G

V

Dac

VDa

b

c

d

ARRAA

KFOD

1

ieAmsaes(

RR

p

0d

ARTICLE IN PRESSModel

IRMET-11539; No. of Pages 8

Journal of Virological Methods xxx (2011) xxx–xxx

Contents lists available at ScienceDirect

Journal of Virological Methods

journa l homepage: www.e lsev ier .com/ locate / jv i romet

evelopment of one-step multiplex RT-PCR method for simultaneous detectionnd differentiation of foot-and-mouth disease virus serotypes O, A, and Asia 1irculating in Vietnam

an Phan Lea,b,∗, Kwang-Nyeong Leea, Tung Nguyenc, Su-Mi Kima, In-Soo Choa, Dong Van Quyend,inh Duy Khangd, Jong-Hyeon Parka,∗∗

Foreign Animal Disease Division, National Veterinary Research and Quarantine Service, Anyang, Gyeonggi 430-757, Republic of KoreaDepartment of Immunology and Pathology, National Institute of Veterinary Research, 86 Truong Chinh, Dongda, Hanoi, Viet NamNational Center for Veterinary Diagnosis, Department of Animal Health, 11/78 Giaiphong, Phuongmai, Dongda, Hanoi, Viet NamLaboratory of Molecular Microbiology, Institute of Biotechnology, Vietnam Academy of Science and Technology, 18-Hoang Quoc Viet, Hanoi, Viet Nam

rticle history:eceived 26 March 2010eceived in revised form 1 April 2011ccepted 5 April 2011vailable online xxx

eywords:oot-and-mouth diseasene-step multiplex RT-PCR

a b s t r a c t

A one-step multiplex RT-PCR method using new primers was developed for the simultaneous detectionand differentiation of Vietnamese FMDV serotypes O, A, and Asia 1 directly from clinical samples. TheRT-PCR method used a cocktail of one universal minus-sense primer designed in the 2B gene and threeserotype-specific plus-sense primers designed in the hypervariable regions of the capsid VP1 coding geneof FMDV. These serotype-specific primer pairs amplified 658, 535, and 427 bp PCR products correspondingto FMDV serotypes O, Asia 1, and A, respectively. In this study, six well-characterized FMDV strainsbelonging to serotypes O, A, and Asia 1 were used as reference strains for validation tests. Among these sixFMDV strains were three vaccine strains for type O (O1/Manisa), A (A22/Iraq), and Asia 1 (As1/Shamir/89).

iagnosis The other reference strains included one pandemic strain of FMDV serotype Asia 1 (Asia1/MOG/05) andtwo pandemic strains of FMDV serotype O (O/UKG/34/2001 and O/SKR/2000). For field application, 37positive-clinical samples and 18 cell culture-adapted viruses belonging to serotypes O, A, and Asia 1, asconfirmed previously by antigen ELISA for FMDV detection, were used. The present method showed highsensitivity and specificity and can be adapted for detection and typing of FMDV serotypes O, A, and Asia1 circulating in Vietnam.

. Introduction

Foot-and-mouth disease virus (FMDV) is a picornavirus belong-ng to the Aphthovirus genus of the Picornavirus family. The virusxists as seven distinct serotypes-O, A, C, Asia 1, and the Southfrican Territories (SAT) serotypes SAT1, SAT2, and SAT3, withultiple subtypes (Carrillo et al., 2005). Viral infection with one

erotype does not confer protection against the other serotypes,nd cross-serotype protection is not always complete (Kitching

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

t al., 1989). Based on the phylogenetic analysis of the VP1 geneequence, FMDV serotype A is classified into 10 major genotypesI–X) (Kitching, 2005; Tosh et al., 2002), FMDV serotype O is

∗ Corresponding author at: Foreign Animal Disease Division, National Veterinaryesearch and Quarantine Service, Anyang 6, Manan-gu, Anyang, Gyeonggi 430-757,epublic of Korea. Tel.: +82 31 467 1719; fax: +82 31 449 5882.∗∗ Corresponding author. Tel.: +82 31 467 1719; fax: +82 31 449 5882.

E-mail addresses: letranphan@gmail.com (V.P. Le),arkjh@nvrqs.go.kr (J.-H. Park).

166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2011.04.027

© 2011 Elsevier B.V. All rights reserved.

classified into 10 topotypes, designated as Europe-South America(Euro-SA), Middle East-South Asia (ME-SA), Southeast Asia (SEA),Cathay (CHY), West Africa (WA), East Africa 1 (EA-1), East Africa2 (EA-2), East Africa 3 (EA-3), Indonesia-1 (ISA-1), and Indonesia-2(ISA-2) (Knowles et al., 2005), and FMDV serotype Asia 1 is groupedinto 6 genotypes (I-VI) (Valarcher et al., 2009).

Foot-and-mouth disease (FMD) is endemic in large areas ofAfrica, Asia, and South America and crosses readily internationalboundaries to cause epidemics in areas, which were virus-free pre-viously. Controlling FMD outbreaks depends on early detection ofinfected animals, which requires a rapid and sensitive method ofdiagnosis (Hoffmann et al., 2009). Generally, FMD diagnosis is basedon clinical signs, followed by confirmation by laboratory tests. Ofthe established diagnostic approaches, virus isolation in cell cultureis considered to be the “gold standard”; however, it takes one to fourdays to generate a result, thus delaying the initiation of control pro-

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

cedures. Other assays, such as antigen-detection ELISA (Ferris andDawson, 1988), are faster but have lower analytical sensitivity andare inappropriate for use with certain sample types (Alexandersenet al., 2003; Hoffmann et al., 2009; Reid et al., 2000). In addition

ING Model

V

2 ogical

trtte2

h(tiOtcmeIhteosdF

2

2

O1s1aic1dmcotcpOi(tVsv

2

fpspiosGt

ARTICLEIRMET-11539; No. of Pages 8

V.P. Le et al. / Journal of Virol

o these two techniques, reverse transcriptase polymerase chaineaction (RT-PCR) is now established as a reliable, fast, and sensi-ive method for detecting FMDV in a wide range of clinical sampleypes (Amaral-Doel et al., 1993; Giridharan et al., 2005; Hoffmannt al., 2009; Marquardt et al., 1995; Meyer et al., 1991; Reid et al.,000; Rodriguez et al., 1994; Saiz et al., 2003).

In Vietnam, FMD is endemic and FMDV serotypes O, A, and Asia 1ave been fully documented as co-circulating serotypes since 1999Le et al., 2010a,b). Recent studies revealed that the viruses causinghe FMD outbreaks belonged to several distinct FMDV subtypes,ncluding topotype ME-SA (PanAsia), SEA, and Cathay of serotype, group IV and V of serotype Asia 1, and genotype IX (ASIA topo-

ype) of serotype A. Of these, the topotype Cathay/type O wasurrently rare whereas the topotype SEA/type O was the most com-on strains (Abdul-Hamid et al., 2011; Gleeson, 2002; Knowles

t al., 2005; Le et al., 2010a,b; Lee et al., 2011; Valarcher et al., 2009).n such a complicated situation of FMD outbreaks, it is necessary toave a molecular method for the rapid identification and differen-iation of FMDV serotypes circulating in the country when ongoingndemic outbreaks occur. It is also critical to speed up diagnosis inrder to select an appropriate emergency vaccine. In the presenttudy, a one-step multiplex RT-PCR method has been successfullyeveloped to simultaneously detect and differentiate VietnameseMDV serotypes O, A, and Asia 1 directly from clinical samples.

. Materials and methods

.1. Cells and virus samples

Six FMDV strains, including three vaccine strains of serotype(O1/Manisa; AJ251477), A (A22/Iraq; AY593762), and Asia(As1/Shamir/89; GU582125) and three pandemic strains of

erotype O (O/UKG/34/2001 and O/SKR/2000; AF377945) and Asia(Asia1/MOG/05; EF614458) were maintained in a IBRS-2 cell line

nd used as the reference strains for serotypes O, A, and Asia 1 dur-ng test optimization. Thirty-seven positive clinical samples and 18ell culture-adapted viruses belonging to serotypes O, A, and Asia, which were previously confirmed by antigen ELISA for FMDVetection (WRL Pirbright, UK), were used to evaluate the one-stepultiplex RT-PCR method. Virus samples were collected from FMD

ases in 17 different provinces in Vietnam (Fig. 1) and named basedn serotype; they were also assigned a country code, a labora-ory record number, and labeled with the year the sample wasollected (Table 1). Table 1 indicates the geographical origin, sam-ling date, host species, and laboratory designation of all samples.ther representative livestock viruses causing diseases with clin-

cal signs similar to FMD, including swine vesicular disease virusSVDV), bovine viral diarrhea virus (BVDV), the Indiana strain ofhe vesicular stomatitis virus (VSV), the New Jersey strain of theSV, and bovine herpes virus 1 (BHV-1, Oxford strain), were cho-en for use in order to test the specificity of reaction of the FMDirus serotype-specific primers.

.2. Oligonucleotide primers

The universal minus-sense primer (VN-VP1R) was designedrom the conserved 2B region based on the alignment of 50 com-lete genomic sequences of FMDV serotypes O, A, and Asia 1elected from the GenBank database. The three serotype-specificlus-sense primers (VN-OF, VN-As1F, and VN-AF) were designed

n the hypervariable regions of the capsid VP1 coding gene based

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

n the alignment of 44 VP1 gene sequences of Vietnamese FMDVerotypes O, A, and Asia 1 (Le et al., 2010a,b) selected from theenBank database (Fig. 2) (Hall, 1999). These primers were chosen

o be pooled as a primer mix for the one-step multiplex RT-PCR.

PRESSMethods xxx (2011) xxx–xxx

The serotype-specific primers form the basis of the RT-PCR typ-ing method, since they were chosen to produce a characteristicsegment length for each serotype (Fig. 3). The primers and theirsequences, location, and polarity are shown in Table 2. All theprimers were commercially synthesized by Bioneer Corporation,Republic of Korea.

2.3. RNA extraction and one-step RT-PCR to detect anddifferentiate FMDVs

FMDV single-stranded RNA (ssRNA) was extracted from clin-ical samples or from infected cell cultures using an RNeasy kit(Qiagen), according to the manufacturer’s protocol. The RNA pel-lets were resuspended in 20 �l of high quality deionized waterand then directly subjected to one-step multiplex RT-PCR using aMaxime one-tube RT-PCR kit (iNtRON Biotechnology). This RT-PCRkit was customized to contain optimal concentrations of the uni-versal primer VN-VP1R and three serotype-specific primers VN-OF,VN-As1F, and VN-AF (10 pM each), as well as all other componentsnecessary for cDNA synthesis in a single 0.2 ml tube. Each premixtube is preserved in a lyophilized form and thus can be easily usedby simply distributing 15 �l of DEPC-treated distilled water and5 �l of the RNA template. The lyophilized pellet in the tube wasdissolved by vortexing, followed by a brief spin. The one-step mul-tiplex RT-PCR was performed using a GeneAmp® PCR System 9700(AB Applied Biosystems) for an initial 30-min incubation at 42 ◦C,followed by 35 cycles of PCR (94 ◦C for 1 min, 52 ◦C for 1 min, and72 ◦C for 1 min) and a final 10-min incubation at 72 ◦C. The PCRresults were then analyzed by gel electrophoresis. A 5 �l aliquot ofthe total 20 �l PCR product was loaded onto a 1.5% (w/v) agarose gelprepared in tris–acetate–EDTA (TAE) buffer. A 1 Kb ladder (iNtRONBiotechnology) was run as a molecular weight marker. The PCRproducts were 658, 535, and 427 bp in length, corresponding toFMDV serotypes O, Asia 1, and A, respectively.

For comparison of the analytical sensitivity, another one-stepRT-PCR using Maxime one-tube RT-PCR kit (iNtRON Biotechnol-ogy), in which only our designed primers were replaced by previousreported primers 1F and 1R (10 pM for each) (Reid et al., 2000), wasused in parallel with our one-step multiplex RT-PCR product. TheRT-PCR using reported primers 1F and 1R was performed using aGeneAmp® PCR System 9700 (AB Applied Biosystems) for an ini-tial 30-min incubation at 45 ◦C, followed by 35 cycles of PCR (94 ◦Cfor 1 min, 55 ◦C for 1 min, and 72 ◦C for 1 min) and a final 10-minincubation at 72 ◦C. These validated 1F/1R primers were specificfor the 5′-UTR region and generated a 328-bp product regardless ofserotype (Reid et al., 2000).

2.4. Sequence analysis

PCR products were subjected to sequencing directly usinga BigDye terminator cycle sequencing kit (Applied Biosys-tems) and an automatic DNA sequencer (model 3730; AppliedBiosystems). The resultant gene sequences were assembled andaligned using the CLUSTAL X ver. 1.81 (Thompson et al., 1997)and MegAlign (DNASTAR, Madison, WI) against correspondingnucleotide sequences of representative FMDVs from the GenBankdatabase. The nucleotide sequences obtained in this study weredescribed in Table 1.

3. Results

3.1. One-step multiplex RT-PCR to detect and type FMDV

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

serotypes O, A, and Asia 1

One-step multiplex RT-PCR using the mixed primers of theconsensus primer VN-VP1R and three serotype-specific primers,

Please cite this article in press as: Le, V.P., et al., Development of one-step multiplex RT-PCR method for simultaneous detection and differentiationof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in Vietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

ARTICLE IN PRESSG Model

VIRMET-11539; No. of Pages 8

V.P. Le et al. / Journal of Virological Methods xxx (2011) xxx–xxx 3

Table 1Foot-and-mouth disease virus isolates used in this study.

No. Isolate Date of collection Geographic origin Species Type Topotype Accession no. Reference Notice

1 A22 Iraq 1964 Iraq Not known A Genotype IV AY593762 Carrillo et al. (2005) Vaccine strain2 A/VN/02/2009 9/01/2009 TT Hue/Vietnam Cattle A Genotype IX GQ406248 This work Isolate3 A/VN/03/2009 9/01/2009 TT Hue/Vietnam Cattle A Genotype IX GQ406249 This work Isolate4 A/VN/09/2009 6/02/2009 Quang Binh/Vietnam Cattle A Genotype IX GQ406247 This work Isolate5 A/VN/11/2009 6/02/2009 Quang Binh/Vietnam Cattle A Genotype IX GQ406250 This work Isolate6 A/VN/16/2009 17/02/2009 Phu Tho/Vietnam Pig A Genotype IX GQ406251 This work Isolate7 A/VN/20/2009 19/02/2009 Bac Can/Vietnam Buffalo A Genotype IX GQ406252 This work Isolate8 A/VN/04/2009 4/02/2009 Hoa Binh/Vietnam Buffalo A Genotype IX GU582083 This work Isolate9 A/VN/13/2009 16/02/2009 Bac Can/Vietnam Cattle A Genotype IX GU582084 This work Isolate

10 A/VN/130/2009 25/9/2009 Ha Giang/Vietnam Cattle A Genotype IX GU582085 This work Isolate11 A/VN/131/2009 25/9/2009 Ha Giang/Vietnam Cattle A Genotype IX GU582086 This work Isolate12 A/VN/89/2008 13/12/2008 Nghe An/Vietnam Buffalo A Genotype IX GU582087 This work Clinical sample13 A/VN/90/2008 13/12/2008 Nghe An/Vietnam Buffalo A Genotype IX GU582088 This work Clinical sample14 A/VN/91/2008 13/12/2008 Nghe An/Vietnam Cattle A Genotype IX GU582089 This work Clinical sample15 A/VN/93/2008 13/12/2008 Nghe An/Vietnam Buffalo A Genotype IX GU582090 This work Clinical sample16 A/VN/14/2009 16/02/2009 Bac Can/Vietnam Buffalo A Genotype IX GU582091 This work Clinical sample17 A/VN/15 2009 17/2/2009 Phu Tho/Vietnam Buffalo A Genotype IX GU582092 This work Clinical sample18 A/VN/22/2009 28/2/2009 Quang Tri/Vietnam Buffalo A Genotype IX GU582093 This work Clinical sample19 O1/Manisa 4/1969 Turkey Cattle O ME-SA AJ251477 Knowles et al.

(2005)Vaccine strain

20 O/UKG/34/2001 2001 United Kingdom Pig O ME-SA Unsubmitted Alexandersen andDonaldson. (2002)

Pandemic strain

21 O/SKR/2000 2000 South Korea Cattle O ME-SA AF377945 Kweon et al. (2002) Pandemic strain22 ThuaThienHue/VIT/07 2007 T T Hue/Vietnam Pig O Cathay GQ855803 Lee et al. (2011) Clinical sample23 O/VN/TN85/2006 06/10/2006 Thai Nguyen/Vietnam Buffalo O SEA GU582094 This work Clinical sample24 O/VN/HN18/2006 04/08/2006 Ha Noi/Vietnam Cattle O SEA GU582095 This work Clinical sample25 O/VN/VP38/2006 27/06/2006 Vinh Phuc/Vietnam Buffalo O SEA GU582096 This work Clinical sample26 O/VN/SL07/2006 20/10/2006 Son La/Vietnam Cattle O SEA GU582097 This work Clinical sample27 O/VN/SL622/2006 28/10/2006 Son La/Vietnam Buffalo O SEA GU582098 This work Clinical sample28 O/VN/TN75/2006 10/07/2006 Thai Nguyen/Vietnam Cattle O SEA GU582099 This work Clinical sample29 O/VN/SL12/2006 25/10/2006 Son La/Vietnam Cattle O SEA GU582100 This work Clinical sample30 O/VN/SL601/2006 17/10/2006 Son La/Vietnam Pig O SEA GU582101 This work Clinical sample31 O/VN/LS91/2006 12/10/2006 Lang Son/Vietnam Cattle O SEA GU582102 This work Clinical sample32 O/VN/HN83/2006 11/10/2006 Ha Noi/Vietnam Pig O SEA GU582103 This work Clinical sample33 O/VN/LS08/2006 20/10/2006 Lang Son/Vietnam Pig O SEA GU582105 This work Clinical sample34 O/VN/GL13/2006 4/2006 Gia Lai/Vietnam Cattle O SEA GU125650 This work Clinical sample35 O/VN/LC039/2007 19/01/2007 Lai Chau/Vietnam Buffalo O SEA GU582110 This work Clinical sample36 O/VN/TN125/2007 21/04/2007 Thai Nguyen/Vietnam Cattle O SEA GU582111 This work Clinical sample37 O/VN/TN089/2007 13/02/2007 Thai Nguyen/Vietnam Cattle O SEA GU582112 This work Clinical sample38 O/VN/HT016/2007 27/12/2007 Ha Tinh/Vietnam Cattle O SEA GU582113 This work Clinical sample39 O/VN/NA79/2009 9/7/2009 Nghe An/Vietnam Cattle O SEA GU582114 This work Isolate40 O/VN/QB88/2009 9/11/2009 Quang Binh/Vietnam Cattle O SEA GU582115 This work Isolate41 O/VN/YB105/2009 17/9/2009 Yen Bai/Vietnam Buffalo O SEA GU582116 This work Isolate42 O/VN/YB106/2009 17/9/2009 Yen Bai/Vietnam Buffalo O SEA GU582117 This work Isolate43 O/VN/SL109/2009 18/9/2009 Son La/Vietnam Buffalo O SEA GU582118 This work Isolate44 O/VN/HG128/2009 25/9/2009 Ha Giang/Vietnam Cattle O SEA GU582119 This work Isolate45 O/VN/QN132/2009 10/01/2009 Quang Ninh/Vietnam Buffalo O SEA GU582120 This work Clinical sample46 O/VN/QN133/2009 10/01/2009 Quang Ninh/Vietnam Buffalo O SEA GU582121 This work Clinical sample47 O/VN/HB138/2009 10/01/2009 Hoa Binh/Vietnam Buffalo O SEA GU582122 This work Clinical sample48 O/VN/SL01/2010 2/2010 Son La/Vietnam Buffalo O SEA HQ260713 This work Clinical sample49 O/VN/SL02/2010 2/2010 Son La/Vietnam Buffalo O SEA HQ260714 This work Clinical sample50 O/VN/LC03/2010 2/2010 Lao Cai/Vietnam Buffalo O SEA HQ260715 This work Clinical sample51 O/VN/DB04/2010 2/2010 Dien Bien/Vietnam Cattle O SEA HQ260716 This work Clinical sample52 O/VN/TQ06/2010 2/2010 Tuyen Quang/Vietnam Buffalo O SEA HQ260717 This work Clinical sample53 O/VN/YB08/2010 2/2010 Yen Bai/Vietnam Cattle O SEA HQ260718 This work Clinical sample54 O/VN/YB09/2010 2/2010 Yen Bai/Vietnam Cattle O SEA HQ260719 This work Clinical sample55 O/VN/YB10/2010 2/2010 Yen Bai/Vietnam Buffalo O SEA HQ260720 This work Clinical sample56 Asia1/MOG/05 2005 Mongolia Cattle Asia 1 Group V EF614458 Lee et al. (2009) Pandemic strain57 As1/Shamir/89 1989 Israel Unknown Asia 1 Group III GU582125 Marquardt et al.

(2000)Vaccine strain

58 Asia1/VN/LC04/2005 10/2005 Lao Cai/Vietnam Buffalo Asia 1 Group IV GU125646 This work Isolate59 Asia1/VN/QT03/2007 6/2007 Quang Tri/Vietnam Cattle Asia 1 Group V GU125645 This work Isolate60 Asia1/VN/QT466/2007 16/06/2007 Quang Tri/Vietnam Pig Asia 1 Group V GU582123 This work Clinical sample61 Asia1/VN/QT523/2007 29/06/2007 Quang Tri/Vietnam Cattle Asia 1 Group V GU582124 This work Clinical sample

Table 2Oligonucleotide primers for one-step multiplex RT-PCR method.

Primer Sequence (5′–3′) Sense Gene Locationa FMDV serotype

VN-VP1R CATGTCYTCYTGCATCTGGTT − 2B 58–78 O, A, Asia1VN-OF AGATTTGTGAAAGTDACACCA + 1D 112–132 OVN-As1F GCGSTHRYYCACACAGGYCCGG + 1D 235–256 Asia 1VN-AF CTTGCACTCCCTTACACCGCG + 1D 343–363 A

a The sequence position calculated from the first nucleotide of 1D and 2B gene in reference to the FMDV strain A/VN/09/2009 (GenBank accession no. GQ406247).

ARTICLE IN PRESSG Model

VIRMET-11539; No. of Pages 8

4 V.P. Le et al. / Journal of Virological Methods xxx (2011) xxx–xxx

F s werfi

Vd1eoatAy5t(

abtfp

ig. 1. Map of Vietnam showing the provinces (red) from which the FMDV isolategure legend, the reader is referred to the web version of the article.)

N-OF, VN-AF, and VN-As1F, has been developed to rapidlyiagnose and type Vietnamese FMDV serotypes O, A, and Asia

(Fig. 3). To evaluate this, the FMDV ssRNAs of six refer-nce strains, including the three vaccine strains, were used. Thene-step multiplex RT-PCR could reliably amplify and differenti-te the six well-characterized reference FMDV strains belongingo serotypes O (O1/Manisa, O/UKG/34/2001, and O/SKR/2000),sia 1 (As1/Shamir/89 and Asia1/MOG/05), and A (A22/Iraq) andielded distinct PCR products of the expected lengths of 658,35, and 427 bp for FMDV serotypes O, Asia 1, and A, respec-ively. No non-specific reactions or cross amplifications occurredFig. 4).

To determine the limits of detection, the virus titration usingseries of 10-fold dilutions were performed on IBRS-2 cells and

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

y one-step multiplex RT-PCR simultaneously. The result showedhat the one-step multiplex RT-PCR could amplify a specific productrom the FMDV samples prepared with 102.5, 103.5, and 101.5 TCID50er ml corresponding to FMDV strains of O1/Manisa (serotype

e collected during outbreaks. (For interpretation of the references to color in this

O), As1/Shamir/89 (serotype Asia 1), and A22/Iraq (serotype A),respectively (Fig. 5B of I, II, and III). For the analytical sensitivitycomparison, the results showed that the sensitivity of referenceprimers 1F/1R (101.5 TCID50/ml) (Reid et al., 2000) was 100 timeshigher than that of our designed primers (103.5 TCID50/ml) for thedetection of serotype Asia 1 (As1/Shamir/89) (Fig. 5A and B of II),but in the case of serotype A (A22/Iraq), the detection limit of ref-erence primers 1F/1R (103.5 TCID50/ml) was 100 times lower thanthat of our designed primers (101.5 TCID50/ml) (Fig. 5A and B ofIII). For serotype O (O1/Manisa), both primer sets showed similarsensitivity (102.5 TCID50/ml) (Fig. 5A and B of I). The use of this one-step multiplex RT-PCR has the advantage of rapidly diagnosing andtyping Vietnamese FMDV serotypes O, A, and Asia 1 in one PCRreaction.

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

Detecting FMD generally requires differentiation from othervesicular diseases. In this study, none of the serotype-specificprimers recognized the other representative vesicular disease viralpathogens, such as BVDV, SVDV, VSV, or BHV-1 (Fig. 6).

ARTICLE IN PRESSG Model

VIRMET-11539; No. of Pages 8

V.P. Le et al. / Journal of Virological Methods xxx (2011) xxx–xxx 5

F ositioV s seq

3

uc

ig. 2. Alignment of gene sequences of FMDV serotypes O, A, and Asia 1 shows the pN-OF, VN-As1F, and VN-AF. Dot (.) indicates nucleotide identity with the consensu

.2. Field FMDV diagnosis and typing application

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

The present one-step multiplex RT-PCR method was evaluatedsing the FMDV ssRNAs of 37 positive clinical samples and 18 cellulture-adapted viruses obtained from the first passage on IBRS-2

n of universal VN-VP1R primer and three serotype O, A, and Asia 1-specific primersuence.

cells. Of the 55 positive samples previously confirmed by anti-

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

gen ELISA for FMDV detection (WRL Pirbright, UK), 17 belongedto FMDV serotype A, 34 to serotype O, and 4 to serotype Asia1 (Table 1). All samples were collected from FMD cases in 17provinces in northern and central Vietnam (Fig. 1). The RT-PCR

ARTICLE IN PRESSG Model

VIRMET-11539; No. of Pages 8

6 V.P. Le et al. / Journal of Virological Methods xxx (2011) xxx–xxx

F of ona he size

ciOa

3

utAaTaOSbAfi(es

Fsio3An

ig. 3. Genome layout of FMDV. The schematic shows the positions and directionsnd three serotype O, A, and Asia 1-specific primers VN-OF, VN-As1F, and VN-AF. T

learly detected and differentiated all 55 FMDV samples, yield-ng the expected 658, 535, and 427 bp PCR products for serotypes, Asia 1, and A, respectively. No non-specific reactions or crossmplifications were observed in the assay (data not shown).

.3. Confirmation of RT-PCR products by gene sequencing

To confirm the specificity of the one-step multiplex RT-PCRsing mixed primers (VN-OF, VN-AF, VN-As1F, and VN-VP1R) forhe simultaneous detection and typing of FMDV serotypes O, A, andsia 1, all amplified DNA fragments were directly sequenced usingn automatic DNA sequencer (model 3730; Applied Biosystems).he obtained nucleotide sequences were then genetically analyzednd showed that the reference FMDV strains of the O1/Manisa,/UKG/34/2001, and O/SKR/2000 all belonged to topotype ME-A of serotype O, the As1/Shamir/89 and Asia1/MOG/05 strainselonged to group III and V, respectively, of serotype Asia 1, and the22/Iraq strain was of genotype IV of serotype A. For Vietnameseeld strains, all 17 strains of serotype A belonged to genotype IXASIA topotype), 34 strains of serotype O belonged to topotype SEAxcept for one strain belonged to topotype Cathay, and 4 strains of

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

erotype Asia 1 belonged to two groups IV and V (Table 1).

ig. 4. One-step multiplex RT-PCR using a cocktail of universal primer VN-VP1R anderotype-specific primers VN-OF, VN-AF, and VN-As1F for direct detection and typ-ng of FMDVs based on the extracted RNAs of the reference strains. Lane 1: a mixturef the PCR products of serotype O, A, and Asia 1; lane 2: O1/Manisa (AJ251477); lane: O/SKR/2000 (AF377945); lane 4: O/UKG/34/2001; lane 5: As1/Shamir/89; lane 6:sia1/MOG/05 (EF614458); lane 7: A22/Iraq (AY593762); lane 8: uninfected cells asegative control. M: 1Kb DNA ladder (INtRON Biotechnology).

e-step multiplex RT-PCR method using a cocktail of a consensus VN-VP1R primers of the expected products of amplification are also shown.

4. Discussion

Multiplex RT-PCR methods using type-specific primers havebeen developed for differentiation of FMDVs (Callens and De Clercq,1997; Giridharan et al., 2005; Rodriguez et al., 1992; Vangrysperreand De Clercq, 1996), but these methods have been shown to beless efficient on clinical samples (Reid et al., 1999). In the presentstudy, the one-step multiplex RT-PCR method using a new cocktailof custom-designed primers has been developed and successfullyapplied for the rapid detection and typing of Vietnamese FMDVserotypes O, A, and Asia 1 directly from clinical samples. Thewhole process, from RNA extraction to RT-PCR to completing theagarose gel electrophoresis, can be performed in approximately 3 h.The specificity and speed of this method makes it a suitable testfor detecting and typing FMDVs and for epidemiological surveil-lance in Vietnam. In this work, six well-characterized FMDV strainshave been used as reference strains for validation tests. Of these,three are vaccine strains for type O (O1/Manisa), A (A22/Iraq), andAsia 1 (As1/Shamir/89) (Carrillo et al., 2005; Knowles et al., 2005;Marquardt et al., 2000). The other reference strains include one pan-demic strain of FMDV serotype Asia 1 (Asia1/MOG/05) that causedFMD outbreaks in early 2005 in China, Russia, Mongolia, and inNorth Korea in 2007 (Guo et al., 2006; Lee et al., 2009; Sakamotoand Yoshida, 2002; Valarcher et al., 2005, 2009) and two FMDVpandemic strains (O/UKG/34/2001 and O/SKR/2000) (Alexandersenand Donaldson, 2002; Kweon et al., 2002) of serotype O that wereresponsible for the explosive FMD outbreaks occurring between1998 and 2001 in the Republic of Korea, Japan, Russia, Mongolia,South Africa, the United Kingdom, the Republic of Ireland, France,and the Netherlands (Knowles et al., 2005). The present one-stepmultiplex RT-PCR method could detect and differentiate reliablyall six reference strains. Interestingly, it has also been success-fully used to diagnose and differentiate the FMDV serotypes Oand A isolated from the most recent FMD outbreaks between Jan-uary and May, 2010 in South Korea. These Korean FMDV serotypesA and O belonged to genetic genotype IX and topotype SEA,respectively (www.wrlfmd.org).In the present study, because ofthe limited number of representative strains for different FMDVserotypes/subtypes available, only viruses belonging to topotypeME-SA, Cathay (CHY), and SEA of serotype O, group III, IV and V ofserotype Asia 1, and genotype IV and IX of serotype A were testedwith the current one-step multiplex RT-PCR. Further studies shouldbe done with more representative subtypes of FMDV serotypes O,A, and Asia 1, especially Cathay topotype of serotype O, in order todetermine detection limits of this assay.

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

In Southeast Asia, FMD is endemic in Cambodia, Laos, Malaysia,Myanmar, the Philippines, Thailand, and Vietnam. The closelyrelated FMDV serotypes O, A, and Asia 1 have been reported asco-circulating in these countries in recent years (Abdul-Hamid

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

ARTICLE IN PRESSG Model

VIRMET-11539; No. of Pages 8

V.P. Le et al. / Journal of Virological Methods xxx (2011) xxx–xxx 7

Fig. 5. Comparison of detection limits of one-step RT-PCR using reference primers 1F/1R (A) (Reid et al., 2000) and serotype O, A, and Asia 1-specific primers (B) on FMDVstrains of O1/Manisa (I), As1/Shamir/89 (II), and A22/Iraq (III). Numerical at the top indicates infectious titer (TCID50/ml) of the virus dilutions used for RNA extraction. N:uninfected cells as negative control. M: 1 Kb Plus DNA Ladder (Invitrogen).

Fig. 6. Specificity of the one-step multiplex RT-PCR using a cocktail of universalprimer VN-VP1R and serotype-specific primers VN-OF, VN-AF, and VN-As1F forsimultaneous detection and differentiation of FMDV serotypes O, A, and Asia 1. Lane1–3: three vaccine strains for type O (O1/Manisa), Asia 1 (As1/Shamir/89), and A(A22/Iraq) were used as the positive controls, respectively. Lane 4–8: four relatedvesicular viruses including swine vesicular disease virus (SVDV), bovine viral diar-rhea virus (BVDV), vesicular stomatitis virus Indiana strain and vesicular stomatitisvirus New Jersey strain (VSV), and bovine herpes virus 1 (BHV-1). M: 1 Kb DNA ladder(INtRON Biotechnology).

et al., 2011; Gleeson, 2002; Knowles et al., 2005; Le et al.,2010a,b; Valarcher et al., 2009). Therefore, the one-step multi-plex RT-PCR method described in this study may be applicablefor FMDV diagnosis in these countries. The present study sup-ports the previous reports that RT-PCR is a simple and rapiddiagnostic method for detecting suspect samples and for differ-entiating FMD serotypes (Bao et al., 2008; Callens and De Clercq,1997; Giridharan et al., 2005; Reid et al., 2000). Four other FMDVserotypes (C, SAT 1–3) were not considered when the primersdescribed above were designed because these types have not yetbeen found in Vietnam. However, they should be considered in thefuture.

For an effective diagnostic test, sensitivity and specificity arevery important. Many factors, such as specific primers, PCR-relatedreagents and conditions, quality of samples, virus strains used,can influence the sensitivity of the RT-PCR (Reid et al., 1998). Thedetection limits of PCR for FMDV detection have been described inseveral previous reports and it was shown that the sensitivity ofthe PCR, depending on different primer pairs used, varied between0.01 TCID50 to 104 TCID50 (Amaral-Doel et al., 1993; Clavijo et al.,2003; Giridharan et al., 2005; House and Meyer, 1993; Meyer et al.,

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

1991; Rodriguez et al., 1994). In this report, the limits of FMDVdetection of one-step multiplex RT-PCR using the new primersvaried between 101.5 and 103.5 TCID50/ml, it was most sensitivefor serotypes A (A22/Iraq), followed by serotype O (O1/Manisa),

ING Model

V

8 ogical

apv

A

tRtVowaVo

R

A

A

A

A

B

C

C

C

F

G

G

G

H

H

H

K

ARTICLEIRMET-11539; No. of Pages 8

V.P. Le et al. / Journal of Virol

nd Asia 1 (As1/Shamir/89). In terms of specificity of the test, theresent one-step RT-PCR did not amplify other vesicular diseaseiral pathogens such as BVDV, SVDV, VSV, and BHV-1.

cknowledgements

The authors acknowledge the contribution of colleagues athe Foreign Animal Disease Division of the National Veterinaryesearch and Quarantine Service, South Korea, the National Cen-er for Veterinary Diagnosis of the Department of Animal Health,ietnam, and the Laboratory of Molecular Microbiology, Institutef Biotechnology, Vietnam Academy of Science & Technology. Thisork was supported by the National Veterinary Research and Quar-

ntine Service, Anyang, Gyeonggi, Republic of Korea and by theietnam’s National Foundation for Science and Technology Devel-pment (NAFOSTED) under grant number 106.05-2010.39.

eferences

bdul-Hamid, N.F., Hussein, N.M., Wadsworth, J., Radford, A.D., Knowles, N.J., King,D.P., 2011. Phylogeography of foot-and-mouth disease virus types O and A inMalaysia and surrounding countries. Infect. Genet. Evol. 11, 320–328.

lexandersen, S., Donaldson, A.I., 2002. Further studies to quantify the dose of nat-ural aerosols of foot-and-mouth disease virus for pigs. Epidemiol. Infect. 128,313–323.

lexandersen, S., Zhang, Z., Donaldson, A.I., Garland, A.J., 2003. The pathogenesis anddiagnosis of foot-and-mouth disease. J. Comp. Pathol. 129, 1–36.

maral-Doel, C.M., Owen, N.E., Ferris, N.P., Kitching, R.P., Doel, T.R., 1993. Detec-tion of foot-and-mouth disease viral sequences in clinical specimens andethyleneimine-inactivated preparations by the polymerase chain reaction. Vac-cine 11, 415–421.

ao, H.F., Li, D., Guo, J.H., Lu, Z.J., Chen, Y.L., Liu, Z.X., Liu, X.T., Xie, Q.G., 2008. A highlysensitive and specific multiplex RT-PCR to detect foot-and-mouth disease virusin tissue and food samples. Arch. Virol. 153, 205–209.

allens, M., De Clercq, K., 1997. Differentiation of the seven serotypes of foot-and-mouth disease virus by reverse transcriptase polymerase chain reaction. J. Virol.Methods 67, 35–44.

arrillo, C., Tulman, E.R., Delhon, G., Lu, Z., Carreno, A., Vagnozzi, A., Kutish, G.F., Rock,D.L., 2005. Comparative genomics of foot-and-mouth disease virus. J. Virol. 79,6487–6504.

lavijo, A., Viera-Pereira, P.J., Bergmann, I., 2003. Use of the reverse transcriptionpolymerase chain reaction (RT-PCR) for the rapid diagnosis of foot and mouthdisease in South America. Vet. Res. Commun. 27, 63–71.

erris, N.P., Dawson, M., 1988. Routine application of enzyme-linked immunosor-bent assay in comparison with complement fixation for the diagnosis offoot-and-mouth and swine vesicular diseases. Vet. Microbiol. 16, 201–209.

iridharan, P., Hemadri, D., Tosh, C., Sanyal, A., Bandyopadhyay, S.K., 2005. Develop-ment and evaluation of a multiplex PCR for differentiation of foot-and-mouthdisease virus strains native to India. J. Virol. Methods 126, 1–11.

leeson, L.J., 2002. A review of the status of foot and mouth disease in South-EastAsia and approaches to control and eradication. Rev. Sci. Tech. 21, 465–475.

uo, H., Liu, X., Liu, Z., Yin, H., Ma, J., Wang, Y., Shang, Y., Zhang, Q., Li, D., Guo, J.,Lu, Z., Xie, Q., 2006. Recent outbreaks of foot-and-mouth disease type Asia 1 inChina. J. Vet. Med. B: Infect. Dis. Vet. Public Health 53, 29–33.

all, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

offmann, B., Beer, M., Reid, S.M., Mertens, P., Oura, C.A., van Rijn, P.A., Slomka,M.J., Banks, J., Brown, I.H., Alexander, D.J., King, D.P., 2009. A review of RT-PCRtechnologies used in veterinary virology and disease control: sensitive and spe-cific diagnosis of five livestock diseases notifiable to the World Organisation forAnimal Health. Vet. Microbiol. 139, 1–23.

Please cite this article in press as: Le, V.P., et al., Development of one-step muof foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in V

ouse, C., Meyer, R.F., 1993. The detection of foot-and-mouth disease virus inoesophageal-pharyngeal samples by a polymerase chain reaction technique. J.Virol. Methods 43, 1–6.

itching, R.P., 2005. Global epidemiology and prospects for control of foot-and-mouth disease. Curr. Top. Microbiol. Immunol. 288, 133–148.

PRESSMethods xxx (2011) xxx–xxx

Kitching, R.P., Knowles, N.J., Samuel, A.R., Donaldson, A.I., 1989. Development of foot-and-mouth disease virus strain characterisation—a review. Trop. Anim. HealthProd. 21, 153–166.

Knowles, N.J., Samuel, A.R., Davies, P.R., Midgley, R.J., Valarcher, J.F., 2005. Pan-demic strain of foot-and-mouth disease virus serotype O. Emerg. Infect. Dis.11, 1887–1893.

Kweon, C.H., Ko, Y.J., Kim, W.I., Kwon, B.J., Hyun, B.H., Sohn, H.J., Choi, K.S., Shin, J.H.,2002. Molecular characterization of foot-and-mouth disease virus O/SKR/2000.Virus Res. 90, 15–22.

Le, V.P., Nguyen, T., Lee, K.N., Ko, Y.J., Lee, H.S., Nguyen, V.C., Mai, T.D., Do, T.H., Kim,S.M., Cho, I.S., Park, J.H., 2010a. Molecular characterization of serotype A foot-and-mouth disease viruses circulating in Vietnam in 2009. Vet. Microbiol. 144,58–66.

Le, V.P., Nguyen, T., Park, J.H., Kim, S.M., Ko, Y.J., Lee, H.S., Nguyen, V.C., Mai, T.D., Do,T.H., Cho, I.S., Lee, K.N., 2010b. Heterogeneity and genetic variations of serotypesO and Asia 1 foot-and-mouth disease viruses isolated in Vietnam. Vet. Microbiol.145, 220–229.

Lee, K.N., Nguyen, T., Kim, S.M., Park, J.H., Do, H.T., Ngo, H.T., Mai, D.T., Lee, S.Y.,Nguyen, C.V., Yoon, S.H., Kweon, C.H., Cho, I.S., Kim, H., 2011. Direct typingand molecular evolutionary analysis of field samples of foot-and-mouth dis-ease virus collected in Viet Nam between 2006 and 2007. Vet. Microbiol. 147,244–252.

Lee, K.N., Oem, J.K., Park, J.H., Kim, S.M., Lee, S.Y., Tserendorj, S., Sodnomdarjaa, R., Joo,Y.S., Kim, H., 2009. Evidence of recombination in a new isolate of foot-and-mouthdisease virus serotype Asia 1. Virus Res. 139, 117–121.

Marquardt, O., Rahman, M.M., Freiberg, B., 2000. Genetic and antigenic variance offoot-and-mouth disease virus type Asia1. Arch. Virol. 145, 149–157.

Marquardt, O., Straub, O.C., Ahl, R., Haas, B., 1995. Detection of foot-and-mouth dis-ease virus in nasal swabs of asymptomatic cattle by RT-PCR within 24 hours. J.Virol. Methods 53, 255–261.

Meyer, R.F, Brown, C.C., House, C., House, J.A., Molitor, T.W., 1991. Rapid and sen-sitive detection of foot-and-mouth disease virus in tissues by enzymatic RNAamplification of the polymerase gene. J. Virol. Methods 34, 161–172.

Reid, S.M., Ferris, N.P., Hutchings, G.H., Samuel, A.R., Knowles, N.J., 2000. Primarydiagnosis of foot-and-mouth disease by reverse transcription polymerase chainreaction. J. Virol. Methods 89, 167–176.

Reid, S.M., Forsyth, M.A., Hutchings, G.H., Ferris, N.P., 1998. Comparison of reversetranscription polymerase chain reaction, enzyme linked immunosorbent assayand virus isolation for the routine diagnosis of foot-and-mouth disease. J. Virol.Methods 70, 213–217.

Reid, S.M., Hutchings, G.H., Ferris, N.P., De Clercq, K., 1999. Diagnosis of foot-and-mouth disease by RT-PCR: evaluation of primers for serotypic characterisationof viral RNA in clinical samples. J. Virol. Methods 83, 113–123.

Rodriguez, A., Martinez-Salas, E., Dopazo, J., Davila, M., Saiz, J.C., Sobrino, F., 1992.Primer design for specific diagnosis by PCR of highly variable RNA viruses: typingof foot-and-mouth disease virus. Virology 189, 363–367.

Rodriguez, A., Nunez, J.I., Nolasco, G., Ponz, F., Sobrino, F., de Blas, C., 1994. DirectPCR detection of foot-and-mouth disease virus. J. Virol. Methods 47, 345–349.

Saiz, M., De La Morena, D.B., Blanco, E., Nunez, J.I., Fernandez, R., Sanchez-Vizcaino,J.M., 2003. Detection of foot-and-mouth disease virus from culture and clin-ical samples by reverse transcription-PCR coupled to restriction enzyme andsequence analysis. Vet. Res. 34, 105–117.

Sakamoto, K., Yoshida, K., 2002. Recent outbreaks of foot and mouth disease incountries of east Asia. Rev. Sci. Tech. 21, 459–463.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. TheCLUSTAL X windows interface: flexible strategies for multiple sequence align-ment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Tosh, C., Sanyal, A., Hemadri, D., Venkataramanan, R., 2002. Phylogenetic analysisof serotype A foot-and-mouth disease virus isolated in India between 1977 and2000. Arch. Virol. 147, 493–513.

Valarcher, J.F., Knowles, N.J., Ferris, N.P., Paton, D.J., Zakharov, V., Sherbakov, A.,Shang, Y.J., Liu, Z.X., Liu, X.T., Sanyal, A., Hemadri, D., Tosh, C., Rasool, T.J., 2005.Recent spread of FMD virus serotype Asia 1. Vet. Rec. 157, 30.

Valarcher, J.F., Knowles, N.J., Zakharov, V., Scherbakov, A., Zhang, Z., Shang, Y.J., Liu,Z.X., Liu, X.T., Sanyal, A., Hemadri, D., Tosh, C., Rasool, T.J., Pattnaik, B., Schu-mann, K.R., Beckham, T.R., Linchongsubongkoch, W., Ferris, N.P., Roeder, P.L.,Paton, D.J., 2009. Multiple origins of foot-and-mouth disease virus serotype Asia1 outbreaks, 2003–2007. Emerg. Infect. Dis. 15, 1046–1051.

ltiplex RT-PCR method for simultaneous detection and differentiationietnam. J. Virol. Methods (2011), doi:10.1016/j.jviromet.2011.04.027

Vangrysperre, W., De Clercq, K., 1996. Rapid and sensitive polymerase chain reactionbased detection and typing of foot-and-mouth disease virus in clinical sam-ples and cell culture isolates, combined with a simultaneous differentiationwith other genomically and/or symptomatically related viruses. Arch. Virol. 141,331–344.