Molecular Cell, Vol. 10, 175–186, July, 2002, Copyright 2002 by Cell Press

Multiple Mitochondrial DNA Polymerasesin Trypanosoma brucei

(Li and Englund, 1997), topoisomerase II (topo II) (Mel-endy and Ray, 1989), and structure-specific endonucle-ase (SSE1, which has RNase H activity) (Engel and Ray,

Michele M. Klingbeil, Shawn A. Motyka,and Paul T. Englund1

Department of Biological ChemistryJohns Hopkins Medical School 1998). Surprisingly, the only known kinetoplastid mito-

chondrial DNA polymerase (pol) is a pol �. This abundantBaltimore, Maryland 21205enzyme is 33% identical to mammalian pol � (Torri andEnglund, 1995), an enzyme involved in nuclear baseexcision repair. The C. fasciculata enzyme was the firstSummaryexample of a pol � found in mitochondria and is thoughtto play a role in gap filling during minicircle replicationKinetoplast DNA (kDNA), the unusual mitochondrial(Torri et al., 1994). No proofreading replicative mitochon-DNA of Trypanosoma brucei, is a network containingdrial polymerase has been identified from kinetoplastidsthousands of catenated circles. Database searchingor any other protozoan.for a kDNA replicative polymerase (pol) revealed no

A notable feature of trypanosomes is that their mito-mitochondrial pol � homolog. Instead, we identifiedchondrial replication proteins are situated in specificfour proteins (TbPOLIA, IB, IC, and ID) related to bacte-regions surrounding the kDNA disk. Topo II (Melendy etrial pol I. Remarkably, all four localized to the mito-al., 1988), pol � (Ferguson et al., 1992), and SSE1 (Engelchondrion. TbPOLIB and TbPOLIC localized beside theand Ray, 1999) localize in two antipodal sites flankingkDNA where replication occurs, and their knockdownthe kDNA disk. In contrast, UMSBP (Abu-Elneel et al.,by RNA interference caused kDNA network shrinkage.2001) and primase (Li and Englund, 1997) are found inFurthermore, silencing of TbPOLIC caused loss of both

minicircles and maxicircles and accumulation of mini- the kinetoflagellar zone (KFZ), a region of the mitochon-circle replication intermediates, consistent with a role drial matrix between the face of the kDNA disk and thein replication. While typical mitochondria contain one membrane nearest the flagellar basal body. The KFZ isDNA polymerase, pol �, trypanosome mitochondria important because kDNA replication involves the vecto-contain five such enzymes, including the previously rial release of minicircles from the network into this zonecharacterized pol �. where DNA synthesis initiates (Drew and Englund, 2001).

Along with UMSBP and primase, a replicative polymer-Introduction ase for minicircles is likely to be found in this region. As

replication proceeds (and may even be completed) in theKinetoplastid protozoa include parasites that cause KFZ, the advanced replication intermediates (or progenytropical diseases. They are also important as one of molecules) migrate to the antipodal sites where SSE1the earliest diverging eukaryotic groups that contain a and pol � presumably remove primers and fill most ofmitochondrion (Sogin and Silberman, 1998). Given their the gaps. The progeny are then attached to the networkphylogenetic distance from higher eukaryotes, it is not periphery by topo II (Wang and Englund, 2001).surprising that kinetoplastids display unusual biological We expected that a kDNA replicative pol would beproperties. One example is their unique mitochondrial related to pol �, the only one of at least 19 eukaryoticDNA, known as kinetoplast DNA (kDNA), which is com- DNA pols implicated in mitochondrial replicationposed of several thousand DNA circles catenated into (Hubscher et al., 2002). Pol � is a family A DNA polymer-a single network. The network is condensed into a disk- ase, a group including bacterial pol I, the phage T7shaped structure in the matrix of the cell’s single mito- polymerase, and eukaryotic pol �. Although these pro-chondrion near the flagellar basal body. In Trypanosoma teins have diverse roles such as gap filling and primerbrucei, the parasite causing African sleeping sickness, removal, replication of mitochondrial and phage DNA,the kDNA network contains several dozen maxicircles and DNA repair, all contain the conserved family signa-(23 kb) and several thousand minicircles (1 kb). Maxicir- ture, the pol A domain, in the C-terminal region.cles resemble other mitochondrial DNAs in that they We made major efforts to identify a kDNA replicativeencode rRNAs and a few proteins including subunits of polymerase in trypanosomes. Initial attempts, involvingrespiratory complexes. Minicircles encode guide RNAs fractionation of C. fasciculata mitochondrial extracts orthat control editing of maxicircle transcripts, a process PCR using degenerate primers, were unsuccessful ininvolving insertion or deletion of uridine residues to form identifying a putative pol �. We then turned to a geno-an open reading frame (Estevez and Simpson, 1999). mics approach, searching for candidate pol genes in

The structural complexity of kDNA dictates an unusual the T. brucei genome databases. Searches for a pol �replication mechanism (reviewed in Klingbeil et al., homolog revealed no candidates, consistent with our2001). Much of our knowledge regarding the replication PCR results. Instead, we found multiple sequence frag-process has come from studying kDNA replication pro- ments related to bacterial pol I. This observation led toteins purified from a related parasite, Crithidia fascicu- our characterization of a pol I-like gene family. T. bruceilata. These proteins include universal minicircle se- has four genes that are members of this family, andquence binding protein (UMSBP, which binds the remarkably all four produce proteins that localize to theminicircle replication origin) (Tzfati et al., 1995), primase mitochondrion. As for the functions of the multiple mito-

chondrial polymerases, we provide genetic evidencethat at least one, which we showed to be enzymatically1Correspondence: penglund@jhmi.edu

Molecular Cell176

Figure 1. Domain Organization of SelectedFamily A DNA Polymerases

Domains were identified using the Pfam data-base (accession numbers are in parenthe-ses). POL A, family A pol domain (PF00476);5� EXO, 5� exonuclease (PF02739); 3� EXO(Ellipse), 3� exonuclease (PF01612); 3� EXO(Hexagon), 3� exonuclease (PF00929); Heli-case, DEAX box helicase domain (PF00270);C, helicase C-terminal domain (PF00271). Se-quences are grouped by ascribed and pre-sumed functions. Abbreviations: T5, Bacte-riophage T5; Ec, Escherichia coli; Dm,Drosophila melanogaster; Hs, Homo sapiens;Tp, Treponema pallidum; and Tb, T. brucei.

active, is involved in kDNA replication. Together with cant similarity only in the C-terminal pol domain (theT. brucei pol domains are 25%–35% identical to theirthe previously characterized pol �, there are at least five

DNA polymerases in trypanosome mitochondria. prokaryotic counterparts). The pol domain of TbPOLIAis most similar to that of Thermus thermophilus, whilethe pol domains of TbPOLIB, -IC, and -ID are most simi-Resultslar to those of Treponema and Sepulina. All the T. bruceipol domains contain the A, B, and C motifs (Sousa,Identification of a DNA Polymerase I-like1996); see Figure 2A for an alignment of these motifsGene Family in T. bruceifrom selected family A members. Several amino acidFamily A DNA polymerases, with Escherichia coli pol Iresidues are conserved among all family A members,as the prototype, have a conserved pol domain near theincluding the four T. brucei sequences (Figure 2A). TheseC terminus (Figure 1). Taking advantage of the nearlyresidues, which have been implicated in polymerasecomplete sequence information in the T. brucei genomefunction based on mutational analyses of E. coli and T.databases, we searched for sequences related to theaquaticus pol I, include: Asp and Glu in motif A; Arg,mitochondrial replicative pol � and other family A mem-Lys, Tyr, and Gly in motif B; and His and Asp in motifbers. A TBLASTN search did not identify a pol � homo-C. The two conserved Asp residues (motifs A and C)log. However, when using the E. coli pol I sequence ascoordinate two Mg2� ions that stabilize the transitiona query, we unexpectedly found four different groupsstate and facilitate phosphoryl transfer (Steitz, 1998).of sequence fragments that shared significant similarityThe conserved Arg and Lys in motif B interact with thewith bacterial pol I polymerase domains (E � 1.4 � 10�3

phosphates of the incoming dNTP (Patel et al., 2001),to 8.1 � 10�13). To sequence the pol I-like genes, weand a single Glu residue (motif A) is involved in thescreened a T. brucei 927 genomic P1 bacteriophageselectivity of dNTPs over rNTPs (Astatke et al., 1998).library. For each gene, we obtained an average of sixThe conservation of these essential residues in the try-clones, consistent with the estimated 5-fold coveragepanosome sequences suggests that they are functionalof the P1 library. We selected a P1 clone for each gene,polymerases.and sequencing revealed large ORFs without introns

(TbPOLIA, 2874 bp; TbPOLIB, 4212 bp; TbPOLIC, 4947bp; and TbPOLID, 4887 bp). These genes encode pre- Phylogenetic Analysis of Family A DNA Polymerasesdicted proteins with molecular masses of 104.9, 158.7, As one of the earliest diverging eukaryotes with a mito-182.0, and 182.8 kDa, respectively. Each gene is ex- chondrion, T. brucei occupies a unique position in evolu-pressed in procyclic T. brucei with transcript sizes large tion. The evolutionary divergence of trypanosomes fromenough to accommodate the ORFs (see below, Figure higher eukaryotes and the probable absence of a pol �5). The GenBank accession numbers are AF445376, from their genome suggested that at least one of the T.AF445377, AF445378, and AF445379, respectively. brucei pol I-like genes could be ancestral to pol � of

higher eukaryotes. If so, a pol I-like protein could be akDNA replicative polymerase. To test this hypothesis,The Family A Polymerase Domain

Sequence alignment of the four candidate T. brucei poly- we conducted phylogenetic analyses to determine theevolutionary relationship among the T. brucei and othermerases with other family A members indicated signifi-

Mitochondrial DNA Polymerases in Trypanosomes177

Figure 2. Relationship of Family A DNA Poly-merases

(A) Alignment of conserved sequence motifsA, B, and C of selected family A DNA polymer-ases. Identical residues are shaded black,and similar residues are shaded gray where12/18 residues are identical or similar.(B) Unrooted maximum parsimony phyloge-netic tree of the family A pol domain. For clar-ity, some closely related pol I sequences wereomitted from the tree. Numbers indicatebootstrap values at internal nodes calculatedfrom 1000 random replica. Functions are su-perimposed on the phylogenetic tree. Nodesa and b represent alternative placements ofTbPOLIB, -IC, and -ID using PUZZLE.Abbreviations are defined in Figure 1 and asfollows: Aa, Aquifex aeolicus; Bs, Bacillusstearothermophilus; Ce, Caenorhabditis ele-gans; Mt, Mycobacterium tuberculosis; Rm,Rhodothermus marinus; Rp, Rickettsia pro-wazekii; Ta, Thermus aquaticus; Sc, Saccha-romyces cerevisiae; Ss, Synechocystis spe-cies; and Xl, Xenopus laevis. Accessionnumbers: Aa pol I (AE000765); Bs pol I(P52026); Ce pol � (U50184); Dm pol �

(L76559); Dm pol � (U62547); Ec pol I(AE000461); Hs pol � (NM_006596); Hs pol �

(P54098); Mt pol I (Q07700); Rm pol I(AAD28505); Rp pol I (AJ235273); Sc pol �

(P15807); Ss pol I (BBA10748); Ta pol I(P19821); Tp pol I (AE001195); and Xl pol �

(S68258).

family A DNA polymerases. Our analyses expanded on Other Kinetoplastid Organisms Contain Multiple PolI-like Genesprevious work of this type (Braithwaite and Ito, 1993).

Because of the multidomain structure of family A mem- Searching other parasite genome databases for polI-like sequences revealed a similar gene family in Leish-bers, we used only the conserved pol domain for phylo-

genetic analyses. Phylogenetic reconstructions re- mania major and possibly in T. cruzi (for which the data-base is much less complete). Three large ORFs from L.vealed three clearly defined clades of bacterial pol I,

replicative mitochondrial pol �, and repair pol � with major (CAC37107, CAB91834, and CAC04270) exhibited48%, 49%, and 63% sequence identity with TbPOLIB,similar tree topologies using both maximum parsimony

and PUZZLE analyses. The placement of the T. brucei -IC, and -ID, respectively. A fourth incomplete sequence,AL449623, exhibited 52% identity to the C-terminal 2/3sequences was not monophyletic. For example, using

parsimony (Figure 2B), TbPOLIA grouped with the pol � of TbPOLIA. Sequence fragments of putative homologsfor TbPOLIA, -IC, and -ID were also detected in the T.subfamily and was basal to the other eukaryotic se-

quences. The three other T. brucei paralogs formed a cruzi EST and genome databases.Of the four pol I-like sequences in T. brucei and L.group basal to the pol � sequences with high bootstrap

values. major, only POLIB and -ID contained a predicted multi-domain structure. In addition to the conserved pol do-There are limits to our interpretation of these data.

For example, long branch attraction can cause misinter- main, both contain a putative 3� exonuclease domain(Figure 1). Although the POLID exonuclease domainpretation of maximum parsimony results (Felsenstein,

1978; Huelsenbeck, 1997). In addition, although our shares similarity with those of pol I and pol �, the POLIBexonuclease domain is markedly different. The domainPUZZLE analysis revealed a placement of the three T.

brucei paralogs at node a (Figure 2B), there was also structure of POLIB will be discussed elsewhere.an alternative placement at node b (Figure 2B), withinthe repair clade. Despite these limitations, our data are Four Pol I-like Proteins Target to the Mitochondrionconsistent with the possibility that TbPOLIB, -IC, or -ID Most mitochondrial proteins are nuclear encoded, and

their subsequent import is usually directed by N-terminalcould be mitochondrial kDNA replicative proteins.

Molecular Cell178

Figure 3. Mitochondrial Targeting of the FourPol I-like Proteins

(A) N-terminal sequences of selected kineto-plastid nuclear-encoded mitochondrial pro-teins. Capital letters indicate known cleavedpresequences. Abbreviations: Cf, Crithidiafasciulata; Lt, Leishmania tarentolae; LipDH,dihydrolipoamide dehydrogenase; MP48, mi-tochondrial RNA ligase.(B) Stably transfected cell populations ex-pressing IA-GFP, IB-GFP, IC-GFP, and ID-GFP were established, and fluorescence ofDAPI and the corresponding fusion proteinswere detected in live parasites. k, kDNA disk;n, nucleus. In control experiments (data notshown), fluorescence of free GFP was distrib-uted throughout the cytoplasm and nucleus,and La9-GFP fusion protein localized exclu-sively to the nucleus (Marchetti et al., 2000).(C) Live T. brucei procyclic cells (YTat1.1) la-beled with MitoTracker Red.(B and C) Cells were incubated with 5 g/mlDAPI or 1 M MitoTracker Red (MolecularProbes) for 30 min, collected by low speedcentrifugation, washed, and resuspended inCytomix at 108 cells/ml. Due to rapid cellmovement and fading of Mitotracker fluores-cence, it was impossible to obtain mergedGFP/DAPI/Mitotracker images. Bar, 4 m.

targeting sequences. Some kinetoplastid targeting se- et al., 2000). All four transgenic cell lines had doublingtimes similar to that of the parental cell line (9 hr), indicat-quences are unusually short (often 9 amino acids)

(Hausler et al., 1997), while others resemble mitochon- ing that fusion protein overexpression did not adverselyaffect cell growth. Remarkably, fluorescence micros-drial targeting sequences in other eukaryotes (Neupert,

1997). TbPOLIC and -ID have three to four residues at copy of live cells stably expressing IA-GFP, IB-GFP, IC-GFP, and ID-GFP all revealed a fluorescence patternthe N terminus similar to those of known kinetoplastid

targeting sequences (Figure 3A), and the algorithm typical of the trypanosome branched tubular mitochon-drion (Figure 3B). The same localization pattern wasPSORT II predicted mitochondrial targeting for both. To

investigate the subcellular localization of these proteins, observed after staining live wild-type cells with Mito-tracker Red (Figure 3C). These data indicate that all fourwe constructed C-terminal GFP fusions for all four ORFs

using the expression vector pXSGFPM3FUS (Marchetti pol I-like proteins are mitochondrial.

Mitochondrial DNA Polymerases in Trypanosomes179

Figure 4. Immunolocalization of T. brucei PolI-like Proteins

(A) Colocalization of TbPOLIA and LipDH (amitochondrial matrix marker). (B) Immunoflu-orescence of TbPOLIB. (C) Immunofluores-cence of TbPOLIC. (D) Colocalization ofTbPOLID and LipDH. (E) Enlargement of onecell from merged image in (B). (F) Enlarge-ment of one cell from merged image in (C). For(B) and (C), the immunofluorescence appearson the flagellar side of the kDNA disk as deter-mined by merging fluorescence and phaseimages. k, kDNA disk; n, nucleus. Bar, 2.5 m.

Immunolocalization of the Pol I-like Proteins one or two spots localized to the flagellar side of thekDNA disk (Figures 4B, 4C, 4E, and 4F). This regionTo confirm the GFP localization and to determine

whether the endogenous pol I-like proteins are posi- is the kinetoflagellar zone where minicircle replicationinitiates. POLIB localization always appeared as twotioned near the kDNA disk (like all other known kDNA

replication proteins), we performed immunofluorescence distinct foci. However, the localization of TbPOLICusually appeared as a single elongated zone or as twoexperiments using antibodies generated against C-ter-

minal peptides. Immunofluorescence using TbPOLIA- and barely resolved spots adjacent to the kDNA disk. Thefact that the corresponding GFP fusion proteins local-TbPOLID-specific antibodies revealed uniform staining

of the branched tubular mitochondrion as observed with ized throughout the mitochondrial matrix is likely dueto overexpression.the GFP fusion proteins, suggesting that both proteins

are distributed throughout the mitochondrial matrix. Asexpected, they colocalized with the mitochondrial ma- RNA Interference Studies

RNA interference (RNAi) is a powerful method for as-trix enzyme lipoamide dehydrogenase (LipDH) (Figures4A and 4D). sessing gene function. Our laboratory developed an in-

ducible RNAi system in T. brucei that allows study ofThe localization of TbPOLIB and -IC was different.Instead of uniform mitochondrial staining, most was in potentially lethal phenotypes (Wang et al., 2000). With

Molecular Cell180

Figure 5. Effect of RNAi

(A) Growth curves of clonal RNAi cell lines were determined by culturing the cells in the absence (solid squares) or presence (open circles)of 1 g/ml tetracycline. Cell density is plotted as the product of cell number and total dilution. Insets: Northern analysis of mRNA levels fromuninduced (�) and induced cells expressing dsRNA for 40 hr (�). Sizes of the mRNAs are: TbPOLIA, 4.2 kb; TbPOLIB, 4.4 kb; TbPOLIC, 6.1kb; and TbPOLID, 5.3 kb. Percent reduction of mRNA levels induced by RNAi was estimated by densitometry of autoradiograms. The dsRNAwas detected on all the Northerns except for that of TbPOLID (data not shown).(B and C) Cells were treated with tetracycline for the indicated days of RNAi induction, washed, and resuspended in Cytomix at 108 cells/ml.More than 200 cells at each time point were scored by eye for the size of the DAPI-stained kDNA disk. (B) Effect of TbPOLIB RNAi on kDNAmorphology. Solid circles, normal appearing kDNA; solid squares, abnormally small kDNA; and open triangles, kDNA apparently composedof multiple DAPI-staining spots. (C) Effect of TbPOLIC RNAi on kDNA morphology. Solid circles, normal appearing kDNA; solid squares,abnormally small kDNA; open circles, no kDNA; and open triangles, multiple DAPI-staining spots.(D) Examples of kDNA morphology induced by TbPOLIC RNAi. Cells with multiple DAPI-staining spots on occasion showed a morphologysimilar to that of ancillary kDNA (not shown) (Miyahira and Dvorak, 1994).

this method, a fragment of the gene of interest is inserted In contrast, induction of TbPOLIB and -IC dsRNA ledto a 95% and 85% loss of target mRNA within 40 hr,into pZJM, a vector that produces dsRNA upon induc-

tion with tetracycline. We found that RNAi of TbPOLIA respectively, and inhibition of cell growth within 7 days(Figure 5A). In the case of TbPOLIB, the decline in cellled to 95% reduction in TbPOLIA mRNA after 40 hr

without any subsequent effect on trypanosome growth, growth was accompanied by changes in the size andmorphology of the kDNA network as visualized by DAPIraising the possibility that TbPOLIA is not essential un-

der normal growth conditions (Figure 5A). There was staining. By day 10, about 65% of the cells containednormal-sized kDNA, but 20% contained abnormallyalso no growth phenotype after induction of TbPOLID

dsRNA, but since there was no effect on the TbPOLID small kDNA or multiple DAPI-staining spots (Figure 5B).The remaining 15% of the cell population showed un-mRNA level, we can draw no conclusions about the

function of this protein (Figure 5A). In studies of other equal kDNA division and other abnormal kDNA morphol-ogy (data not shown). The kDNA phenotype that accom-T. brucei genes using pZJM, we found examples where

the mRNA level was not reduced after tetracycline in- panied TbPOLIC RNAi was more striking. As early as 3days after induction, only 55% of the cell population stillduction (Wang et al., 2000 and our unpublished data).

Mitochondrial DNA Polymerases in Trypanosomes181

contained normal-sized kDNA, while the remaining cells C-terminal hemagglutinin (HA) tag was expressed inyeast under control of the galactose-inducible GAL1contained abnormally small kDNA (30%), no kDNA (5%),

or multiple DAPI-staining spots heterogeneous in size promoter. Using SDS-PAGE and Western blotting witha monoclonal HA antibody, we detected a protein near(10%) (Figure 5C). The largest spot occupied the charac-

teristic location of kDNA with smaller spots appearing the predicted size (�200 kDa) in extracts of galactose-induced cells but not from uninduced cells (Figure 6C).to have fragmented from the kDNA (Figure 5D). In some

cases, a smaller spot was detected on the opposite side Some of the 200 kDa protein could be precipitated usingHA antibody coupled to protein A-Sepharose, but noneof the nucleus (anterior end of the cell) (data not shown).

After 8 days of RNAi, 65% of the cells contained small precipitated with beads alone. We assayed the precipi-tated protein for DNA polymerase activity using an oligo-kDNA, and at day 15 only small DAPI staining spots, if

any, were detected. nucleotide primer-template (Figure 6D; Table 1). PAGEof the resulting products revealed extension products(lane 4) similar to those obtained using Klenow pol ITbPOLIC RNAi Affects Minicircle Replication(lanes 1 and 2), indicating that TbPOLIC is an activeAlthough the shrinking kDNA phenotype suggested aDNA polymerase. No extension products were detecteddefect in kDNA replication, another possibility existed.in precipitates from beads alone (lane 5) or from precipi-The networks could simply be decatenated, with minicir-tates of uninduced cells (lane 6).cles and maxicircles dispersed throughout the mito-

chondrion and therefore difficult to detect by DAPI stain-ing. However, if the phenotype were due to a replication Discussionblock, we would predict a progressive decrease in theminicircle and maxicircle copy number. To distinguish To better understand kDNA replication, we initiated abetween these possibilities, we induced TbPOLIC RNAi, project to identify a kDNA replicative polymerase. Usingpurified total DNA at different times, and analyzed sam- a genomics approach, we discovered four candidateples for minicircles, maxicircles, and a nuclear gene by polymerases in T. brucei with similarity to bacterial poldot-blotting. We found a decrease in copy number of I. We also found similar sequences in the genome data-both minicircles and maxicircles relative to nuclear DNA bases of the related species, L. major and T. cruzi, indi-(Figure 6A), thereby suggesting that kDNA network cating that multiple pol I-like proteins are characteristicshrinkage was due to a replication defect. of trypanosomatids. Most other eukaryotes, in contrast,

We next examined the effects of TbPOLIC silencing have only a single pol I-like enzyme, pol �, which ison free minicircle replication intermediates. The kDNA involved in nuclear DNA repair (Tosal et al., 2000). Amaz-replication process involves release of covalently closed ingly, localization studies using GFP fusions (Figure 3B)minicircles from the network, unidirectional � structure and immunofluorescence (Figure 4) showed that all fourreplication, and subsequent reattachment of newly syn- candidate polymerases localize in the cell’s single mito-thesized gapped progeny. Free minicircle replication in- chondrion. There is also another polymerase localizedtermediates are easily resolved by gel electrophoresis in trypanosomatid mitochondria, a pol � (Ferguson etand have been well characterized in C. fasciculata (Bir- al., 1992). We initially purified and characterized thiskenmeyer and Ray, 1986; Kitchin et al., 1985), and T. equi- pol � from C. fasciculata (Torri and Englund, 1995) andperdum (Ryan and Englund, 1989). We therefore fraction- recently identified a homolog in T. brucei (70% identityated DNA samples on an agarose gel and detected free with C. fasciculata pol �, T. Saxowsky and P.T.E., unpub-minicircle replication intermediates by Southern hybrid- lished data). Furthermore, fractionation of T. brucei mito-ization (Figure 6B). Intact networks do not enter the gel chondrial extracts indicated that they contain a pol �and are inefficiently transferred to membranes. How- as well as other DNA polymerases (Fuenmayor et al.,ever, they appear to decline in concentration consistent 1998). Therefore, in striking contrast to other eukaryoteswith Figure 6A. Free minicircle replication intermediates that apparently have just one mitochondrial DNA poly-normally constitute only a small percentage of network merase, pol �, T. brucei has at least five mitochondrialminicircles in log phase cells. In contrast, the concentra- polymerases. While writing this paper, we discoveredtion of free minicircle replication intermediates actually yet another pol I-like ORF in the T. brucei database. Thisincreases during RNAi of TbPOLIC. Lane 0 shows the ORF resembles pol �, and we are now characterizingfree minicircle population from uninduced cells in which that gene and its product. So far, we have demonstratedcovalently closed and gapped minicircles are the major polymerase activity only for recombinant TbPOLIC (Fig-species. During the course of RNAi, there was a progres- ure 6D), but the conservation of residues known to besive increase in covalently closed (up 1.7-fold, day 6) and essential for pol I activity suggests that the other polgapped circles (up 2-fold, day 6) and a more pronounced I-like proteins will also be active. Attempts to expressaccumulation of multiply gapped and oligomeric spe- the others are in progress.cies. These changes in the population of free minicircle The finding of multiple pol I-like proteins in trypano-replication intermediates provide additional evidence somes raises questions regarding the evolution of familythat TbPOLIC plays a role in kDNA replication. A DNA polymerases. Of foremost interest is whether pol

I-like proteins in trypanosomes are intermediates in theevolution of the highly diverged mitochondrial pol �.TbPOLIC Is an Active DNA Polymerase

Although the T. brucei pol I-like proteins contain all the Genome sequencing of numerous organisms shows thatprokaryotes possess a single family A member, pol I,residues known to be essential for pol I activity, we

wanted to formally show that at least one pol I-like pro- and that most eukaryotes possess pol � and pol � (S.cerevisiae lacks pol �). Phylogenetic analyses of thetein was active. Recombinant TbPOLIC containing a

Molecular Cell182

Figure 6. Function of TbPOLIC

(A) Loss of minicircles and maxicircles afterTbPOLIC RNAi induction. Total DNA (5 � 105

cell equivalents/spot) was purified and ana-lyzed by dot-blotting with probes to minicir-cles, maxicircles, and the nuclear hexosetransporter gene, THT1 (Wang and Englund,2001). Hybridization was measured by phos-phorimaging and reported as a percentage ofthat in uninduced cells. To correct for unequalloading, the amount of minicircle and maxicir-cle DNA was normalized to THT1.(B) Effect on free minicircle replication inter-mediates. Total DNA (106 cell equivalents/lane) from the same induction as in (A) waspurified and fractionated on a 1.5% agarosegel (20 � 25 � 0.5 cm, 70 V, 18 hr) includingethidium bromide (Wang and Englund, 2001).After transfer to a membrane, kDNA was de-tected with a minicircle probe. Lane M, kDNAmarkers of covalently closed (I), gapped andnicked (II), and linearized (III) free minicircles.Lanes 0–8, DNA samples from the indicateddays of RNAi induction. Asterisk, crosshy-bridization to nuclear DNA. Oligomeric andmultiply gapped species resemble those pre-viously identified in T. equiperdum, a relatedspecies (Ryan and Englund, 1989; Shapiro,1994).(C) Immunoprecipitation of TbPOLIC-HA fromyeast. Cell equivalent amounts of immuno-precipitate pellets (P) and supernatants (S)were analyzed by Western blotting with HAepitope antibodies followed by chemilumi-nescence.(D) DNA synthesis by TbPOLIC-HA. Productswere resolved by 20% denaturing PAGE andvisualized by autoradiography. Cell equiva-lent amounts of precipitates were assayed.Lane 1, Klenow pol I (80 U); lane 2, Klenowpol I (40 U); lanes 3 and 7, 5�-[32P]oligo-nucleotides B1 and B3; lane 4, immunopre-cipitate (�-HA beads) from galactose inducedcells; lane 5, immunoprecipitate (beads only)from galactose-induced cells; and lane 6, im-munoprecipitate (�-HA beads) from unin-duced cells. For lanes 4–6, comparableamounts of beads were used.

family A pol domain suggest that a single gene duplica- I-like sequences. The latter may function in mitochon-drial or chloroplast DNA replication (Burgers et al., 2001).tion event occurred early in eukaryotic evolution (pre-

sumably soon after the mitochondrial endosymbiosis) Furthermore, rice has a pol I-like enzyme that is localizedto a plastid subcellular fraction and may function inthat gave rise to the pol � repair and pol � replicative

clades. The branching pattern among the T. brucei se- plastid maturation (Kimura et al., 2002).All previously studied kDNA replication proteins local-quences also implies the existence of two clades. One

or more of the T. brucei sequences in the replicative ize to discrete sites around the kDNA disk (see Intro-duction). However, using GFP fusions and immunolo-clade could represent an ancestral form of pol � that

may now be trypanosome specific and required for repli- calization, we found that TbPOLIA and -ID distributethroughout the mitochondrial matrix. The localization ofcation of their unique kDNA. The lack of a pol � homolog

in any trypanosomatid genome database supports this TbPOLIB and -IC differed between the GFP fusion andthe endogenous protein visualized by specific antibod-hypothesis. Alternatively, trypansomatids could have

lost a pol � homolog and simply expanded the pol � ies. Whereas most of the endogenous proteins localizednear the kDNA disk (Figures 4B and 4C), the GFP fusionsfamily. Both scenarios are possible at this point because

we have no information regarding family A pols in other were distributed uniformly throughout the mitochondrialmatrix (with an enrichment often seen near the disk)early branching eukaryotes. Nonetheless, the expansion

of a pol I-like gene family in trypanosomes was an impor- (Figure 3B). This discrepancy could be explained by thefact that the GFP fusions were overexpressed from thetant event for generating diversity and new functions.

It is interesting that Arabidopsis thaliana also appears strong procyclin promoter and that excess protein satu-rated the localization sites near the kDNA disk. Overex-to lack pol �, but does have a pol � and two other pol

Mitochondrial DNA Polymerases in Trypanosomes183

Table 1. Oligonucleotides

Primera Sequenceb

POLIA-gfpS GCTAGCTCGTTACATGGTCATCCGc

POLIA-gfpA GCTAGCACTCGGCACCCGCAGTCCPOLIA-rnaiS GAGTTTCTCGAGGTTTGCGGACTATGACAAGCPOLIA-rnaiA GAGTTTAAGCTTTCCTCAGGGTTTCTTCTGAC

POLIB-gfpS TTAAGCTTATGCGGCTAAATAGCTGCTGGPOLIB-gfpA TTAAGCTTTTCTACACTGTCAGTAACTTCCPOLIB-rnaiS CGGAAACTCGAGCGACAACAAGGACAAGATGPOLIB-rnaiA GTGGAAAAGCTTGCGACGAGGCGGTTCAAAG

POLIC-gfpS TTAAGCTTATGCGACGTACTTTCAGTCGCPOLIC-gfpA TTAAGCTTCCTGGACAACTCCCCTAGPOLIC-rnaiS TGGTGGCTCGAGTCAACAATACGGCTATTGTGGPOLIC-rnaiA GAGTTTAAGCTTTGCGGGAGGACACGCCGGCPOLIC-haS CGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACTCGAGATGCGACGTACTTTCAGTCGCTACGPOLIC-haA ATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAAAGATGCGCCTGGACAACTCCCCTAGTGATGGTCC

POLID-gfpS TAGATGAGTTAAGCTTATGCTGCGGCGGCTCTTCAAGPOLID-gfpA TGAGAGAAGTAAGCTTCAGTGTCTCCTCAATGACAACGGGPOLID-rnaiS GGGAAACTCGAGGATGGGACAATAAGTAAGPOLID-rnaiA GAGGAAAAGCTTCTTGAATGCCTCTGAGGTCG

B1-primer AGCTACCATGCCTGCACGAAB3-template AGCTATGACCATGATTACGAATTGCTTAGTTCGTGCAGGCATGGTAGCT

a S and A indicate sense and antisense primers.b Restriction sites in primer used in subsequent cloning are underlined and start codons are bold.c The start codon is provided by the vector and is directly upstream of the NheI site. Therefore, the GFP fusion protein has two extra aminoacids, Ala and Ser, at the N terminus.

pression could also explain why IA-GFP fusion (but inhibition and shrinking of the kDNA network (Figure 5).Network shrinking was previously observed followingnever endogenous TbPOLIA visualized with specific an-

tibody) localized to the nucleus as well as to the mito- RNAi of T. brucei topo II, a protein that attaches newlyreplicated minicircles to the network (Wang and En-chondrion in 7% of the cells (data not shown).

What could be the functions of the multiple mitochon- glund, 2001). The more subtle network shrinking follow-ing TbPOLIB silencing will require further study. How-drial DNA polymerases? They could have redundant

functions, or more likely, each could have a specific role ever, RNAi of TbPOLIC provided stronger evidence fora kDNA replication defect. The more striking kDNAin kDNA replication or repair. We used RNAi as a genetic

tool to begin dissecting the roles of these proteins. RNAi shrinkage was not due to just decatenation of the net-work but to progressive loss of both minicircles andof TbPOLIA caused nearly complete degradation of its

mRNA without affecting growth. This finding raises the maxicircles (Figure 6A). Minicircle loss appears to resultfrom a direct effect on their replication (see below). Maxi-possibility that TbPOLIA could be involved in kDNA re-

pair, and further studies are needed to address this circle loss could also be a direct effect or could be dueto indirect effects from the loss of minicircles.hypothesis. RNAi did not clarify a role for TbPOLID, as

there was no decrease in mRNA levels. The decrease in kDNA content due to TbPOLIC silenc-ing was accompanied by dramatic changes in the popu-The localization of TbPOLIB and -IC provides some

clue to their function. Based on immunofluorescence, lation of free minicircle replication intermediates (Figure6B). RNAi caused accumulation of all types of intermedi-these proteins are positioned between the face of the

kDNA disk and the mitochondrial membrane nearest the ates with the most striking increases observed for multi-ply gapped and oligomeric species. Therefore, TbPOLICflagellar basal body, the kinetoflagellar zone. This is

the precise region where free minicircle replication initi- is involved in the minicircle replication process, but thisfinding does not point to a precise role for this enzymeates and intermediates are detected. TbPOLIB and -IC

are thus ideally positioned for a role in kDNA replication. (e.g., whether it is involved in leading or lagging strandsynthesis). Interpretation of these data is complicatedThere was variation in TbPOLIB and -IC localization

among different cells (e.g., localization in one or two by the fact that TbPOLIC was silenced relative to themultiple other mitochondrial polymerases (includingsites, with variation in spacing or position) (Figures 4B

and 4C and data not shown), and this variation could TbPOLIB, which also localizes in the kinetoflagellarzone) and the possibility that silencing of the TbPOLICbe due to changes in localization during the cell cycle.

There is ample precedent for such variation with other activity was incomplete. With regard to the latter point,there was 85% reduction in specific mRNA after 40 hrkDNA replication proteins (topo II and pol � [Johnson

and Englund, 1998], SSE1 [Engel and Ray, 1999], and of RNAi, but we have no information regarding the pro-tein stability or the minimal number of TbPOLIC mole-UMSBP [Abu-Elneel et al., 2001]).

Further evidence concerning the function of TbPOLIB cules required for the replication process. If a fewTbPOLIC molecules were still synthesized during RNAi,and -IC came from RNAi studies. Consistent with a role

in replication, silencing of these genes resulted in growth there might be enough to allow replication to occur at

Molecular Cell184

constructs were linearized with BstXI for insertion into the chromo-a greatly reduced rate, causing a buildup of some repli-somal tubulin locus.cation intermediates. In any case, the localization of the

For RNAi experiments, nonhomologous fragments of TbPOLI(A–D)TbPOLIC in the kinetoflagellar zone (the site for initiationcoding sequence (each 500 bp) were PCR amplified using P1 clones

of minicircle replication), the fact that it is required for as template and primers containing XhoI or HindIII linkers (Table 1).maintenance of the kDNA network, and that fact that its The PCR products were then ligated into the RNAi vector, pZJM

(Wang et al., 2000). Constructs were linearized with NotI prior toknockdown perturbs the population of free minicircletransfection to allow integration into the chromosomal nontran-replication intermediates provide strong evidence for ascribed rDNA spacer region. All constructs were verified by DNAfunction in kDNA replication. Further studies are under-sequencing.way to determine the precise role of this enzyme.

Trypanosome Growth and TransfectionExperimental Procedures For GFP experiments, T. brucei procyclic strain YTat1.1 (from E.

Ullu, Yale University) was cultured at 27�C in Cunningham’s mediumPolymerase Gene Identification, Library Screening, containing 20% fetal bovine serum (Fantoni et al., 1994). For stableand Sequencing transfections, cells (2–3 � 107 ) were washed three times and thenUsing sequences of several bacterial pol I proteins as queries, resuspended in 0.5 ml of cytomix (van den Hoff et al., 1992). CellsTBLASTN searches of the T. brucei genome databases (http:// were electroporated with 25 g of linearized GFP expression con-www.tigr.org/tdb/mdb/tbdb/ and http://www.sanger.ac.uk/Projects/ structs in a chilled 4 mm gapped cuvette using two pulses (10 sT_brucei/) revealed four different sequence groups with similarity apart) from a BTX electroporator (Model ECM 600) set for peakto family A pol domains. We amplified these sequences by PCR discharge at 1.6 kV and resistance-timing mode R2 (24 ). Afterfrom T. brucei 427 genomic DNA and used the PCR products to electroporation, cells were transferred to 9.5 ml of Cunningham’sprobe a bacteriophage P1 library of T. brucei 927 genomic DNA on medium. Selection was applied after 24 hr by adding G418 (50 g/a high-density filter (from S. Melville, University of Cambridge) using ml). Cells were analyzed for GFP expression as early as 24 hr post-the recommended conditions (http://parsun1.path.cam.ac.uk/libs- transfection.2.htm). Individual P1 clones (19E2, TbPOLIA; 8A12, TbPOLIB; 21A10, For RNAi experiments, T. brucei procyclic strain 29-13 (from G.TbPOLIC; and 10A1, TbPOLID) were sequenced on both strands Cross, Rockefeller University) was cultured in SDM-79 medium con-at the DNA Analysis Facility (R. Ingersoll, Johns Hopkins Medical taining 15% fetal bovine serum, G418 (15 g/ml), and hygromycinSchool), and primer walking was used to generate contigs con- (50 g/ml). The drugs maintain expression of the T7 RNA polymerasetaining each ORF. Consensus sequences were generated using and the tetracycline repressor, respectively (Wirtz et al., 1999). Sta-Sequencher Software (Gene Codes Corp.). ble transfections with pZJM constructs were performed as de-

scribed (Wang et al., 2000), and selection was applied with phleo-mycin (2.5 g/ml) 24 hr later. Stable cell lines were cloned by limitingSequence Analysisdilution in SDM-79 medium (containing G418, hygromycin, andThe T. brucei polymerase ORFs were used for additional databasephleomycin) using 96-well tissue culture plates at 1 cell/ml. Culturingsearches at the NCBI blast server (http://www.ncbi.nlm.nih.gov/under 5% CO2 at 27�C (cloning method from W. Gibson, UniversityBLAST) and the parasite genome blast server (http://www.ebi.ac.uk/of Bristol) resulted in clonal cell lines with plating efficiencies rangingblast2/parasites.html). Protein domains were predicted using thefrom 30%–60%. Cell densities were determined using a CoulterPfam protein families database (http://pfam.wustl.edu), and organ-Counter (model Z1, Coulter Electronics), and cultures were dilutedellar targeting was predicted with the PSORTII program (http://psort.1:10 when the density reached 3–5 � 106 cells/ml.nibb.ac.jp).

Other protein sequences were downloaded from public data-bases. Due to the significant sequence divergence among the family Production of AntibodiesA polymerases, a protein profile alignment was first generated for The following C-terminal peptides were synthesized with an extrabacterial pol I sequences using PILEUP (GCG) with default settings. cysteine at the N terminus for coupling: pol IA, LGDLEEWTVDAll other family A sequences were subsequently aligned to the pro- HALGLRVPS; pol IB, DALIPELSKEVTDSVEITV; pol IC, KAEIHIGPSLfile. The Pfam (version 6.2) protein alignment for the family A pol GELSR; and pol ID, DVVAGENMGALRPVVIEETL. All peptides weredomain was used to refine the alignment, and manual adjustments coupled to maleimide-activated keyhole limpet hemocyanin or towere made using SEQLAB (GCG). For the phylogenetic analysis of Sulfo-link beads (both from Pierce Chemical Co.) to elicit productionfamily A polymerases, only the pol domain was used. Large inserts of polyclonal sera in rats. Immunizations followed standard proto-and ambiguous sites were excluded (alignment is available upon cols at Cocalico Biologicals (Reamstown, PA). Sera were collectedrequest). Phage sequences were not used for the two phylogenetic after six boosts.reconstructions. Parsimony analysis used the PHYLIP PROTPARSprogram (http://evolution.genetics.washington.edu/phylip/progs. Immunofluorescencedata.prot.html) with 1000 replicates and branch swapping to search Immunofluorescence was as described (Wang and Englund, 2001).for the shortest trees. A maximum-likelihood analysis used the pro- Slides were incubated 90 min with primary antibody diluted ingram PUZZLE (Strimmer and von Haeseler, 1996) with 1000 itera- blocking buffer, 1:25 for anti-pol IA, -pol IB, -pol IC, and -pol ID. Notions, the Jones, Thorton, and Taylor substitution matrix, and eight immunofluorescence signal was detected with preimmune sera. Therate categories. primary antibody, rabbit anti-LipDH (from L. Krauth-Siegel, Universi-

tat Heidelberg), was diluted 1:500 for colocalization studies. Slideswere incubated with secondary antibody for 45 min as follows: 1:250Plasmid Constructsdilution of AlexaFluor 488 goat anti-rat IgG (Molecular Probes) orTo generate GFP fusion proteins, the coding regions of TbPOLIA,1:250 dilution of AlexaFluor 594 goat anti-rabbit IgG (Molecular-IB, -IC, and -ID were amplified by PCR (high-fidelity Taq polymer-Probes).ase, Roche Diagnostics, Inc.) using P1 clones as template and prim-

ers containing either NheI or HindIII linkers (Table 1). The PCR prod-ucts were digested with the appropriate restriction enzymes and Fluorescence Microscopy

Cells were examined with an Axioskop microscope (Carl Zeiss, Inc.).ligated into the corresponding sites of pXSGFPM3FUS (Marchettiet al., 2000) (from C. Tschudi, Yale University) to generate the in- Images were captured with a Sensys CCD camera (Photometrics

Ltd.) using IP Lab software v3.1 (Scanalytics). For GFP analyses,frame C-terminal fusion proteins IA-GFP, IB-GFP, IC-GFP, and ID-GFP. The IA and IC constructs contained full-length coding se- live cell images were collected using fluorescein and DAPI single

channel filter sets (chroma 41004 and 31000, respectively; Chromaquence. Because of internal HindIII sites, the IB and ID constructscontained the N-terminal 1053 aa (75%) and 1086 aa (67%) of the Technology Corp.). Imaging of fixed cells for immunofluorescence

used a multichannel emission filter equipped with a computer-drivencoding sequence, respectively. Prior to transfection, the IA-GFPconstruct was linearized with PpuM I, while IB-, IC-, and ID-GFP filter wheel containing individual excitation filters for DAPI, fluores-

Mitochondrial DNA Polymerases in Trypanosomes185

cein, and Texas Red (chroma 61002; Chroma Technology Corp.). side chain prevents Escherichia coli DNA polymerase I (Klenowfragment) from incorporating ribonucleotides. Proc. Natl. Acad. Sci.Registration was confirmed using 0.56 m TetraSpeck micro-

spheres (Molecular Probes). Virtually no bleed-through of fluores- USA 95, 3402–3407.cein and rhodamine channels was detected. Birkenmeyer, L., and Ray, D.S. (1986). Replication of kinetoplast

DNA in isolated kinetoplasts from Crithidia fasciculata. IdentificationRNA Purification and Analysis of minicircle DNA replication intermediates. J. Biol. Chem. 261,Total RNA was purified from 5 � 107 parasites using the Purescript 2362–2368.RNA Isolation Kit (Gentra System) and fractionated on a 1.5% aga- Braithwaite, D.K., and Ito, J. (1993). Compilation, alignment, androse/7% formaldehyde gel. To ensure that equal amounts of RNA phylogenetic relationships of DNA polymerases. Nucleic Acids Res.were loaded per lane, rRNA was estimated by ethidium bromide 21, 787–802.staining. RNA was then transferred to GeneScreen Plus membrane

Burgers, P.M., Koonin, E.V., Bruford, E., Blanco, L., Burtis, K.C.,(NEN). Specific mRNAs were detected by Northern hybridizationChristman, M.F., Copeland, W.C., Friedberg, E.C., Hanaoka, F., Hin-using a 32P-labeled probe (random primed) made from the samekle, D.C., et al. (2001). Eukaryotic DNA polymerases: proposal for aPCR fragment used in the corresponding pZJM construct (Table 1).revised nomenclature. J. Biol. Chem. 276, 43487–43490.Hybridization and washing conditions were as described (Wang etDrew, M.E., and Englund, P.T. (2001). Intramitochondrial locational., 2000).and dynamics of Crithidia fasciculata kinetoplast minicircle replica-tion intermediates. J. Cell Biol. 153, 735–744.Recombinant TbPOLIC Expression and Immunoprecipitation

TbPOLIC coding sequence was PCR amplified from P1 clone 21A10. Engel, M.L., and Ray, D.S. (1998). A structure-specific DNA endonu-The primer contained sequences homologous to the GAL1-URA3 clease is enriched in kinetoplasts purified from Crithidia fasciculata.promoter and the HA epitope in pHS15 (Sesaki and Jensen, 1999) Nucleic Acids Res. 26, 4733–4738.(from H. Sesaki, Johns Hopkins Medical School). The PCR product Engel, M.L., and Ray, D.S. (1999). The kinetoplast structure-specificand XhoI-NotI-digested pHS15 were cotransformed into yeast strain endonuclease I is related to the 5� exo/endonuclease domain ofJB811 (MATa leu2 trp1 ura3-52 prb1122 pep4-3 prc1-407, from J. bacterial DNA polymerase I and colocalizes with the kinetoplastBoeke, Johns Hopkins Medical School), and pPOLIC-HA was topoisomerase II and DNA polymerase � during replication. Proc.formed by homologous recombination. JB811 cells carrying Natl. Acad. Sci. USA 96, 8455–8460.pPOLIC-HA were grown in raffinose medium (OD600, 1.0), centri-

Estevez, A.M., and Simpson, L. (1999). Uridine insertion/deletionfuged, and resuspended (OD600, 0.5) in galactose medium to induceRNA editing in trypanosome mitochondria—a review. Gene 240,TbPOLIC-HA expression (4 hr, 30�C). Uninduced cells were grown247–260.in raffinose medium for 4 hr.Fantoni, A., Dare, A.O., and Tschudi, C. (1994). RNA polymerase III-Immunoprecipitation was performed at 4�C. Cells (10 OD600 units)mediated transcription of the trypanosome U2 small nuclear RNAwere lysed with glass beads in 1 ml IP buffer (50 mM Tris-HCl [pHgene is controlled by both intragenic and extragenic regulatory ele-7.5], 5 mM EDTA, 50 mM NaCl, 1% Triton X-100, and proteasements. Mol. Cell. Biol. 14, 2021–2028.inhibitors: 1 mM PMSF, 1 g/ml each of aprotinin, pepstatin, and

leupeptin). Extracts were centrifuged (12,500 � g, 10 min), and 75 Felsenstein, J. (1978). Cases in which parsimony and compatibilityl of a 1:1 slurry of protein A-Sepharose (beads only) was added methods will be positively misleading. Syst. Zool. 27, 401–410.to the supernatants. Samples were gently agitated for 30 min, and Ferguson, M., Torri, A.F., Ward, D.C., and Englund, P.T. (1992). Inthe beads were cleared by centrifugation (12,500 � g, 1 min). Then situ hybridization to the Crithidia fasciculata kinetoplast reveals two75 l of a 1:1 slurry of 12CA5 monoclonal HA antibody coupled to antipodal sites involved in kinetoplast DNA replication. Cell 70,protein A-Sepharose (�-HA coupled beads) or beads only was 621–629.added to each supernatant. The tubes were gently agitated for 4

Fuenmayor, J., Zhang, J., Ruyechan, W., and Williams, N. (1998).hr, and beads were collected by centrifugation and supernatantsIdentification and characterization of two DNA polymerase activitiessaved. Pellets were washed three times with IP buffer containing 1present in Trypanosoma brucei mitochondria. J. Eukaryot. Micro-mM EDTA and resuspended in 500 l of 50 mM Tris-HCl (pH 8.0),biol. 45, 404–410.0.1 mM EDTA, 50 mM KCl, 2 mM DTT, 10% glycerol, and proteaseHausler, T., Stierhof, Y.D., Blattner, J., and Clayton, C. (1997). Con-inhibitors as above.servation of mitochondrial targeting sequence function in mitochon-drial and hydrogenosomal proteins from the early-branching eukary-DNA Polymerase Assayotes Crithidia, Trypanosoma and Trichomonas. Eur. J. Cell Biol. 73,Reaction mixtures (20 l) contained 50 mM Tris-HCl (pH 8.0), 5 mM240–251.MgCl2, 100 mM KCl, 1 mM DTT, 100 g/ml bovine serum albumin,Hubscher, U., Maga, G., and Spadari, S. (2002). Eukaryotic DNA25 M each of dCTP and dGTP, 5 M of B1/B3 primer-templatepolymerases. Annu. Rev. Biochem. 71, 133–163.(see Table 1), and 50 nM each of [�-32P]dATP and [�-32P]dTTP (both

3000 Ci/mmol). Reactions were incubated at 37�C for 90 min and Huelsenbeck, J.P. (1997). Is the Felsenstein zone a fly trap? Syst.stopped by adding 2� formamide gel loading buffer. Biol. 46, 69–74.

Johnson, C.E., and Englund, P.T. (1998). Changes in organizationAcknowledgments of Crithidia fasciculata kinetoplast DNA replication proteins during

the cell cycle. J. Cell Biol. 143, 911–919.We dedicate this paper to the memory of Viiu Klein. We appreciate

Kitchin, P.A., Klein, V.A., and Englund, P.T. (1985). Intermediates incomments on the manuscript by Drs. D. Robinson, H. Sesaki, T.the replication of kinetoplast DNA minicircles. J. Biol. Chem. 260,Shapiro, B. Sollner-Webb, and members of our lab. M.M.K. was3844–3851.supported by NRSA (5F32AI09789). This work was supported byKimura, S., Uchiyama, Y., Kasai, N., Namekawa, S., Saotome, A.,the National Institutes of Health (GM27608).Ueda, T., Ando, T., Ishibashi, T., Oshige, M., Furukawa, T., et al.(2002). A novel DNA polymerase homologous to Escherichia coliReceived: November 21, 2001DNA polymerase I from a higher plant, rice (Oryza sativa L.). NucleicRevised: May 7, 2002Acids Res. 30, 1585–1592.

References Klingbeil, M.M., Drew, M.E., Liu, Y., Morris, J.C., Motyka, S.A., Sax-owsky, T.T., Wang, Z., and Englund, P.T. (2001). Unlocking the se-crets of trypanosome kinetoplast DNA network replication. ProtistAbu-Elneel, K., Robinson, D.R., Drew, M.E., Englund, P.T., and Shlo-152, 255–262.mai, J. (2001). Intramitochondrial localization of universal minicircle

sequence-binding protein, a trypanosomatid protein that binds ki- Li, C., and Englund, P.T. (1997). A mitochondrial DNA primase fromnetoplast minicircle replication origins. J. Cell Biol. 153, 725–734. the trypanosomatid Crithidia fasciculata. J. Biol. Chem. 272, 20787–

20792.Astatke, M., Ng, K., Grindley, N.D., and Joyce, C.M. (1998). A single

Molecular Cell186

Marchetti, M.A., Tschudi, C., Kwon, H., Wolin, S.L., and Ullu, E.(2000). Import of proteins into the trypanosome nucleus and theirdistribution at karyokinesis. J. Cell Sci. 113, 899–906.

Melendy, T., and Ray, D.S. (1989). Novobiocin affinity purificationof a mitochondrial type II topoisomerase from the trypanosomatidCrithidia fasciculata. J. Biol. Chem. 264, 1870–1876.

Melendy, T., Sheline, C., and Ray, D.S. (1988). Localization of a typeII DNA topoisomerase to two sites at the periphery of the kinetoplastDNA of Crithidia fasciculata. Cell 55, 1083–1088.

Miyahira, Y., and Dvorak, J.A. (1994). Kinetoplastidae display natu-rally occurring ancillary DNA-containing structures. Mol. Biochem.Parasitol. 65, 339–349.

Neupert, W. (1997). Protein import into mitochondria. Annu. Rev.Biochem. 66, 863–917.

Patel, P.H., Suzuki, M., Adman, E., Shinkai, A., and Loeb, L.A. (2001).Prokaryotic DNA polymerase I: evolution, structure, and “base flip-ping” mechanism for nucleotide selection. J. Mol. Biol. 308, 823–837.

Ryan, K.A., and Englund, P.T. (1989). Synthesis and processing ofkinetoplast DNA minicircles in Trypanosoma equiperdum. Mol. Cell.Biol. 9, 3212–3217.

Sesaki, H., and Jensen, R.E. (1999). Division versus fusion: Dnm1pand Fzo1p antagonistically regulate mitochondrial shape. J. CellBiol. 147, 699–706.

Shapiro, T.A. (1994). Mitochondrial topoisomerase II activity is es-sential for kinetoplast DNA minicircle segregation. Mol. Cell. Biol.14, 3660–3667.

Sogin, M.L., and Silberman, J.D. (1998). Evolution of the protistsand protistan parasites from the perspective of molecular systemat-ics. Int. J. Parasitol. 28, 11–20.

Sousa, R. (1996). Structural and mechanistic relationships betweennucleic acid polymerases. Trends Biochem. Sci. 21, 186–190.

Steitz, T.A. (1998). A mechanism for all polymerases. Nature 391,231–232.

Strimmer, K., and von Haeseler, A. (1996). Quartet puzzling: a quartetmaximum likelihood method for reconstructing tree topologies. Mol.Biol. Evol. 13, 964–969.

Torri, A.F., and Englund, P.T. (1995). A DNA polymerase beta in themitochondrion of the trypanosomatid Crithidia fasciculata. J. Biol.Chem. 270, 3495–3497.

Torri, A.F., Kunkel, T.A., and Englund, P.T. (1994). A beta-like DNApolymerase from the mitochondrion of the trypanosomatid Crithidiafasciculata. J. Biol. Chem. 269, 8165–8171.

Tosal, L., Comendador, M.A., and Sierra, L.M. (2000). The mus308locus of Drosophila melanogaster is implicated in the bypass ofENU-induced O-alkylpyrimidine adducts. Mol. Gen. Genet. 263,144–151.

Tzfati, Y., Abeliovich, H., Avrahami, D., and Shlomai, J. (1995). Uni-versal minicircle sequence binding protein, a CCHC-type zinc fingerprotein that binds the universal minicircle sequence of trypanoso-matids. Purification and characterization. J. Biol. Chem. 270, 21339–21345.

van den Hoff, M.J., Moorman, A.F., and Lamers, W.H. (1992). Electro-poration in ‘intracellular’ buffer increases cell survival. Nucleic AcidsRes. 20, 2902.

Wang, Z., and Englund, P.T. (2001). RNA interference of a trypano-some topoisomerase II causes progressive loss of mitochondrialDNA. EMBO J. 20, 4674–4683.

Wang, Z., Morris, J.C., Drew, M.E., and Englund, P.T. (2000). Inhibi-tion of Trypanosoma brucei gene expression by RNA interferenceusing an integratable vector with opposing T7 promoters. J. Biol.Chem. 275, 40174–40179.

Wirtz, E., Leal, S., Ochatt, C., and Cross, G.A. (1999). A tightly regu-lated inducible expression system for conditional gene knock-outsand dominant-negative genetics in Trypanosoma brucei. Mol. Bio-chem. Parasitol. 99, 89–101.