Molecular Phylogenetics and Evolution 49 (2008) 368–376

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/locate /ympev

Short Communication

Molecular signatures of two cattail species, Typha domingensis and Typhalatifolia (Typhaceae), in South Florida

Xing-Hai Zhang a,*, Manuel Tapia a, James B. Webb a, Yi-Hong Huang a, ShiLi Miao b

a Department of Biological Sciences, Florida Atlantic University, 777 Glades Road, Boca Raton, FL 33431, USAb Everglades Division, South Florida Water Management District, 3301 Gun Club Road, West Palm Beach, FL 33406, USA

a r t i c l e i n f o

Article history:Received 26 March 2008Accepted 28 March 2008Available online 4 April 2008

1055-7903/$ - see front matter � 2008 Elsevier Inc. Adoi:10.1016/j.ympev.2008.03.032

* Corresponding author. Fax: +1 561 297 2749.E-mail address: xhzhang@fau.edu (X.-H. Zhang).

a b s t r a c t

� 2008 Elsevier Inc. All rights reserved.

1. Introduction

Cattails (Typha spp., Typhaceae) are perennial, monocot clonalplants found worldwide in wetlands, lakes and rivers (McNaughton,1966; Smith, 1987). Among three cattail species found in NorthAmerica, Typha domingensis, Typha latifolia and Typha angustifolia,the former two grow in South Florida. In early 1900s, T. domingensiswas recorded only in small isolated patches in the Everglades. How-ever, during the past few decades it has expanded rapidly. In WaterConservation Area 2A (Fig. 1) alone over 6000 ha of native wetlandhabitat has been replaced by dense monotypic T. domingensis stands,with another 6000 ha having a marked cattail presence. The expan-sion of cattails in the historically oligotrophic Everglades is symp-tomatic of nutrient loading, altered hydrology and changes in thenatural fire regime (Davis, 1994; Rutchey and Vilcheck, 1999; Miao,2004; Weisner and Miao, 2004). The invasiveness of cattails poses athreat to the Everglades ecosystem structure, function and biodiver-sity. In contrast, T. latifolia is sparsely populated in South Florida.Another cattail T. angustifolia was introduced to North America inthe early 1800s and has since been spreading to many US statesbut has not yet been found in Florida. Monitoring the spread of thesecattail species is an important task for habitat restoration and watermanagement. Yet, no reliable method of identifying and differentiat-ing T. domingensis and T. latifolia currently exists. Furthermore,because both species exhibit different hydrological tolerances(Grace, 1989), their presence becomes important for Evergladeshydrological restoration (Davis and Ogden, 1994). Accurate speciesidentification is integral to this process.

Cattails are known self-pollinators, but cross- or neighbor-polli-nation occurs given suitable conditions (Krattinger, 1975). Putativehybrids among the three North American species have been exper-imentally produced (Smith, 1967, 1987). Despite its sterility, a cat-tail named Typha � glauca, a hybrid between the native T. latifolia

ll rights reserved.

and the exotic T. angustifolia, has become an aggressive invaderof wetlands across much of the eastern USA (Galatowitsch et al.,1999). The presence of this hybrid suggests ongoing interspecifichybridization in cattails. Marburger et al. (2005) suggested thathybridization might be an important mechanism underlying cattailinvasion across the Great Lakes region. However, another study didnot find any gene flow between these two species in the centralUSA (Selbo and Snow, 2004). Hybrids of T. domingensis � T. latifoliaare known only from a few collections (Flora of North America,1993). This introgression is probably uncommon due to theextreme sterility of the hybrid progeny, although no extensiveinvestigation has been reported.

Natural hybridization (crossing) of Typha species, if indeedoccurred, may produce a progeny that behaves differently thantheir parents. It has been well demonstrated that cattail expansionin the Everglades correlates nutrient enrichment and hydrologicalalterations (Davis, 1994; Wu et al., 1997; Rutchey and Vilcheck,1999; Miao, 2004; Weisner and Miao, 2004). However, it is notclear whether cattails in nutrient-enriched areas are (1) hybridsbetween T. domingensis and T. latifolia, or (2) the same genotypeof T. domingensis that is distributed in various areas. To our knowl-edge, no natural hybrid between the two species has been identi-fied even though they are occasionally found to grow insympatry. However, reliable identification of these closely relatedspecies or their potential hybrids is lacking, which not only hindersthe phylogenetic or evolutionary studies of Typha species and otherrelevant taxa, but also affects management of habitat preservationefforts.

Typha domingensis and T. latifolia are morphologically similar. Itis difficult to visually distinguish these species in the field, espe-cially before the spadix (flower) appears (Fig. 2A and B). T. latifoliais often identified by their darker pistillate (portion of the femaleinflorescence) and wider leaves (Fig. 2C). The elongated gap be-tween the staminate and pistillate is considered the defining char-acteristic of T. domingensis (Fig. 2D). Unfortunately, these traits arenot always consistent and misidentification often occurs. For

Fig. 1. Water conservation areas in South Florida and sample locations. Ok, city ofOkeechobee; re, reference (non-impacted) location in WCA 2; br, Boca Ratoncampus, Florida Atlantic University. Samples Nos. 1–3 from WCA 1 and Nos. 15–17from WCA 3 are also considered from non-impacted locations because of theirdistance from canals.

X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376 369

example, depending on growth conditions in the field, leaf widthcan vary greatly for both species. The pistillate of T. domingensiscan be darker and the gap on spadix of T. latifolia can be somewhatelongated as well (Fig. 2E and F). It would be expected that themorphology of any possible hybrid would be even more indistin-guishable from their parents. Definite species identification is notonly a primary requirement for the accuracy of the GenBank data-base needed for any valid studies involving these species, but alsoconstitutes the necessary foundation for detection of any emerginghybrids in the natural habitats. Comparative analysis of nuclearand organelle DNA sequences in these plants should sufficientlyserve this purpose.

Previous studies found a lack or a low degree of genetic diver-sity in both T. domingensis and T. latifolia populations (Mashburnet al., 1978; Sharitz et al., 1980; Keane et al., 1999; Lamote et al.,2005), indicating intraspecific genetic homogeneity. This is proba-bly due to their primary modes of reproduction, i.e. self-pollinationand vegetative propagation by rhizomatous growth (Krattinger,1975). However, a high degree of intraspecific polymorphismwas observed in the microsatellite loci in both T. latifolia and T.angustifolia (Tsyusko-Omeltchenko et al., 2003). Numerous DNAsequences for T. latifolia and a few for T. angustifolia are reportedin the database. However, there is only one entry of a partial 26SrRNA gene sequence for T. domingensis and none for the NorthAmerican collections of T. angustifolia. We are not aware of anycomparative studies using molecular markers for Typha species

verification and phylogeny. Moreover, during the course of thisstudy, we discovered cases of dubious phylogeny and suspectedspecies misidentification or ambiguity that further highlight theimportance of species identification and verification. Thus, themain objective of our study was to develop DNA markers of bothnuclear and chloroplast genes for the two cattail species fromSouth Florida. By examining intraspecific and interspecific varia-tion, we hoped to generate biparental and maternal molecular sig-natures for accurate verification of Typha species that can bereliably used for studies of species phylogeny and evolution. Ourstudy demonstrates that nucleotide sequence variation can serveas an effective means for Typha species identification and as a valu-able supplement and verification to morphological examination. Asecondary objective was to examine whether genotypic differenti-ation occurred in populations along a nutrient gradient in SouthFlorida.

2. Materials and methods

2.1. Sample collection

Leaves or seeds of cattails Typha domingensis Pers. and T. latifoliaL. were collected from Water Conservation Areas (WCAs) 1, 2 and 3in the Everglades Protect Area and distant Central Florida regionsof Okeechobee city, St. John River and Kissimmee River areas(Fig. 1, other coordinates available upon request), resulting in a to-tal of 25 locations. At least four samples from each location wereobtained, each of which was at least 10 m apart to ensure that theywere not from the same rhizomatous clones. Two additional sam-ples of T. domingensis were also collected from northern Mexico. Inthe WCAs, the samples were collected from the impacted, nutrient-enriched regions that are located nearby man-made canals whererunoff from residential or agricultural areas often occurs. The‘‘non-impacted” or ‘‘reference” regions are deep inside the wet-lands and not easily accessible to humans. Seeds were also col-lected from WCA 2 and germinated in the greenhouse on theBoca Raton campus, Florida Atlantic University. Seedlings were col-lected and used for DNA isolation. The DNA samples of T. angusti-folia collected from the Great Lakes region (USA) were kindlyprovided by Dr. S. Travis of University of New England (Maine,USA).

2.2. DNA isolation, PCR, cloning, sequencing and analysis

Total cellular DNA was isolated from leaves (�100 mg freshweight each) using Qiagen Plant DNeasy mini kit (Valencia, Califor-nia, USA) as previously described (Zhang et al., 2001). Polymerasechain reaction (PCR) was carried out using the high fidelityproof-reading DNA polymerases Pfx (Invitrogen, Carlsbad, Califor-nia, USA) or PrimeSTARTM HS (TaKaRa, Shiga, Japan) according tothe protocols by the manufacturers. The primers (see supplemen-tary data) were designed based on the conserved sequences for T.latifolia or T. angustifolia whenever available in the databases. Fornuclear gene cloning, 20 or more populations were sampled,depending on the genes. For chloroplast DNA cloning, overlappingclones were obtained by PCR using DNA samples from two popula-tions (WCA 2 reference site and a St. John River site) of each spe-cies. Theses two sites are separated by over 300 km.

The amplified DNAs were separated by agarose gel electropho-resis and extracted with GENECLEAN� III kit (Q-BIOgene, Irvine, CA,USA). The DNA fragment was ligated to pCR�-Blunt II-TOPO orpCR�-Blunt vectors (Invitrogen) and transferred into Escherichiacoli competent cells. The plasmids were isolated from selected col-onies and verified by restriction enzyme digestion and gel electro-phoresis. At least four randomly picked clones were analyzed from

Fig. 2. Morphology of two cattails from South Florida, Typha latifolia and T. domingensis. Leaf width (A and B) and spadix (C and D) are commonly used to distinguish cattailspecies. However, these phenotypes are not always a reliable indicator in the natural habitats, such as in the example of flower color and shape (E and F).

370 X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376

X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376 371

each plant sample to minimize the possibility that a differentmember of a gene family was accidentally cloned for comparison.Sequencing of chloroplast genomic clones was done by primerwalking. DNA sequencing for both directions was done at the R.J.Carver Biotechnology Center at University of Illinois (Urbana, IL,USA) and Northwestern University Biotechnology Center (Chicago,IL, USA). Sequence analysis was carried out with Biology Work-bench (San Diego Supercomputer Center, CA, USA) and NCBI pro-grams. Wherever possible, sequences available in databases wereused as a reference.

3. Results and discussion

3.1. Low degrees of intraspecific DNA polymorphism

DNA sequences are inherently informative of taxa evolution andphylogeny. Whereas coding regions are generally more conservedand non-synonymous substitutions (resulting in changes in pro-tein sequences) are rare, non-coding sequences in introns andintergenic regions are more divergent due to the lack of selectionconstraints. Thus, sequence information from both coding andnon-coding regions may provide a more comprehensive snapshotof possible genomic changes. As for nucleotide substitutions,transition substitutions (between two purines or between twopyrimidines) occur more frequently than transversions (purine M

pyrimidine) and may become saturated over evolutionary time.However, transition status may suggest relationships amongclosely related taxa such as intragenus and intraspecific variation.In contrast to the nuclear genes, chloroplasts of Typha species areinherited maternally and cannot be transmitted through pollen.Therefore, chloroplast DNA sequences, along with the biparentalnuclear genes, are useful for phylogenetic analysis and detectionof putative hybrids (Provan et al., 2001).

We examined three intron-containing nuclear genes (malatesynthase, metallothionein-like protein and phytochelatin synthase)and an approximately 15-kb fragment of the chloroplast genomes.Malate synthase (MS) converts glyoxylate to malate in the glyoxy-late cycle. It is responsible for energy mobilization through fatty acidmetabolism during processes such as seed germination and senes-cence in plants (Graham et al., 1992). Metallothioneins (MT) aresmall cysteine-rich proteins found in a wide variety of plants andanimals. They play an important role in heavy metal metabolism(Grill et al., 1987). Phytochelatins are a family of cysteine-richthiol-reactive peptides that are functionally analogous to metallo-thioneins. They are found in many organisms, and are able to detox-ify heavy metals (Grill et al., 1987; Heiss et al., 2003; Li et al., 2004).Phytochelatin synthases (PS) from plants, yeast and animals have aconserved N-terminal sequence that is hypothesized to be the acti-vation and catalytic site and a variable C-terminal that acts as a sen-sor of metal ions. We chose to analyze the more divergent 30-portionof the gene coding for the C-terminus, which also includes an intronand a 56 bp 30-untranslated region (UTR).

We found no intraspecific variation among populations fromnutrient-enriched and non-impacted (reference) areas of either T.domingensis or T. latifolia for the nuclear genes malate synthaseand phytochelatin synthase. Among the 20 T. domingensis popula-tions, we observed two nucleotide transitions in one population(WCA 2A reference, Fig. 1) in the first intron of the metallothioneingene (see below and supplementary data). This was the only intra-specific polymorphism detected in this study. The low degree ofintraspecific polymorphism observed in these two cattail speciesof South Florida is consistent with several previous studies show-ing a lack of genetic variation in T. latifolia (Mashburn et al.,1978; Sharitz et al., 1980; Keane et al., 1999; Lamote et al.,2005). It is not entirely surprising that we did not detect anynoticeable intraspecific polymorphism associated with the water

nutrient conditions. Even though it is possible that such nutrient-linked DNA variation might exist for other genes or genomicregions among these populations, we consider such genomicchanges unlikely or very rare particularly because anthropogenicchanges in the Florida Everglades are a recent event. We believethat changes in gene expression related to water/soil nutrientconditions are more likely contributing to any phenotypic variationamong the cattail populations.

3.2. Interspecific variation in the nuclear genes

In contrast to the low DNA polymorphism within the T. latifoliaor T. domingensis populations in Florida, extensive interspecific orinter-ecotypic variation was detected in the nuclear genes as de-scribed below.

3.2.1. Malate synthase (MS)The MS sequence of T. latifolia samples collected in Florida was

identical to that of T. latifolia previously published (AF249966, Le-wis and Doyle, 2001). Between T. latifolia and T. domingensis, therewere four synonymous nucleotide substitutions in the coding re-gion (variation rate at 2.3% of the region sequenced), and nine sub-stitutions (variation rate at 5.0%) in the intron region (supplementdata). When compared to T. angustifolia, T. latifolia and T. domingen-sis differed by 2 and 4 synonymous nucleotide substitutions in thecoding sequence and 9 and 11 substitutions in the intron, respec-tively (supplement data). Therefore, even though the MS proteinappeared to be highly conserved between these Typha species,extensive DNA polymorphism was found.

3.2.2. Metallothionein-like protein (MT)A portion of the MT gene including two introns was cloned

from populations of T. latifolia, T. domingensis and T. angustifoliaand compared to the reported sequences from T. latifolia(AF419840) (Zhang et al., 2004) and T. angustifolia (EF543084).The sequences differed not only among the three species, butsurprisingly also between the samples of the same species. Com-pared to our T. latifolia, T. domingensis and T. angustifolia,AF419840 (T. latifolia) had a 3-bp (ACC) insertion in the codingregion, resulting in an extra threonine residue in its predictedprotein sequence. Otherwise, the coding sequence was identicalbetween these three species. However, there was extensive var-iation within the introns. Most notable were two 4-bp deletionsand one 11-bp insertion in the second intron for our T. latifoliasamples, as compared to our T. domingensis collections andAF419840 (supplement data). It is puzzling to note that althoughdesignated as T. latifolia, AF419840 (Tl1 in Fig. 3A) was phyloge-netically closer to the T. angustifolia or T. domingensis than to ourT. latifolia (Tl2 in Fig. 3A), and contained the same two 4-bpinsertions and a 11-bp deletion found in other Typha species ex-cept for our T. latifolia (supplement data). Between the two T.angustifolia collections MT DNA polymorphism was also foundin the introns, resulting in separate clusters on the phylogeneticgene tree (Ta1 and Ta2 in Fig. 3A and supplement data). Thisunexpected discrepancy could be due to (1) the divergence be-tween the ‘‘Old World” ecotypes (Tl1 and Ta1 from Asia) andthe ‘‘New World” ones (Tl1 and Ta2 from North America), (2)paralogy of the MT genes compared, and/or (3) misidentificationof species or subspecies. The confusion and uncertainty in DNA-derived species phylogeny is further illustrated by the analysis ofphytochelatin synthase genes (see below), demonstrating thecomplexity and difficulty, therefore the importance, of Typhaspecies identification/validation. Nevertheless, the presence/ab-sence of insertions/deletions in the MT intron could be used asa molecular signature to distinguish T. latifolia or T. angustifoliafrom T. domingensis, at least for the North American ecotypes.

Table 1Intron sequence variation of phytochelatin synthase gene between T. latifolia,T. domingensis and T. angustifolia from North America

Species pair Insertion (bp)a Substitutions (bases)

Transition Transversion Total

T. latifolia/T. domingensis 2/5 25 8 33T. latifolia/T. angustifolia 30/4 16 13 29T. domingensis/T. angustifolia 31/2 13 10 23

a Insertions are generated in the maximal positional alignment.

Fig. 3. Phylogenetic relationship between T. angustifolia, T. latifolia and T. doming-ensis. (A) PHYLIP unrooted dendrogram based on type 2 metallothionein-likeprotein genes including introns. Ta1: T. angustifolia (India, EF543085) and Ta2:T. angustifolia (USA); Tl1: T. latifolia (China, AF419840, Zhang et al., 2004); Tl2 andTd: T. latifolia and T. domingensis samples collected from Florida populations, res-pectively; Tdr: T. domingensis samples collected from a reference site (non-impac-ted WCA 2A) (Fig. 1). (B) PHYLIP unrooted dendrogram based on phytochelatinsynthase cDNA sequences. Ta: T. angustifolia (USA); Tl1: T. latifolia sequence (China,AF308658); Tl2 and Td: T. latifolia and T. domingensis (Florida populations).

372 X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376

3.2.3. Phytochelatin synthase (PS)Between our T. latifolia and T. domingensis, there were five sub-

stitutions resulting in one amino acid change (proline ? leucine)in the coding region, and one substitution (T ? A) in 30-UTR. Whencompared to the T. angustifolia coding sequence, there were 5 and 3substitutions for T. latifolia (one amino acid change) and T. doming-ensis, respectively (supplement data). The intron exhibited moreextensive variation (23 to 33 substitutions, Table 1) and differedin size (862, 865 and 836 bp in T. latifolia, T. domingensis andT. angustifolia, respectively). There were numerous insertions/dele-tions between these Typha species, notably a 25-bp deletion inT. angustifolia as compared to the other two species (data notshown). These changes are a strong indication of pronounceddivergence in this gene, particularly in the non-coding intron,and should be phylogenetically informative as molecular signa-tures for these two Typha species.

A PS cDNA sequence (AF308658) that is derived from the sameT. latifolia plant (Asian ecotype) as the MT gene AF419840discussed above was again more similar to our T. domingensis orT. angustifolia than to our T. latifolia (Fig. 3B). Compared to ourT. domingensis, AF308658 differed by one synonymous substitutionin the 394-bp coding region (supplement data) and one substitu-tion in 30-UTR. In contrast, there were 5 substitutions (resultingin proline ? leucine change) in the coding region and two substi-tutions in 30-UTR between AF308658 and our T. latifolia (supple-ment data). There is no intron information in AF308658.Together with the analysis of MT proteins above (Fig. 3A), ourresults have revealed unexpectedly a more divergent and puzzlingphylogeny for ecotypes of Typha species, which not only demon-strates the complexity of Typha species verification but may alsoimply an active evolutionary process for Typha between the twoWorlds.

3.3. Chloroplast genomes of cattails

T. domingensis is the dominant cattail implicated in the emer-gence of monotypic habitat in the Florida Everglades. This specieshas not been studied at the molecular level. In order to study Typhaevolution and phylogeny, both nuclear and maternal molecular

markers are needed. Analyses of the limited nuclear gene sequencedata available for Typha have revealed an unexpected and some-what confusing phylogeny. To further examine the evolutionaryrelationship between Typha species in Florida, we have clonedand sequenced about 15-kb portion of the large single copy regionof the chloroplast genomes from representative populations ofT. latifolia and T. domingensis. This fragment spans from ATPase eto rps18, containing 16 protein-coding genes, an open readingframe (ORF) and 2 tRNA genes (Fig. 4). There was no nucleotidechange among populations within species. The gene organizationof the two cattails was similar to that of maize, rice and tobacco(Fig. 4). Several noticeable features were observed. First, a trun-cated WaccD was identified from both species that was similar tothat of Liriodendron tulipifera (DQ899947) and tobacco (Shinozakiet al., 1986) but had no similarity to the rice accD (Hiratsukaet al., 1989). accD is absent in the chloroplast genomes of wheat(Ogihara et al., 2002) and maize (Maier et al., 1995). This is inter-esting because accD (encoding a subunit of acetyl-CoA carboxyl-ase) is known to be located in a hotspot of divergence (Maieret al., 1995). It appears that the accD gene that is present in theplastid genomes of tobacco, Liriodendron, black pine and liverworthas been degenerated into a similar but truncated reading frame intwo Typha species, further to an unrecognizable ORF in rice and toits total elimination in wheat and maize. This observation leads usto speculate that the Typha WaccD may symbolize an internode inthe plastid genomic evolution and phylogeny. Whether the TyphaWaccD is functional remains to be studied. Second, we could notidentify rpl23/ORF133 between rbcL and accD in the cattails asfound in rice (Hiratsuka et al., 1989; Fig. 4), again reflecting thevariable property of this region. Finally, although the protein-and tRNA-coding genes were conserved, the intergenic regionsshowed a surprisingly high degree of divergence in both lengthand positional sequence between these two cattail plants.

3.4. Interspecific variation of the chloroplast genomes betweenT. latifolia and T. domingensis

Our T. latifolia chloroplast sequence is identical, wherever appli-cable, to the published partial sequences of the same species(AY147736, a USA collection; Leebens-Mack et al., 2005). Withinthe 17 protein-coding sequences, there were a total of 8 nucleotidechanges between T. latifolia and T. domingensis in three genes (rbcL,cemA and petL) resulting in two amino acid substitutions (both inrbcL; Table 2). The non-coding, intergenic regions (especially thelonger ones) were divergent with numerous insertions/deletionsand nucleotide substitutions (Tables 3 and 4 and Fig. 4). This vari-ation, especially from the insertion/deletion of repeats (Table 4 andFig. 4), suggests that T. latifolia and T. domingensis have experiencedsignificant divergent events in the chloroplast genomes since theirseparation. The fact that variation occurred mostly in the non-cod-ing intergenic regions, whereas the coding regions and theirrespective immediate 50- or 30-UTR sequences are highly con-served, reflects not only the selective constraints on the essentialfunctions of these genes but also a recent history of Typha specia-

Fig. 4. Gene organization of a portion of the chloroplast genomes from Typha spp. (T. latifolia and T. domingensis), maize (Maier et al., 1995), rice (Hiratsuka et al., 1989) andtobacco (Shinozaki et al., 1986). Note. petG in tobacco is same as petE in maize, rice and Typha. ycf stands for hypothetical chloroplast open reading frame.

Table 2Codon variation of chloroplast protein-coding regions between T. latifolia andT. domingensis

Gene Size (bp) T. latifolia vs. T. domingensis

Atpe 390 IdenticalAtpb 1488 IdenticalrbcL 1434 GCT (A) M GCA (A)

GCG (A) M GCA (A)TTA (L) M TCA (S)CGC (R) M CGT (R)GAG (E) M GAC (D)

waccD 558 IdenticalpsaI 111 Identicalycf4 555 IdenticalcemA 690 TAC (Y) M TAT (Y)

GAT (D) M GAC (D)petA 963 IdenticalpsbJ 123 IdenticalpsbL 117 IdenticalpsbF 120 IdenticalpsbE 252 IdenticalpetL 96 CTG (L) M CTA (L)petE 114 IdenticalpsaJ 129 Identicalrpl33 201 Identicalrps18 306 Identical

Letters in parenthesis denote amino acids.

X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376 373

tion. The insertion/deletion of repeats (Table 4) should represent aconvenient and reliable maternal molecular signature unique toeach species.

3.5. Species determination and phylogeny of Typha spp.

Accurate species identification is prerequisite to studies ofecology and evolution. Due to the similar and overlapping mor-phology of cattails in various habitats, the determination of Ty-pha species based solely on morphology is often unreliable (anexample in Fig. 2). The possible appearance of subspecies or nat-ural hybrids would further complicate taxonomic determination.Molecular evidence, especially DNA sequence information of nu-clear and organelle genes, should be used for species verificationat least as a supplemental tool. Even though spontaneous muta-tions caused by geographical separations or growth environmentcontribute to intraspecific DNA polymorphism, interspecificortholog variation should almost always be greater than intra-specific differences, with perhaps an exception of highly con-served sequences such as histone genes. Any discord betweenDNA sequence homology and species phylogeny should not becasually ignored. During the course of this study, we haveencountered several dubious Typha identities that defy evolu-tionary common sense based on DNA sequence comparison.One case is the nuclear metallothionein and phytochelatin syn-thase genes from two ecotypes of T. latifolia which were moredivergent to each other than either was to other Typha speciesas discussed above (Fig. 3). To further illustrate the efficacy ofusing DNA sequences as a sensitive species identifier, we exam-ined in detail the maternally transmitted, single copy chloroplastrbcL gene for the large subunit of ribulose-1,5-bisphosphate car-boxylase/oxygenase.

A total of five Typha rbcL sequences of various lengths arereported in the public domain—two each from T. latifolia andT. angustifolia and one from T. capensis, in addition to our collec-tions of T. angustifolia, T. latifolia and T. domingensis (Table 5).Analysis of these sequences reveals a surprising and puzzling phy-logenetic pattern regarding T. latifolia and T. angustifolia (Table 5

Table 3Variation in intergenic regions between chloroplast genomes of T. latifolia and T. domingensis

Intergene Size (bp) Insertion (bp) Substitutions (bp)

T. latifolia T. domingensis T. latifolia T. domingensis Transition Transversion

atpe–atpb 4 4 0 0 0 0atpb–rbcL 822 819 3 0 1 2rbcL–waccD 843 833 27 17 0 3psaI–ycf4 369 369 0 0 0 0ycf4–cemA 880 904 1 25 1 2cemA–petA 213 213 0 0 0 0petA–psbJ 1154 1162 0 8 1 3psbJ–psbL 121 121 0 0 0 0psbL–psbF 22 22 0 0 0 0psbF–psbE 16 16 0 0 0 0psbE–petL 1438 1452 15 1 5 5petL–petE 164 169 0 5 0 1petE–trnW 115 115 0 0 0 0trnW–trnP 138 139 0 1 0 0trnP–psaJ 359 355 5 1 0 3psaJ–rpl33 573 537 36 0 1 0rpl33–rps18 234 234 0 0 0 1

Table 4Insertion/deletion of repeats in intergenic regions between T. latifolia andT. domingensis

Intergene Repeat sequence T. latifolia T. domingensis

rbcL–waccD ATACAAGAT Insertion (twice) DeletionpetA–psbJ TATG Deletion InsertionpsbE–petL TAATT Deletion InsertionpetL–petE TAAAT Deletion InsertionpsaJ–rpl33 TGAGTTATTGATATGTGAAGA Insertion Deletion

TTAATAATATAATTAC Insertion Deletion

Fig. 5. Phylogenetic relationship between Typha rbcL genes based on the nucleotide(A) or amino acid (B) sequences. Rice (NC_008155) is used as outgroup. Tl1:T. latifolia (Florida, USA, this study and DQ069503, AZ, USA, Leebens-Mack et al.,2005); Tl2: T. latifolia (M91634, VA, USA, Duvall et al., 1993); Td: T. domingensis(FL, USA, this study); Ta1: T. angustifolia (AY952434, China); Ta1: T. angustifolia(AM110250, Denmark, Asmussen et al., 2006); Ta3: T. angustifolia (USA, this study)and Tc: T. capensis (AM235159, South Africa, Forest et al., 2007).

374 X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376

and Fig. 5; also supplement data). First, our T. latifolia rbcL (T. lati-folia3) was identical to T. latifolia1 (DQ069503) and very similar toT. latifolia2 (M91634), T. domingensis (this study), T. angustifolia3(USA ecotype, this study) and T. capensis (AM235159) (Table 5and Fig. 5). Within the amino acid sequence used for analysis,our T. domingensis rbcL was identical to T. latifolia1 and T. capensis.This observation is expected for a maternally transmitted andhighly conserved chloroplast gene. It may also suggest a closerphylogenetic relationship of T. domingensis to T. capensis thaneither to T. angustifolia (Fig. 5), even though T. capensis is not foundin North America. More sequence data from T. capensis are neededto support a more robust phylogenetic tree. Second, there was asurprisingly high degree of intraspecific variation in rbcL amongthe T. latifolia samples and particularly among the T. angustifoliaecotypes (Fig. 5 and Table 5). For example, phylogenetic trees de-rived from the nucleotide and amino acid sequences both placedthe three T. angustifolia plants in separate clusters (Fig. 5). Consid-ering Typha species appear to exhibit a very low level of intraspe-cific polymorphism in the nuclear genomes (Mashburn et al., 1978;

Table 5Variation of Typha rbcL genes by pairwise comparison

Taxon (collection locale) GenBank Accession No. 1

1. T. latifolia1 (AZ, USA) DQ069503 02. T. latifolia2 (VA, USA) M91634 53. T. latifolia3 (FL, USA) This study 04. T. domingensis (FL, USA) This study 35. T. angustifolia1 (China) AY952434 196. T. angustifolia2 (Denmark) AM110250 307. T. angustifolia3 (USA) This study 48. T. capensis (South Africa) AM235159 4

Below diagonal, number of nucleotide substitutions within the 1227-bp coding regionamino acid substitutions in the predicted 407-amino acid rbcL protein.

Sharitz et al., 1980; Keane et al., 1999; Lamote et al., 2005, and thisstudy), it is striking to observe such levels of intraspecific variationfor the maternally transmitted, highly conserved rbcL gene. Similardiscrepancies were also found in two entries of the chloroplast ATPsynthase b and e subunit genes both reportedly from T. latifolia(data not shown). Changes in the gene sequences due to ecotypedifferentiation are not likely to have caused such large scale nucle-otide substitutions. Assuming a negligible occurrence of sequenc-ing errors, the most obvious explanation for these discords iseither species misidentification or the presence of hybrid or sub-species in the sample pools.

Chloroplast genomes are overall highly conserved, especiallyfor coding sequences. For example, the sequence of operon psbJ–

2 3 4 5 6 7 8

1 0 1 6 6 2 10 1 2 7 7 3 25 0 1 6 6 2 18 3 0 7 5 2 0

16 19 22 0 12 8 635 30 27 44 0 3 5

9 9 1 22 26 0 59 4 1 23 27 2 0

with uncertain nucleotides removed from the dataset; above diagonal, number of

X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376 375

psbL–psbF–psbE is identical for T. latifolia, T. domingensis andT. angustifolia (supplement data), and the ycf2 sequence is samefor T. latifolia and T. domingensis. Yet the non-coding sequencessuch as in intergenic regions can be significantly variable as shownin this report. Chloroplast sequences that include both conservedand more variable regions such as those used in this study shouldbe informative in verifying the maternal parentage of closelyrelated species to generate a meaningful phylogeny. The aforemen-tioned gross divergence in the rbcL coding region is probably, atleast to a large extent, caused by mis-identification of the Typhaspecies due to their morphological similarity. On the other hand,Typha, as aquatic weedy plants with unique modes of reproductionand distribution in a wide range of ecosystems, may consist ofmore genetically divergent ecotypes, subspecies, species and/ornatural hybrids than currently known, even though the intraspe-cific genetic variation within populations is obviously very low(Mashburn et al., 1978; Sharitz et al., 1980; Keane et al., 1999;Lamote et al., 2005, and this study). Use of morphology alone toidentify Typha species may lead to erroneous annotations andcause distortions in the phylogenetic studies. Consequently, addi-tional care must be taken when dealing with DNA data from lessstudied taxa such as Typha. Our study has demonstrated the powerof DNA sequences as sensitive phylogenetic signatures for speciesidentification and verification and as a tool for studies of geneand species evolution. Application of the informative nuclear andchloroplast DNA signature sequences reported in this study shouldalleviate the difficulty in sample identification and data mining toadvance the study of molecular phylogeny and evolution in Typhaspecies.

4. Conclusions

(1) A lack of intraspecific genetic variation was confirmedamong populations of T. latifolia and T. domingensis grown acrossthe nutrient gradient in South Florida. Even though the existenceof nutrient-specific polymorphism for other genetic loci might stillbe possible, it is more likely that variation at the gene expressionlevel plays key roles in the growth response of the cattails to theanthropogenic changes in the habitats.

(2) Variation in both coding and intron sequences of malatesynthase and phytochelatin synthase can reliably distinguish T. lat-ifolia from T. domingensis in the Florida habitats. Specifically, thecodon insertion in the coding region and the insertions/deletionsin the introns of metallothionein can be used as landmark molec-ular signatures for these two cattail species.

(3) The coding sequences of the chloroplast genomes are highlyconserved and less phylogenetically informative. However, nucleo-tide variation, particularly insertions/deletions, in four intergenicregions (petA–psbJ, psbE–petL, petL–petE and psaJ–rpl33) are sig-nificant maternal markers for distinguishing T. latifolia andT. domingensis and detecting intraspecific ecotype variation.

(4) Distinguishing Typha species by morphology can be difficult.The limited DNA sequence information for Typha species availablein the public domain is prone to erroneous species designation.Therefore, special cautions should be exercised when using thesesequences for phylogenetic or evolution studies. On the otherhand, the discrepancy displayed by the DNA-based phylogenymay also suggest a divergent group of the Typha genus and the pos-sible presence of maternally distinct ecotypes, subspecies, newspecies and/or natural hybrids. Complementary evidence ofmorphology and multiple DNA sequences of both the nuclear andorganelle genomes should help determination of Typha speciesand identification of new species or hybrids. Establishment of areliable comprehensive DNA database for the important ecotypesof T. domingensis and T. latifolia would be a necessary first step.

Acknowledgments

We thank Kevin Maier and Mark Barrett of A.R.M. Loxahat-chee National Wildlife Refuge, Dale Gawlik of Florida AtlanticUniversity, Robert Johnson of South Florida Water ManagementDistrict (SFWMD), and Kenneth Snyder and Randal Snyder ofSt. John River Water Management District for help with samplecollections, Steven Travis of University of New England for thegift of Typha angustifolia DNA and Susan Hohner of SFWMD forhelp with generating Fig. 1. We also appreciate the discussionon Typha angustifolia with Joy Marburger of Great Lakes Researchand Education Center. This work was supported by a FloridaAtlantic University startup fund and a fund from SFWMD. TheDNA sequences reported in this paper are deposited in the Gen-Bank database.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ympev.2008.03.032.

References

Asmussen, C.B., Dransfield, J., Deichmann, V., Barfod, A.S., Pintaud, J.C., Baker, W.J.,2006. A new subfamily classification of the palm family (Arecacee): evidencefrom plastid DNA phylogeny. Bot. J. Linn. Soc. 151, 15–38.

Davis, S.M., 1994. Phosphorus inputs and vegetation sensitivity in the Everglades.In: Davis, S.M., Ogden, J.C. (Eds.), Everglades: The Ecosystem and its Restoration.St. Lucie Press, Delray Beach, FL, USA, pp. 357–378.

Davis, S.M., Ogden, J.C., 1994. Everglades: The Ecosystem and its Restoration. St.Lucie Press, Delray Beach, FL, USA. p. 826.

Duvall, M.R., Clegg, M.T., Chase, M.W., Clark, W.D., Kress, W.J., Hills, H.G., Eguiarte,L.E., Smith, J.F., Gaut, B.S., Zimmer, E.A., Learn Jr., G.H., 1993. Phylogenetichypotheses for the monocotyledons constructed from rbcL sequence data. Ann.Mo. Bot. Gard. 80, 607–619.

Flora of North America Editorial Committee (Eds.), 1993. Flora of North America,vol. 22. New York, Oxford, p. 213.

Forest, F., Grenyer, R., Rouget, M., Davies, T.J., Cowling, R.M., Faith, D.P., Balmford, A.,Manning, J.C., Proches, S., van der Bank, M., Reeves, G., Hedderson, T.A.,Savolainen, V., 2007. Preserving the evolutionary potential of floras inbiodiversity hotspots. Nature 445, 757–760.

Galatowitsch, S.M., Anderson, N.O., Ascher, P.D., 1999. Invasiveness in wetlandplants in temperate North America. Wetlands 19, 733–755.

Grace, J.B., 1989. Effects of water depth on Typha latifolia and Typha domingensis.Am. J. Bot. 76, 762–768.

Graham, I.A., Leaver, C.J., Smith, S.M., 1992. Induction of malate synthase geneexpression in senescent and detached organs of cucumber. Plant Cell 4, 349–357.

Grill, E., Winnacker, E.L., Zenk, M.H., 1987. Phytochelatins, a class of heavy-metal-binding from plants, are functionally analogous to metallothioneins. Proc. Natl.Acad. Sci. USA 84, 439–443.

Heiss, S., Wachter, A., Bogs, J., Cobbett, C., Rausch, T., 2003. Phytochelatin synthase(PCS) protein is induced in Brassica juncea leaves after prolonged Cd exposure. J.Exp. Bot. 54, 1833–1839.

Hiratsuka, J., Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M., Mori, M., Kondo,C., Honji, Y., Sun, C.R., Meng, B.Y., Li, Y.Q., Kanno, A., Nishizawa, Y., Hirai, A.,Shinozaki, K., Sugiura, M., 1989. The complete sequence of the rice (Oryzasativa) chloroplast genome: intermolecular recombination between distincttRNA genes accounts for a major plastid DNA inversion during the evolution ofthe cereals. Mol. Gen. Genet. 217, 185–194.

Keane, B., Pelikan, S., Toth, G.P., Smith, M.K., Rogstad, S.H., 1999. Genetic diversity ofTypha latifolia (Typhaceae) and the impact of pollutants examined withtandem-repetitive DNA probes. Am. J. Bot. 86, 1226–1238.

Krattinger, K., 1975. Genetic mobility in Typha. Aquat. Bot. 1, 57–70.Lamote, V., De Loose, M., Van Bockstaele, E., Roldán-Ruiz, I., 2005. Evaluation of AFLP

markers to reveal genetic diversity in Typha. Aquat. Bot. 83, 296–309.Leebens-Mack, J., Raubeson, L.A., Cui, L., Kuehl, J.V., Fourcade, M.H., Chumley, T.W.,

Boore, J.L., Jansen, R.K., dePamphilis, C.W., 2005. Identifying the basalangiosperm node in chloroplast genome phylogenies: sampling one’s way outof the Felsenstein zone. Mol. Biol. Evol. 22, 1948–1963.

Lewis, C.E., Doyle, J.J., 2001. Phylogenetic utility of the nuclear gene malate synthasein the palm family (Arecaceae). Mol. Phylogenet. Evol. 19, 409–420.

Li, Y., Dhankher, O.P., Carreira, L., Lee, D., Chen, A., Schroeder, J.I., Balish, R.S.,Meagher, R.B., 2004. Overexpression of phytochelatin synthase in Arabidopsisleads to enhanced arsenic tolerance and cadmium hypersensitivity. Plant CellPhysiol. 45, 1787–1797.

Ogihara, Y., Isono, K., Kojima, T., Endo, A., Hanaoka, M., Shiina, T., Terachi, T., Utsugi,S., Murata, M., Mori, N., Takumi, S., Ikeo, K., Gojobori, T., Murai, R., Murai, K.,Matsuoka, Y., Ohnishi, Y., Tajiri, H., Tsunewaki, K., 2002. Structural features of a

376 X.-H. Zhang et al. / Molecular Phylogenetics and Evolution 49 (2008) 368–376

wheat plastome as revealed by complete sequencing of chloroplast DNA. Mol.Genet. Genomics 266, 740–746.

Maier, R.M., Neckermann, K., Igloi, G.L., Kössel, H., 1995. Complete sequence of themaize chloroplast genome: gene content, hotspots of divergence and finetuning of genetic information by transcript editing. J. Mol. Biol. 251, 614–628.

Marburger, J., Travis, S., Windels, S., 2005. Cattail sleuths: use forensic science tobetter understand spread of an invasive species. NPS Nat. Resource Year Rev.2005, 75–76.

Mashburn, S.J., Sharitz, R.R., Smith, M.H., 1978. Genetic variation among Typhapopulations of the southeastern United States. Evolution 32, 681–685.

McNaughton, S.J., 1966. Ecotype function in the Typha community-type. Ecol.Monogr. 36, 297–325.

Miao, S.L., 2004. Rhizome growth and nutrient resorption: mechanisms underlyingthe replacement of two clonal species in Florida Everglades. Aquat. Bot. 78, 55–66.

Provan, J., Powell, W., Hollingsworth, P.M., 2001. Chloroplast microsatellites: newtools for studies in plant ecology and evolution. Trends Ecol. Evol. 16, 142–147.

Rutchey, K.R., Vilcheck, K., 1999. Air photo-interpretation and satellite imageryanalysis techniques for mapping cattail coverage in a northern Evergladesimpoundment. Photogram. Eng. Remote Sensing 65, 185–191.

Selbo, S.M., Snow, A.A., 2004. The potential for hybridization between Typhaangustifolia and Typha latifolia in a constructed wetland. Aquat. Bot. 78,361–369.

Sharitz, R.R., Wineriter, S.A., Smith, M.H., Liu, E.H., 1980. Comparison of isozymesamong Typha species in the eastern United States. Am. J. Bot. 84, 401–409.

Shinozaki, K. et al., 1986. The complete nucleotide sequence of the tobaccochloroplast genome: its gene organization and expression. EMBO J. 5, 2043–2049.

Smith, S.G., 1967. Experimental and natural hybrids in North American Typha(Typhaceae). Am. Midl. Naturalist 78, 257–287.

Smith, S.G., 1987. Typha: its taxonomy and the ecological significance of hybrids.Arch. Hydrobiol. Beih. [Stuttgart] 27, 129–138.

Tsyusko-Omeltchenko, O.V., Schable, N.A., Smith, M.H., Glenn, T.C., 2003.Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol.Ecol. Notes 3, 535–538.

Weisner, S.E.B., Miao, S.L., 2004. Use of morphological variability in Cladiumjamaicense and Typha domingensis to understand vegetation changes in anEverglades marsh. Aquat. Bot. 78, 319–335.

Wu, Y., Sklar, F.H., Rutchey, K., 1997. Analysis and simulations of fragmentationpatterns in the Everglades. Ecol. Appl. 7, 268–276.

Zhang, X.-H., Brotherton, J.E., Widholm, J.M., Portis Jr., A.R., 2001. Targeting anuclear anthranilate synthase a-subunit gene (ASA2) to the tobacco plastidgenome results in enhanced tryptophan biosynthesis. Return of a gene to itspre-endosymbiotic origin. Plant Physiol. 127, 131–141.

Zhang, Y.-W., Tam, N.F.Y., Wong, Y.S., 2004. Cloning and characterization of type 2metallothionein-like gene from a wetland plant, Typha latifolia. Plant Sci. 167,869–877.