION The genetic alterations involved in the progression

of oral dysplasia to oral SCC are not well understood. Alterations in thep53 gene have been proposed as one of the major factors responsible for both initiation and progression of oral cancer. 6, 18-22 Both loss of het- erozygosity and point mutations of the p53 gene have been reported to occur in oral c a n c e r . 19,2°,22,23

Alterations in p53 expression have been shown to occur in various premalignant lesions during head and neck tumorigenesis. 24' 25 Demonstration of p53 gene alterations in conjunction with clinical and micro- scopic features could facilitate early identification, recognition, and treatment of PVL. In addition, the role of HPV 16 as an etiologic agent in the pathogen- esis of PVL and oral SCC has been studied. TM 26, 27 Evidence that HPV E6 protein binds to p53 protein and enhances its degradation is one mechanism that could mediate transformation. 28, 29 Thus loss of wild- type p53 function as demonstrated by gene mutation or HPV infection could be critical in the progression of PVL to SCC. However, this is not supported by the results from the current study.

A combination of immunohistochemical analysis of p53 protein and detection of mutations with SSCP, denaturing gradient gel electrophoresis, or restriction fragment length polymorphism along with or without direct sequencing is a standard method to study alter-

Fig. 2. Cold-SSCP analysis of exons 6 and 7 of the p53 gene in oral SCC. In addition to the wild-type (WT) bands, abnormally migrating bands can be seen in exon 6 for SCC 2, SCC 4, and SCC 8 and in exon 7 for SCC 1. Gastric ad- enocarcinomas (represented as +C) known to contain mu- tations in exons 6 and 7 were used as positive controls.

ations of the p53 gene. Missense mutations in the p53 gene can generate mutant proteins with an increased half-life thus allowing their immunohistochemical detection, in contrast to normal cells where wild-type p53 protein is not detected because of its short half- life. Cold-SSCP is a very sensitive technique that quickly determines the presence of mutations via al- tered mobility of mutated DNA in a gel compared with wild-type controls. 14' ~5

The results of this study suggest a yet to be iden- tified role of HPV in development and progression of PVL through wild-type p53 protein stabilization in a small percentage of cases. In this study we observed HPV 16 in two of seven oral SCC samples with p53 protein accumulation, and HPV 16 or 18 in two of eight PVL samples with p53 protein accumulation. One sample of oral SCC showed the presence of HPV 16 in the absence of p53 protein accumulation and the presence of a mutation in exon 6 of the p53 gene. Only 1 of the 10 normal oral mucosal samples demon-

476 Gopalakrishnan et al. ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY April 1997

st ra ted the p r e s e n c e o f H P V 16, h o w e v e r , p53 p ro te in

a c c u m u l a t i o n was no t s een in this sample . T h e pres-

e n c e o f H P V s e q u e n c e s in n o r m a l ora l t i ssues has

b e e n repor ted . 3° This s tudy is cons i s t en t w i t h p rev i -

ous repor t s o b s e r v i n g the p r e s e n c e o f p53 g e n e m u -

ta t ions in ora l S C C s . 19, 2o In addi t ion , the p r e s e n c e o f

p53 g e n e m u t a t i o n s w i t h i n exons 5 t h rough 8 in three

o f s e v e n H P V - n e g a t i v e oral S C C samp le s i s cons i s -

ten t w i t h p r e v i o u s l y r e p o r t e d o b s e r v a t i o n s in c e r v i c a l

cancer . 31 T h e s e m u t a t i o n s w e r e no t i den t i f i ed in all

e igh t H P V - n e g a t i v e P V L samples . A l t h o u g h ca re fu l

m i c r o d i s s e c t i o n was u s e d to sc rape on ly the p53 pro-

te in p o s i t i v e ce l l s fo r D N A iso la t ion , there m a y h a v e

b e e n c o n t a m i n a t i n g w i l d - t y p e ce l l s that c o u l d h a v e

o v e r w h e l m e d the m u t a t e d popu la t ion , thus r e d u c i n g

the chances o f de t ec t i ng m u t a t e d p53. 32

O n l y t w o o f the f o u r m u t a t i o n p o s i t i v e oral S C C

samp le s e x p r e s s e d h i g h l e v e l s o f p53 pro te in . L a c k o f

p53 p ro t e in a c c u m u l a t i o n in the o the r t w o cases m a y

h a v e b e e n due to a m u t a t i o n that r e su l t ed in a s top

c o d o n that f r equen t l y resul t s in a p53 p ro t e in nul l

p h e n o t y p e . P V L samp le s d e m o n s t r a t e d a c c u m u l a t i o n

o f p53 p ro t e in in 8 o f 10 cases . T h e m a j o r i t y o f pos -

i t ive ce l l s w e r e l o c a l i z e d to the basa l and the i m m e -

dia te suprabasa l layer . N o p53 m u t a t i o n s w e r e iden-

t i f ied in these samples .

P V L has b e e n r e p o r t e d to h a v e a h i g h d e g r e e o f

p r o g r e s s i o n to S C C . 8 Its p r o g r e s s i o n f r o m a foca l

dysp las t i c l e s ion to a m u l t i f o c a l d i s t r ibu t ion m a y be

c a u s e d by seve ra l gene t i c a l tera t ions . O u r resul t s are

in a c c o r d a n c e w i t h p r e v i o u s i nves t i ga to r s on the

p r e s e n c e o f p53 g e n e m u t a t i o n s in ora l S C C spec i -

mens . H o w e v e r , ou r resul ts do no t p r o v i d e e v i d e n c e

fo r a ro l e o f p53 g e n e m u t a t i o n s in the p r o g r e s s i o n

f r o m P V L to oral S C C or p r o v i d e e v i d e n c e that H P V

16/18 in f ec t i on p lays a ro l e in the p a t h o g e n e s i s o f

P V L by i nac t i va t i on o f p53. T h e r e f o r e , o the r as ye t

to be i den t i f i ed gene t i c a l te ra t ions o r e n v i r o n m e n t a l

fac tors a re l i ke ly to be i n v o l v e d .

We thank Ms. Mary Lloyd for histochemical assistance. We also thank Ms. Diana Carter for her assistance in typ- ing the manuscript.

REFERENCES

1. Levine AJ. The tumor suppressor genes. Ann Rev Biochem 1992;62:623-51.

2. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mu- tations in human cancers. Science 1991 ;253:49-53.

3. Levine AJ, Momand J, Finlay CA. Thep53 tumor suppressor gene. Nature (London) 1991 ;351:453-6.

4. Mowat M, Cheng A, Kimura N, Bemstein A, Benchimol S. Rearrangements of the cellular p53 gene in erythroleukemia cells transformed by friend virus. Nature (London) 1985; 314:633-6.

5. Nigro JM, Baker S J, Preisinger AC, Jessup JM, Hostetter R,

Cleary K, et al. Mutations in the p53 gene occur in diverse human tumor types. Nature (London) 1989;342:705-8.

6. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Muta- tions in the p53 tumor suppressor gene: clues to cancer eti- ology and molecular pathogenesis. Cancer Res 1994;54:4855- 78.

7. Zambetti GP, Levine AJ. A comparison of the biological ac- tivities of wild-type and mutant p53. FASEB J 1993;7:855- 65.

8. Hansen L, Olson J, Silverman Jr S. Proliferative verrucous leukoplakia: a long term study of 30 patients. Oral Surg Oral Med Oral Pathol 1985;60:285-98.

9. Neville BW, Darmn D, Allen CM, Bouquot JE, editors. Ep- ithelial pathology. In: Oral and maxillofacial pathology. Phil- adelphia: WB Saunders, 1995:259-321.

10. Palefsky JM, Silverman Jr S, Abdel-Sallam M, Daniels TE, Greenspan JS. Association between proliferative verrucous leukoplakia and infection with human papilloma virus type 16. J Oral Pathol Med 1995;24:193-7.

11. Scheffner M, Munger K, Byrne JC, Howley PM. The state of the p53 and retinoblastoma genes in human cervical carci- noma cell lines. Proc Natl Acad Sci U S A 1991;88:5523-7.

12. Boone CW, Kelloff GJ. Intraepithelial neoplasia, surrogate endpoint biomarkers and cancer chemoprevention. J Cell Biochem Suppl 1993;17F:37-48.

13. Morse MA, Stoner GD. Cancer chemoprevention: principles and Prospects. Carcinogenesis 1993;14:1737-46.

14. Hongyo T, Buzard GS, Palli D, et al. Mutations of the K-ras and p53 genes in gastric adenocarcinomas from a high-inci- dence region around Florence, Italy. Cancer Res 1995;55: 2665-72.

15. Hongyo T, Buzard GS, Calvert RJ, Weghorst CM. "Cold- SSCP": a simple rapid and non-radioactive method for opti- mized single strand conformation polymorphism analyses. Nucleic Acids Res 1993;21:3637-42.

16. Bauer HM, Ting Y, Greer CE, Chambers JC, et al. Genital human papilloma virus infection in female university students as determined by a PCR-based method. JAMA 1991;265: 472-7.

17. Bauer HM, Greer CE, Manos MM. Determination of genital human papilloma virus infection by consensus PCR amplifi- cation. In: Herrington CS, McGee JO'D, editors. Diagnostic molecular pathology: a practical approach. Oxford: Oxford University Press, 1992:131-52.

18. Scully C. Oncogenes, tumor suppressor genes and viruses in oral squamous cell carcinoma. J Oral Pathol Med 1993:22: 337- 47.

19. Sakai E, Rikimara K, Ueda M, et al. Thep53 tumor suppres- sor gene and ras oncogene mutations in oral squamous cell carcinoma. Int J Cancer 1992;52:867-72.

20. Sakai E, Tsuchida N. Most human squamous cell carcinomas in the oral cavity contain mutatedp53 tumor suppressor genes. Oncogene 1992;7:927-33.

21. Zariwala M, Schmid S, Pfaltz M, Ohgaki H, Kleihues P, Schafer R. p53 gene mutations in oropharyngeal carcinomas: a comparison of solitary and multiple primary tumors and lymph-node metastases. Int J Cancer 1994;56: 807-11.

22. Boyle JO, Hakim J, Koch W, et al. The incidence of p53 mu- tations increases with progression of head and neck cancer. Cancer Res 1993;53:4477-80.

23. Largey JS, Meltzer S J, Yin J, Norris K, Sauk JJ, Archibald DW. Loss of heterozygosity of p53 in oral cancers demon- strated by the polymerase chain reaction. Cancer 1993;71: 1933-7.

24. Shin DM, Kim J, Ro JY, et al. Activation of p53 gene expres- sion in premalignant lesions during head and neck tumori- genesis. Cancer Res 1994;54:321-6.

25. Sauter ER, Cleveland D, Trock B, Ridge JA, Klein-Szanto AJP. p53 is overexpressed in fifty percent of pre-invasive le- sions of head and neck epithelium. Carcinogenesis 1994; 15: 2269-74.

26. Greer RJ, Eversole LR, Crosby LK. Detection of human pap-

ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY Gopalakrishnan et al. 4 7 7 Volume 83, Number 4

illoma virus genomic DNA in oral smokeless tobacco-asso- ciated leukoplakias and epithelial malignancies. J Oral Max- illofac Surg 1990;48:1201-5.

27. Woods KR, Shillitoe EJ, Spitz MR, Schantz SP, Adler-Storthz K. Analysis of human papilloma virus DNA in oral squamous cell carcinomas. J Oral Pathol Med 1993;22:101-8.

28. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, How- ley PM. The E6 oncoprotein encoded by human papilloma virus types 16 and 18 promotes the degradation of p53. Cell 1990;63:1129-36.

29. Hubbert NL, Sedman SA, Schiller JT. Human papilloma vi- rus type 16 E6 increases the degradation rate of p53 in human keratinocytes. J Virol 1992;66:6237-41.

30. Cox M, Maitland N, Scully C. Human herpes simplex-1 and papilloma virus type 16 homologous DNA sequences in nor- mal, potentially malignant and malignant oral mucosa. Oral Oncol, Eur J Cancer 1993;29B:215-9.

31. Crook T, Wrede D, Tidy JA, Petermason W, Evans D J, Vousden KH. Clonal p53 mutations in primary cervical can- cer; association with human papilloma virus-negative tumors. Lancet 1992;339:1070-3.

32. Hong W-S, Hong S-II, Lee DS, Son Y. Effect of non-tumor cell contamination on detection of p53 gene mutations in hu- man gastric cancer cells by polymerase chain reaction single- strand conformation polymorphism analysis. Korean J Intern Med 1994;9:20-4.

Reprint requests: Gary D. Stoner, PhD School of Public Health and Laboratory of Cancer Chemoprevention and Etiology CHRI, Rm 1148, 300 W. 10th Avenue The Ohio State University Columbus, OH 43210-1240