Morphological and expression analyses of MADS genes in Japanese traditional narrow- and/or...

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

Scientia Horticulturae 134 (2012) 191–199

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae

journa l h o me page: www.elsev ier .com/ locate /sc ihor t i

Morphological and expression analyses of MADS genes in Japanese traditionalnarrow- and/or staminoid-petaled cultivars of Rhododendron kaempferi Planch.

Keisuke Tasakia, Akira Nakatsukab, Kyeong-Seong Cheona, Misato Kogab, Nobuo Kobayashib,∗

a The United Graduate School of Agricultural Sciences, Tottori University, Tottori 680-8553, Japanb Faculty of Life and Environmental Sciences, Shimane University, Shimane 690-8504, Japan

a r t i c l e i n f o

Article history:Received 23 June 2011Received in revised form 6 October 2011Accepted 14 November 2011

Keywords:AzaleaChoripetalous flowerGamopetalous flowerMADS-box geneSai-zaki formStaminoid petal

a b s t r a c t

The morphological traits of the floral mutation cultivars ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’ ofRhododendron kaempferi that characteristically exhibit extremely narrow and/or staminoid petals wereinvestigated. In addition, to confirm the causes of the mutations in these cultivars, the MADS-box C classAG gene homologues in R. kaempferi were isolated, and the MADS-box gene expression patterns in thefloral organs of the wild-type plants and cultivars were analyzed. A morphological observation of theepidermis showed that the ‘Kagaribi’ and ‘Kinshibe’ cultivars formed staminoid flag petals and staminoidorgans in whorl 2, respectively. The epidermal cells of the staminoid organs of whorl 2 in ‘Kagaribi’ and‘Kinshibe’ resembled those of the stamens in whorl 3. In ‘Kin-kujyaku,’ the petals in whorl 2 and leaveswere extremely narrow. The sepals in whorl 1 were absent, and the style in whorl 4 was split into 5 parts.The epidermal cells of the petals in whorl 2 in ‘Kin-kujyaku’ were dissimilar to the epidermal cells of thestamens in whorl 3. The deduced amino acid sequence of the isolated AG homologue from R. kaempferiwas well-conserved among the AG orthologues. The expression levels of RkAG in whorl 2 to whorl 3 of‘Kagaribi’ and ‘Kinshibe’ was approximately 27% and the same level, respectively. In ‘Kin-kujyaku,’ theexpression pattern was similar to that of the wild type. These results suggest that the ‘Kagaribi’ and‘Kinshibe’ floral mutations might be caused by the expression of RkAG in whorl 2.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

Since the Edo era (1603–1867) in Japan, old azalea cultivarshave been developed from the natural populations of a varietyof species from the Rhododendron subgenus Tsutsusi section Tsut-susi (Ericaceae), such as Rhododendron kaempferi, Rhododendronmacrosepalum, Rhododendron indicum and Rhododendron ripense(Kobayashi et al., 2000; Kunishige and Kobayashi, 1980; Kurashigeand Kobayashi, 2008). The first monograph describing azalea isKinshu-Makura, which was written by Ito in 1692 and introduced337 cultivars of azalea and Satsuki hybrids; an English translation ofthis monograph is entitled A Brocade Pillow: azaleas of Old Japan (Itoand Creech, 1984). The cultivars mentioned in this monograph con-tain various morphological mutations and double and hose-in-hoseflower traits. One of the flower mutational traits “misome-sho”,comprising long-lasting corollas with temporal color changes, wasrecently investigated and may be derived from sepaloid petalscaused by a homeotic gene mutation (Kobayashi et al., 2010). Inaddition, our previous study of “sai-zaki”, which has choripetalouscorollas that consist of 5 independent narrow petals, using old

∗ Corresponding author. Tel.: +81 852 32 6506; fax: +81 852 32 6537.E-mail address: [email protected] (N. Kobayashi).

cultivars of R. macrosepalum suggested that one of the mutationalcultivars might have had a similar mutation in the growth ofthe lateral organs in the transverse plane (Tasaki et al., in press).The “sai-zaki” cultivars are also found in a group of R. kaempferi,which grows from the extreme south to central Hokkaido in Japan(Chamberlain and Rae, 1990; Kumakura, 1976; Yamazaki et al.,1979; Wilson and Rehder, 1921; Yamazaki, 1996). This groupincludes various cultivars that have mutations in their floral organs,including narrow and staminoid petals, and their variation seemsto be related to the floral identity genes.

The identities of the four floral organs are specified by theclassical ABC model, which consists of floral homeotic MADS-box genes from classes A, B and C (Coen and Meyerowitz,1991; Weigel and Meyerowitz, 1994). Expression of the classA genes alone determines sepal development, whereas the co-expression of class A and B genes or class B and C genes specifiesthe formation of petals or stamens, respectively; the expres-sion of the class C genes alone results in carpel development.The class B MADS-box genes, DEFICIENS (DEF) and GLOBOSA(GLO) in Antirrhinum and APETALA3 (AP3) and PISTILLATA (PI) inArabidopsis, induce petal and stamen formation in whorls 2 and 3,respectively (Davies et al., 1996; Goto and Meyerowitz, 1994; Jacket al., 1992; Sommer et al., 1990; Tröbner et al., 1992). The class CMADS-box genes, AGAMOUS (AG) in Arabidopsis thaliana and PLENA

0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved.doi:10.1016/j.scienta.2011.11.013


192 K. Tasaki et al. / Scientia Horticulturae 134 (2012) 191–199

Fig. 1. Gross morphology of the flowers and leaves of wild-type (A, E, I, O, S, and W), ‘Kagaribi’ (B, F, J, K, P, T, and X), ‘Kinshibe’ (C, G, L, M, Q, U, and Y) and ‘Kin-kujyaku’ (D,H, N, R, V, and Z) in R. kaempferi. Flower (A–D), sepal (E–H), opened corolla (H), petal (I–N), stamen (O–R), pistil (S–V), and leaf (W–Z).

(PLE) and FARINELLI (FAR) in Antirrhinum majus, induce the repro-ductive organs in whorls 3 and 4 (Bradley et al., 1993; Davies et al.,1999; Yanofsky et al., 1990). In azalea, the class B MADS-box geneshave been isolated previously (Kobayashi et al., 2010; Cheon et al.,2011).

We focused on the Japanese traditional cultivars with narrowedand/or staminoid petals, ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’, inR. kaempferi, and investigated the morphological trait of these cul-tivars. In addition, we are report the isolation of class C MADS-boxgenes and expression pattern of the class B and C genes in the floralorgans of these cultivars.

2. Materials and methods

2.1. Plant materials

The wild species R. kaempferi Planch. and its cultivars ‘Kagaribi’,‘Kinshibe’ and ‘Kin-kujyaku’ (Wilson and Rehder, 1921; Yamazaki,1996) that were used in this study were obtained from the aza-lea resources collection of the Plant Breeding Laboratory of Facultyof Life and Environmental Science of Shimane University (Fig. 1).An alternate wild-type form of R. kaempferi (wtSH) from Matsue,Shimane was used for the MADS-box gene expression analysis.

2.2. Morphological observations

During the flowering season that lasted from mid-April to mid-May in 2010 and 2011, the maximum widths and lengths of thepetals and sepals and the lengths of the filaments and styleswere measured. In the growing season, from the final 10 days ofAugust–mid-October of 2009, the maximum widths and lengths

of the larger 5th–7th leaves from shoot apices of current-yearbranches were measured. Images were recorded with a digital cam-era (Canon EOS 50D; Canon Co., Tokyo, Japan).

2.3. Microscopy

The morphological traits of the epidermal cells from the petals,sepals and leaves of the wild-type plants and 3 cultivars were inves-tigated using SUMP (Suzuki’s Universal Microprinting Method;SUMP Laboratory, Tokyo, Japan), which makes celluloid replicas ofthe organ surfaces with a light microscope (Nikon XF-21; Nikon Co.,Tokyo, Japan). Images were recorded with a digital camera (NikonCOOLPIX 8400; Nikon Co., Tokyo, Japan).

2.4. Cloning of MADS class C gene

Total RNA was extracted from the pistils of wild type R. kaempferiusing the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Toavoid DNA contamination, 20 �g total RNA from each sample wastreated with RNase-free DNaseI (Takara Bio, Shiga, Japan). First-strand cDNA was synthesized using oligo (dT) and ReverTra Acereverse transcriptase (Toyobo Co., Osaka, Japan) and was used asa template for the polymerase chain reaction (PCR). The reactionsolution (20 �L) contained 1 �L cDNA, 1× PCR buffer, 3 �M MgCl2,0.15 �M of each dNTP, 1.0 �M of each degenerated primer and 0.5units of Ex Taq (Takara Bio). The amplification conditions were asfollows: 5 min at 95 ◦C followed by 30 cycles of 30 s at 95 ◦C, 30 s at50 ◦C, 30 s at 72 ◦C, and 5 min at 75 ◦C. Degenerated primers for theAG gene (Table 1 ) that corresponded to the MADS domain weredesigned from the consensus sequences of AG genes in other plantspecies, such as PEONY and DUPLICATED in Ipomoea nil, PLE and


K. Tasaki et al. / Scientia Horticulturae 134 (2012) 191–199 193

Table 1Primers used for cloning of full-length and semi-quantitative RT-PCR for AG homologous in R. kaempferi.

Name Sequence (5′–3′)

Isolation for RkAGDegenerated primers

AG-F1 GARTATKCMAAYAAYAGTGTAG-R1 GTARTBRWKRTTKGKYTSBA

Gene-specific primers3′RACE

First PCR AG-3RACE1 GGGAGATTGAGTTGCAAAATNested PCR AG-3RACE2 CATGTATCTGCGGGCAAAGA

5′RACEFirst PCR AG-5RACE-F1 GAATGAAATGCTGTTTGCTG

AG-5RACE-R1 AGGTTAAAGCGCTAAGAGCCNested PCR AG-5RACE-F2 ATGCAGAAAAGGGAGATTGA

AG-5RACE-R2 ATGTGCCTGTTTGAATTCTGRT primer AG-5RACE-P GGCTGCTGCTGTTGCGCCTG

Full length isolation primers AG-full-Fl CCCTTCTCTCAGTATTTTTCTTTACAAGCAG-full-Rl CTCTACTAGCTATTTGTTCTTGATTCATAA

Semi-quantitative RT-PCR primersRkAG-F TGCCATCATCCCATGATCATRkAG-R TTGTCCAGCAACAACATACTRrPI-F CTGGAAACTGGCCTTGCRrPI-R GGCATCTGGGGCTGGTARpAP3 -F TATGAGAAAATGCAAGAGCACRpAP3 -R GGCTAATATACCGCGGCCTCACTIN-F AGCAATGTATGTTGCTATCCACTIN-R TGATCGAGTTGTAGGTAGTC

RT-qPCR primersRkAG -Realtime-F ACTACTCTCGCCACGACCAARkAG -Realtime-R CCAAAAGGAAACACACAAAAGGRrPI -Realtime-F AGATGCCTTTTGCCTTCCACRrPI -Realtime-R GGTTGATCGATCCCCATTACARpAP3 -Realtime-F CACAGAAGCCTCCTCCATGARpAP3 -Realtime-R TGGTGGTTAGGCTGCATACGACTIN -Realtime-1 TCTTGATCTTGCTGGTCGTGACTIN -Realtime-2 GGGCATCTGAATCTCTCAGCHistone H3 -Realtime-F GAAACTCCCATTCCAGAGGCTHistone H3 -Realtime-R GCATGGATGGCACAGAGGTT

FAR in A. majus, and AG in A. thaliana. After electrophoresis, thePCR products of the predicted size were excised using QuantumPrepTM Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad, Hercules, CA, USA). The PCR products were cloned using pGEM-T vectors (Promega, Madison, WI, USA) and Escherichia coli JM109-competent cells (Takara Bio), and were sequenced.

Full-length cDNA sequences of the putative AG gene were iden-tified by RACE (Rapid Amplification of cDNA Ends)-PCR usingthe 3′-Full RACE Core Set (Takara Bio) and 5′-Full RACE Core Set(Takara Bio) according to the supplier’s protocols (Takara Bio).Gene-specific primers were designed from the sequenced frag-ments (Table 1) for the RACE-PCR. The amplified cDNA fragmentswere cloned using pGEM-T vectors (Promega) and E. coli DH5�-competent cells (Nippon Gene, Tokyo, Japan) and were sequenced.The forward and reverse primers for full length gene isolation weredesigned on 5′ UTR and 3′ UTR, respectively. The reaction solu-tion (20 �L) contained 1 �L cDNA, 1× PCR buffer, 3 �M MgCl2,0.15 �M of each dNTP, 0.2 �M of each full length isolation primerand 0.5 units of Ex Taq (Takara Bio). The amplification conditionswere as follows: 30 s at 98 ◦C followed by 30 cycles of 10 s at 98 ◦C,30 s at 59 ◦C, 1 min 30 s at 72 ◦C. The cloning of cDNA fragmentsamplified by full length isolation primer set was carried out by amethod same as the above. The all primer sets using for isolationof C class gene are shown in Table 1.

2.5. Sequence analysis

After screening, target fragments were sequenced using an ABIPRISM 3100 Genetic Analyzer and the BigDye Terminator Sequenc-ing System (Applied Biosystems, USA). The DNA sequences were

translated to amino acid sequences using the program GENETYXWIN, Version 10.0 (Software Development). Multiple sequencesof the azalea clones were aligned using CLUSTAL W, Version 2.0(Thompson et al., 1994). The phylogenetic tree was constructedwith the GENETYX-Tree software program (Genetyx, Tokyo, Japan)using the neighbor-joining method (Saitou and Nei, 1987), andbootstrap trials were conducted 1000 times.

2.6. Expression analysis by semi-quantitative RT-PCR andRT-quantitative PCR

The expression of the AG-homologue genes, RpAP3 (DDBJ acces-sion no. AB598826; Cheon et al., 2011), and RrPI (DDBJ accessionno. AB639033; Nakatsuka et al., 2009), in the floral organs ofthe wild-type, wtSH, ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’ plantswere determined by semi-quantitative RT-PCR and RT-quantitativePCR. ACTIN (Nakatsuka et al., 2008; DDBJ accession no. AB610421)and Histone H3 (De Keyser et al., 2007) was used as internal con-trol. For the semi-quantitative RT-PCR and RT-qPCR, total RNA wasextracted from the floral organs just after the flowering using thehot borate method and RNeasy Plant Mini Kit (QIAGEN, Germany)and was treated with RNase-free DNase I (Takara). Next, the totalRNA was reverse-transcribed using oligo (dT) and ReverTra Acereverse transcriptase (Toyobo) according to the manufacturer’sinstructions.

In semi-quantitative RT-PCR, The PCR reaction solution (50 �L)contained 1 �L of cDNA that was diluted ten-fold, 1× PCR buffer,0.15 �M of each dNTP, 0.5 �M of each gene-specific primer (Table 1)and 1.25 units of Taq polymerase (Takara). The amplification con-ditions were as follows: 5 min at 95 ◦C followed by 30 cycles of 30 s



Fig. 2. Epidermal cells of the petal (1–4) and stamen (5–6) of wild type (A), ‘Kagaribi’ (B), ‘Kinshibe’ (C), ‘Kin-kujyaku’ (D) in R. kaempferi. (1) Adaxial surface of upper part ofpetal, (2) abaxial surface of upper part of petal, (3) adaxial surface of lower part of petal, (4) abaxial surface of lower part of petal, (5) upper part of filament, (6) lower part offilament. Bar = 100 �m.

at 95 ◦C, 30 s at 54 ◦C (RrPI, 60 ◦C), 30 s at 72 ◦C, and 5 min at 75 ◦C.The primer sets used for the amplifications is shown in Table 1. ThePCR products were separated on a 1.0% agarose gel in 1× TBE andstained with ethidium bromide.

In RT-qPCR, 1.0 �l of cDNA samples was used as template in a20 �l RT-qPCR assay mix containing 10 �l SYBR Premix Ex Taq II(Takara Bio) and 0.5 �M of each primer. Each RT-qPCR assay wasrun on a Thermal Cycler Dice Real Time System (Takara) with aninitial denaturalization of 30 s at 95 ◦C, followed by 40 cycles of 5 sat 95 ◦C and 30 s at 60 ◦C. Each cDNA sample was analyzed in three

technical replicates. The primer sets used for the amplifications areshown in Table 1.

Amplification of the ACTIN and Histone H3 genes under identicalconditions was conducted as an internal control to normalize thelevels of the cDNA. The data for each PCR was calculated with thedifference in the threshold cycle (Ct) values (�Ct) between the twosamples (the target genes and the reference genes) to calculate rel-ative amounts of template present. The value of the relative geneexpression was calculated using the maximum value of all whorlsin each plant as the standard, and mean and standard error (SE)



Fig. 3. (continued ).

were calculated by the value of the relative expression betweenthe reference genes.

3. Results

3.1. Morphological observations

Wild-type R. kaempferi has gamopetalous corollas that areformed by the fusion of 5 petals (Fig. 1A and I). In contrast,‘Kagaribi’ and ‘Kin-kujyaku’ have choripetalous corollas (Fig. 1B andD, respectively). The flowers of ‘Kinshibe’ are composed of approx-imately 10 stamen and/or staminoid organs (Fig. 1C).

In whorl 1, the average sepal length, width and indexof the wild-type plants were 3.4 ± 0.8 mm, 2.9 ± 0.5 mm and0.87 ± 0.12, respectively, and it was egg-shaped (Fig. 1E). Theaverage sepal length, width and index of ‘Kagaribi’ were4.2 ± 1.2 mm, 2.6 ± 0.7 mm and 0.65 ± 0.18, respectively. The aver-age sepal length, width and index of ‘Kinshibe’ were 5.5 ± 1.4 mm,2.1 ± 0.3 mm and 0.42 ± 0.18, respectively, and it was more slenderthan the wild-type plant (Fig. 1G). The sepals of ‘Kin-kujyaku’ wereabsent (Fig. 1H).

In whorl 2, the average petal length, width and index of the wildtype were 37.5 ± 3.2 mm, 19.1 ± 0.9 mm and 0.52 ± 0.06, respec-tively. The lower areas of the corollas formed tubes, and the upper

areas were divided into 5 petals, which were widened. The aver-age petal length, width and index of ‘Kagaribi’ were 33.3 ± 4.0 mm,4.6 ± 2.2 mm and 0.13 ± 0.07, respectively. The organs of ‘Kagaribi’formed flag petals with flat areas at the tips. The lower parts of theorgans were slightly flat (Fig. 1J and K). In whorl 2 of ‘Kinshibe,’staminoid organs were present. Some of these organs appearedto be intermediate forms of the petals and stamens (Fig. 1M).Even if the organs completely resembled stamens, the lower partsof the filaments were slightly flat, as were those of ‘Kagaribi’(Fig. 1L). The average filament length of the whorl 2 organs of‘Kagaribi’ was 29.6 ± 1.8 mm, which was similar to that of the whorl3 organs, which was 31.6 ± 2.3 mm. The average petal length, widthand index of ‘Kin-kujyaku’ were 30.4 ± 3.4 mm, 2.9 ± 0.7 mm and0.10 ± 0.02, respectively. The shapes of the petals of ‘Kin-kujyaku’were extremely narrow (Fig. 1N). The lower halves of the petalswere curled, and they were not fused.

In whorl 3, the stamens of the wild type were composed of fil-aments and anthers. The average filament length of the wild typewas 35.7 ± 2.3 mm. In ‘Kagaribi’, the whorl 3 organs formed anther-less stamens (Fig. 1P). The average filament length of ‘Kagaribi’ was25.1 ± 3.1 mm, which was shorter than that of the wild-type plant.The average filament length of ‘Kinshibe’ was 31.6 ± 2.3 mm, andit had normal-shaped stamens with anthers that resembled thoseof the wild-type plant (Fig. 1Q). ‘Kin-kujyaku’ had normal-shapedstamens in whorl 3. The average filament length of ‘Kin-kujyaku’was 26.3 ± 3.5 mm, which was shorter than that of the wild-typeplant (Fig. 1R).

The typical pistil of the wild type in whorl 4 is shown in Fig. 1S.The average pistil length of the wild type was 37.7 ± 1.1 mm. Thepistil of ‘Kagaribi’ was slightly folded (Fig. 1T). The average stylelength of ‘Kagaribi’ was 27.1 ± 1.9 mm, and that of ‘Kinshibe’ was31.5 ± 2.5 mm, which was shorter than that of the wild-type plant.The style of ‘Kin-kujyaku’ was split into 5 parts (Fig. 1V).

The average leaf length, width and index of the wild typewere 45.4 ± 5.9 mm, 22.3 ± 4.7 mm and 0.49 ± 0.07, respectively,and they were elliptical in shape (Fig. 1W). The average leaf length,width and index of ‘Kagaribi’ were 47.4 ± 3.7 mm, 21.0 ± 1.4 mmand 0.44 ± 0.02, respectively. The leaf size and shape of ‘Kagaribi’was similar to that of the wild-type plant (Fig. 1X). The aver-age leaf length, width and index of ‘Kinshibe’ were 33.8 ± 5.6 mm,14.5 ± 2.8 mm and 0.43 ± 0.02, respectively. The leaves wereslightly smaller than those of the wild-type plant (Fig. 1Y).The average leaf length, width and index of ‘Kinkujyaku’ were39.5 ± 2.4 mm, 2.4 ± 0.4 mm and 0.06 ± 0.01, respectively. Theleaves and petals of ‘Kin-kujyaku’ were extremely narrow (Fig. 1Z).

3.2. Epidermal observations

The epidermal cells in whorls 2 and 3 of the wild type, ‘Kagaribi’,‘Kinshibe’ and ‘Kinkujyaku’ were observed (Fig. 2).

In whorl 2, the adaxial and abaxial epidermal cells located onthe upper and base portions of the organs in the wild type wereangular (Fig. 2A1–2). In ‘Kagaribi’, the epidermal cells on the topflat areas of the petals (Fig. 2B1–2) were similar in shape to thoseof the wild-type plant. In the base part of the organ of ‘Kagaribi’,the adaxial and abaxial epidermal cells (Fig. 2B3–4) were narrowerthan those of the wild-type plant (Fig. 2A3–4). The shapes of the

Fig. 3. Characterization of RkAG genes. (A) Isolated RkAG1-1 base sequence. The bases under the RkAG1-1 base sequence show the base of RkAG1-2 different from RkAG1-1partially. Arrows show the all primers used in this study for RkAG. (B) Multiple alignments of the deduced amino acid sequences in the MADS domain, I box, K box, andAG motifs I and II of the C terminal region of RkAG and other plant AG genes. The conserved residues are shown in grey and identical residues in black. The dots show theposition of an amino acid participating in a classification to PLE lineage by the state of the amino acid. (C) A neighbor-joining phylogenetic tree of RkAG sequences, RkAG1-1 andRkAG1-2. Numbers next to the nodes are bootstrap values from 1000 replicates. The deduced amino-acid sequences were retrieved from the DDBJ/EMBL/GeneBank databases.In: Ipomoea nil (PN: BAC97838, DP: BAC97837); Ph: Petunia × hybrida (FBP6: CAA48635, pMADS3: BAB79434, FBP3: CAA50549, pMADS1: Q07472, FBP11: CAA57445); Am:Antirrhinum majus (PLE: AAB25101, FAR: CAB42988, SQUA: CAA45228, GLOB: Q03378, DEF: BAI68389); At: Arabidopsis thaliana (AG: NP 567569, SHP1/AGL1: NP 191437,SHP2/AGL5: NP 565986, AP1: CAA78909, PI: NP 197524, AP3: AAD51901, STK/AGL11: NP 192734).



adaxial cells of the petals were similar to those of the epidermalcells of the filament bases in ‘Kagaribi’ (Fig. 2B3–6). In the staminoidorgans of ‘Kinshibe’, the adaxial and abaxial epidermal cells of theupper parts of the filaments (Fig. 2C1–2) were narrower than thoseof the wild type petals. Narrower epidermal cells were observedin the base portions of the organs (Fig. 2C3–4). In ‘Kin-kujyaku’,the adaxial and abaxial epidermal cells of the base portions of thepetals (Fig. 2D1–4) were more similar to those of the wild type thanthose of ‘Kagaribi’ and ‘Kinshibe’. Trichomes were observed on thesurfaces of the staminoid organs in ‘Kinshibe’ (Fig. 2C3–4).

In whorl 3, the epidermal cells of the upper areas in the wildtype were elliptical in shape (Fig. 2A5). The epidermal cells in theupper areas of the filaments in all cultivars were similar in shapeto those of the wild-type plant (Fig. 2B–D5). The filament basesof both the wild-type plants and cultivars had extremely narrowepidermal cells and trichomes (Fig. 2A6, B–D6, respectively).

3.3. cDNA cloning and sequence analysis of C-class genes from R.kaempferi

cDNA clones of the AG homologue gene were isolated fromthe pistils of R. kaempferi plants. Twenty two fragments weresequenced and two kinds of sequence (10 and 12 clones) wereobtained. The full-length sequences of two AG homologue genes,which contained 40 bp 5′ untranslated regions (UTR), 759 bp of cod-ing sequence each and 238 bp 3′ UTRs. The base sequence of twoAG homologue genes varied in 7 bases in the protein cording region(Fig. 3A). Therefore, two genes were named RkAG1-1 and RkAG1-2,respectively (Accession no. AB639031 and AB639032). These twoRkAG showed 99% amino acid identity. The difference of deduced252 amino acid sequence between RkAG1-1 and RkAG1-2 was only1 amino acid, which is aspartic acid (D226) or asparagine (N226), inthe AG motif I (Fig. 3B). A BLASTP search showed that the RkAG1-1and RkAG1-2 had the highest homology to PN in I. nil (75% [E-value:5e−132] and 75% [4e−131] amino acid identities, respectively),FBP6 in Petunia × hybrida (74% [1e−129] and 74% [9e−129] aminoacid identities, respectively) and PLE in A. majus (73% [4e−128] and73% [3e−127] amino acid identities, respectively). MADS domainsand AG motifs are characteristic of MADS-box genes and AG homo-logues, respectively (Munster et al., 1997; Kramer et al., 2004). Thededuced amino-acid sequences of MADS domain, the I regions, Kboxes, and AG motifs I and II of the C-terminal regions of RkAG1-1and RkAG1-2 both were highly conserved among the AG ortholo-gous genes in eudicots (Fig. 3B). A phylogenetic tree showed thatRkAG1-1 and RkAG1-2 formed a cluster with C class genes such asPN in I. nil, FBP6 in P. × hybrida and PLE in A. majus (Fig. 3C). Parts ofthe amino acid were a state of an amino acid peculiar to PLE lineage(Kramer et al., 2004).

3.4. Expression analysis of class B and C genes in floral organs

To analyze the expression of the RrPI, RpAP3, RkAG1-1/-2 inthe floral organs of ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’, semi-quantitative RT-PCR and RT-qPCR was performed (Fig. 4). Inpreliminary experiment, it is confirmed that both RrPI and RkAGprimer set amplified two homologous genes having difficulty indistinction in R. kaempferi.

In semi-quantitative RT-PCR to confirm the band patterns in flo-ral organs, transcription of the class C gene RkAG was detected inwhorls 3 and 4 of all plants. The strong expression of RkAG in whorl2 which is not shown in wild type and wtSH was shown apparentlyin ‘Kagaribi’ and ‘Kinshibe’. Transcription of the class B genes RrPIand RpAP3 were detected in whorls 2 and 3 of all plants (Fig. 4A).

Furthermore, to confirm the relative expression level of class Band C genes in floral organs in a plant, RT-qPCR was performed.The expression of RkAG in whorl 2 of ‘Kagaribi’ and ‘Kinshibe’ was

detected as well as the result in semi-quantitative RT-PCR (Fig. 4B).The expression levels of RkAG in whorl 2 to whorl 3 of ‘Kagaribi’ and‘Kagaribi’ was approximately 27% and the same level, respectively.In ‘Kin-kujyaku’, expression level of RkAG in whorl 2 to whorl 3 wasapproximately 1.37%. The relative expression of class B genes RrPIand RpAP3 were detected in whorl 2 and 3 as well as the result insemi-quantitative RT-PCR.

4. Discussion

The corollas of all of the cultivars were separated into 5 partsby the formation of narrow petals or staminoid organs. ‘Kagaribi’and ‘Kinshibe’ formed filament-like organs in whorl 2, and mostof the petals of ‘Kinshibe’ showed prominently staminoid organs.The similarities between the epidermal cells of the base portions ofthe organs in whorls 2 and 3 in ‘Kagaribi’ and ‘Kinshibe’ supportedthe above-mentioned inference regarding the staminoid petals ofthe two cultivars. The alteration to intermediate between petal andfilament in whorl 2 of ‘Kagaribi’ may possibly relate to the absenceof the innate ability to form anthers in the stamens of whorl 3.However, even though the petals in whorl 2 of ‘Kin-kujyaku’ werenarrowed, the epidermal cells were not similar to the stamen cellsin whorl 3 but were similar to the wild-type cells. The width of theleaves and petals were markedly reduced in comparison with thewild type, suggesting the failure to develop the lateral organs inthe transverse plane (Table 2). These traits are similar to ‘Seigaiha’,which is the cultivar in R. macrosepalum. In our previous study, itwas proposed that ‘Seigaiha’ might possess a pleiotropic mutation(Tasaki et al., in press).

The ag mutant in Arabidopsis results in the overall phenotype ofa flower within a flower and the absence of stamens and carpels(Yanofsky et al., 1990). Ito et al. (2007) reported that the floralhomeotic gene, AG, plays a central role in reproductive organ devel-opment in A. thaliana and controls late-stage stamen development,including anther morphogenesis and dehiscence and the formationand elongation of the filament. PLE in A. majus, which is orthologousto AG, is required for the stamens and carpels to develop (Bradleyet al., 1993; Davies et al., 1999). RkAG1-1/-2 showed 73% aminoacid similarity with PLE and formed a cluster with the class C genesin the phylogenetic tree. These results suggest the possibility thatRkAG1-1/-2 might be responsible for the MADS-box C function inazalea.

Although the RkAG expression levels in whorl 2 of wild typeand wtSH were approximately 0.01% and 0.23%, compared withwhorl 3, respectively, the RkAG expression of ‘Kagaribi’ and ‘Kin-shibe’ was strongly detected. It is thought that the conversion ofpetals to staminoid organs in whorl 2 of ‘Kagaribi’ and ‘Kinshibe’might be related to the RkAG in whorl 2; the ectopic expressionof PLE in whorl 2 is observed in the fistulata mutant of A. majus,and it has staminoid petal mutation (Mcsteen et al., 1998; Motteet al., 1998). Cartolano et al. (2007) reported on the mechanism ofthe spatial restriction of the class C genes by FISTULATA in A. majusand BLIND, in P. hybrida. In azalea, a similar factor might be pre-venting the expression of RkAG in whorl 2. However, the irregularexpression pattern of RkAG in whorl 1 was also observed in theother species and cultivars of azalea (data not shown). To under-stand the relationship of the expression pattern and morphology inazalea, it is necessary to consider the stage of the floral organs andgenes that are analyzed. Indeed, strong RkAG expression was notdetected in whorl 2 of ‘Kin-kujyaku’, and the expression patternsof the MADS-box genes were similar to the wild type. In Petunia(Vandenbussche et al., 2009), the maw chsu double mutant showedsevere pleiotropic mutations that were similar in morphology to‘Kin-kujyaku’. In the present study, we focused on other homeoticgenes; we are currently analyzing this trait.



Fig. 4. Expression analysis of the MADS-box class B and C genes in wild-type plant, wtSH, ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’ of R. kaempferi. (A) Semi quantitative RT-PCRanalysis. 1–4: whorl 1–4. Se: sepal, Pe: petal, St: stamen, Pi: pistil, StP: staminoidy petal, AS: antherless stamen, SO: staminoid organ, NP: narrow petal. ACTIN was used asan internal control. (B) RT-qPCR analysis. ACTIN and HISTONE H3 was used as an internal control. Expression data were standardized in respective plant independently.

Table 2Average size of lateral organs in R. kaemnferi, ‘Kagaribi’, ‘Kinshibe’ and ‘Kin-kujyaku’.

R. kaempferi ‘Kagaribi’ ‘Kinshibe’ ‘Kin-kujyaku’

Sepal (n = 40)Sepal length 3.4 ± 0.8dab 4.2 ± 1.2a 5.5 ± 1.4b –Sepal width 2.9 ± 0.5a 2.6 ± 0.7a 2.1 ± 0.3b –Sepal index 0.87 ± 0.12 0.65 ± 0.18 0.42 ± 0.18 –

Petal (n = 40)a

Petal length 37.5 ± 3.2a 33.3 ± 4.0b 29.6 ± 1.8c 30.4 ± 3.4cPetal width 19.1 ± 0.9a 4.6 ± 2.2b – 2.9 ± 0.7cPetal index 0.52 ± 0.06 0.13 ± 0.07 – 0.10 ± 0.02

Stamen (n = 40)c

Filament length 35.7 ± 2.3a 25.1 ± 3.1b 31.6 ± 2.3c 26.3 ± 3.5bPistil (n = 8)

Style length 37.7 ± 1.1a 27.1 ± 1.9b 31.5 ± 2.5c –Leaf (n = 8)

Leaf length 45.4 ± 5.9a 47.4 ± 3.7a 33.8 ± 5.6b 39.5 ± 2.4abLeaf width 22.3 ± 4.7a 21.0 ± 1.4a 14.5 ± 2.8b 2.4 ± 0.4cLeaf index 0.49 ± 0.07 0.44 ± 0.02 0.43 ± 0.02 0.06 ± 0.01

a Petal length and width of ‘Kinkujyaku’ is 35 replications.b Letters represent results from Tukey’s multiple comparison test (P < 0.01) of each organ in wild-type and cultivars.c Filament length of ‘Kagaribi’ and ‘Kinkujyaku’ is 36 and 24 replications, respectively.d Mean ± SD.



We are cultivating crossbred lines using these cultivars. Basedon this report, we will continue our homeotic gene analysis andheredity investigation in an attempt to obtain basic informationregarding floral formation, and the obtained data will be applied toazalea plant breeding.

Acknowledgments

This study was surrported by Grant-in-Aid for ScientificResearch (KAKENHI Nos. 22580032 and No. 23241076) from JapanSociety for the Promotion of Science (JSPS).

References

Bradley, D., Carpenter, R., Sommer, H., Hartley, N., Coen, E., 1993. Complementaryfloral homeotic phenotypes result from opposite orientations of a transposon atthe plena locus of Antirrhinum. Cell 72, 85–95.

Cartolano, M., Castillo, R., Efremova, N., Kuckenberg, M., Zethof, J., Gerats, T.,Schwarz-Sommer, Z., Vandenbussche, M., 2007. A conserved microRNA mod-ule exerts homeotic control over Petunia hybrida and Antirrhinum majus floralorgan identity. Nat. Genet. 39, 901–905.

Chamberlain, D.F., Rae, S.J., 1990. A revision of Rhododendron. IV Subgenus Tsutsusi.Edinb. J. Bot. 47, 89–200.

Cheon, K.S., Nakatsuka, A., Kobayashi, N., 2011. Isolation and expression patternof genes related to flower initiation in the evergreen azalea Rhododen-dron × pulchrum ‘Oomurasaki’. Sci. Hort. 130, 906–912.

Coen, E.S., Meyerowitz, E.M., 1991. The war of the whorls: genetic interactions con-trolling flower development. Nature 353, 31–37.

Davies, B., DiRosa, A., Eneva, T., Saedler, H., Sommer, H., 1996. Alteration of tobaccofloral organ identity by expression of combinations of Antirrhinum mads-boxgenes. Plant J. 10, 663–677.

Davies, B., Motte, P., Keck, E., Saedler, H., Sommer, H., Schwarz-Sommer, Z., 1999.PLENA and FARINELLI: redundancy and regulatory interactions between twoAntirrhinum MADS-box factors controlling flower development. EMBO J. 18,4023–4034.

De Keyser, E., De Riek, J., Van Bockstaele, 2007. Gene expression profiling of keyenzymes in azalea flower colour biosynthesis. Acta Hort. 743, 115–120.

Goto, K., Meyerowitz, E.M., 1994. Function and regulation of the Arabidopsis floralhomeotic gene PISTILLATA. Genes Dev. 8, 1548–1560.

Ito, I., Creech, J.L., 1984. A Brocade Pillow: Azaleas of Old Japan. John Weatherhill,Inc., New York/Tokyo.

Ito, T., Ng, K.-H., Lim, T.-S., Yu, H., Meyerowitz, E.M., 2007. The homeotic protein AGA-MOUS controls late stamen development by regulating a jasmonate biosyntheticgene in Arabidopsis. Plant Cell 19, 3516–3529.

Jack, T., Brockman, L.L., Meyerowitz, E.M., 1992. The homeotic gene APETALA3 ofArabidopsis thaliana encodes a MADS box and is expressed in petals and stamens.Cell 68, 683–697.

Kobayashi, N., Handa, T., Yoshimura, K., Tsumura, Y., Arisumi, K., Takayanagi, K.,2000. Evidence for introgressive hybridization based on chloroplast DNA poly-morphisms and morphological variation in wild evergreen azalea populationsof the Kirishima mountains Japan. Edinb. J. Bot. 57, 209–219.

Kobayashi, N., Ishihara, M., Ohtani, M., Nakatsuka, A., Cheon, K.S., Mizuta, D., Tasaki,K., 2010. Evaluation and application of the long-lasting flower trait (Misome-Sho) of azalea cultivars. Acta Hort. 855, 165–168.

Kramer, E.M., Jaramillo, M.A., Di Stilioa, V.S., 2004. Patterns of gene duplication andfunctional evolution during the diversification of the AGAMOUS subfamily ofMADS box genes in angiosperms. Genetics 166, 1011–1023.

Kumakura, H., 1976. Yamatsutsusi to sono hinshu. In: Garden Life. Garden Series:Tsutsuji, Sono Shurui to Saibai. Seibundoshinkosha, Tokyo, pp. 78–80 (inJapanese).

Kunishige, M., Kobayashi, Y., 1980. Chromatographic identification of Japanese aza-lea species and their hybrids. In: Luteyn, J.L., O’brien, M.E. (Eds.), ContributionToward a Classification of Rhododendron. New York Bot. Garden, New York, pp.277–287.

Kurashige, Y., Kobayashi, N., 2008. Evergreen azalea cultivars and breeding trendsin the Taisho era inferred by discovered “azalea research notes” of Kanagawaagricultural research station. Hort. Res. (Japan) 7, 323–328 (in Japanese withEnglish abstract).

Mcsteen, P.C.M., Vincent, C.A., Doyle, S., Carpenter, R., Coen, E.S., 1998. Controlof floral homeotic gene-expression and organ morphogenesis in Antirrhinum.Development 125, 2359–2369.

Motte, P., Saedler, H., Schwarz-Sommer, Z., 1998. STYLOSA and FISTULATA: regula-tory components of the homeotic control of Antirrhinum floral organogenesis.Development 125, 71–84.

Munster, T., Pahnke, J., Di Rosa, A., Kim, J.T., Martin, W., Saedler, H., Theissen, G.,1997. Floral homeotic genes were recruited from homologous MADS-box genespreexisting in the common ancestor of ferns and seed plants. Proc. Natl. Acad.Sci. U.S.A. 94, 2415–2420.

Nakatsuka, A., Hibino, S., Kinoshita, Y., Mizuta, D., Nakagawa, T., Kobayashi, N., 2009.Analysis of expressed sequence tags (EST) from corolla of Rhododendron ripenseMakino. Hort. Res. (Japan) 8 (Suppl. 2), 525 (In Japanese).

Nakatsuka, A., Mizuta, D., Kii, Y., Miyajima, I., Kobayashi, N., 2008. Isolation andexpression analysis of flavonoid biosynthesis genes in evergreen azalea. Sci.Hort. 118, 314–320.

Saitou, N., Nei, N., 1987. The neighbour-joining method: a new method for recon-structing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Sommer, H., Beltran, J.P., Huijser, P., Pape, H., Lonnig, W.E., Saedler, H., Schwarz, Zs.,1990. Deficiens, a homeotic gene involved in the control of flower morphogene-sis in Antirrhinum mujus: the protein shows homology to transcription factors.EMBO J. 9, 605–613.

Tasaki, K., Nakatsuka, A., Kobayashi, 2012. N. Morphological analysis of narrow-petaled cultivars of Rhododendron macrosepalum Maxim., J. Japan. Soc. Hort. Sci.,in press.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensi-tivity of progressive multiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,4673–4680.

Tröbner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Lönnig, W.E., Saedler, H., Som-mer, H., Schwarz-Sommer, Z., 1992. GLOBOSA: a homeotic gene which interactswith DEFICIENS in the control of Antirrhinum floral organogenesis. EMBO J. 11,4693–4704.

Weigel, D., Meyerowitz, E.M., 1994. The ABCs of floral homeotic genes. Cell 78,203–209.

Wilson, E.H., Rehder, A., 1921. A Monograph of Azaleas. Theophrastus. Little Comp-ton, Rhode Island.

Vandenbussche, M., Horstman, A., Zetho, J.F., Koes, R., Rijpkema, A.S., Gerats, T.,2009. Differential recruitment of WOX transcription factors for lateral devel-opment and organ fusion in Petunia and Arabidopsis. Plant Cell 21, 2269–2283.

Yamazaki, T., 1996. A Revision of the Genus Rhododendron in Japan, Taiwan, Korea,and Sakhalin. Tsumura Laboratory, Tokyo.

Yamazaki, T., Kumakura, H., Nozawa, K., Akabane, M., Suzuki, Y., 1979. YamatsutsusiKei, Garden Life, Color Engei Sensho: Nihon no Engei Tsutsusi. Seibun-doshinkosha, Tokyo, pp. 17–24 (in Japanese).

Yanofsky, M.F., Ma, H., Bowman, J.L., Drews, G.N., Feldmann, K.A., Meyerowitz, E.M.,1990. The protein encoded by the Arabidopsis homeotic gene agamous resemblestranscription factor. Nature 346, 35–39.

Morphological and expression analyses of MADS genes in Japanese traditional narrow- and/or...

Documents

Transcript of Morphological and expression analyses of MADS genes in Japanese traditional narrow- and/or...