Mucin 1 (MUC1) signalling contributes to increasethe resistance to cell death in human bronchial epithelialcells exposed to nickel acetate

Alessandro Castorina • Salvatore Giunta

Received: 8 April 2014 / Accepted: 9 July 2014

� Springer Science+Business Media New York 2014

Abstract We have previously reported that nickel

acetate (Ni2?), a well-known human carcinogenic

agents, differentially affected apoptosis in two differ-

ent airway epithelial cell lines derived from the human

respiratory tract (A549 and Beas-2B, respectively),

suggesting a potential involvement of epidermal

growth factor receptor (EGFR)/Neu receptors in

mediating this effect. Since ErbBs are closely associ-

ated to Mucin 1 (MUC1), a glycoprotein component of

airway mucus that is overexpressed in lung tumors, we

have investigated the role of this signaling system in

the survival response of airway epithelial cells against

Ni2?-induced cell death. We found that A549 cells

exposed to Ni2? do not show any significant increase

of MUC1 levels. Conversely, Beas-2B cells exposed

to equivalent concentrations of Ni2? showed increased

expression of MUC1 levels and this correlated with

increased phosphorylation of both EGFR and of the

extracellular-regulated kinase 1/2 (ERK1/2) and

increase resistance to apoptosis, as indicated by cell

viability assessments and DNA damage. Interestingly,

suppression of MUC1 by small interfering RNA

inhibited the EGFR activation in Beas-2B cells,

leading to a significant decrease of survival and

enhancement of DNA fragmentation and cleaved

Caspase-3 expression. These results strongly suggest

a role for MUC1 in Ni2?-induced neoplastic transfor-

mation, which likely involves the activation of the

EGFR-mediated cell survival pathway, highlighting

new avenues in the molecular approach to lung cancer

prevention.

Keywords Nickel � Lung cancer � Apoptosis �Mucin-1 � EGFR

Introduction

Professional exposure to nickel compounds is associ-

ated with increased incidence of certain human cancer,

including lung and nasal cancers (Costa 1991). Several

mechanisms have been proposed for nickel-induced

carcinogenesis. These include production of reactive

oxygen species (ROS) (Capasso et al. 2014), induction

of DNA damage (Costa 1991; Lu et al. 2005),

alteration of epigenetic changes such as histone

modifications (Salnikow and Zhitkovich 2008; Salni-

kow and Costa 2000), disruption of cellular iron

homeostasis (Davidson et al. 2005), and activation of

oncogenic pathways (Pan et al. 2011). It has been

reported that nickel compounds can regulate the

expression of specific genes related to tumor devel-

opment (Cangul et al. 2002; Salnikow and Costa

2000), however, the molecular mechanisms involved

have not been clearly identified.

A. Castorina � S. Giunta (&)

Department of Bio-Medical Sciences, Section of Anatomy

and Histology, University of Catania, Via S.Sofia, 87,

95123 Catania, Italy

e-mail: sgiunta@unict.it

123

Biometals

DOI 10.1007/s10534-014-9776-x

Several studies have reported that nickel com-

pounds may either promote apoptosis or increase cell

resistance in different cell types (Ahamed et al. 2011;

Ding et al. 2006; Pan et al. 2011). These opposite

effects might depend on the different activation of

specific target membrane receptors and/or molecular

pathways. In a previous work (Giunta et al. 2012) we

have shown that nickel acetate (Ni2?) exposure

differentially affected apoptosis in two distinct airway

epithelial cell lines derived from the human respira-

tory tract. In particular, we observed a decreased

susceptibility of bronchial (Beas-2B) compared to

alveolar (A549) epithelial cells to Ni2?-induced

apoptosis which was correlated to an increased

activation of both epidermal growth factor receptor

(EGFR) and neuregulin (Neu) receptor. Such recep-

tors have been shown to be differently regulated after

exposure to different metals both in A549 and Beas-

2B cells, thus activating molecular pathways that

either promoted proliferation or induced cell death

(Wu et al. 1999; Castorina et al. 2008; Kundu et al.

2011, Mosesson and Yarden 2004). Both EGFR and

Neu receptor are situated at the cell membrane and

have an extracellular ligand-binding region, a trans-

membrane region and a cytoplasmic tyrosine-kinase

domain. Ligand binding to the receptors lead to the

activation of a variety of intracellular signaling

pathways that promote cell growth, proliferation,

differentiation, and migration (Zandi et al. 2007;

Baselga and Arteaga 2005). The EGFR downstream

signaling pathways include components of the Ras/

Raf/MAPK (ERK, JNK and p38) and PI3 K/Akt, of

which ERK represents the main kinase responsible for

EGFR-mediated cell survival (Chen et al. 1998 Li

et al. 1998). Although the role of EGFR in lung cancer

progression is well-known, how EGFR is activated by

this specific carcinogen in lung epithelial cell is not

well understood.

Mucin 1 (MUC1) is present on the surface of

various mucosal epithelial cells and is overexpressed

in various adenocarcinomas (Baldus et al. 2004).

MUC1 is synthesized as a single peptide and then

undergoes autocleavage into two subunits, subse-

quently forming a stable non-covalent heterodimer

consisting of an extracellular domain and a cytoplas-

mic tail (Macao et al. 2006). The extracellular domain

of MUC1 is composed of variable number tandem

repeats (VNTR) that consist of 20-amino acids

enriched in serine, threonine, and proline residues

modified by extensive O-glycans, which is thought of

as a physical barrier against the extracellular milieu.

Enhanced expression of MUC1 by tumor microenvi-

ronment has been associated with tumor progression

(Schroeder et al. 2004). In addition, in vitro studies

have demonstrated that the expression of MUC1 in

cancer cells is involved in the invasion (Kohlgraf et al.

2003; Tsutsumida et al. 2006), potentiation of cellular

signaling (Wei et al. 2006) and resistance to genotoxic

anticancer reagents (Ren et al. 2004; Wei et al. 2005),

suggesting that the expression of MUC1 is closely

associated with malignancy of tumor, ultimately

leading to poor prognosis. Recently, It has been shown

that MUC1 interacts with EGF receptors on the cell

surface (Schroeder et al. 2001; Pochampalli et al.

2007a), leading to the sustenance of cell signaling by

ligand binding.

In the present study we have hypothesized that the

higher resistance of Beas-2B to Ni2?-induced apop-

tosis could be due to an enhancement of MUC1

expression, which in turn stimulates the transactiva-

tion of EGF receptors. Furthemore, since MAPKK/

ERK signaling is the major pathway involved in

EGFR-mediated cell survival, we also investigated

total and phosphorylated protein levels of ERK1/2.

The results show that MUC1 confers resistance to

Ni2?-induced apoptosis through EGFR/ERK1/2 sig-

naling in human bronchial epithelial cells (Beas-2B),

highlighting the role of MUC1 and EGFR as potential

molecular targets in lung cancer prevention.

Materials and methods

Cell cultures

Human alveolar type 2-like (A549) and bronchial

epithelial cells (Beas-2B) were purchased from ATCC

(cat no. CCL-185 and CRL-9609, respectively). Both

cell lines were maintained in epidermal growth factor

(EGF)-free Dulbecco modified Eagle medium (DMEM)

containing 500 mg/L glucose, L-glutamine, 100 mg/L

sodium pyruvate supplemented with 10 % FBS,

0.02 M/L HEPES, 100 U/mL penicillin, and 50 ng/mL

streptomycin. Cells were grown in an incubator at 37 �C

in a humidified atmosphere with 5 % CO2 and passaged

at 80 % confluence.

Biometals

123

siRNA mediated knock down of MUC1

MUC1-specific siRNA was generated to the following

target sequence of the MUC1 extracellular domain:

(MUC1: 50-AAGACTGATGCCAGTAGCACT-30)(Lan et al. 1990), and a non-silencing siRNA was

designed to the following target sequence, which lacks

homology to any known mammalian gene:

AATTCTCCGAACGTGTCACGT (Qiagen). Trans-

fections were performed with Lipofectamine 2000

(Invitrogen) following the manufacturer’s suggestions,

4–6 h post-transfection the medium was changed. The

effective gene silencing was confirmed by Western blot

using the appropriate antibody.

Cell viability (MTT assay)

To assess cell viability, we used the cell proliferation

kit I (MTT) following manufacturer’s instructions

(Roche). Cells were seeded into 96-well plates at a

concentration of 1 9 104 cells/well and allowed to

adhere for 24 h. Cells were then treated with 0.1 mM

of nickel acetate (Ni2?) (Sigma Aldrich) for 24 and

48 h. EGF-free DMEM containing 0.5 mg/mL 3-[4,5-

dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bro-

mide (MTT) (Sigma–Aldrich) was added in each

well. Following incubation for 4 h at 37 �C, medium

was removed, and 100 lL of DMSO was added.

Formazan formed by the cleavage of the yellow

tetrazolium salt MTT was measured spectrophotomet-

rically by absorbance change at 550–600 nm using a

microplate reader.

Apoptotic assay by immunodetection

of oligonucleosomes

Mononucleosomes and oligonucleosomes released

from the nucleus into the cytoplasm of apoptotic cells

were detected with the use of a sandwich enzyme-

linked immunosorbent assay (The Cell Death Detec-

tion) ELISAPLUS 10 9 (Roche Applied Sciences). For

sample preparation, after the treatments, Beas-2B cells

were harvested by trypsinization. Cells were lysed in

incubation buffer for 30 min. The lysate was then

centrifuged at 20,000g9 10 min. Supernatant was

diluted to yield 1 9 104 cell equivalents/mL and used

for immunodetection. The assay was performed as

follows: (1) an antibody that react with the histone H1,

H2A, H2B, H3 and H4 was fixed on the wall of the

microplate module provided with the kit; (2) samples

prepared as described above were added to the plate

containing the immobilized anti-histone antibody; (3)

anti-DNA monoclonal antibodies conjugated to per-

oxidase were added, to allow their binding to the DNA

part of nucleosomes; and (4) after removal of unbound

peroxidase conjugate, the amount of peroxidase

retained in the immunocomplex was determined

photometrically with 2,20-azino-di(3-ethylbenzthiaz-

oline sulfonate) as a substrate.

Hoechst 33258 nuclear staining

The typical morphological features of apoptotic

degeneration were analyzed by the use of fluorescence

microscopy with the nuclear dye Hoechst 33258

(Forloni et al. 1993). Cells were fixed with a solution

of methanol/acetic acid (3:1 v/v) for 30 min, washed

three times in PBS and incubated for 15 min at 37 �C

with 0.4 lg/mL Hoechst 33258 dye. After being

rinsed in water, cells were visualized for determination

of nuclear chromatin morphology with the use of an

Axiovert 40 fluorescence microscope (Carl Zeiss Inc.).

Apoptotic cells were recognized on the basis of

nuclear condensation and/or fragmented chromatin.

Each condition was reproduced in three dishes per

experiment. Both apoptotic and normal cells were

determined by analyzing at least three different fields

per dish in a fixed pattern as previously described

(Castorina et al. 2012).

Western blot analysis

Lysates were prepared from subconfluent cells as

previously described (Giunta et al. 2012). Immunoblot

analysis was performed by using antibodies listed

below: MUC1 mouse monoclonal antibody (cell

signaling, #4538), p-EGF Receptor (Tyr 1173) rabbit

polyclonal antibody (sc-03, Santa Cruz Biotechnology,

Inc.), p-Neu Receptor (Tyr 1248) rabbit polyclonal

antibody (sc-12352, Santa Cruz Biotechnology, Inc.),

cleaved Caspase-3 rabbit polyclonal antibody (sc-

22171-R, Santa Cruz Biotechnology, Inc), ERK1/2

Antibody (MK1) mouse monoclonal antibody (sc-

135900, Santa Cruz Biotechnology, Inc.), p-ERK1/2

(Thr 202/Tyr 204) rabbit polyclonal antibody (sc-

16982, Santa Cruz Biotechnology, Inc) and b-tubulin

rabbit polyclonal antibody (sc-9104, Santa Cruz Bio-

technology, Inc.) which was used as loading control.

Biometals

123

All primary antibodies were diluted 1:200, while

secondary antibodies (HRP-conjugated goat anti-

mouse and anti-rabbit antibodies, Amersham Biosci-

ences) were used at 1:10,000. Blots were developed

using enhanced chemiluminescence technique (Amer-

sham Biosciences). No signal was detected when the

primary antibody was omitted (data not shown).

Statistical analysis

All statistical analyses were performed using Graph-

Pad InStat version 3.00, GraphPad Software Inc., San

Diego CA, USA). Data are reported as mean ± SEM.

One-way analysis of variance (ANOVA) was used to

compare differences among groups and statistical

significance was assessed by Tukey–Kramer post hoc

test, unless otherwise indicated. The level of signif-

icance accepted for all statistical tests was p B 0.05.

Results

Ni2? treatment increases MUC1 protein expression in

Beas-2B but not in A549 cells

In our previous report we have demonstrated that

Beas-2B are more resistant to Ni2?–induced cell death

than A549 cells. To investigate whether such resistance

was correlated to increased MUC1 expression, both

A549 and Beas-2B were treated with 0.1 mM Ni2? for

24 and 48 h (these experimental conditions were

chosen according to our previous work, Giunta et al.

2012) and subsequently MUC1 protein levels were

measured by Western blot analyses. Our findings

indicate that MUC1 protein expression was differen-

tially affected by Ni2? exposure in either cell line after

24 and 48 h (Fig. 1). Data obtained from these analyses

showed that, as compared to untreated controls, MUC1

protein levels were significantly increased with treat-

ment in Beas-2B cells both after 24 and 48 h

(**p \ 0.01 vs Control) (Fig. 1). Conversely, Ni2?-

treated A549 cells did not show any significant increase

in MUC1 protein expression at both times tested. These

results demonstrated that resistance to Ni2?-induced

apoptosis is correlated with increased MUC1 levels.

Therefore, subsequent experiments were performed

only on Beas-2B cells.

MUC1 suppression inhibits Ni2?-induced EGFR

activation

As previously shown the resistance of Beas-2B cells to

Ni2? is associated to increased phosphorylation levels

of both EGFR and Neu. Therefore, we sought to

determine whether MUC1 plays a role in the activation

of both EGFR and Neu receptors in this cell line. To

this end, before Ni2? treatment, Beas-2B were trans-

fected with either MUC1-specific siRNA to knock-

down MUC1 protein expression (MUC1-siRNA) or

with a non-targeted sequence, which was used as

control siRNA (Control-siRNA), and changes in

Fig. 1 Ni2? treatment

increased MUC1 protein

expression in Beas-2B but

not in A549 cells. MUC1

expression was measured by

Western blot analyses in

A549 and Beas-2B treated

with 0.1 mM Ni2? for 24

and 48 h. Bands were

quantified using

ImageQuantTL software

and normalized values were

plotted in the histogram

shown below; (**p \ 0.01

vs Ctrl). Each condition was

reproduced at least three

times with similar results

using three different batches

of cells (n = 3)

Biometals

123

expression of phosphorylated proteins (p-EGFR and

p-Neu, respectively) were evaluated by Western Blot

analyses. Our findings demonstrated that the basal

activation levels of EGFR were significantly lower in

MUC1-siRNA than in control-siRNA cells (*p \ 0.05

vs Control-siRNA). Moreover, loss of MUC1 inhibits

Ni2?-induced EGFR activation at both time consid-

ered (**p \ 0.01 vs Control-siRNA), (Fig. 2a). Oppo-

sitely, the rate of Neu activation was not affected by

MUC1 silencing neither after 24 and 48 h (Fig. 2a).

The association of MUC1 expression and EGFR

activation suggests that MUC1 plays a role in Ni2?-

induced EGFR activation.

MUC1 attenuation partially blocks EGF-induced

EGFR transactivation in Beas-2B cells

To confirm the mechanism of MUC1-mediated EGFR

activation, we examined the effects of MUC1 silencing

on EGFR activation in response to exogenous EGF

treatment. Both MUC1-siRNA and Control-siRNA

cells were maintained either in EGF-free medium and

stimulated with 50 or 100 ng/mL EGF (Sigma) for 24 h

and subsequently p-EGFR protein levels were mea-

sured by Western Blot analyses. Data obtained from

these analyses showed that EGFR phosphorylation

induced by EGF treatment after 24 h was significantly

lower in MUC1-siRNA as compared to control-siRNA

cells at both doses tested (#p \ 0.05, ##p \ 0.01,

###p \ 0.001 vs EGF-unstimulated cells) (Fig. 2b).

These findings corroborate the idea that EGFR is, at

least in part, activated through a MUC1-dependent

mechanism.

MUC1-driven EGFR activation protects Beas-2B

cells against Ni2?-induced apoptosis

To investigate whether MUC1-mediated EGFR acti-

vation prevents the induction of apoptosis by Ni2?

treatment in Beas-2B cells, we studied the effects of

MUC1-siRNA on Ni2?–induced cell death. As previ-

ously indicated, both MUC1-siRNA and Control-

siRNA cells were exposed to 0.1 mM Ni2? for 24 and

48 h and assayed for cell viability and DNA fragmen-

tation. In agreement with our previous work (Giunta

et al. 2012) the survival rate in control-siRNA cells

was not significantly affected by Ni2? treatment at

both times tested (p [ 0.05 vs untreated controls).

Interestingly, the same Ni2? exposure caused a

significant decline in cell viability in MUC1-siRNA

cells both after 24 and 48 h when compared to control-

siRNA (**p \ 0.01 vs Control-siRNA) (Fig. 3a).

Representative images displayed in Fig. 3b show

the morphological signs of nuclear damage (as deter-

mined by Hoechst 33258 staining) in response to Ni2?

treatment both in MUC1-siRNA and Control-siRNA

cells. As shown, After 24 and 48 h treatment, MUC1-

siRNA cells showed the typical morphological fea-

tures of apoptotic degeneration, whereas apparent

normal morphology persisted in Ni2?-treated Control-

siRNA cells (Fig. 3b).

In the light of these results, to further confirm the

activation of an apoptotic process in MUC1-siRNA

cells, the expression levels of the apoptotic cleaved

Caspase-3 protein was also measured after metal

treatment by Western blot analysis. As demonstrated

in Fig. 3c, Ni2?-treated MUC1-siRNA cells showed a

dramatic increase of cleaved Caspase-3 expression

(***p \ 0.001 vs control), inferring on the existence

of a potential correlation between MUC1 levels and

the activation of apoptotic pathway. Conversely, any

significant changes in the expression of cleaved

Caspase-3 protein were observed in Ni2?-treated

Control-siRNA cells.

MUC1 induces EGFR-mediated ERK1/2

activation

The common cell signalling pathways for EGFR-

mediated cell survival is the MAPKK/ERK1/2 signaling

cascade. To determine whether these downstream

effectors are involved to Ni2?-induced resistance to

apoptosis by EGFR/MUC1 signaling, we used Western

Blot analyses to detect changes in ERK1/2 protein levels

as well as in their phosphorylated forms both in control-

and MUC1-siRNA cells treated with Ni2?. Our findings

indicate that, ERK1/2 phosphorylation was triggered by

Ni2? treatment in MUC1-expressing bronchial epithe-

lial cells (Control-siRNA) (***p \ 0.001 vs control),

but not in MUC1 knockdown cultures (MUC1-siRNA)

(Fig. 4a), suggesting that the activation of ERK1/2

signalling by EGFR may be MUC1-dependent.

To confirm whether resistance to Ni2?-induced

apoptosis of Beas-2B cells is attributable to MUC1/

EGFR-mediated activation of ERK1/2 signalling,

Beas-2B cells were pretreated with the specific

MEK1 inhibitor (PD98059, 25 lM) for 30 min prior

to exposure to Ni2?. As shown in Fig. 4b, pretreatment

Biometals

123

Fig. 2 MUC1 suppression inhibits EGFR activation induced by

Ni2? in Beas-2B cells. Phosphorylated EGFR and Neu receptor

protein was measured by Western blot analyses both in control

and MUC1-siRNA Beas-2B cells exposed to 0.1 mM Ni2? at

the indicated times (a) or EGF (b). Bands were quantified using

ImageQuantTL software and normalized values were plotted in

the histogram shown on the right; (*p \ 0.05, **p \ 0.01,

***p \ 0.001 vs control-siRNA), (#p \ 0.05, ##p \ 0.01,

###p \ 0.001 vs EGF-unstimulated cells). Each condition was

reproduced at least three times with similar results using three

different batches of cells (n = 3)

Biometals

123

with PD98059 in MUC1 positive cells (Control-

siRNA) caused a robust increase of apoptotic cell

death already at 0.1 and 0.5 mM Ni2? (*p \ 0.05 vs

Control) and a further rise at higher Ni2? concentra-

tions (1, 2.5 and 5 mM, respectively, **p \ 0.01 vs

Control). Conversely, cells treated with vehicle

showed increased resistance to Ni2? treatment, as

histone-associated DNA fragmentation was signifi-

cantly increased only at the highest concentrations

tested (1, 2.5 and 5 mM, respectively; *p \ 0.05 vs

Control). Pretreatment with PD98059 did not affect

the viability of MUC1-siRNA cells treated with Ni2?

(data not shown).

Discussion

The current study demonstrated that MUC1 provides

protection against Ni2?-induced apoptosis through a

mechanism that involves EGFR/ERK1/2 signaling in

human bronchial epithelial cells (Beas-2B).

MUC1 is a membrane-bound O-glycoprotein that is

physiologically expressed in most epithelial cells. In

contrast, deregulated expression of MUC1 is a prom-

inent characteristic of various types of cancers and

inflammatory diseases (Baldus et al. 2004). The

oncogenic effects of MUC1 are believed to occur

through the interaction with several proteins impli-

cated in the cancer regulation, including members of

the ErbB family (Singh and Hollingsworth 2006;

Hattrup and Gendler 2008; Pochampalli et al. 2007a).

Interestingly, in our recent report we have shown that

Ni2? markedly stimulated both EGFR and Neu

receptor in human bronchial epithelial cells (Beas-

2B), but not in human alveolar type 2-like (A549), thus

increasing the resistance to cell death caused by metal

exposure (Giunta et al. 2012). However, the underly-

ing molecular mechanisms were left uncharacterized.

Therefore, in the present study we sought to determine

whether the increased resistance of Beas-2B with

respect to A549 cells to Ni2?-induced apoptosis could

be attributed, at least to a certain extent, to the MUC1-

Fig. 3 MUC1-mediated EGFR activation protects Beas-2B

cells against Ni2?-induced apoptosis Either control- and MUC1-

siRNA Beas-2B cells were exposed to 0.1 mM Ni2? for

indicated times and cell viability (a), DNA damage (b) and

cleaved Caspase-3 protein expression (c) were analyzed as

detailed in ‘Materials and methods’. a MTT analyses. Values are

expressed as mean ODs ± SEM of cell viability; (**p \ 0.01

vs Control-siRNA). b Hoechst 33258 nuclear staining. Cells

were stained with the fluorescent nuclear dye Hoechst 33258

and viewed at 40 9 magnification; scale bar 50 lm. c Western

blot analyses of cleaved Caspase-3. Bands were quantified using

ImageQuantTL software and normalized values were indicated

below each corresponding band; (***p \ 0.001 vs control).

Each experiment was performed at least three times using three

different batches of cells (n = 3)

Biometals

123

mediated activation of the EGFR/ERK1/2 signaling

cascade.

In the first part of this paper, we revealed that Ni2?

exposure significantly increased MUC1 expression in

Beas-2B but not in A549 cells (Fig. 1). The following

inhibition of MUC1 expression by siRNA approach in

Beas-2B suppressed the previously observed activa-

tion of EGFR caused by Ni2?, whereas any effect was

observed in the activation state of Neu (Fig. 2a).

Finally, MUC1 silencing also provoked a marked

overall decrease in EGFR activation after exogenous

stimulation with EGF (Fig. 2b). These data are

consistent with other studies demonstrating an onco-

genic role of MUC1 through its ability to activate

EGFR signalling. In particular, using in vivo models,

several research groups reported that overexpression

of MUC1 is associated with increased binding of EGF

to its high affinity EGFR in mammary glands and in

the malignant progression of breast tumors (Schroeder

et al. 2004). In contrast, MUC1 depletion has been

shown to decrease cyclin D1 expression and delayed

the onset of breast tumors (Pochampalli et al. 2007b).

Moreover, in vitro studies have demonstrated that

MUC1 promotes the EGFR-dependent activation of

Fig. 4 MUC1 induces EGFR-mediated ERK1/2 activation in

Beas-2B cells. a Either control- and MUC1-siRNA Beas-2B

cells were exposed to 0.1 mM Ni2? for indicated times and

changes in ERK1/2 protein levels as well as in their

phosphorylated forms was measured by Western blot analyses;

Bands were quantified using ImageQuantTL software and

normalized values were plotted in the histogram shown on the

right; (***p \ 0.001 vs control). b Effect of Ni2? exposure on

apoptosis in Beas-2B cells as determined by oligonucleosomes

detection. After pretreatment with vehicle or 25 lm PD98059

for 30 min, Beas-2B cells were exposed to increasing concen-

trations of Ni2? (0.1, 0.5, 1, 2.5 and 5 mM, respectively) for

24 h and processed for oligonucleosomes detection as described

in ‘Materials and methods’; Values are expressed as mean

ODs ± SEM; (*p \ 0.05 or **p \ 0.01 vs untreated cells).

Each experiment was performed at least three times using three

different batches of cells (n = 3)

Biometals

123

the PI3 K/AKT pathway in non-small cell lung cancer

cells (Raina et al. 2011), further supporting the

involvement of this molecule in cancer development.

In the second part of this study we discovered that

attenuation of MUC1 expression through siRNA

delivery, and hence the reduced the interaction with

EGFR, resulted in a significant decrease of ERK1/2

transactivation (Fig. 4a) when cells were exposed to

Ni2?, and this correlated with enhancement of cell

death, cleaved Caspase-3 expression and DNA dam-

age (Fig. 3a–c). We also found that the formerly

observed effects were partially reversed by treatment

with the MEK1 inhibitor (Fig. 5b).

Previous findings by Schroeder et al. (2001) have

demonstrated the role of MUC1 in mediating ERK1/2

activation using MUC1 transgenic mice. Interestingly,

other studies have shown that overexpression of

MUC1 in mouse breast cancer cells (Horn et al.

2009) and in human lung cancer cells (Yao et al. 2011)

results in ERK activation, although whether MUC1

directly contributes to the activation of ERK1/2

signalling remains to be investigated.

In conclusion, we have demonstrated that Ni2?

exposure induced MUC1 expression to confer resis-

tance to apoptotic cell death through the activation of

the EGFR/ERK1/2 signaling pathway in human

bronchial epithelial cells (Beas-2B). In the light of

these data, we hypothesize that persistent MUC1

expression during chronic exposure to nickel com-

pounds might contribute to increase epithelial cell

resistance, thereby promoting carcinoma development

through inhibition of the physiological apoptotic

machinery.

Acknowledgments The present research was partially

supported by grants from the Department of Bio-Medical

Sciences, Section of Anatomy and Histology, University of

Catania. We would like to thank Mr. P. Asero for his technical

support.

References

Ahamed M, Akhtar MJ, Siddiqui MA, Ahmad J, Musarrat J, Al-

Khedhairy AA, AlSalhi MS, Alrokayan SA (2011) Oxi-

dative stress mediated apoptosis induced by nickel ferrite

nanoparticles in cultured A549 cells. Toxicology 283:

101–108

Baldus SE, Engelmann K, Hanisch FG (2004) MUC1 and the

MUCs: a family of human mucins with impact in cancer

biology. Crit Rev Clin Lab Sci 41:189–231

Baselga J, Arteaga CL (2005) Critical update and emerging

trends in epidermal growth factor receptor targeting in

cancer. J Clin Oncol 23:2445–2459

Cangul H, Broday L, Salnikow K, Sutherland J, Peng W, Zhang

Q, Poltaratsky V, Yee H, Zoroddu MA, Costa M (2002)

Molecular mechanisms of nickel carcinogenesis. Toxicol

Lett 127:69–75

Capasso L, Camatini M, Gualtieri M (2014) Nickel oxide

nanoparticles induce inflammation and genotoxic effect in

lung epithelial cells. Toxicol Lett 226:28–34

Castorina A, Tiralongo A, Cavallo D, Loreto C, Carnazza ML,

Iavicoli S, D’Agata V (2008) Expression profile of ErbB

receptor’s family in human alveolar type 2-like cell line

A549 exposed to hexavalent chromium. Toxicol In Vitro

22:541–547

Castorina A, Giunta S, Scuderi S, D’Agata V (2012) Involve-

ment of PACAP/ADNP signaling in the resistance to cell

death in malignant peripheral nerve sheath tumor

(MPNST) cells. J Mol Neurosci 48:674–683

Chen W, Martindale JL, Holbrook NJ, Liu Y (1998) Tumor

promoter arsenite activates extracellular signal-regulated

kinase through a signaling pathway mediated by epidermal

growth factor receptor and Shc. Mol Cell Biol 18:

5178–5188

Costa M (1991) Molecular mechanisms of nickel carcinogene-

sis. Annu Rev Pharmacol Toxicol 31:321–337

Davidson T, Chen H, Garrick MD, D’Angelo G, Costa M (2005)

Soluble nickel interferes with cellular iron homeostasis.

Mol Cell Biochem 279:157–162

Ding J, Zhang X, Li J, Song L, Ouyang W, Zhang D, Xue C,

Costa M, Melendez JA, Huang C (2006) Nickel com-

pounds render anti-apoptotic effect to human bronchial

epithelial Beas-2B cells by induction of cyclooxygenase-2

through an IKKbeta/p65-dependent and IKKalpha- and

p50-independent pathway. J Biol Chem 281:39022–39032

Forloni G, Angeretti N, Chiesa R, Monzani E, Salmona M,

Bugiani O, Tagliavini F (1993) Neurotoxicity of a prion

protein fragment. Nature 362:543–546

Giunta S, Castorina A, Scuderi S, Patti C, D’Agata V (2012)

Epidermal growth factor receptor (EGFR) and neuregulin

(Neu) activation in human airway epithelial cells exposed

to nickel acetate. Toxicol In Vitro 26:280–287

Hattrup CL, Gendler SJ (2008) Structure and function of the

cellsurface (tethered) mucins. Annu Rev Physiol 70:431–457

Horn G, Gaziel A, Wreschner DH, Smorodinsky NI, Ehrlich M

(2009) ERK and PI3 K regulate different aspects of the epi-

thelial to mesenchymal transition of mammary tumor cells

induced by truncated MUC1. Exp Cell Res 315:1490–1504

Kohlgraf KG, Gawron AJ, Higashi M, Meza JL, Burdick MD,

Kitajima S, Kelly DL, Caffrey TC, Hollingsworth MA

(2003) Contribution of the MUC1 tandem repeat and

cytoplasmic tail to invasive and metastatic properties of a

pancreatic cancer cell line. Cancer Res 63:5011–5020

Kundu S, Sengupta S, Bhattacharyya A (2011) EGFR upregu-

lates inflammatory and proliferative responses in human

lung adenocarcinoma cell line (A549), induced by lower

dose of cadmium chloride. Inhal Toxicol 23:339–348

Lan MS, Batra SK, Qi WN, Metzgar RS, Hollingsworth MA

(1990) Cloning and sequencing of a human pancreatic

tumor mucin cDNA. J Biol Chem 265:15294–15299

Biometals

123

Li X, Lee JW, Graves LM, Earp HS (1998) Angiotensin II

stimulates ERK via two pathways in epithelial cells: pro-

tein kinase C suppresses a G protein-coupled receptor-EGF

receptor transactivation pathway. EMBO J 17:2574–2583

Lu H, Shi X, Costa M, Huang C (2005) Carcinogenic effect of

nickel compounds. Mol Cell Biochem 279:45–67

Macao B, Johansson DG, Hansson GC, Hard T (2006) Auto-

proteolysis coupled to protein folding in the SEA domain

of the membrane-bound MUC1 mucin. Nat Struct Mol Biol

13:71–76

Mosesson Y, Yarden Y (2004) Oncogenic growth factor

receptors: implications for signal transduction therapy.

Semin Cancer Biol 14:262–270

Pan JJ, Chang QS, Wang X, Son YO, Liu J, Zhang Z, Bi YY, Shi

X (2011) Activation of Akt/GSK3b and Akt/Bcl-2 sig-

naling pathways in nickel-transformed BEAS-2B cells. Int

J Oncol 39:1285–1294

Pochampalli MR, Bitler BG, Schroeder JA (2007a) Trans-

forming growth factor alpha dependent cancer progression

is modulated by Muc1. Cancer Res 67:6591–6598

Pochampalli MR, el Bejjani RM, Schroeder JA (2007b) MUC1

is a novel regulator of ErbB1 receptor trafficking. Onco-

gene 26:1693–1701

Raina D, Kosugi M, Ahmad R, Panchamoorthy G, Rajabi H,

Alam M, Shimamura T, Shapiro GI, Supko J, Kharbanda S,

Kufe D (2011) Dependence on the MUC1-C oncoprotein in

non-small cell lung cancer cells. Mol Cancer Ther

10:806–816

Ren J, Agata N, Chen D, Li Y, Yu WH, Huang L, Raina D, Chen

W, Kharbanda S, Kufe D (2004) Human MUC1 carci-

noma-associated protein confers resistance to genotoxic

anticancer agents. Cancer Cell 5:163–175

Salnikow K, Costa M (2000) Epigenetic mechanisms of nickel

carcinogenesis. J Environ Pathol Toxicol Oncol 19:307–

318

Salnikow K, Zhitkovich A (2008) Genetic and epigenetic

mechanisms in metal carcinogenesis and cocarcinogenesis:

nickel, arsenic, and chromium. Chem Res Toxicol 21:28–

44

Schroeder JA, Thompson MC, Gardner MM, Gendler SJ (2001)

Transgenic MUC1 interacts with epidermal growth factor

receptor and correlates with mitogen-activated protein

kinase activation in the mouse mammary gland. J Biol

Chem 276:13057–13064

Schroeder JA, Masri AA, Adriance MC, Tessier JC, Kotlarczyk

KL, Thompson MC, Gendler SJ (2004) MUC1 overex-

pression results in mammary gland tumorigenesis and pro-

longed alveolar differentiation. Oncogene 23:5739–5747

Singh PK, Hollingsworth MA (2006) Cell surface-associated

mucins in signal transduction. Trends Cell Biol 16:

467–476

Tsutsumida H, Swanson BJ, Singh PK, Caffrey TC, Kitajima S,

Goto M, Yonezawa S, Hollingsworth MA (2006) RNA

interference suppression of MUC1 reduces the growth rate

and metastatic phenotype of human pancreatic cancer cells.

Clin Cancer Res 12:2976–2987

Wei X, Xu H, Kufe D (2005) Human MUC1 oncoprotein reg-

ulates p53-responsive gene transcription in the genotoxic

stress response. Cancer Cell 7:167–178

Wei X, Xu H, Kufe D (2006) MUC1 oncoprotein stabilizes and

activates estrogen receptor alpha. Mol Cell 21:295–305

Wu W, Graves LM, Jaspers I, Devlin RB, Reed W, Samet JM

(1999) Activation of the EGF receptor signaling pathway

in human airway epithelial cells exposed to metals. Am J

Physiol 277:924–931

Yao M, Zhang W, Zhang Q, Xing L, Xu A, Liu Q, Cui B (2011)

Overexpression of MUC1 enhances proangiogenic activity

of non-small-cell lung cancer cells through activation of

Akt and extracellular signal-regulated kinase pathways.

Lung 189:453–460

Zandi R, Larsen AB, Andersen P, Stockhausen MT, Poulsen HS

(2007) Mechanisms for oncogenic activation of the epi-

dermal growth factor receptor. Cell Signal 19:2013–2023

Zhang J, Zhou Y, Wu YJ, Li MJ, Wang RJ, Huang SQ, Gao RR,

Ma L, Shi HJ, Zhang J (2013) Hyper-methylated miR-203

dysregulates ABL1 and contributes to the nickel-induced

tumorigenesis. Toxicol Lett 223:42–51

Biometals

123