Multiplex PCR and minisequencing of SNPs—a model with 35 Y chromosome SNPs

Juan J. Sancheza,*, Claus Børstinga, Charlotte Hallenberga, Anders Bucharda,Alexis Hernandezb, Niels Morlinga

aDepartment of Forensic Genetics, Institute of Forensic Medicine, University of Copenhagen, 11 Frederik V’s Vej,

DK-2100 Copenhagen, DenmarkbDepartamento de Canarias, Instituto Nacional de Toxicologıa, Campus de Ciencias de la Salud, 38320 La Laguna, Tenerife, Spain

Received 22 January 2003; received in revised form 2 July 2003; accepted 7 July 2003

Abstract

We have developed a robust single nucleotide polymorphism (SNPs) typing assay with co-amplification of 25 DNA-fragments

and the detection of 35 human Y chromosome SNPs. The sizes of the PCR products ranged from 79 to 186 base pairs. PCR

primers were designed to have a theoretical Tm of 60 � 5 8C at a salt concentration of 180 mM. The sizes of the primers ranged

from 19 to 34 nucleotides. The concentration of amplification primers was adjusted to obtain balanced amounts of PCR products

in 8 mM MgCl2. For routine purposes, 1 ng of genomic DNAwas amplified and the lower limit was approximately 100 pg DNA.

The minisequencing reactions were performed simultaneously for all 35 SNPs with fluorescently labelled dideoxynucleotides.

The size of the minisequencing primers ranged from 19 to 106 nucleotides. The minisequencing reactions were analysed by

capillary electrophoresis and multicolour fluorescence detection. Female DNA did not influence the results of Y chromosome

SNP typing when added in concentrations more than 300 times the concentrations of male DNA. The frequencies of the 35 SNPs

were determined in 194 male Danes. The gene diversity of the SNPs ranged from 0.01 to 0.5.

# 2003 Elsevier Ireland Ltd. All rights reserved.

Keywords: Y chromosome; Single nucleotide polymorphism; Multiplex PCR; Minisequencing; Genotyping

1. Introduction

A large number of single nucleotide polymorphisms

(SNPs) have been identified [1]. Investigations of SNPs

on the Y chromosome in various populations have given

us important information on the history of the human male

populations (e.g. [2–8]). Due to the low mutation rates of

SNPs, the information relates to longer periods of time

compared to the information obtained with e.g. short tandem

repeat (STR) [9–11] and minisatellite markers as, for exam-

ple MSY1 [12,13].

Presently, typing of selected short tandem repeat (STR)

systems is the state of the art in forensic routine casework. It

is, however, anticipated that SNP typing will be used for

parentage testing and forensic casework in the future. The

advantage of SNPs in forensic casework is that small DNA

fragments of 40–50 bps from e.g. heavily degraded DNA can

be SNP typed. Furthermore, the SNP technology has a high

potential for automation. Although the genetic information

obtained by a SNP, in average, is much lower than that

obtained by an STR system, typing of 50–100 selected SNPs

would be sufficient for forensic casework [14]. The low

mutation rate of SNPs [15,16] makes these markers an

attractive tool for parentage testing.

Genetic markers on the Y chromosome are valuable tools

in forensic casework in special situations, e.g. in cases with

mixtures of DNA with a dominant amount of female DNA

and a very small amount of male DNA. In such cases, the

DNA profile of the autosomes of the male cannot be

obtained, but the Y chromosome markers can usually be

typed, even in situations with a very large relative amount of

female DNA [17]. In special cases of parentage testing, e.g.

Forensic Science International 137 (2003) 74–84

* Corresponding author. Tel.: þ45-35-32-62-25;

fax: þ45-35-32-61-20.

E-mail address: juan.sanchez@forensic.ku.dk (J.J. Sanchez).

0379-0738/$ – see front matter # 2003 Elsevier Ireland Ltd. All rights reserved.

doi:10.1016/S0379-0738(03)00299-8

if the alleged father is unavailable for testing while close

male relatives are available, investigation of genetic markers

on the Y chromosome are valuable.

If SNP typing is going to be used in forensic casework, it

is essential that the investigations can be performed on small

amounts of DNA, if possible, <1 ng DNA. If the polymerase

chain reaction (PCR) is used, the amplifications of all DNA

fragments to be investigated must be done in one or very few

amplification reactions.

We decided to explore a SNP typing method that is based on

multiplex PCR and multiplex minisequencing. We chose SNP

markers on the Y chromosome because these markers, in

forensic genetics, offer additional information to the informa-

tion obtained by STR typing. Furthermore, the Y chromosome

SNPs are useful tools for the study of genetics of populations.

In the last years, a number of multiplex PCR Y chromo-

some SNP analyses have been reported. Most of them

included a limited amount of SNPs (often 3–10 SNPs) in

each PCR (e.g. [2,3,18]) although larger multiplexes have

been reported [19,20].

We selected Y chromosome SNPs that were reported to be

polymorphic in European and other populations [4,21,22].

However, the main purpose of the study was to explore the

technical issues related to multiplexing a larger number of

DNA fragments and simultaneous detection of a large

number of SNPs. The intention was not to make a final

panel for typing of major Y chromosome haplogroups. In

order to assess the technical performance of the SNP typing

system, we included four pairs of SNPs each of which pair

was expected to give concordant results (e.g. M40 and M96).

Here, we describe a method for typing 35 SNPs on the Y

chromosome. The typing was performed by (1) multiplex

PCR amplification of 25 Y chromosome DNA fragments, (2)

multiplex primer extension reactions of 35 SNPs with

fluorescence labelled nucleotides, and (3) detection of the

35 SNPs by capillary electrophoresis and multicolour fluor-

escence detection.

2. Materials and methods

2.1. Donors and DNA preparations

A total of 194 unrelated males and 15 unrelated female

Danes donated blood samples or buccal cells. DNA was

isolated from 200 ml of peripheral blood using QIAamp

DNA Blood Mini Kit according to the manufacturer’s pro-

tocol (Qiagen, Hagen, Germany). Alternatively, 1.2 mm

(diameter) FTA1 paper (Whatman International, Cam-

bridge, UK) soaked with blood or buccal cells was used.

Mixtures of DNA from males and females were prepared in

checker board with three concentrations of male DNA (0.16,

0.8 and 1.6 ng) and female DNA ranging from 0 to 60 ng.

Fluorometric measurement of DNA concentration was

done by SYBR Green I and analysed in a LightCycler

instrument (Roche Diagnostics GmbH, Germany) and

Hoechst 33258 (Molecular Probes Inc., Eugene, OR) using

a Hoefer DyNA Quant 200 instrument (Molecular Vision).

Calibration reference curves were established using a calf

thymus DNA standard (Sigma–Aldrich, Missouri, USA).

2.2. Selection of PCR amplification primers

The Y chromosome SNPs selected (Table 1) included

those used by Semino et al. [21] for a study of the distribu-

tion of Y chromosome SNPs in European populations. In

addition, we included SNPs that were reported to be poly-

morphic in other ethnic groups.

DNA segments including the SNPs selected were identi-

fied and complementary primers were designed so that the

lengths of the amplified genomic Y chromosome DNA

fragments would range from 79 to 186 nucleotides. Some

SNPs were situated very closely to each other and it was

decided to include a number of amplification targets with

two or three SNPs (Table 1).

The sequence of each locus was obtained from GenBank1

(http://www.ncbi.nlm.nih.gov) using a nucleotide basic local

alignment search tool (BLAST). Published PCR primers

were initially used as the reference sequence for each Y

SNP locus, but all of them needed to be redesigned.

The primers for the genomic segments spanning one or more

Y chromosome markers were designed with the Primer

3.0 program v. 0.2 (http://www-genome.wi.mit.edu/cgi-bin/

primer/primer3_www.cgi). All primers were selected to have

theoretical melting temperatures of 60 � 5 8C at a salt con-

centration of 180 mM and a purine:pyrimidine content close

to 1:1, when possible. The lengths of the primers ranged

between 19 and 34 nt. Primers with four or more bases at the

30 end complementary to another part of the primer were

discarded or redesigned to avoid artefacts due to hairpin

formation. Each primer pair was tested for primer–primer

interactions, and the primer sequences were checked to avoid

similarities with repetitive sequences or with other loci in the

genome. The primers were checked for homology to other

amplicons in the pool of 25 primer pairs. Table 1 shows the

sequences of the amplification primers selected.

2.3. PCR conditions

HPLC purified primers for amplification were purchased

from TAG A/S (Copenhagen, Denmark). A primer stock

solution was prepared by dissolving the lyophilized primers

in Tris/EDTA buffer (10 mM Tris, 100 mM EDTA, pH 7.5;

Sigma–Aldrich) to a final DNA concentration of 100 pmol/ml.

Each primer pair was tested in singleplex PCR. Ten ng

template was amplified by PCR in a 25 ml reaction volume

containing 1� PCR buffer, 1.5 mM MgCl2, 200 mM of each

dNTP, 0.4 mM of each primer, and 0.6 units of AmpliTaq

Gold DNA polymerase at 94 8C for 5 min followed by 30

cycles of 30 s at 95 8C, 30 s at 60 8C, 30 s at 72 8C, and a

final extension for 5 min at 72 8C. The products were

analysed by electrophoresis in 11% polyacrylamide gels.

J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84 75

TBE (1�) (89 mmol/l Tris base, 89 mmol/l boric acid,

2 mmol/l EDTA, pH 8.3) was used as electrophoresis buffer.

The gels were stained with 0.5 mg/ml ethidium bromide. The

10 bp ladder from invitrogen (Groningen, The Netherlands)

was used to assign the sizes of the fragments.

The final setup of the PCR amplification included 1 ng

DNA in a 50 ml reaction volume containing 1� PCR buffer,

8 mM MgCl2, 400 mM of each dNTP, 0.01–0.42 mM of each

primer, and 2.5 units of AmpliTaq Gold DNA polymerase

(AB, Foster City, CA).

All DNA amplifications were performed in a GeneAmp

9600 thermal cycler (Perkin-Elmer, Wellesley, USA) using

the following programme: denaturation at 94 8C for 5 min

followed by 33 cycles for 30 s at 95 8C, 30 s at 60 8C, and 30 s

at 65 8C, followed by a final extension for 7 min at 65 8C.

The concentrations of the primers in the multiplex reac-

tion were adjusted in order to obtain equal amount of each

PCR product. The primer concentrations ranged from 0.01 to

0.42 mM (Table 1).

The PCR products were analysed on 11% polyacrylamide

gels as described later (Fig. 1).

In order to eliminate the excess of primers and dNTPs, the

PCR products was purified on a MinElute PCR purification

spin column (Qiagen, Hagen, Germany) following the man-

ufacturer’s protocol. The DNAwas eluted in 30 ml of Milli-Q

water.

E. coli exonuclease I (Exo I) and shrimp alkaline phos-

phatase (SAP) was also used to remove primers and unin-

corporated dNTPs (USB Corporation, Cleveland, USA). Six

microliters ExoSAP-IT kit or 5 units of SAP and 2 units of

Table 1

Y chromosome SNPs and primer sequences for PCR amplification of 25 Y chromosome DNA fragments with SNPs

Locus GenBank or

dbSNPs accesion

Mutation PCR primers (50 ! 30) mM Amplicon

size (bp)Forward primer Reverse primer

M2/sY81 Rs3893 A/G acggaaggagttctaaaattcagg aaaatacagctccccctttatcct 0.15 128

M9a Rs3900 C/G aggaccctgaaatacagaactg aaatatttcaacatttcacaaaggaa 0.36 186

M17a Rs3908 4G/3G cctggtcataacactggaaatc agctgaccacaaactgatgtaga 0.09 170

M18a Rs3909 2 bp insertion cctggtcataacactggaaatc agctgaccacaaactgatgtaga 0.09 170

M19a Rs3010 T/A cctggtcataacactggaaatc agctgaccacaaactgatgtaga 0.09 170

M32a AC009977 T/C tgaccgtcataggctgagaca ttgaagcccccaagagagac 0.07 160

M33a AC009977 A/C tgaccgtcataggctgagaca ttgaagcccccaagagagac 0.07 160

M35 Rs1179188 G/C agggcatggtccctttctat tccatgcagactttcggagt 0.42 96

M40/SRY4064 AC006040 G/A tggtctcaatctcttcaccctgt catttcagtaaatgccacacaaga 0.18 119

M45a Rs2032631 G/A gagagaggatatcaaaaattggcagt tgacagtggcaccaaaggtc 0.03 138

M46/Tat AC002531 T/C tatatggactctgagtgtagacttgtga ggtgccgtaaaagtgtgaaataatc 0.46 115

M52 AC009977 A/C cctcaacttcccagagtgttg gacgaagcaaacatttcaagagag 0.03 152

M78a AC010889 C/T tgcattactccgtatgttcgac tggaagcttaccatctttttatga 0.08 132

M81a Rs2032640 C/T catctcttaacaaaagaggtaaattttgtcc cattgtgttacatggcctataatattcagt 0.24 179

M89 Rs2032652 C/T tggattcagctctcttcctaaggttat ctgctcaggtacacacagagtatca 0.03 135

M96 AC010889 G/C tgccctctcacagagcactt ccacccactttgttgctttg 0.27 143

M123 AC010889 G/A gttgcccaggaatttgcat cacagagcaagtgactctcaaag 0.02 88

M139a AC010137 5G/4G ccccgaaagttttattttattcca ttctcagacaccaatggtcctatc 0.06 113

M151a AC010889 G/A catctcttaacaaaagaggtaaattttgtcc cattgtgttacatggcctataatattcagt 0.24 179

M153a AC010137 T/A ccccgaaagttttattttattcca ttctcagacaccaatggtcctatc 0.06 113

M154a AC010889 T/C catctcttaacaaaagaggtaaattttgtcc cattgtgttacatggcctataatattcagt 0.24 179

M157a AC010889 A/C gagagaggatatcaaaaattggcagt tgacagtggcaccaaaggtc 0.03 138

M163a AC009977 A/C aggaccctgaaatacagaactg aaatatttcaacatttcacaaaggaa 0.36 186

M167/SRY2627 AC006040 C/T cggaaccactaccagcttca agttaaggccccacgcagt 0.03 113

M170 Rs2032597 A/C cagctcttattaagttatgttttcatattctgtg gtcctcattttacagtgagacacaac 0.07 119

M172 Rs2032604 T/G tgagccctctccatcagaag gccaggtacagagaaagtttgg 0.16 179

M173 Rs2032624 A/C ttttcttacaattcaagggcatttag ctgaaaacaaaacactggcttatca 0.10 81

M175 Rs2032678 �5 bp gatttaaactctctgaatcaggcacat ttctactgatacctttgtttctgttcattc 0.02 79

M212a Rs2032664 C/A ccatataaaaacgcagcattctgtt tggagagaacttgagaaaaagtagagaa 0.12 176

M213a Rs2032665 T/C ccatataaaaacgcagcattctgtt tggagagaacttgagaaaaagtagagaa 0.12 176

M224a AC010889 T/C tgcattactccgtatgttcgac tggaagcttaccatctttttatga 0.08 132

SRY10831/SRY1532 Rs2534636 A/G tcatccagtccttagcaaccatta ccacataggtgaaccttgaaaatg 0.06 150

12f2 AC005820 Present/absent cactgactgatcaaaatgcttacagat ggatcccttccttacaccttataca 0.06 90

92R7 Rs2535813 GA/A ttaaatccctcctatttgtgctaacc aatgcatgaacacaaaagacgtaga 0.04 89

P25 Rs150173 C/CA tggaccatcacctgggtaaagt ggcagtataaggttgtcacatcacat 0.01 109

a SNP markers on the same DNA fragment: (M9 and M163), (M17, M18 and M19), (M32 and M33), (M45 and M157), (M78 and M224),

(M81, M151 and M154), (M139 and M153), (M212 and M213). All primers were redesigned compared to previously published primers.

76 J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84

Exo I were added to 15 ml of PCR product, mixed, and

incubated at 37 8C for 1 h. The enzymes were inactivated at

75 8C for 15 min.

2.4. Design of PCR minisequencing primers

Table 2 shows the genotyping primers designed for each

SNP. Primers for detection of deletions and insertions were

designed with the 30, base corresponding to the last base

before the possible deletion or insertion. For each SNP

system investigated in the present study, the following base

would identify the polymorphism. The sequences of the

primers were checked for the possibility of primer–dimer

and hairpin formation and investigated in PCR without

template (‘self-extension reaction’). In order to distinguish

between the sizes of the detection primers, the primers

were synthesized with lengths between 19 and 106 nucleo-

tides with intervals of four nucleotides for the great major-

ity of the primers (Table 2). The lengths of the template

specific parts of the primers ranged from 16 to 29 nucleo-

tides. The desired length of a primer was adjusted at the

50 end by addition of a piece of a ‘neutral’ sequence

and, if necessary, a poly-C tail. The neutral sequence,

50-AACTGACTAAACTAGGTGCCACGTCGTGAAAGT-

CTGACAA-30, is a random sequence that did not match

with any human sequence in the NCBI non-redundant

database [19].

For each 4 bp DNA fragment size interval of the detection

primers, two SNP loci were detected. This was done by

selecting two SNP loci with different nucleotide polymorph-

ism. One SNP could be, e.g. an A/T SNP and the other a C/G

SNP. Thus, the minisequencing primers for the two SNPs

could have the same length and the two polymorphisms

would still be detectable. Primers for minisequencing were

HPLC purified (DNA-Technology A/S, Aarhus, Denmark

and Proligo France SAS, Paris, France).

2.5. Minisequencing reaction and capillary

electrophoresis

Multiplex PCR minisequencing was performed in 8 ml

reactions with 0.2 ml purified PCR product (6–10 ng equiva-

lent to 5–8 fmol of each fragment), 4 ml of SNaPshotTM

reaction mix and 0.01–0.5 mM of the primers (Table 2). The

thermal cycling was performed with a rapid thermal ramp to

96 8C for 10 s, 50 8C for 5 s, and 60 8C for 30 s for 25 cycles.

Fig. 1. Multiplex PCR products of 25 Y chromosome DNA fragments. Ethidium bromide stained polyacrylamide gel with

PCR products obtained from various sources of blood. A negative control with DNA from a female was included. (L) 10 bp ladder

from invitrogene.

J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84 77

A positive control (provided with the kit) and negative

control (sterile water or PCR product from a female), was

performed for each batch of 44 samples.

The homogeneity of each primer was checked in single-

plex minisequencing. The occurrence of extra peaks one or

more nucleotides smaller than the expected size indicated

heterogeneity of the minisequencing primer.

After the minisequencing reaction, 1 Unit of SAP was

added and the tube was incubated at 37 8C for 1 h in order to

remove the 50 phosphoryl groups of the unincorporated

[F]ddNTPs. SAP was inactivated by incubation at 75 8Cfor 15 min.

One ml of the purified minisequencing PCR product was

analysed on an AB Prism 3100 Genetic Analyser with a

36 cm capillary array, POP-4 polymer and 10 s at 3000 V

injections. GeneScan-120 LIZTM was used as internal size

standard. The data were analysed using GeneScan Analysis

software v. 3.7 (Applied Biosystems). After background

substraction and colour separation, peaks were sorted

into bins according to sizes by comparison to the internal

size standard. Peaks above 400 relative fluorescence units

were considered positive signals and a SNP type was

assigned.

2.6. Reproducibility studies

DNA samples from 194 unrelated male Danes were typed

twice with the minisequencing technique and assigned SNP

types for the 35 SNP systems. The assignments of SNP types

of the duplicate testing were compared.

Table 2

Minisequencing primer sequences for typing of 35 Y chromosome SNP markers

Locus Poly

(dC)

Neutral Sequence

(50 ! 30)Target specific sequence

(50 ! 30)Orientationa mM Primer

size (nt)

M170 None None caacccacactgaaaaaaa Reverse 0.02 19

M45 None caa ctcagaaggagctttttgc Reverse 0.02 22

M139 None aa taatctgacttggaaagggg Forward 0.01 22

M2/sY81 None gacaa ctttatcctccacagatctca Reverse 0.28 26

M46/Tat None None gctctgaaatattaaattaaaacaac Reverse 0.25 26

M167/SRY2627 None tgaaagtctgacaa aagccccacagggtgc Forward 0.35 30

M213 None tgacaa tcagaacttaaaacatctcgttac Reverse 0.02 30

M52 None tctgacaa aatatcaagaaacctatcaaacatcc Reverse 0.02 34

P25 None tcgtgaaagtctgacaa tgcctgaaacctgcctg Forward 0.04 34

M78 None gaaagtctgacaa cttattttgaaatatttggaagggc Reverse 0.02 38

92R7 None gtgaaagtctgacaa catgaacacaaaagacgtagaag Reverse 0.01 38

M89 None cacgtcgtgaaagtctgacaa aactcaggcaaagtgagagat Reverse 0.09 42

M123 None acgtcgtgaaagtctgacaa atttctaggtattcaggcgatg Reverse 0.03 42

M35 None ggtgccacgtcgtgaaagtctgacaa tcggagtctctgcctgtgtc Reverse 0.25 46

M153 None ggtgccacgtcgtgaaagtctgacaa gctcaaagggtatgtgaaca Forward 0.02 46

M40/SRY4064 None aaactaggtgccacgtcgtgaaagtctgacaa tccaccctgtgatccgct Reverse 0.08 50

M154 None gccacgtcgtgaaagtctgacaa gttacatggcctataatattcagtaca Reverse 0.03 50

M32 None taggtgccacgtcgtgaaagtctgacaa agacaagatctgttcagtttatctca Forward 0.50 54

M151 None aggtgccacgtcgtgaaagtctgacaa caatctactacatacctacgctatatg Forward 0.02 54

M17 None actaaactaggtgccacgtcgtgaaagtctgacaa ccaaaattcacttaaaaaaaccc Reverse 0.02 58

M96 None aactgactaaactaggtgccacgtcgtgaaagtctgacaa ggaaaacaggtctctcataata Forward 0.15 62

M172 7 aactgactaaactaggtgccacgtcgtgaaagtctgacaa caaacccattttgatgctt Forward 0.10 66

M173 3 aactgactaaactaggtgccacgtcgtgaaagtctgacaa tacaattcaagggcatttagaac Forward 0.03 66

M19 4 aactgactaaactaggtgccacgtcgtgaaagtctgacaa aaactatttttgtgaagactgttgta Forward 0.10 70

M224 7 aactgactaaactaggtgccacgtcgtgaaagtctgacaa aattgatacacttaacaaagatacttc Forward 0.13 74

SRY10831/SRY1532 10 aactgactaaactaggtgccacgtcgtgaaagtctgacaa ttgtatctgactttttcacacagt Forward 0.03 74

M18 17 aactgactaaactaggtgccacgtcgtgaaagtctgacaa gtttgtggttgctggttgtta Forward 0.05 78

M157 18 aactgactaaactaggtgccacgtcgtgaaagtctgacaa caccaaaggtcatttgtggt Reverse 0.20 78

M81 14 aactgactaaactaggtgccacgtcgtgaaagtctgacaa cttggtttgtgtgagtatactctatgac Reverse 0.03 82

M163 25 aactgactaaactaggtgccacgtcgtgaaagtctgacaa cacaaaggaattttttttgag Reverse 0.51 86

M212 20 aactgactaaactaggtgccacgtcgtgaaagtctgacaa gcattctgttaatataaaacacaaaa Forward 0.20 86

M9 22 aactgactaaactaggtgccacgtcgtgaaagtctgacaa catgtctaaattaaagaaaaataaagag Reverse 0.40 90

12f2 29 aactgactaaactaggtgccacgtcgtgaaagtctgacaa aacatgtaagtctttaatccatctc Forward 0.02 94

M33 29 aactgactaaactaggtgccacgtcgtgaaagtctgacaa cagttacaaaagtataatatgtctgagat Reverse 0.18 98

M175 46 aactgactaaactaggtgccacgtcgtgaaagtctgacaa cacatgccttctcacttctc Forward 0.28 106

a The detection orientation has been probed relative to the YCC information reported in [32].

78 J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84

2.7. Statistical methods

Gene diversities and standard errors were calculated

according to the methods of Nei [23].

3. Results

3.1. DNA purification methods

DNA purified with Qiagen columns and DNA from FTA1

paper with bloodstains in all cases gave satisfactory results

(Fig. 1). DNA from buccal cells on FTA1 paper gave

variable intensities of the results of samples.

3.2. Design of primers

When no band or only a very weak band was observed,

suggesting that the affinities of the primers were suboptimal,

the primers were redesigned. In one case, the PCR amplifica-

tion was very weak and four different sets of primers were

tried before an acceptable yield was obtained. It was not

possible to understand the reason since the primer set best

suited from a theoretical point gave the lowest yield. In three

cases with unsatisfactory yields, the primers were redesigned

with ‘GC’ at the 30 end with successful results. Twenty-one of

the 25 primer pairs worked satisfactorily at the first design.

3.3. PCR buffer and efficiency of multiplex PCR

amplification

We found that the best results of amplification of all 25

DNA targets were obtained by increasing the concentration

to 8 mM MgCl2. Higher concentrations inhibited the ampli-

fication (data not shown).

3.4. Quality of DNA primers for template PCR

amplification

Unpurified primers could be combined into multiplexes

up to seven systems while HPLC purified primers could be

combined to amplify at least 25 templates in one reaction.

3.5. Titration of primer concentrations in PCR

amplification

It was necessary to titrate primer concentrations to obtain

a balanced PCR multimix for minisequencing. The final

concentrations of primers ranged from 0.11 to 0.46 mM.

Fig. 2. Electropherogramme with 35 Y chromosome SNP profiles from a male donor. GeneScan analysis of SNaPshotTM minisequencing of

the Y chromosome SNP multiplex.

J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84 79

3.6. Sensitivity of the target multiplex PCR amplification

In our hands, the lower limit for reproducible results was

approximately 100 pg DNA with a range up to approxi-

mately 10 ng and an optimum at 1–2 ng (Figs. 2 and 3).

3.7. Purification of the PCR template amplification

product

Both spin column and enzymatic purified PCR amplifica-

tion products gave satisfactory minisequencing typing reac-

tions. The recovery with the Exo I-SAP was 100% while the

column purification had a recovery of approximately 80%

(data not shown).

3.8. Design of DNA primers for minisequencing

None of the 35 detection primers had to be redesigned.

3.9. Quality of DNA primers for minisequencing

Clear, homogeneous peaks were obtained only if the

purity of the primers was higher than approximately 90%.

If the purity was less, the signal from degenerated primers

(n � 1, n � 2, etc.) would decrease the discrimination.

3.10. Annealing temperature of minisequencing

primers

Annealing temperatures from 50 to 60 8C gave almost the

same overall results in the 35 SNP multiplex when judged by

inspection of the peak areas.

3.11. Y chromosome SNP typing results

Fig. 2 shows a representative electropherogramme of

typing of 35 Y chromosome SNPs in an individual. In

one of the 194 males, typing could no reaction was obtained

in M81. The same lack of reaction in M81 was found in the

son of the investigated man. The remaining 34 Y chromo-

some SNPs were detected in the man and his child. All other

male samples gave a full 35-Y-SNP profile.

3.12. Reproducibility of Y chromosome SNP typing

with minisequencing

SNP typing was performed twice in all 194 male Danes

and the duplicate types were consistent. In each minisequen-

cing experiments, at least one sample with known types for

all 35 SNPs was included, and concordant assignments of

SNP types were obtained in all cases.

Four samples were typed for the 11 SNPs SRY2627,

M213, M35, M153, SRY4064, M17, M18, M9, SRY10831,

92R7, and P25 as part of an interlaboratory exercise of the

European DNA Profiling Group, and correct results were

obtained.

50 100 250 500 1000 2000 4000 80000

5

10

15

20

25

DNA (pg)

Rel

ativ

e F

luor

esce

nce

Uni

ts(%

)

Fig. 3. Sensitivity of the 35 Y chromosome SNP typing assay.

For each DNA concentration, the relative fluorescence units

(RFUs from GeneScan) of investigations of four SNPs detected

with each of the four dyes: blue, green, yellow and red were

collated from typing of two individuals. For each DNA

concentration, the median RFU value of the two individuals

was calculated for each dye, and for each concentration the

median RFUs were normalized as a percentage of the total RFUs

of all the RFUs for the dye in question. Finally, for each DNA

concentration, the median of the normalized RFU values for all

four dyes was calculated as a percentage of the sum of all

normalized median RFU values of all concentrations. Thus, the

sum of RFUs in the figure sum up to 100%. The error bars

indicate the standard error of the mean (S.E.M.).

Fig. 4. Effect of excess DNA from females on the 35 Y

chromosome SNP typing assay. The relative fluorescence units

(RFUs from GeneScan) of mixtures of male DNA and female

DNA in great excess. The RFUs were calculated as indicated in

Fig. 3. In general, there was a dose response relation between the

concentration of male DNA and the RFU signal strength, while

female DNA had practically no influence on the RFU signal in

the concentration range investigated.

80 J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84

3.13. Male–female mixtures of DNA

Female DNA did not influence the results of Y chromo-

some SNP typing when added in concentrations more than

300 times the concentrations of male DNA (Fig. 4).

3.14. Y chromosome SNP population data in Danes

Table 3 shows the frequency distribution of the 35 SNPs

investigated in 194 male Danes. No SNP signal was obtained

in 15 female Danes. A total of 19 SNPs showed variation

while 16 SNPs were monomorphic in the male Danes

studied.

Two signals were obtained in P25 and 92R7 in some

individuals (cf discussion). DNA from individuals with two

signals in theses systems was investigated with STR-tech-

nique. Only one STR-profile was obtained in each individual

demonstrating that contamination of DNA was not the

reason for the two signals in P25 and 92R7.

4. Discussion

We have developed a PCR multiplex-based system for

typing of a large number of SNPs using Y chromosome

SNPs as an example. An important part of the work was to

explore the various aspects of the multiplex PCR methods.

The 35 Y chromosome SNPs presented here are not our final

set of Y chromosome SNPs for population studies or forensic

genetic applications.

Table 3

Frequencies of 35 Y chromosome SNP markers in male Danes

Locus Fragment numbera Polymorphismb Frequency (number) Frequency (%)

M2/sY81 1 A/G 194/0 100.0/0.0

M9 2 C/G 85/109 43.8/56.2

M17 3 4G/3G 162/32 83.5/16.5

M18 3 No ins./2 bp ins. 194/0 100.0/0.0

M19 3 T/A 194/0 100.0/0.0

M32 4 T/C 194/0 100.0/0.0

M33 4 A/C 194/0 100.0/0.0

M35 5 G/C 190/4 97.9/2.1

M40/SRY4064 6 G/A 190/4 97.9/2.1

M45 7 G/A 86/108 44.3/55.7

M46/Tat 8 T/C 193/1 99.5/0.5

M52 9 A/C 194/0 100.0/0.0

M78 10 C/T 192/2 99.0/1.0

M81c 11 C/T 193/0 100.0/0.0

M89 12 C/T 4/190 2.1/97.9

M96 13 G/C 190/4 97.9/2.1

M123 14 G/A 193/1 99.5/0.5

M139 15 5G/4G 0/194 0.0/100.0

M151 11 G/A 194/0 100.0/0.0

M153 15 T/A 194/0 100.0/0.0

M154 11 T/C 194/0 100.0/0.0

M157 7 A/C 194/0 100.0/0.0

M163 2 A/C 194/0 100.0/0.0

M167/SRY2627 16 C/T 194/0 100.0/0.0

M170 17 A/C 119/75 61.3/38.7

M172 18 T/G 189/5 97.4/2.6

M173 19 A/C 89/105 45.9/54.1

M175 20 No del./5 bp del. 194/0 100.0/0.0

M212 21 C/A 194/0 100.0/0.0

M213 21 T/C 4/190 2.1/97.9

M224 10 T/C 194/0 100.0/0.0

SRY10831/SRY1532 22 A/G 32/162 16.5/83.5

12f2 23 Present/absent 189/5 97.4/2.6

92R7 24 GA/Ad 86/108 44.3/55.7

P25 25 C/CAd 124/70 63.9/36.1

a Some PCR products contain more than one SNP in the same fragment.b Following the Y chromosome consortium nomenclature system [32].c One male gave no reaction in minisequencing of M81.d Two signals were detected in some individuals [24,33].

J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84 81

Successful PCR multiplexing depends on a number of

factors. Below, we present some of our considerations

concerning the selection of the SNPs and the generation

of the multiplex PCRs for amplification and minisequen-

cing.

At an early stage, it was decided to use the multicolour

fluorescence electrophoresis technique combined with PCR

multiplexing at approximately 60 8C in high concentrations

of MgCl2. The spacing between minisequencing primers

was decided to be four nucleotides because we wanted to

obtain reliable separation in the electrophoresis.

We attempted to avoid SNPs situated in regions reported

to be replicated. Two exceptions were the P25 and 92R7

SNPs that are situated in a region that most probably is part

of a duplication [24]. Both SNPs seem to discriminate

between European and other populations [25].

Multiplex PCR amplification primers between 19 and 34

bases pairs long were selected because it was anticipated that

such long primers would work well under multiplex condi-

tions [26].

Qiagen purified DNA from blood samples and blood

stains on FTA1 paper worked equally well in the assay.

Chelex treated blood samples worked as well (data not

shown). Optimal multiplex SNP typing results were obtained

with 1 ng DNA (range 0.1�20 ng DNA). Thus, quantifica-

tion of DNA is not mandatory for the SNP assay. It should,

however, be noticed that the balance of the amounts of

amplification products of the DNA fragments is changed

with increasing amounts of templates. With increasing

concentrations of PCR amplified fragments, small, fluores-

cent adenosinnucleotide peaks with sizes of PCR amplified

fragments plus one nucleotide were seen, most likely do to

non-template addition of a single adenosin molecules to the

30 end of some PCR amplified fragments. At low amounts of

template DNA, loss of signal will occur due to stochastic

phenomena [27].

Commonly used PCR buffers include only KCl, Tris and

MgCl2. It has been reported that many primer pairs produ-

cing short amplification products (<200 bp) work better at

higher salt concentration (KCl) in multiplex systems [26].

Increasing the concentration of KCl in the PCR buffer 1.6

and 2-fold in our 35-plex did not increase the yield of PCR

product significantly and had no effect on the synthesis of

fragments >150 bp. Increase of MgCl2 concentration from 2

to 8 mM increased the yield of amplicons; higher MgCl2concentration inhibited the amplification (data not shown).

We used AmpliTaq Gold DNA polymerase (Applied

Biosystems) because this enzyme minimizes primer dimer

formation. Even with a 4-base 30 overlap between two

primers we obtained homogeneous PCR products (data

not shown). The most efficient enzyme concentration

seemed to be around 2.5 U/50 ml reaction volume.

In our hands, primer concentrations below 0.01 mM were

insufficient and concentrations above 0.5 mM seemed to

inhibit multiplex PCRS probably by inducing dimer–dimer

formation. Primer concentrations were adjusted to be

approximately 103 times more than the concentration of

the template.

We stored dNTPs in small aliquots at �20 8C for up to 8

months. However, we observed that dNTPs were sensitive to

repeated freezing and thawing. As a rule of thumb, the

multiplex PCR would fail if the dNTPs have been frozen

and thawed more than four times. The amount of time in

freezer was less important as it has been reported by others

authors [28].

The enzymatic purification method is obviously easy, has

an almost 100% recovery and a very limited risk of con-

tamination.

We chose to adjust the length of the minisequencing

primers by means of (1) a part of a neutral sequence of

up to 40 nt and for the longer primers (2) an additional poly-

C part. The neutral sequence was selected in order to obtain a

more balanced base composition. We chose poly-C for the

tail because, in theory, poly-G would give a higher molecular

mass, poly-A would have a risk of depurination during

synthesis, and poly-T tails may interfere with the addition

of 30 ddA in the minisequencing reaction (SNaPshotTM

protocol recommendation, Applied Biosystems).

The quality of minisequencing primers is important

because primer batches with heterogeneous primer

sequences consisting of the intended DNA sequence of

‘n’ nucleotides plus a spectrum of shorter nucleotides

(n � 1, n � 2, n � 3, etc.) in many cases will destroy the

minisequencing reaction. In addition, we observed amplifi-

cation failure due to a heterogeneous primer batch in the

PCR multiplex with seven systems even though each of the

seven works in singleplex reactions. Therefore, we recom-

mend that each primer batch is tested before the multiplex

PCR and subsequent analyses, e.g. by minisequencing or

mass spectrometry. Purification of the primers with e.g.

HPLC or gel purification techniques can to some extent

solve these problems.

The minisequencing system was rather insensitive to the

annealing temperature. It was necessary to adjust primer

concentrations from 0.01 to 0.50 mM in the minisequencing

multimix.

The longer extension products had electrophoretic mobi-

lities corresponding to those predicted by the number of

bases. The mobility of shorter extension products with the

same number of bases varied to some extent. This is most

probably due to the fact that differences in the masses of the

various fluorochromes used and in the exact composition of

purines and pyrimidines have a relatively high influence on

the mobility of short DNA molecules.

The SNP-typing results were highly reproducible. A total

of 194 males were SNP typed in duplicate and no discre-

pancies were observed. Furthermore, five of the most poly-

morphic SNPs were analysed by a DNA hybridisation assay

using the Nanogen technology [29]. Concordant results were

obtained for all 194 individuals (data not shown).

In one father-child combination, no allele of M81 was

detectable. An amplified fragment was present in the first

82 J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84

PCR because two other SNPs (M151 and M154) on the

fragment were detected, but no reaction of M81 was detected

in the minisequencing reaction. Work is in progress in order

to determine the nature of the variant.

A total of 19 of 29 SNPs reported to be polymorphic in

Europeans in a previous study [4] and 9 of 10 SNPs reported

in another study [21] turned out to be polymorphic in the

male Danes studied. The gene diversity for the loci showing

polymorphism ranged from 0.01 to 0.5 (Table 3). M173,

M45, 92R7 and M9 were the most polymorphic markers in

Danes. The data were described as frequencies of individual

SNPs and not as Y chromosome haplogroups because the

study was a technical study and the Y chromosome multi-

plex is not ideal for typing of Y chromosome haplogroups. A

larger study of Y chromosome haplogroups in Danes and

other populations will be published elsewhere.

P25 and 92R7 were previously reported as SNPs [30,31].

However, the P25 and 92R7 minisequencing primers were

extended with two different dideoxynucleotides during the

minisequencing reaction of numerous samples. This indi-

cates that at least two different, almost identical fragments

were amplified during the PCR reaction. Hurles et al. [33]

previously observed that SNP typing of 92R7 gave two

results in some individuals. Further studies have confirmed

that P25 and 92R7 are paralogous sequence variants and that

at least one of the sequence variants in each group of loci is

polymorphic [24].

The multiplex PCR SNP typing format presented here

seems to be useful for forensic casework because small

amounts of DNA (100 pg DNA) can be reliably typed.

The multiplex presented is not our final package for Y

chromosome SNPs for forensic purposes. The way forward

would go either through (1) the development of SNP

packages optimised for an initial screening plus further

packages optimised for the major populations or (2) the

development of a large multiplex package that include Y

chromosome SNPs that can discriminate between individual

lineages in all populations.

Acknowledgements

We thank Dr. Rebecca Reynolds, Roche Molecular Sys-

tems, for advice concerning the design of the multiplex PCR

for template generation in the initial phase of the project. We

thank Ms. AnneMette Holbo Birk for technical assistance.

The work was supported by grants to Juan Sanchez from

Ellen and Aage Andersen’s Foundation and Manuel Morales

Foundation.

References

[1] R. Sachidanandam, D. Weissman, S.C. Schmidt, J.M. Kakol,

L.D. Stein, G. Marth, S. Sherry, J.C. Mullikin, B.J.

Mortimore, D.L. Willey, S.E. Hunt, C.G. Cole, P.C. Coggill,

C.M. Rice, Z. Ning, J. Rogers, D.R. Bentley, P.Y. Kwok, E.R.

Mardis, R.T. Yeh, B. Schultz, L. Cook, R. Davenport, M.

Dante, L. Fulton, L. Hillier, R.H. Waterston, J.D. McPher-

son, B. Gilman, S. Schaffner, W.J. Van Etten, D. Reich, J.

Higgins, M.J. Daly, B. Blumenstiel, J. Baldwin, N. Stange-

Thomann, M.C. Zody, L. Linton, E.S. Lander, D. Altshuler,

A map of human genome sequence variation containing 1.42

million single nucleotide polymorphisms, Nature 409 (2001)

928–933.

[2] S. Paracchini, B. Arredi, R. Chalk, C. Tyler-Smith,

Hierarchical high-throughput SNP genotyping of the human

Y chromosome using MALDI-TOF mass spectrometry,

Nucleic Acids Res. 30 (2002) e27.

[3] M. Raitio, K. Lindroos, M. Laukkanen, T. Pastinen, P.

Sistonen, A. Sajantila, A.C. Syvanen, Y-chromosomal SNPs

in Finno-Ugric-speaking populations analyzed by minise-

quencing on microarrays, Genome Res. 11 (2001) 471–482.

[4] P.A. Underhill, G. Passarino, A.A. Lin, P. Shen, M. Mirazon

Lahr, R.A. Foley, P.J. Oefner, L.L. Cavalli-Sforza, The

phylogeography of Y chromosome binary haplotypes and

the origins of modern human populations, Ann. Hum. Genet.

65 (2001) 43–62.

[5] M.A. Jobling, C. Tyler-Smith, Fathers and sons: the Y

chromosome and human evolution, Trends Genet. 11 (1995)

449–456.

[6] H. Oota, W. Settheetham-Ishida, D. Tiwawech, T. Ishida, M.

Stoneking, Human mtDNA and Y chromosome variation is

correlated with matrilocal versus patrilocal residence, Nat.

Genet. 29 (2001) 20–21.

[7] M. Seielstad, Asymmetries in the maternal and paternal

genetic histories of Colombian populations, Am. J. Hum.

Genet. 67 (2000) 1062–1066.

[8] G. Passarino, G.L. Cavalleri, A.A. Lin, L.L. Cavalli-Sforza,

A.L. Borresen-Dale, P.A. Underhill, Different genetic com-

ponents in the Norwegian population revealed by the analysis

of mtDNA and Y chromosome polymorphisms, Eur. J. Hum.

Genet. 10 (2002) 521–529.

[9] P. de Knijff, Messages through bottlenecks: on the combined

use of slow and fast evolving polymorphic markers on

the human Y chromosome, Am. J. Hum. Genet. 67 (2000)

1055–1061.

[10] M.A. Jobling, Y-chromosomal SNP haplotype diversity in

forensic analysis, Forensic Sci. Int. 118 (2001) 158–162.

[11] J.L. Mountain, A. Knight, M. Jobin, C. Gignoux, A. Miller,

A.A. Lin, P.A. Underhill, SNPSTRs: empirically derived,

rapidly typed, autosomal haplotypes for inference of popula-

tion history and mutational processes, Genome Res. 12 (2002)

1766–1772.

[12] M.A. Jobling, E. Heyer, P. Dieltjes, P. de Knijff, Y

chromosome-specific microsatellite mutation rates re-exam-

ined using a minisatellite, MSY1, Hum. Mol. Genet. 8 (1999)

2117–2120.

[13] M. Brion, R. Cao, A. Salas, M.V. Lareu, A. Carracedo, New

method to measure minisatellite variant repeat variation

in population genetic studies, Am. J. Hum. Biol. 14 (2002)

421–428.

[14] P. Gill, An assessment of the utility of single nucleotide

polymorphisms (SNPs) for forensic purposes, Int. J. Legal

Med. 114 (2001) 204–210.

[15] D.E. Reich, S.F. Schaffner, M.J. Daly, G. McVean, J.C.

Mullikin, J.M. Higgins, D.J. Richter, E.S. Lander, D.

J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84 83

Altshuler, Human genome sequence variation and the

influence of gene history, mutation and recombination, Nat.

Genet. 32 (2002) 135–142.

[16] R. Thomson, J.K. Pritchard, P. Shen, P.J. Oefner, M.W.

Feldman, Recent common ancestry of human Y chromo-

somes: evidence from DNA sequence data, Proc. Natl. Acad.

Sci. U.S.A. 97 (2000) 7360–7365.

[17] M.A. Jobling, A. Pandya, C. Tyler-Smith, The Y chromo-

some in forensic analysis and paternity testing, Int. J. Legal

Med. 110 (1997) 118–124.

[18] N.M. Makridakis, J.K. Reichardt, Multiplex automated

primer extension analysis: simultaneous genotyping of several

polymorphisms, Biotechniques 31 (2001) 1374–1380.

[19] K. Lindblad-Toh, E. Winchester, M.J. Daly, D.G. Wang, J.N.

Hirschhorn, J.P. Laviolette, K. Ardlie, D.E. Reich, E.

Robinson, P. Sklar, N. Shah, D. Thomas, J.B. Fan, T.

Gingeras, J. Warrington, N. Patil, T.J. Hudson, E.S. Lander,

Large-scale discovery and genotyping of single nucleotide

polymorphisms in the mouse, Nat. Genet. 24 (2000) 381–386.

[20] R. Reynolds, K. Walker, L. Steiner, SNP genotyping using

megaplex PCR amplification and linear probe assays, in:

Proceedings of the 19th International Congress ISFG,

Munster, Germany (P. Gill), FSS, 2002, WS2.

[21] O. Semino, G. Passarino, P.J. Oefner, A.A. Lin, S. Arbuzova,

L.E. Beckman, G. De Benedictis, P. Francalacci, A. Kouvatsi,

S. Limborska, M. Marcikiae, A. Mika, B. Mika, D. Primorac,

A.S. Santachiara-Benerecetti, L.L. Cavalli-Sforza, P.A. Un-

derhill, The genetic legacy of Paleolithic Homo sapiens

sapiens in extant Europeans: a Y chromosome perspective,

Science 290 (2000) 1155–1159.

[22] P. Malaspina, F. Cruciani, B.M. Ciminelli, L. Terrenato, P.

Santolamazza, A. Alonso, J. Banyko, R. Brdicka, O. Garcia,

C. Gaudiano, G. Guanti, K.K. Kidd, J. Lavinha, M. Avila, P.

Mandich, P. Moral, R. Qamar, S.Q. Mehdi, A. Ragusa, G.

Stefanescu, M. Caraghin, C. Tyler-Smith, R. Scozzari, A.

Novelletto, Network analyses of Y-chromosomal types in

Europe, northern Africa, and western Asia reveal specific

patterns of geographic distribution, Am. J. Hum. Genet. 63

(1998) 847–860.

[23] M. Nei, Molecular Evolutionary Genetics, Columbia Uni-

versity Press, New York, 1982, p. 512.

[24] C. Bøsting, J.J. Sanchez, N. Morling, The two Y chromosome

loci, P25 and 92R7, are polymorphic paralogous sequence

variants, Forensic Sci. Int. (2003), submitted for publication.

[25] M.F. Hammer, T.M. Karafet, A.J. Redd, H. Jarjanazi, S.

Santachiara-Benerecetti, H. Soodyall, S.L. Zegura, Hierarch-

ical patterns of global human Y chromosome diversity, Mol.

Biol. Evol. 18 (2001) 1189–1203.

[26] O. Henegariu, N.A. Heerema, S.R. Dlouhy, G.H. Vance, P.H.

Vogt, Multiplex PCR: critical parameters and step-by-step

protocol, Biotechniques 23 (1997) 504–511.

[27] B.E. Krenke, A. Tereba, S.J. Anderson, F. Buel, S. Culhane, C.J.

Finis, C.S. Tomsey, J.M. Zachetti, A. Masibay, D.R. Rabbach,

E.A. Amiott, C.J. Sprecher, Validation of a 16-locus fluorescent

multiplex system, J. Forensic Sci. 47 (2002) 773–785.

[28] P. Markoulatos, N. Siafakas, M. Moncany, Multiplex

polymerase chain reaction: a practical approach, J. Clin.

Lab. Anal. 16 (2002) 47–51.

[29] P.N. Gilles, D.J. Wu, C.B. Foster, P.J. Dillon, S.J. Chanock,

Single nucleotide polymorphic discrimination by an electro-

nic dot blot assay on semiconductor microchips, Nat. Biotech.

17 (1999) 365–370.

[30] M.F. Hammer, A.J. Redd, E.T. Wood, M.R. Bonner, H.

Jarjanazi, T. Karafet, S. Santachiara-Benerecetti, A. Oppen-

heim, M.A. Jobling, T. Jenkins, H. Ostrer, B. Bonne-Tamir,

Jewish and middel eastern non-jewish populations share a

common pool of Y-chromosome biallelic haplotypes, Proc.

Natl. Acad. Sci. U.S.A. 97 (2000) 6769–6774.

[31] N. Mathias, M. Bayes, C. Tyler-Smith, Highly informative

compound haplotypes for the human Y chromosome, Hum.

Mol. Genet. 3 (1994) 115–123.

[32] The Y Chromosome Consortium, A nomenclature system for

the tree of human Y chromosomal binary haplogroups,

Genome Res. 12 (2002) 339–3480.

[33] M.E. Hurles, R. Veitia, F. Arroyo, M. Armenteros, J.

Bertranpetit, A. Perez-Lezaun, E. Bosch, M. Shlumukova,

A. Cambon-Thomsen, K. McElreavey, A. Lopez De Munain,

A. Rohl, I.J. Wilson, L. Singh, A. Pandya, F.R. Santos, C.

Tyler-Smith, M.A. Jobling, Recent male-mediated gene flow

over a linguistic barrier in Iberia, suggested by analysis of a

Y-chromosomal DNA polymorphism, Am. J. Hum. Genet. 65

(1999) 1437–1448.

84 J.J. Sanchez et al. / Forensic Science International 137 (2003) 74–84