Accepted Manuscript

Trypanosoma cruzi: Multiplex PCR to Detect and Classify Strains according to

groups I and II1

Daniel B. Liarte, Silvane M.F. Murta, Mario Steindel, Alvaro J. Romanha

PII: S0014-4894(08)00320-2

DOI: 10.1016/j.exppara.2008.12.005

Reference: YEXPR 5672

To appear in: Experimental Parasitology

Received Date: 27 June 2008

Revised Date: 4 December 2008

Accepted Date: 5 December 2008

Please cite this article as: Liarte, D.B., Murta, S.M.F., Steindel, M., Romanha, A.J., Trypanosoma cruzi: Multiplex

PCR to Detect and Classify Strains according to groups I and II1, Experimental Parasitology (2008), doi: 10.1016/

j.exppara.2008.12.005

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers

we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and

review of the resulting proof before it is published in its final form. Please note that during the production process

errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT 1

Trypanosoma cruzi: Multiplex PCR to Detect and Classify 1

Strains according to groups I and II12

3

4

5

Daniel B. Liarte a, Silvane M.F. Murta a, Mario Steindel b, Alvaro J. Romanha a6

7

8

a Laboratório de Parasitologia Celular e Molecular, Centro de Pesquisas René Rachou-9

Fiocruz, Av. Augusto de Lima 1715, 30190-002 Belo Horizonte, Minas Gerais, Brazil10

11

b Departamento de Microbiologia e Parasitologia, Universidade Federal de Santa Catarina,12

88040-900 Florianópolis, Santa Catarina, Brazil.13

14

15

Corresponding author: Laboratório de Parasitologia Celular e Molecular, Centro de 16

Pesquisas René Rachou – Fiocruz. Av. Augusto de Lima 1715, 17

30190-002 Belo Horizonte, Minas Gerais, Brazil.18

Tel.: +55 31 3349 7786; fax: +55 31 3295 311519

E-mail address: daniel@cpqrr.fiocruz.br (Daniel B. Liarte)20

21

1The nucleotide sequences reported in this paper are available in the GenBank 22

database under the accession numbers: DQ91442-521.23

24

ACCEPTED MANUSCRIPT 2

Abstract25

A multiplex PCR was developed for simultaneous detection of T. cruzi DNA and 26

classification of the parasite strain into groups I and II. As little as 10 fg of T. cruzi DNA 27

could be detected by multiplex PCR. The technique was shown to be specific for T. cruzi 28

DNA, since no PCR amplification products were obtained with DNA from other29

tripanosomatid species. Multiplex PCR was validated by assaying genomic DNA from 3430

strains of T. cruzi that had been previously characterized; 24 blood samples from31

experimentally-infected mice and non-infected controls; 20 buffy coat samples from 32

patients in the acute phase of Chagas disease and non-infected individuals, and 15 33

samples of feces from naturally infected Triatoma infestans. T. cruzi samples from patients 34

and from Y strain infected mice were classified by multiplex PCR as T. cruzi II and samples 35

from T. infestans and Colombiana strain infected mice as T. cruzi I.36

Index descriptors and abbreviations37

DNA, deoxyribonucleic acid; kDNA, kinetoplast deoxyribonucleic acid; PBS, phosphate 38

buffered saline; PCR, polymerase chain reaction; rDNA, ribosomal DNA; RAPD, random 39

amplification of polymorphic DNA; RFLP, restriction fragment length polymorphism; T. 40

cruzi I, Trypanosoma cruzi group I; T. cruzi II, Trypanosoma cruzi group II; Z1, Z2, Z3, 41

zymodemes 1, 2 and 3; Triatomine; Trypanosoma cruzi; Triatoma infestans; Satellite DNA; 42

Multiplex PCR.43

44

45

46

ACCEPTED MANUSCRIPT 3

1. Introduction47

Chagas disease is caused by the protozoan Trypanosoma cruzi (Family: 48

Trypasonomatidae, Order: Kinetoplastida). In Latin America, some 15 million people are 49

infected with T. cruzi, whilst up to 28 million people are at risk of contracting the disease 50

(World Health Organization, 2007). The extensive variability in the symptoms of Chagas 51

disease may be correlated with specific genetic markers in the host or parasite, although it 52

is likely that both will affect the outcome of the infection (Sturm et al., 2003).53

T. cruzi exhibits a considerable intra-specific diversity that is exemplified by 54

differences in morphology of blood forms, virulence, pathogenicity, susceptibility to 55

chemotherapeutic agents, immunological properties and infectivity in host cells (Murta and56

Romanha, 1999). In an attempt to standardize the nomenclature applied to the parasite, T. 57

cruzi has been separated into two major groups, T. cruzi I and T. cruzi II (Anonymous, 58

1999). This classification has received support from studies using a variety of molecular59

markers including polymorphism of rDNA and mini-exon genes, RAPD and RFLP (Steindel 60

et al., 1993; Souto et al., 1996; Bastrenta et al., 1999; Sturm et al., 2003). Although T. cruzi61

I is associated with the sylvatic cycle of the disease, and T. cruzi II with the domestic cycle, 62

this epidemiologically important association is not totally correct once T. cruzi I and T. cruzi63

II have already been isolated in both sylvatic and domestic cycles (Yeo et al, 2007).64

The total DNA content (nuclear and kinetoplastic) of T. cruzi varies from strain to 65

strain and also amongst clones of the same strain, but is typically in the range 0.12 - 0.33 66

pg per cell (Lanar et al., 1981; Kooy et al., 1989; Thompson and Dvorak, 1989; McDaniel 67

and Dvorak, 1993). The genome of T. cruzi is estimated to contain between 1.8 and 2.5 x 68

108 bp, although more than 50% is apparently associated with repetitive elements, such as 69

transposons and multi-copy genes, according to the recently published genomic sequence 70

of the parasite strain CL-Brener (El-Sayed et al., 2005). Such highly repetitive sequences71

probably play important roles in genomic structure and in gene expression. Since most are 72

ACCEPTED MANUSCRIPT 4

species specific, they may be employed in the diagnosis of Chagas disease. Moreover, the 73

rapid evolutionary change in the interspersion pattern of the repetitive sequences also 74

makes such elements useful for strain-classification studies (Requena et al., 1996).75

A satellite DNA element of 195 bp with 120,000 copies per genome was the first 76

repeated nuclear sequence to be described in T. cruzi (Gonzalez et al., 1984). The high77

abundance and intra-specific diversity of this repeat suggested its possible application to 78

detect T. cruzi infection. Indeed, it is possible to detect minimum amounts of parasite DNA79

in diverse biological samples including infected blood, biopsies of heart tissue and feces of 80

triatomines, through PCR amplification of the 195 bp repeat element (Moser et al., 1989; 81

Olivares-Villagómez et al., 1998; Machado et al., 2000; Virreira et al., 2003). Furthermore, 82

studies carried out by Bastrenta et al. (1999) and Elias et al. (2005) have demonstrated83

that there is an association between the sequences of satellite DNA repeats of T. cruzi and 84

parasite groups.85

Whilst PCR targeting of highly repetitive sequences provides sensitive detection of86

T. cruzi DNA, markers that could distinguish between T. cruzi strains are also important as87

they would allow parasite classification without the need to isolate strains. In the present 88

work we have developed a multiplex PCR that provides simultaneous diagnosis of89

infection with T. cruzi and classification according to T. cruzi groups I and II.90

2. Materials and methods91

The use of human blood samples were approved by the Ethical Committee of the 92

Universidade Federal de Santa Catarina, Brazil (Nº 233/05).93

2.1. Samples analyzed94

Thirty four strains of T. cruzi that had been previously characterized according to 95

the isoenzyme profile, fragment f30 and T. cruzi group (Murta et al., 1998; Toma et al., 96

2007) were used in this study (Table 1). These strains were isolated from patients with 97

ACCEPTED MANUSCRIPT 5

acute and chronic Chagas disease, and from other vertebrate and invertebrate hosts from98

various geographical areas (Filardi and Brener, 1987; Toma et al., 2007). Twelve strains (4 99

strains of each zymodeme, Z1, Z2 and ZB) were selected for sequencing and analysis of 100

the 195 bp satellite repetitive DNA. All the strains used in this study are listed on Table 1.101

For the technical validation trials, DNA samples were obtained from: (i) blood of 102

non-infected mice (10 samples; negative controls), and of mice that had been 103

experimentally infected with T. cruzi strains Colombiana (8 samples) and Y (6 samples),104

both in acute phase of infection, (ii) the Buffy coat of individuals living in the state of Santa 105

Catarina, Brazil (an area non-endemic for Chagas disease) who presented negative 106

serology (indirect immunofluorescence assay) and parasitological examinations (11 107

samples), and of patients in the acute phase of Chagas disease (9 samples) who were 108

infected in a recent outbreak in the same state (Steindel et al., 2005 and 2008), (iii) feces109

of Triatoma infestans captured from Mato Queimado region (Rio Grande do Sul state, 110

Brazil - 15 samples), and (iv) strains of Trypanosoma rangeli, Leishmania braziliensis and 111

Leishmania amazonensis available at the Laboratório de Parasitologia Celular e Molecular 112

of the Centro de Pesquisas René Rachou. All the DNA samples were stored at -20°C. The 113

DNA samples of triatomine feces diluted on PBS 1X and blood of mice (5-25 µl of each114

sample), were first collected on filter paper and dried at room temperature. After this step, 115

each sample was sealed in plastic bags and stored to 4 - 8°C until the extraction of DNA116

using a simple lysis method, as described below. 117

2.2. DNA extraction118

DNA from epimastigote forms of different T. cruzi strains was extracted using the119

standard phenol-chloroform method (Maniatis et al., 1982). A simple lysis method was 120

employed in order to extract DNA from blood samples (5 µl) of mice and from the feces of 121

T. infestans. In each case, the filter paper containing the sample was perforated and 122

placed in a tube together with 100 µl of deionized water, heated at 70ºC for 10 min, 123

ACCEPTED MANUSCRIPT 6

centrifuged at 17,900 x g for 3 min at room temperature, and the supernatant (DNA 124

preparation) used in the PCR amplification experiments.125

2.3. Multiplex PCR126

The primers used to amplify sequences of T. cruzi satellite DNA in the multiplex 127

PCR experiments were sense Diaz 7 (5’ CGCAAACAGATATTGACAGAG 3’) and anti-128

sense Diaz 8 (5’ TGTTCACACACTGGACACCAA 3’), as previously described by Diaz et 129

al. (1992), and sense TcSat 4 (5' GCAGCCGCTCGAAAACTATCC 3'), which was 130

designed on the basis of nucleotide sequences determined in the present study. In each 131

experiment the reaction mixture (10 μl) contained: PCR buffer (50 mM KCl, 20 mM Tris-132

HCl; pH 8.4), 1.9 mM MgCl2, 200 μM of each dNTP (Promega, Madison, WI, USA), 5 pmol133

of each primer; 0.5 units of Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 1 μl 134

of DNA from the T. cruzi DNA preparation. Amplifications were carried out in a Perkin 135

Elmer (CA, USA) Mastercycler® thermocycler and involved an initial denaturation step of 5 136

min at 95°C, followed by 30 cycles of 20 s at 95°C, 10 s at 60°C and 15 s at 72°C, and a137

final extension step of 5 min at 72°C. An aliquot (3 µl) of the PCR product was subjected to 138

electrophoresis on a 6% non-denaturing polyacrylamide gel and the components 139

visualized by silver staining (Sanguinetti et al., 1994).140

2.4. Purification and cloning of satellite DNA141

The PCR-amplified products were purified with Qiagen (Valencia, CA, USA) 142

QIAquick® PCR Purification and Gel Extraction kits, and subsequently cloned into pCR®2.1 143

TOPO vector using a TOPO TA Cloning® kit (Invitrogen), according to the protocols 144

provided by the manufacturers. Recombinant vectors were inserted into chemo competent145

E. coli TOP10 F’ cells and the recombinant plasmids purified using a QIAprep® Spin 146

Miniprep kit (Qiagen) and quantified spectrophotometrically.147

ACCEPTED MANUSCRIPT 7

2.5. DNA sequencing148

Recombinant plasmids were sequenced using an Amersham Bioscience 149

Megabace® 500 capillary sequencer and DYEnamic® ET Terminator sequencing kit.150

Reactions were carried out in 96-well plates and each mixture contained 4 µl of DYEnamic 151

ET Terminator sequencing solution, 5.0 pmoles of M13 forward primer (5’ 152

GTAAAACGACGGCCAG 3’), Diaz 7 or Diaz 8 primer (see item 2.3.), and ca. 150 ng of 153

DNA in a final volume of 10 µl. Samples were submitted to 25 cycles of 20 s at 95°C, 15 s 154

at 50°C and 1 min at 60°C in a Mastercycler® thermocycler, precipitated and electro-155

injected according to the protocols described by the manufacturer.156

2.6. Analysis of sequences157

Vector sequences were masked using the Cross-Match algorithm (Gotoh, 1982) 158

and sequence quality was evaluated with Phred base-calling software (Ewing and Green, 159

1998; Ewing et al., 1998). Only bases with Phred values larger than 20 (> 99% accuracy) 160

were included in the 195 bp repetitive satellite DNA sequences established for strains of T. 161

cruzi. DNA sequences were aligned using the Clustal X program (Thompson et al., 1997),162

and discrepancies between sequences were confirmed by visual inspection of the 163

chromatograms and were edited manually when necessary. Phylogenetic trees were 164

constructed using MEGA 3 (Kumar et al., 2004) and Clustal X programs. Some trees were 165

viewed with the aid of the TreeView program developed by Page (2001).166

167

3. Results168

3.1. Analysis of satellite DNA nucleotide sequences established for strains of T. cruzi169

Samples of DNA from 34 strains of T. cruzi were submitted to PCR analysis using170

the primers Diaz 7 and 8 (Table 1). A 195 bp fragment was detected in all samples171

ACCEPTED MANUSCRIPT 8

analyzed, together with additional bands corresponding to the amplification of tandem172

repeats of this element. The sensitivity of the PCR analysis was 1 fg for Colombiana (T. 173

cruzi I) strain and 0.1 fg for Ernane (T. cruzi II) strain. No amplification products were174

observed when DNA from T. rangeli, L. braziliensis or L. amazonensis was used as 175

template in amounts up to 10 pg per reaction. These results are in accord with the 176

literature and confirm the use of Diaz 7 and 8 primers to amplify sequences of the satellite 177

DNA of T. cruzi.178

One hundred and sixty nucleotide sequences of satellite DNA derived from 12179

strains of T. cruzi were analyzed and the distribution of these sequences is presented in 180

Table 2. Polymorphisms were detected among the 195 bp sequences of each strain and 181

among strains from different zymodemes. A total of 89 polymorphic sites were observed, 182

but most of them were present in only a small number of sequences and were not 183

representative. Nevertheless, 8 polymorphic sites in satellite DNA were exclusive to strains 184

of T. cruzi I, although no sequence presented all 8 polymorphisms simultaneously.185

Figure 1 show a phylogenetic tree constructed on the basis of the nucleotide 186

sequences determined for T. cruzi satellite DNA. Two main branches were associated with 187

groups I and II of T. cruzi. The minor branch, delimited by a circle, contained exclusively 188

strains of group I (40 out of the 68 Z1 sequences), whilst the major branch contained 189

strains of group II (all 56 Z2 sequences and 36 ZB sequences) and some from group I (the 190

remaining 28 Z1 sequences). Of the four group I strains of T. cruzi analyzed, i.e. 191

Colombiana, Quaraizinho, Barra Seca and Yuyu (Table 2), only sequences of the 192

Colombiana strain were clustered exclusively in the group I branch. In the case of the 193

Quaraizinho strain, 9 out of the 17 sequences determined were clustered in the group I 194

branch, for the Barra Seca strain 6 out of 11 sequences were in the group I branch, and for 195

the Yuyu strain 6 out of 21 sequences were in the group I branch. This heterogeneity 196

suggests that some polymorphisms are exclusive to the satellite DNA of group I strains, 197

ACCEPTED MANUSCRIPT 9

and that these polymorphisms are not present in all of the repeat units from one same198

strain. 199

3.2. Multiplex PCR200

From these results, five primers (two sense and three anti-sense) complementary to 201

the polymorphic 3’ end bases characteristic of T. cruzi I strains were designed. Different 202

primer combinations were tested in PCR amplification reactions with DNA derived from 203

strains Colombiana and Quaraizinho (Z1), Noel and Ernane (Z2), and CL Brener and 204

Romano (ZB). Control PCR amplification reactions were also carried out with Diaz 7 and 8 205

primers. PCR product profiles that allowed the differentiation of T. cruzi strains into groups 206

I and II were obtained when primers TcSat 4, Diaz 7 and 8 were used together. Using this 207

set of primers, a panel of 34 T. cruzi strains consisting of 11 strains of T. cruzi I (Z1), 19 208

strains of T. cruzi II (10 strains of Z2 and 9 of ZB) and 4 strains of zymodeme 3 were 209

subjected to PCR amplification. Figure 2 shows the expected 111 bp fragment, resulting 210

from PCR amplification using TcSat 4 and Diaz 8 primers. It is present in all T. cruzi strains 211

and was used as a positive control for T. cruzi in DNA amplification reactions. Concerned 212

to, the 195 bp fragment generated by the PCR amplification with Diaz 7 and 8 primers, it is 213

present in all T. cruzi II (Z2 and ZB) and zymodeme 3 strains and absent in T. cruzi I 214

strains. Fragments of 306 and 390 bp can also be observed in the PCR product profile. 215

They resulted from primer annealing to adjacent sequences.216

To determine the sensitivity of the method, genomic DNA from strains Colombiana 217

(T. cruzi I) and Ernane (T. cruzi II) was assayed by multiplex PCR using 10 pg to 1 fg. The 218

minimum amount of DNA that allowed the detection of both 111 and 195 bp bands was 10 219

fg for both strains. The specificity of multiplex PCR was evaluated using DNA from T.220

rangeli, L. braziliensis and L. amazonensis. No amplification products were observed when 221

DNA from these phylogenetically related parasites was used in a concentration of up to 10 222

pg, indicating that multiplex PCR is specific to T. cruzi.223

ACCEPTED MANUSCRIPT 10

3.3. Validation of multiplex PCR224

The application of the multiplex PCR technique was evaluated using samples from 225

different sources: (i) blood, collected on filter paper, from mice experimentally infected with 226

T. cruzi and from non-infected controls, (ii) buffy coat DNA from patients in the acute 227

phase of Chagas disease and from individuals that were not infected with the parasite, and 228

(iii) feces from Triatoma infestans naturally infected with T. cruzi, collected on filter paper.229

Fourteen blood samples from Swiss mice infected with Colombiana (T. cruzi I) and 230

Y (T. cruzi II) strains were analyzed by multiplex PCR. The expected 111 bp fragment was 231

detected in all samples, whilst the 195 bp fragment was detected exclusively in samples 232

from animals infected with the Y strain (Figure 3). Furthermore, amplification products 233

were not observed in any of the 10 negative control samples derived from non-infected 234

mice. A uniform smear was, however, observed in all samples and this is probably derived 235

from excess protein that was co-extracted with the DNA. In order to evaluate any possible236

effects of mouse DNA on the multiplex PCR reaction, amplification profiles were obtained 237

using 10 ng of DNA derived from non-infected mice, either alone or mixed with 1 pg to 10 238

fg of genomic DNA from Colombiana and Y strains. No amplification products were 239

observed using mouse DNA alone, and the presence of mouse DNA did not change the 240

sensitivity of the multiplex PCR even when present in an amount that was 106-times higher241

than that of parasite DNA.242

Nine samples of DNA from patients infected with T. cruzi in a recent outbreak of 243

Chagas disease in the state of Santa Catarina, Brazil, were assayed by multiplex PCR. A 244

T. cruzi II profile, with the presence of a 195 bp fragment similar to that of a standard 245

sample from group II, was observed for all patients in the acute phase of the disease. 246

None of the 11 samples derived from non-infected individuals living in the same area 247

presented amplification products. Similarly to mouse DNA, human DNA did not interfere 248

ACCEPTED MANUSCRIPT 11

with multiplex PCR. There was no change in the sensitivity of the PCR even when human 249

DNA was present in an amount 2.4 x 106-times higher than that of parasite DNA (Figure 4).250

Fifteen samples of feces from T. infestans potentially infected with T. cruzi were 251

assayed by multiplex PCR. A previous microscopic examination revealed that 11 of the 252

triatomines were infected with T. cruzi whilst 4 were not. Multiplex PCR confirmed the253

microscopic findings and showed that all the strains were T. cruzi I.254

255

4. Discussion256

Chagas disease is an important public health problem in Latin America. The 257

resurgence of numerous cases of acute infection and the occurrence of outbreaks of oral 258

infection with T. cruzi reinforce the need to implement more sensitive and rapid diagnostic 259

methods. PCR detection of kDNA through amplification of repeated DNA sequences of T. 260

cruzi has been used to diagnose Chagas disease in humans (Galvão et al., 2003; Virreira 261

et al., 2003). However, the sensitivity of the PCR may vary according to the target DNA, 262

the strain of parasite and to the type of clinical sample employed. Moreover, classification 263

of the infecting strain of T. cruzi either by DNA or isoenzyme methods require large 264

amounts of biological material, necessitating parasite isolation and cultivation, which is not 265

always possible. In the present study, we have contributed to the epidemiological studies 266

of Chagas disease by developing a multiplex PCR technique by which diagnosis of the 267

disease and classification of the parasite into groups T. cruzi I and T. cruzi II may be 268

carried out simultaneously.269

The target of the multiplex PCR was nuclear 195 bp satellite DNA of T. cruzi that 270

presents two important features: (i) it is present in a large number of copies in the genome271

of the parasite, thus providing high sensitivity of detection, and (ii) the frequency of 272

polymorphism is high within and between different strains (Gonzalez et al., 1984), thus273

allowing strain classification. A number of studies have shown that this repeat is an 274

ACCEPTED MANUSCRIPT 12

appropriate target for the molecular diagnosis of Chagas disease and also for taxonomic 275

purposes (Gonzalez et al., 1984; Olivares-Villagómez et al., 1998; Bastrenta et al., 1999; 276

Virreira et al., 2003). Furthermore, it has been demonstrated that strains of T. cruzi may be 277

separated into two groups, T. cruzi I and T. cruzi II, by RFLP analysis of the 195 bp 278

satellite DNA (Bastrenta et al., 1999), or by analysis of the nucleotide sequences of the 279

repeats (Elias et al., 2005). However, no methodology has yet been described that would 280

permit the simultaneous diagnosis and classification of T. cruzi strains.281

In the present study, polymorphisms in the sequences of satellite DNA of T. cruzi I282

and T. cruzi II strains have been identified, and primers complementary to these 283

polymorphic sites were designed. Multiplex PCR using a combination of Diaz 7 and 8 and 284

TcSat 4 primers, yielded amplification products that allowed differentiation between T. 285

cruzi strains of groups I and II. Multiplex PCR was then used to analyze 34 strains of T. 286

cruzi isolated from 8 host species from 4 different countries. The PCR product profile of all 287

T. cruzi strains exhibited a 111 bp fragment, which functioned as a positive control for the 288

PCR, and a 195 bp fragment that was characteristic of T. cruzi strains of group II. In T. 289

cruzi group I the 195 bp was absent.290

It is suggested that the different PCR product profiles established in the two groups 291

of T. cruzi could be related to quantitative differences in the satellite DNA present. Elias et 292

al. (2003) and Vargas et al. (2004) reported that the amount of satellite DNA in T. cruzi I293

strains was 4 to 9-times smaller than T. cruzi II. Thus, in T. cruzi II strains, the abundance 294

of satellite DNA may be sufficient to enable both of the sense primers (TcSat 4 and Diaz 7) 295

to bind to their templates, leading to the amplification of 111 and 195 bp fragments. 296

However, when the number of repeats is smaller, as in T. cruzi I strains, competition for 297

complementary sites favor the TcSat 4 primer, leading to amplification of the 111 bp 298

fragment only. An important factor with respect to the preferential binding of the TcSat 4 299

primer is its higher annealing temperature compared with that of Diaz 7, allowing it to 300

ACCEPTED MANUSCRIPT 13

anneal to its respective complementary site earlier and more readily than the Diaz 7 301

primer.302

It’s unclear the classification of the strains of T. cruzi belonging to zymodeme 3 into 303

the two major groups. According to an expert committee, T. cruzi I and T. cruzi II304

correspond, respectively, to zymodemes Z1 and Z2; however the strains of zymodeme 3 305

should not be grouped into any of the major groups until further characterization of these 306

isolates be performed (anonymous, 1999). Later, Brisse et al. (2000) proposed the 307

subdivision of T. cruzi II into five sub-groups (T. cruzi IIa-IIe) and the parasites of 308

zymodeme 3 were distributed into sub-groups IIa and IIc. On the other hand, Freitas et al. 309

(2006) proposed that Z3 stocks correspond to an ancestral lineage T. cruzi III (although 310

some strains, as Can III, cannot be accommodated into this scenario) and Pedroso et al. 311

(2007) suggest that Z3 isolates from the Brazilian Amazon constitute an independent 312

cluster with low intra-group genetic diversity. The multiplex PCR described here showed a 313

profile of T. cruzi II for the strains of zymodeme 3. It’s important to observe that the primers 314

used for multiplex PCR were made for diagnosis and classification of T. cruzi strains only 315

into the groups I and II. Multiplex PCR was validated using reference strains of T. cruzi I 316

(Colombiana strain), T. cruzi II (Y strain), including hybrid groups of T. cruzi IIe (CL-Brener 317

strain) and T. cruzi IIa (Can III strain, hybrid according to Freitas et al., 2006).318

Multiplex PCR is sensitive compared with other techniques employed in molecular 319

diagnosis. The sensitivity of the method when applied to samples of genomic DNA was 10 320

fg, which corresponds to about 1/30th of the DNA of one parasite. Such sensitivity is equal 321

to that achieved by other primers used to diagnose Chagas disease, including S 35 and 36 322

(Kirchhoff et al., 1996), which amplify a kDNA fragment. Although the use of Diaz 7 and 8 323

primers alone provides an even higher PCR sensitivity of ca. 0.1 to 1 fg depending on the 324

strain of T. cruzi, multiplex PCR offers the considerable advantage of being able both to 325

detect and to characterize the parasite with respect to group. In contrast, strain genotyping 326

ACCEPTED MANUSCRIPT 14

using rDNA or mini-exon genes (Murta et al., 1998) demands concentrations of DNA 327

around of 100 pg, i.e. 10,000 times higher than the necessary for the method proposed in 328

this study. Recently, Valadares et al. (2008) described seven polymorphic microsatellite 329

loci that are useful for characterization of parasites directly in infected tissues. For all these 330

loci, the authors designed two pairs of primers for full nested PCR assay. Using this 331

strategy, it’s possible to detect as little as 200 fg of parasite DNA (20X more than multiplex 332

PCR) and to identify strains of T. cruzi groups I, II, III (T. cruzi IIc) and hybrid groups (T. 333

cruzi IId-e). This method however is limited by diverse factors such as the small amount of 334

parasites in the infected tissues and the varying reaction sensitivities of each microsatellite 335

locus. A further important consideration is that the cultivation of parasites required to 336

obtain sufficient DNA for analysis may select for a specific sub-population, thus genotyping 337

may not reflect the heterogeneity of the original parasite population (Veloso et al., 2005). 338

The specificity of multiplex PCR was confirmed by the absence of PCR products when 339

DNA from phylogenetically related parasites (T. rangeli and Leishmania spp.) was 340

amplified. This result is in accordance with previous reports that the 195 bp satellite DNA 341

is exclusive of T. cruzi (Moser et al., 1989; Virreira et al., 2003).342

In order to validate the multiplex PCR method, clinical and field samples were 343

assayed. The collection of samples on filter paper facilitates the handling of field samples 344

and simplifies the extraction method, thus saving time and money. Using this technique, it345

was possible to correctly detect and classify blood samples of mice that had been346

experimentally infected with T. cruzi group I (Colombiana) and group II (Y) strains.347

Samples of DNA, extracted from feces collected on filter paper, of naturally infected T.348

infestans were also tested by multiplex PCR. All of the positive samples showed infection 349

with T. cruzi I strains. Machado et al. (2000) reported that the use of feces collected on 350

filter paper provided a rapid and practical method for the detection of T. cruzi and T. 351

rangeli in triatomines.352

ACCEPTED MANUSCRIPT 15

Multiplex PCR analysis of DNA from buffy coat of individuals in the acute phase of 353

Chagas disease revealed that all T. cruzi strains were of group II. These findings are in 354

accordance with recent studies using rDNA, mini-exon genes and isoenzyme (Steindel et 355

al., 2008). Buffy coat DNA samples from non-infected individuals were all negative for T. 356

cruzi according to multiplex PCR. Neither human nor mouse DNA affected the sensitivity 357

of multiplex PCR, indicating that the technique may be applied to clinical and field samples 358

without interference from the presence of excess host DNA.359

One of difficulties observed in the field research is the identification of mixed 360

infections with different genotypes of T. cruzi. The presence of multiple genotypes was 361

observed in triatomines and mammals (Bosseno et al., 1996; Solari et al., 2001). However, 362

there are few studies about T. cruzi groups I and II mixed infections and their prevalence in 363

field. It is possible that the frequency of mixed infections varies according to the 364

geographical area, the species of reservoirs and vectors and the tool (genetic marker) 365

utilized. Steindel et al. (1995) observed two mixed infections in 59 T. cruzi strains (3.4%)366

isolated from sylvatic reservoirs or naturally infected vectors. In an outbreak of Chagas 367

disease occurred in 2005, Steindel et al (2008) found two T. cruzi isolates obtained from 368

opossums belonged to the T. cruzi I, nine acute chagasic patients belonged to the T. cruzi369

II and two isolates from T. tibiamaculata with mixed infections. Marcet et al. (2006) found 370

only one mixed infection among 28 triatomines (3.6%) naturally infected in the northeast of 371

Argentina. Exceptionally, Bosseno et al. (1996) observed 45.7% of mixed infections in T. 372

infestans from Bolivia. Such data should be taken with caution since the triatomines were 373

captured in the same nest. In the Paraná state, Brazil Spitzner et al. (2007) observed 50% 374

of mixed infections in 18 strains isolated from triatomines. The authors found 6 of 9 375

Triatoma sordida and 3 of 9 P. megistus infected with T. cruzi I and T. cruzi II parasites, 376

simultaneously. Mixed infections were also observed in vertebrate hosts (Pinho et al., 377

ACCEPTED MANUSCRIPT 16

2000; Lisboa et al., 2006; Herrera et al., 2005), however the small number of samples 378

does not permit an evaluation of the frequency of mixed infections.379

The detection of mixed infections will depend on the tool (genetic marker) used. As 380

demonstrated by Steindel et al. (2008) using a phenotypic marker (MLEE) and by Spitzner 381

et al. (2007) with the mitochondrial gene cytochrome oxidase II (COII), it is possible to 382

detect mixed infections in samples of T. cruzi in which rDNA assay, SL gene analyzes and 383

RAPD do not detected. However, they depend of large amount of the parasite. The ability 384

of the multiplex PCR to detect mixed infection was performed using a mix of genomic DNA 385

of the strains Colombiana (T. cruzi I) and Y (T. cruzi II). Unfortunately, the profile observed 386

was similar to T. cruzi II and multiplex PCR couldn’t identify mixed infections into DNA 387

samples. However, the resolution of mixed infections is possible by the isolation of the 388

parasite clones by direct plating on a sensitive solid medium, as described by Yeo et al. 389

(2007). In this case, multiplex PCR could be performed even with a single parasite.390

In summary, the multiplex PCR described here is a sensitive, specific, rapid and 391

practical methodology that may be employed with different sources biological samples,392

containing minimal amounts of DNA, in order to detect and classify T. cruzi. The primers 393

designed were specific for classification into the groups T. cruzi I and T. cruzi II and cannot 394

be used for classification of T. cruzi II sub-group or T. cruzi III (T. cruzi IIc). Our study 395

shows that the 195 bp repetitive nuclear DNA sequences is an ideal target for molecular 396

diagnosis of Chagas disease and simultaneously for classification of the infecting T. cruzi 397

strain.398

Acknowledgements399

The authors wish to thank Danielle Scholl (Laboratório de Protozoologia, 400

Universidade Federal de Santa Catarina, SC, Brazil) and Ivan Sonoda (Laboratório de 401

Triatomíneos e Epidemiologia da Doença de Chagas, CPqRR, Fiocruz, MG, Brazil) for 402

their support in obtaining buffy coat samples from patients and feces from triatomines, 403

ACCEPTED MANUSCRIPT 17

respectively. This work was supported by grants from the Brazilian agencies: Conselho 404

Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Fundação de Amparo 405

à Pesquisa do Estado de Minas Gerais (FAPEMIG).406

References407

Anonymous, 1999. Recommendations from a satellite meeting. International Symposium 408

to commemorate the 90th anniversary of the discovery of Chagas disease. Memórias 409

do Instituto Oswaldo Cruz 94 (Suppl. 1), 429-432.410

Bastrenta, B., Bosseno, M.F., Barnabé, C., Tibayrenc, M., Brenière, S.F., 1999. Restriction 411

fragment length polymorphism of 195 bp repeated satellite DNA of Trypanosoma cruzi412

supports the existence of two phylogenetic groups. Memórias do Instituto Oswaldo 413

Cruz 94, 323-328.414

Bosseno, M.F., Telleria, J., Vargas, F., Yaksic, N., Noireau, F., Morin, A., Breniere, S.F., 415

1996. Trypanosoma cruzi: study of the distribution of two widespread clonal genotypes 416

in Bolivian Triatoma infestans vectors shows a high frequency of mixed infections. 417

Experimental Parasitology. 83, 275-282.418

Brisse, S., Dujardin, J.C., Tibayrenc, M., 2000. Identification of six Trypanosoma cruzi419

phylogenetic lineages by random amplified polymorphic DNA and multilocus enzyme 420

eletrophoresis. International Journal for Parasitology. 30, 35-44.421

Diaz, C., Nussenzweig, V., Gonzalez, A., 1992. An improved polymerase chain reaction 422

assay to detect Trypanosoma cruzi in blood. American Journal of Tropical Medicine 423

and Hygiene. 46, 616-623.424

Elias, M.C., Vargas, N.S., Zingales, B., Schenkman, S., 2003. Organization of satellite 425

DNA in the genome of Trypanosoma cruzi. Molecular and Biochemical Parasitology. 426

129, 1-9.427

Elias, M.C., Vargas, N., Tomazi, L., Pedroso, A., Zingales, B., Schenkman, S., Briones, 428

M.R., 2005. Comparative analysis of genomic sequences suggests that Trypanosoma 429

ACCEPTED MANUSCRIPT 18

cruzi CL Brener contains two sets of non-intercalated repeats of satellite DNA that 430

correspond to T. cruzi I and T. cruzi II types. Molecular and Biochemical Parasitology. 431

140, 221-227.432

El-Sayed, N.M., Myler, P.J., Bartholomeu, D.C., Nilsson, D., Aggarwal, G., Tran, A.N., 433

Ghedin, E., Worthey, E.A., Delcher, A.L., Blandin, G., Westenberger, S.J., Caler, E., 434

Cerqueira, G.C., Branche, C., Haas, B., Anupama, A., Arner, E., Aslund, L., Attipoe, P., 435

Bontempi, E., Bringaud, F., Burton, P., Cadag, E., Campbell, D.A., Carrington, M., 436

Crabtree, J., Darban, H., da Silveira, J.F., de Jong, P., Edwards, K., Englund, P.T., 437

Fazelina, G., Feldblyum, T., Ferella, M., Frasch, A.C., Gull, K., Horn, D., Hou, L., 438

Huang, Y., Kindlund, E., Klingbeil, M., Kluge, S., Koo, H., Lacerda, D., Levin, M.J., 439

Lorenzi, H., Louie, T., Machado, C.R., McCulloch, R., McKenna, A., Mizuno, Y., 440

Mottram, J.C., Nelson, S., Ochaya, S., Osoegawa, K., Pai, G., Parsons, M., Pentony, 441

M., Pettersson, U., Pop, M., Ramirez, J.L., Rinta, J., Robertson, L., Salzberg, S.L., 442

Sanchez, D.O., Seyler, A., Sharma, R., Shetty, J., Simpson, A.J., Sisk, E., Tammi, 443

M.T., Tarleton, R., Teixeira, S., Van Aken, S., Vogt, C., Ward, P.N., Wickstead, B., 444

Wortman, J., White, O., Fraser, C.M., Stuart, K.D., Andersson, B., 2005. The genome 445

sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309, 409-446

415.447

Ewing, B., Green, P., 1998. Base-calling of automated sequencer traces using Phred. II. 448

Error probabilities. Genome Research. 8, 186-194.449

Ewing, B., Hillier, L., Wendl, M.C., Green, P., 1998. Base-calling of automated sequencer 450

traces using Phred. I. Accuracy assessment. Genome Research. 8, 175-185.451

Filardi, L.S., Brener, Z., 1987. Susceptibility and natural resistance of Trypanosoma cruzi452

strains to drugs used clinically in Chaga’s disease. Transactions of the Royal Society of 453

Tropical Medicine and Hygiene. 81, 755-759.454

ACCEPTED MANUSCRIPT 19

Freitas, J.M., Augusto-Pinto, L., Pimenta, J.R., Bastos-Rodrigues, L., Gonçalves, V.F., 455

Teixeira, S.M.R., Chiari, E., Junqueira, A.C.V., Fernandes, O., Macedo, A.M., 456

Machado, C.R., Pena, S.D.J., 2006. Ancestral genomes, sex and the population 457

structure of Trypanosoma cruzi. PLoS Pathogens. 2(3), e24.458

Galvão, L.M., Chiari, E., Macedo, A.M., Luquetti, A.O., Silva, S.A., Andrade, A.L., 2003. 459

PCR assay for monitoring Trypanosoma cruzi parasitemia in childhood after specific 460

chemotherapy. Journal of Clinical Microbiology. 41, 5066-5070.461

Gonzalez, A., Prediger, E., Huecas, M.E., Nogueira, N., Lizardi, P., 1984. Mini-462

chromosomal repetitive DNA in Trypanosoma cruzi: its use in a high-sensitivity parasite 463

detection assay. Proceedings of the National Academy of Sciences USA 81, 3356-464

3360.465

Gotoh, O., 1982. An improved algorithm for matching biological sequences. Journal for466

Molecular Biology. 162, 705-708.467

Herrera, L., D'Andrea, P.S., Xavier, S.C., Mangia, R.H., Fernandes, O., Jansen, A.M., 468

2005. Trypanosoma cruzi infection in wild mammals of the National Park 'Serra da 469

Capivara' and its surroundings (Piaui, Brazil), an area endemic for Chagas disease. 470

Transactions of the Royal Society of Tropical Medicine and Hygiene. 99(5), 379-88.471

Kirchhoff, L.V., Votava, J.R., Ochs, D.E., Moser, D.R., 1996. Comparison of PCR and 472

microscopic methods for detecting Trypanosoma cruzi. Journal of Clinical Microbiology. 473

34, 1171-1175. 474

Kooy, R.F., Ashall, F., Van Der Ploeg, M., Overdulve, J.P., 1989. On the DNA content of 475

Trypanosoma cruzi. Molecular and Biochemical Parasitology. 36, 73-76.476

Kumar, S., Tamura, K., Nei, M., 2004. MEGA3. Integrated software for molecular 477

evolutionary genetics analysis and sequence alignment. Briefings Bioinformatics 5, 478

150-163.479

ACCEPTED MANUSCRIPT 20

Lanar, D.E., Levy, S.C., Manning, J.E., 1981. Complexity and content of the DNA and 480

RNA in Trypanosoma cruzi. Molecular and Biochemical Parasitology. 3, 327-341.481

Lisboa, C.V., Mangia, R.H., Luz, S.L., Kluczkovski, A. Jr., Ferreira, L.F., Ribeiro, C.T., 482

Fernandes, O., Jansen, A.M., 2006. Stable infection of primates with Trypanosoma 483

cruzi I and II. Parasitology 133(Pt 5), 603-11.484

Machado, E.M., Alvarenga, N.J., Romanha, A.J., Grisard, E.C., 2000. A simplified method 485

for sample collection and DNA isolation for polymerase chain reaction detection of 486

Trypanosoma rangeli and Trypanosoma cruzi in triatomine vectors. Memórias do 487

Instituto Oswaldo Cruz 95, 863-866.488

Maniatis, T.M., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning. A Laboratory Manual. 489

Cold Spring Harbor University Laboratory Press, Cold Spring Harbor.490

Marcet, P.L., Duffy, T., Cardinal, M.V., Burgos, J.M., Lauricella, M.A., Levin, M.J., Kitron, 491

U., Gürtler, R.E., Schijman, A.G., 2006 PCR-based screening and lineage identification 492

of Trypanosoma cruzi directly from faecal samples of triatomine bugs from 493

northwestern Argentina. Parasitology 132(Pt 1), 57-65. 494

McDaniel, J.P., Dvorak, J.A., 1993. Identification, isolation and characterization of 495

naturally-occurring Trypanosoma cruzi variants. Molecular and Biochemical 496

Parasitology. 57, 213-222.497

Moser, D.R., Kirchhoff, L.V., Donelson, J.E., 1989. Detection of Trypanosoma cruzi by 498

DNA amplification using the polymerase chain reaction. Journal of Clinical 499

Microbiology. 27, 1477-1482.500

Murta, S.M.F., Romanha, A.J., 1999. Characterization of Trypanosoma cruzi.501

Memórias do Instituto Oswaldo Cruz 94, 177-180.502

Murta, S.M.F., Gazzineli, R.T., Brener, Z., Romanha, A.J., 1998. Molecular 503

characterization of susceptible and naturally resistant strains of Trypanosoma cruzi to 504

benznidazol and nifurtimox. Molecular and Biochemical Parasitology. 93, 203-214. 505

ACCEPTED MANUSCRIPT 21

Olivares-Villagómez, D., Mccurley, T.L., Vnencak-Jones, C.L., Correa-Oliveira, R., Colley, 506

D.G., Carter, C.E., 1998. Polymerase chain reaction amplification of three different 507

Trypanosoma cruzi DNA sequences from human chagasic cardiac tissue. American 508

Journal of Tropical Medicine and Hygiene. 59, 563-570.509

Page, R.D.M., 2001. TreeView – tree drawing software for Apple Macintosh and Windows. 510

Available at http://taxonomy.zoology.gla.ac.ukl/rod/treeview.html. Accessed in August 511

2006512

Pedroso, A., Cupolillo, E., Zingales, B., 2007. Trypanosoma cruzi: exploring the nuclear 513

genome of zymodeme 3 stocks by chromosome size polymorphism. Experimental 514

Parasitology. 116(1), 71-6.515

Pinho, A.P., Cupolillo, E., Mangia, R.H., Fernandes, O., Jansen, A.M., 2000. Trypanosoma 516

cruzi in the sylvatic environment: distinct transmission cycles involving two sympatric 517

marsupials. Transactions of the Royal Society of Tropical Medicine and Hygiene. 94(5), 518

509-14.519

Requena, J.M., Lopez, M.C., Alonso, C., 1996. Genomic repetitive DNA elements of 520

Trypanosoma cruzi. Parasitology Today 12, 279-282.521

Sanguinetti, C.J., Dias Neto, E., Simpson, A.J., 1994. Rapid silver staining and recovery of 522

PCR products separated on polyacrylamide gels. Biotechniques 17, 914-921.523

Solari, A., Campillay, R., Ortíz, S., Wallace, A., 2001. Identification of Trypanosoma cruzi524

genotypes circulating in Chilean chagasic patients. Experimental Parasitology. 97(4), 525

226-33. 526

Souto, R.P., Fernandes, O., Macedo, A.M., Campbell, D.A., Zingales, B., 1996. DNA 527

markers define two major phylogenetic lineages of Trypanosoma cruzi. Molecular and 528

Biochemical Parasitology. 83, 141-152.529

Spitzner, F.L., Freitas, J.M., Macedo, A.M., Toledo, M.J.O., Araújo, S.M., Prioli, A.J., 530

Gomes, M.L., 2007. Trypanosoma cruzi - triatomine associations and the presence of 531

ACCEPTED MANUSCRIPT 22

mixed infections in single triatomine bugs in Paraná state, Brazil. Acta parasitologica. 532

52, 74-81.533

Steindel, M., Dias Neto, E., Menezes, C.L.P., Romanha, A.J., Simpson, A.J., 1993. 534

Random amplified polymorphic DNA analysis of Trypanosoma cruzi strains. Molecular 535

and Biochemical Parasitology. 60, 71-80. 536

Steindel, M., Toma, H.K., Ishida, M.M., Murta, S.M.F., de Carvalho Pinto, C.J., Grisard, 537

E.C., Schlemper Jr, B.R., Ribeiro-Rodrigues, R., Romanha, A.J., 1995. Biological and 538

isoenzymatic characterization of Trypanosoma cruzi strains isolated from sylvatic 539

reservoirs and vectors from the State of Santa Catarina, Southern Brazil. Acta Tropica540

60, 167-177.541

Steindel, M., Dias, J.C.P., Romanha, A.J., 2005. Doença de Chagas: Mal que ainda 542

preocupa. Ciência Hoje 37, 32-38.543

Steindel, M., Kramer Pacheco, L., Scholl, D., Soares, M., de Moraes, M.H., Eger, I., 544

Kosmann, C., Sincero, T.C., Stoco, P.H., Murta, S.M.F., de Carvalho-Pinto, C.J., 545

Grisard, E.C., 2008. Characterization of Trypanosoma cruzi isolated from humans, 546

vectors, and animal reservoirs following an outbreak of acute human Chagas disease 547

in Santa Catarina State, Brazil. Diagnostic Microbiology and Infectious Diseases. 60(1), 548

25-32.549

Sturm, N.R., Vargas, N.S., Westenberger, S.J., Zingales, B., Campbell, D.A., 2003. 550

Evidence for multiple hybrid groups in Trypanosoma cruzi. International Journal for551

Parasitology. 33, 269-279.552

Thompson, C., Dvorak, J.A., 1989. Quantitation of total DNA per cell in an exponentially 553

growing population using the diphenylamine reaction and flow cytometry. Analytical 554

Biochemistry. 177, 353-357.555

ACCEPTED MANUSCRIPT 23

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The 556

Clustal X Windows interface: flexible strategies for multiple sequence alignment aided 557

by quality analysis tools. Nucleic Acids Research. 25, 4876-4882.558

Toma, H.K., Yamada-Ogatta, S.F., Brandão, A., Krieger, M.A., Goldenberg, S., 559

Fernandes, O., 2007. Trypanosoma cruzi: Subtractive hybridization as a molecular 560

strategy to generate new targets to distinguish groups and hybrids. Experimental 561

Parasitology. 117, 178-187.562

Valadares, H.M., Pimenta, J.R., de Freitas, J.M., Duffy, T., Bartholomeu, D.C., Oliveira, R. 563

de P., Chiari, E., Moreira, M. da C., Filho, G.B., Schijman, A.G., Franco, G.R., 564

Machado, C.R., Pena, S.D., Macedo, A.M., 2008. Genetic profiling of Trypanosoma 565

cruzi directly in infected tissues using nested PCR of polymorphic microsatellites. 566

International Journal for Parasitology. 38(7), 839-50.567

Vargas, N., Pedroso, A., Zingales, B., 2004. Chromosomal polymorphism, gene synteny 568

and genome size in T. cruzi I and T. cruzi II groups. Molecular and Biochemical 569

Parasitology. 138, 131-141.570

Veloso, V.M., Romanha, A.J., Lana, M., Murta, S.M., Carneiro, C.M., Alves, C.F., Borges, 571

E.C., Tafuri, W.L., Machado-Coelho, G.L., Chiari, E., Bahia, M.T., 2005. Influence of 572

the long-term Trypanosoma cruzi infection in vertebrate host on the genetic and 573

biological diversity of the parasite. Parasitology Research. 96, 382-389. 574

Virreira, M., Torrico, F., Truyens, C., Alonso-Vega, C., Solano, M., Carlier, Y., Svoboda, 575

M., 2003. Comparison of polymerase chain reaction methods for reliable and easy576

detection of congenital Trypanosoma cruzi infection. American Journal of Tropical 577

Medicine and Hygiene. 68, 574-582.578

Yeo, M., Lewis, M.D., Carrasco, H.J., Costa, N.A., Llewellyn, M., Valente, S.A.S., Valente,579

V.C., Arias, A.R., Miles, M.A., 2007. Resolution of multiclonal infections of 580

Trypanosoma cruzi from naturally infected triatomine bugs and from experimentally 581

ACCEPTED MANUSCRIPT 24

infected mice by direct plating on a sensitive solid medium. Internacional Journal for582

Parasitology. 37(1), 111-120.583

World Health Organization (WHO), 2007. Available at http://www.who.org Accessed in 584

October 2008.585

586

Legends to figures587

Figure 1588

Neighbour-joining phylogenetic tree of representative sequences of satellite DNA from 12 589

T. cruzi strains. The major branch contains sequences of T. cruzi groups I and II. The 590

minor branch, delimited by a circle, contains only sequences of T. cruzi group I. For each 591

strain, the numbers of identical sequences determined are shown in brackets. Strains of T. 592

cruzi: BS - Barra Seca, Col – Colombiana, Qua – Quaraizinho, CLB – CL-Brener, Roma –593

Romano, Ern – Ernane.594

* – Sequences of T. cruzi I strains present in the major branch.595

Figure 2596

Electrophoretic profiles (6% polyacrylamide gel silver stained) of PCR products obtained 597

by amplification of satellite DNA from 16 T. cruzi strains of different zymodemes and 598

groups using TcSat 4, Diaz 7 and 8 primers. 599

MM – Molecular Marker Φ X 174 digested with Hae III enzyme (bp). 600

NC – PCR negative control (without DNA).601

Figure 3602

Electrophoretic profiles (6% polyacrylamide gel silver stained) of the products of multiplex 603

PCR obtained in the presence of excess mouse DNA to which had been added known 604

amounts of T. cruzi DNA and blood samples derived from mice experimentally infected 605

ACCEPTED MANUSCRIPT 25

with T. cruzi. Standard DNA samples of T. cruzi I (Colombiana) and II (Y) strains were 606

used.607

MM – Molecular Marker Φ X 174 digested with Hae III enzyme (bp). 608

NC – PCR negative control (without DNA). 609

Figure 4610

Electrophoretic profiles (6% polyacrylamide gel silver stained) of the products of multiplex 611

PCR obtained by amplification of DNA samples from patients in the acute phase of 612

Chagas disease. 613

MM – Molecular Marker Φ X 174 digested with Hae III enzyme (bp). 614

NC – PCR negative control (without DNA).615

ACCEPTED MANUSCRIPT

Table 1 – Strains of Trypanosoma cruzi analysed by multiplex PCR (n = 34).

T. cruzi

strainOrigina Host Zymodemeb Groupc

Multiplex

PCRd

Barra secae RS Triatoma infestans 1 I I

CA-I Arg Human CPg 1 I I

Colombianae Col Human CPg 1 I I

DM-28 Ven Didelphis marsupialis 1 I I

Quaraizinhoe RS T. infestans 1 I I

SC-14 SC Panstrongylus megistus 1 I I

SC-28 SC D. marsupialis 1 I I

SC-42 SC D. marsupialis 1 I I

SC-51 SC P. megistus 1 I I

Tehuantepec Mex Triatomine 1 I I

Yuyue BA T. infestans 1 I I

Chaninha MG Felis domesticus 2 II II

Exr 424/3 SP Philander opossum 2 II II

Exr 426/1 SP D. marsupialis 2 II II

Ernanee GO Human CPg 2 II II

Noele MG Human APf 2 II II

PNMe MG Human CPg 2 II II

São Felipe BA Human CPg 2 II II

SMJ GO Human CPg 2 II II

VL-10e MG Human CPg 2 II II

Y SP Human APf 2 II II

CL RS T. infestans B II II

ACCEPTED MANUSCRIPT

Cl-Brenere RS T. infestans B II II

FL RS T. infestans B II II

Ibarra Arg Human CPg B II II

Je MG Human APf B II II

JA GO Human CPg B II II

Lunae Arg Human APf B II II

MR RS T. infestans B II II

Romanoe Arg Human APf B II II

3663 AM Panstrongylus geniculatus 3 ND II

4167 AM Rhodnius brethesi 3 ND II

Can III PA Human 3 ND II

JJ AM Human 3 ND II

a Origin of strains: AM – Amazonas, Arg – Argentina, BA – Bahia, Col – Colômbia, GO –

Goiás, Mex – Mexico, MG – Minas Gerais, PA – Pará, RS – Rio Grande do Sul, SC –

Santa Catarina, SP – São Paulo and Ven – Venezuela. AM, BA, GO, MG, PA, RS,

SC and SP are different states from Brazil.

b According to Murta et al. (1998) and Toma et al (2007).

c According to Anonymous, (1999). ND, not determined.

d Typed in this study.

e Strains selected for nucleotide sequence analysis of satellite DNA.

f AP – Acute phase.

g CP – Chronic phase

ACCEPTED MANUSCRIPT

Table 2 – Distribution by strain of the 195 bp satellite DNA

sequences within groups I and II of T. cruzi.

T. cruzi strain ZymodemeaSequences

T. cruzi I T. cruzi II Total

Colombiana 1 19 0 19

Quaraizinho 1 9 8 17

Barra Seca 1 6 5 11

Yuyu 1 6 15 21

PNM 2 0 17 17

Ernane 2 0 15 15

VL-10 2 0 15 15

Noel 2 0 9 9

Romano B 0 12 12

J B 0 11 11

Luna B 0 7 7

Cl-Brener B 0 6 6

Total 40 120 160

a According to Murta et al. (1998).

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT