www.elsevier.com/locate/ybbrc

Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

BBRC

Molecular and metabolic retinoid pathways in humanamniotic membranes q

Geoffroy Marceau a,b, Denis Gallot a,c, Valerie Borel a,b, Didier Lemery a,c,Bernard Dastugue b, Pierre Dechelotte d, Vincent Sapin a,b,*

a Universite d’Auvergne, JE 2447, ARDEMO, F-63000 Clermont-Ferrand, Franceb INSERM, U.384, Laboratoire de Biochimie, Faculte de Medecine, F-63000 Clermont-Ferrand, France

c CHU Clermont-Ferrand, Maternite, Hotel-Dieu, F-63000 Clermont-Ferrand, Franced CHU Clermont-Ferrand, Service d’Anatomie et de Cytologie Pathologiques, Hotel-Dieu, F-63000 Clermont-Ferrand, France

Received 2 June 2006Available online 12 June 2006

Abstract

Vitamin A (retinol) and its active derivatives (the retinoids) are essential for the growth and development of the mammalian fetus andplacenta. The amniotic membranes are extra-embryonic structures that are indispensable for normal gestation in mammals. Althoughplacental involvement of retinoids is clearly established, little is known about the roles of retinoids for the associated amniotic mem-branes. The aim of this study was to define the metabolic and molecular pathways of retinoic signaling in human fetal membranes.The expression of retinoid receptors (RARa, b and RXRa, b) was established at transcript and protein levels. Enzymes involved inretinoic acid generation were also detected. The enzymatic generation of functional retinoids was confirmed using specific inhibitorsof retinol metabolism. Finally, the functionality of retinoid pathways was demonstrated by inducing established retinoid target geneexpression. Our results clearly demonstrated that the molecular and metabolic actors of retinoic signaling pathways are functional inhuman fetal membranes.� 2006 Elsevier Inc. All rights reserved.

Keywords: Retinol; Retinoic acid; Nuclear receptors; Human; Amniotic membranes; Ethanol

The extra-embryonic tissues (i.e., placenta and amniotic/fetal membranes) are well-established structures indispens-able for normal gestation in mammals [1]. These mem-branes, which enclose the embryo and the fetusthroughout the pregnancy, are composed of the inneramnion lining the amniotic cavity and the outer chorion,which directly abuts the fetal surface of the placenta andunderlies the decidua. The amnion is composed of a singlelayer of cuboidal epithelium and an underlying connective

0006-291X/$ - see front matter � 2006 Elsevier Inc. All rights reserved.

doi:10.1016/j.bbrc.2006.06.024

q G.M. and V.S. were supported by INSERM grants (respectively, PosteAccueil and Contrat Interface). D.G. was supported by grants from theSociete Francaise de Medecine Perinatale and College National desGynecologues et Obstetriciens Francais. The ARDEMO team wassupported by the French Research Department (JE 2447).

* Corresponding author. Fax: + 33 4 73 27 61 32.E-mail address: Vincent.SAPIN@u-clermont1.fr (V. Sapin).

tissue stroma. The chorion is composed of reticular fibersand layers of trophoblast cells. These membranes providesufficient strength and elasticity to accommodate fetalgrowth and movements. They can also undergo pro-grammed rupture during the first stage of labor [2]. Theamniotic membranes play an integral role in fetal develop-ment and the progression of pregnancy. In addition to theirautocrine regulatory activities, the membranes secrete sub-stances both into the amniotic fluid, affecting amniotic fluidhomeostasis, and towards the uterus, where they can influ-ence maternal cellular physiology. The membranes alsohelp to protect the fetus against infection ascending thereproductive tract [3]. The cellular lineages and mecha-nisms occurring during mammalian placentation are nowwell described but the related molecular pathways involvedin the physiopathology of amniotic membranes are stillpoorly understood [4]. In these membranes, zinc finger

1208 G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

transcription factors seem to be heavily involved. We pre-viously established that two zinc finger Kruppel-like fac-tors (KLF4 and 6) were present in both the components(amnion and chorion) of the amniotic structures [5]. Otherzinc finger nuclear receptors (glucocorticoid and progester-one) are expressed in fetal membranes [6], able to regulatethe transcription of specific target genes such as 11b-hy-droxysteroid dehydrogenase type 1 [7] or molecular outputsuch as prostaglandin [8]. The peroxisome proliferator acti-vated receptor (PPAR) isoforms change their expressionpatterns in human amniotic membranes with labor [9]. Sev-eral authors claim PPARc is involved in labor [10] and incross-talk with NF-jB and inflammation pathways [11]where cytokines seems to play a role in the initiation of par-turition [12]. We also recently defined a specific expressionof another zinc finger nuclear receptor liver X receptor(LXR) a in the human amniotic membranes [13]. ThePPAR and LXR are transcriptionally active as heterodi-mers with retinoid X receptor (RXR), a retinoids (activederivatives of vitamin A/retinol) zinc finger transcriptionfactor [14]. The involvement of PPAR and LXR in thephysiopathology of the fetal membranes raises the questionof the involvement of their heterodimeric partners, the ret-inoid receptors, in those tissues.

Vitamin A derivatives play a crucial role in embryonicdevelopment, as demonstrated by the teratogenic effect ofeither an excess or a deficiency of vitamin A during mam-malian gestation. However, retinoid effects extend beyondembryonic development, tissue homeostasis, lipid metabo-lism, cellular differentiation, and proliferation being inpart controlled through the retinoid signaling pathway[15]. These pleiotropic effects of retinoids are mediatedby retinoic acid receptors (RARs) and RXRs, which areligand-activated transcription factors. Two families ofnuclear receptors for retinoic acid (RA) have been charac-terized. Members of the RAR family (a, b, and c) areactivated by most physiologically occurring retinoids(all-trans RA, 9-cis RA, 4-oxo RA, and 3,4 di-hydroRA). In contrast, members of the RXR family (a, b,and c) are activated only by 9-cis RA [14,15]. The tran-scriptional regulation of the target genes relies on the rec-ognition and cooperative assembly of RAR–RXRheterodimers in short DNA sequences in their promoterregions called retinoic acid response elements (RARE).Mammalian placentas are known to express RAR andRXR nuclear transcription factors by which retinoic acidsmodulate the expression of target genes [16]. Several pla-cental genes modulated by retinoids have been describedin humans and mice such as, for example, chorionicgonadotrophin hormone (CGH), placental lactogen hor-mone, leptin, receptor of epidermal growth factor, 17b-hydroxysteroid dehydrogenase type 1, and STRA [17].Other genes already known to be regulated by retinoidsduring mammalian development are also expressed infetal membranes. Nevertheless, the molecular signalingpathway of retinoids is not yet established in the amnioticmembranes.

To be biologically active (see Fig. 1), retinol must first beoxidized to retinaldehyde and then to retinoic acid. A largenumber of enzymes catalyze the oxidation of retinol to ret-inaldehyde (among them alcohol dehydrogenases/ADHand retinol dehydrogenase of the microsomal fraction/DHRS) as well as several enzymes able to catalyze theoxidation of retinaldehyde to retinoic acid: retinal dehy-drogenase (RALDH1, 2, 3, and 4) [18]. The catabolismof all-trans and 9-cis RA is also an important mechanismfor controlling RA levels in cell and tissues, and is carriedout by three specific members of cytochrome P450s(CYP26A1, B1, and C1) [19]. Since retinol, retinaldehyde,and retinoic acid are lipids, they lack appreciable water sol-ubility and consequently must be bound to proteins withincells. Several intracellular binding proteins for retinol, ret-inaldehyde, and retinoic acid have been identified andextensively characterized. They include cellular retinolbinding protein types 1 and 2 (CRBP1 and 2) and cellularretinoic acid binding proteins, types 1 and 2 (CRABP1 and2). We have already demonstrated that the human placentahas the ability to esterify the retinoids [20] and produceactive retinoids from retinol [21]. It is well-established thatretinol is present in amniotic fluid [22] and in human amni-otic membranes [23]. Curiously, the human fetal membranemetabolism of retinoids, and more particularly their enzy-matic pathways and their ability to metabolize the retinol,is currently not documented.

The aim of this work was: (i) to identify the molecularand metabolic actors of retinoid pathway, (ii) to evaluateretinol conversion into retinoic acid, and (iii) to assessthe nuclear functionality of retinoids in human fetalmembranes.

Materials and methods

Chemicals. All-trans retinol, all-trans retinoic acid, trypsin, dimethylsulfoxide (DMSO), ethanol, and ketoconazole were purchased from Sig-ma–Aldrich (Saint-Quentin-Fallavier, France). For all the experiments,both retinoic acid and retinol were prepared as 1000· stock solution inDMSO. Culture medium and additives (streptomycin, penicillin, anddextran-coated charcoal stripped fetal calf serum/FCS) were purchasedfrom Invitrogen (Cergy-Pontoise, France). The transfection reagentGeneJammer was purchased from Stratagene Europe (Amsterdam, TheNetherlands).

Tissue collections. Ten human placenta and attached fetal membraneswere obtained from 10 different patients undergoing planned caesareansection, after informed consent, in accordance with the Declaration ofHelsinki. Five fetal membranes were collected at term after spontaneousvaginal delivery to study the influence of labor. The research was approvedby the Institutional Regional Ethics Committee (CCPPRB Auvergne).Placental tissues and culture cells were frozen at �80 �C for RT-PCRexperiments and immunohistochemistry assays.

Cell cultures. Primary amniotic cells’ isolation from 10 different humanterm fetal membranes was conducted as previously described [24]. Briefly,a strip of placental membranes (approximately 5 by 5 cm) was cut and theamnion was separated from the chorion. The tissue was rinsed in warmHanks’ balanced salt solution (HBSS) and then transferred to a seconddish of HBSS for removal, under a dissecting microscope, of blood clotsand the connective tissue layer that underlies the amniotic epithelium. Thetissue was rinsed three more times in HBSS. In the last rinse, the tissue wascut into squares (approximately 2 by 2 mm). The pieces were stirred gently

CRBPs

CRABPs

ADHs

SDRs

RALDHs

CYP26s

Retinol

Retinol

RAR RXR

DNA

Retinoic Acid Responsive Element

Apo- -Apo

Nuclear membrane

CRBPs

Nucleus

9-cis retinoic acid

Fig. 1. Schematic representation of intracellular retinoid signaling pathway. Retinol is converted into retinal and retinoic acids, before it acts throughnuclear retinoid receptors or is inactivated by hydroxylation. Abbreviations: ADH, alcohol dehydrogenase; CRABP, cellular retinoic acid binding protein;CRBP, cellular retinol binding protein; CYP26, cytochrome p450 retinoic acid inducible; RAR, retinoic acid receptor; RALDH, retinaldehydedehydrogenase; RXR, retinoid X receptor; SDR, short-chain dehydrogenase/reductase.

G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216 1209

with a magnetic stirrer for 30 min in 10 ml of a solution of 0.25% trypsin.This first trypsin solution was discarded and replaced with a second 10 mlof warm trypsin solution. The tissue was stirred for 20 min in the secondbatch of trypsin, which was then poured through a 0.5 mm wire mesh andcentrifuged for 6 min at 200g. The pellet of dissociated cells was resus-pended in 1 ml of culture medium. The remaining pieces of membranefiltered from the solution were stirred with a third 10 ml of trypsin solu-tion, which was then filtered and centrifuged as for the second solution.The cells from the second and third trypsinizations were pooled. Theprimary culture cells were identified as amniotic epithelial cells by bothmorphology and monoclonal antibody staining of cytologic markers [24].Both the primary cultures of amniotic epithelial cells and the humanamnion-like Wistar Institute Susan Hayflick (WISH) cell line culture wereconducted using ATCC recommendations, under standard conditions (5%CO2, 95% humidified air, 37 �C) in Modified Eagle’s Medium (MEM)supplemented with 5% dextran-coated charcoal stripped FCS (to preventcontamination by endogenous serum retinoids), 50 mg/ml of streptomy-cin, and 50 IU/ml of penicillin. No change in the cellular growth ormorphology of the primary cultures of amniotic epithelial cells or theWISH cell line was observed during the 7 days, between treatment withnormal and dextran-coated charcoal stripped FCS.

RT-PCR experiments. Total mRNA was extracted from 10 humantotal amnion, chorion, and cell cultures using TRIZOL (Invitrogen,Cergy-Pontoise, France). The cDNA was generated using a SuperscriptFirst-Strand Synthesis System for RT-PCR (Gibco-BRL, Cergy-Pontoise,France). The RNA quantity was determined by spectrophotometericmeasurement at 260 and 280 nm (ratio with proteins). The RNA qualitywas studied by the RNA/protein ratio (260 nm/280 nm) and by gel elec-trophoresis (2% agarose) to observe the presence of intact 28S and 18S

RNA bands. Specific oligonucleotide primers were originally generated byusing the web program Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) based on the published full-length humanmRNA sequences of each specific gene and designed to avoid genomicDNA amplification (Table 1). All the primers were first checked for theirspecificity to amplify defined mRNA regions, using human tissue alreadyreported to express these genes (positive control). PCR amplification wascarried out in an Eppendorf Mastercycler, using 50 ng of total cDNA perreaction and according to the following program: initial denaturation at95 �C for 5 min, followed by denaturation at 95 �C for 45 s, annealing at59 �C for 45 s, and extension at 72 �C for 60 s (36 cycles), terminated by afinal extension of 72 �C for 7 min. The PCR products were separated on a2% agarose gel and sequenced on both strands to confirm the specificity ofthe reaction, with the same primers as those of the PCR, using the DNADye Terminator Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf,France) and the Applied Biosystems model 377 DNA Sequencer. Ampli-fication of the housekeeping gene acidic ribosomal phosphoprotein P0(36B4) was used as positive control. A negative control for amplimercontamination was set up using a complete PCR mix without cDNA.Band intensities were analyzed (linear range of PCR amplification) bydensitometry (using NIH image 1.63 program) and normalized againstthat of the 36B4 band [25].

Immuno-histological and -cytological experiments. Ten cryosections ofwhole amnion, chorion, and cells grown in Lab-Tek culture chambers(MC2, Clermont-Ferrand, France) were fixed in 4% paraformaldehyde inPBS (pH 7.4) at 25 �C for 10 min, rinsed three times with PBS, incubatedat 25 �C for 10 min in H2O2 (quenching of endogen peroxidases), andincubated in PBS with 3% bovine serum albumin (Sigma–Aldrich, Saint-Quentin-Fallavier, France) at 25 �C for 30 min. Cells and tissues were

Table 1Sequences of synthetic oligonucleotides used for the RT-PCR analysis

Human gene Sequence (50–3 0) Product size (pb) Gene No.

Forward Reverse

Retinoid acid receptor a (RARa) agtcctcaggctaccactat cctccttcttcttcttgttt 225 NM-000964Retinoid acid receptor b (RARb) atggatgttctgtcagtgag catagtggtaccctgatgat 268 NM_000965Retinoid acid receptor c (RARc) accaataaggagcgactct atctcctctgagctggtg 212 M24857Retinoid X receptor a (RXRa) ggatcccacacttctcag gagtcagggttaaagaggac 286 NM_002957Retinoid X receptor b (RXRb) agtactgccgctatcagaa gttagtcacagggtcatttg 242 NM_021976Retinoid X receptor c (RXRc) ctacacagataccccagtga gggtagttcatgtttccaat 249 NM_006917Aldehyde dehydrogenase 1A (ADH1A) tcttggtggctttaaaagta gtctcaaaacatcagaatgg 175 NM_000667Aldehyde dehydrogenase 3 (ADH3) atgaagttcgcattaagatg tttcaagcagtagttgctct 239 NM_000669Aldehyde dehydrogenase 4 (ADH4) aacctgcctggttaatttat actttcaacttcccagaact 231 NM_000670Dehydrogenase/reductase 4 (DHRS4) tatcctagtctccaatgctg caaggctgttttactgacat 235 NM_021004Dehydrogenase/reductase 9 (DHRS9) aaacctcagagagacttcgt tctagtgtcagccagtcagt 169 NM_005771Microsomal retinol dehydrogenase 4 (RODH4) catactggacgtgaacttgt ccaggaagctctttaagaat 278 NM_0037083-Hydroxysteroid epimerase (EPIM) tgaacactgaggactctatga ttcaactatgctgattttcac 242 NM_003725Retinal dehydrogenase 1 (RALDH1) tactcaccgatttgaagatt ttgtcaacatcctccttatc 151 NM_000689Retinal dehydrogenase 2 (RALDH2) tgacttccagcaagatagag tggattatagacagggaaca 179 NM_003888Retinal dehydrogenase 3 (RALDH3) acctggaggtcaagttca ctgtatccatcgtctccag 291 NM_000693Retinal dehydrogenase 4 (RALDH4) tagattcttacgacccatca taaggttttcccttggtct 224 AF303134Cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1) aagctctgggacctgtact tgtagatgaagccgtatttc 163 NM_000783Cytochrome P450, family 26, subfamily B, polypeptide 1 (CYP26B1) acctctttgaggtctaccag gctctcaatgaggaggtc 194 NM_019885Cytochrome P450, family 26, subfamily C, polypeptide 1 (CYP26C1) ggagaacctcttctcactg cttgcactgtgaatgattag 191 NM_183374Cellular retinol binding protein 1 (CRBP1) gatctgacaggcatagatga cttcttgaatacttgcttgc 180 NM_002899Cellular retinol binding protein 2 (CRBP2) atgaaaactttgagggctac gaaatccacatcatagttgc 155 NM_004164Cellular retinoic acid binding protein 1 (CRABP1) accactgagatcaacttcaa tcactctcggacataaattc 234 NM_004378Cellular retinoic acid binding protein 2 (CRABP2) gaattgctcaaagtgctg ctgctcacagaccattttat 243 NM_001878Acidic ribosomal phosphoprotein P0 (36B4) aggctttaggtatcaccact gcagagtttcctctgtgata 219 M17885

For each gene, the nucleotidic sequences of the two specific primers were detailed. The size of the amplification product was noted (pairs of bases/pb). Thegene accession number used to find both primers was indicated.

1210 G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

incubated overnight at 4 �C in the presence of RARa, b, c and RXRa, b, c(respectively, Santa-Cruz (sc) 551, 552, 550, 553, 831, and 555) certifiedrabbit polyclonal primary antibodies (1/200 in PBS) (Tebu, Le Perray-en-Yvelines, France). This was followed by three PBS washes; 1-h incubationin the presence of a secondary goat HRP anti-rabbit antibody (Interchim,Montlucon, France) at room temperature and again three washes withPBS. The samples were then examined after DAPI nuclear staining (5 min,dilution in PBS 1/500), and after mounting in an aqueous mounting fluidVectashield (Vector, Burlingame, CA) under a Zeiss Axiophot micro-scope. For negative controls, sections were incubated with normal rabbitIgG in place of anti-RARs or anti-RXRs.

Transfection of cultured cells. Plasmid DR5-tk-CAT contains one copyof the retinoic acid-responsive element DR5 (direct repeat 5) ligated to aherpes simplex thymidine kinase promoter upstream of a chimeric chlor-amphenicol acetyl transferase (CAT) reporter gene [26]. Primary amnioncells obtained from 10 different fetal membranes were trypsinized 16 hbefore transfection. A total of 3 · 105 cells in 6-well plates were transfectedusing GeneJammer with 1 lg of reporter DR5-tk-CAT plasmid and 1 lgof cytomegalovirus (CMV)-b-galactosidase vector serving as internalcontrol to normalize variations in transfection efficiency. The CMV-b-galactosidase plasmid contains CMV promoter and enhancer sequencesthat drive a b-galactosidase (b-GAL) gene. Parallel transfections of thecorresponding vectors CAT and b-GAL at equivalent concentrations wereperformed in all experiments. After overnight incubation with DNA, cellswere washed and incubated with fresh medium for a further 12 h. Theywere treated for another 24 h with retinoids (retinol or ATRA) in 1000·stock solutions in DMSO. In this case, the maximal DMSO concentrationto which the cells were exposed was <0.1%. In other experiments ethanol,bisdiamine (Acros organics, Noisy-le-Grand, France), ketoconazole, andDMSO were added at concentrations of 100 mmol/l, 100 lmol/l,300 lmol/l, and 500 mmol/l, respectively. Cell viability assays were per-formed for each treatment (ethanol, bisdiamine, ketoconazole, andDMSO) using XTT assays (Roche Diagnostics, Meylan, France). For thispurpose, cells were seeded on 96-well plates at 5 · 104 cells/well and

treated for 24 h with ethanol, bisdiamine, ketoconazole, or DMSO atconcentrations ranging from 10 to 200 mmol/l, 10 to 200 lmol/l, 10 to500 lmol/l, and 10 to 900 mmol/l, respectively. The average values of cellsgrown in regular medium were considered as 100% viability; no toxicity>10% was observed for ethanol between 10 and 100 mmol/l, for bisdi-amine between 10 and 100 lmol/l, for ketoconazole treatment between 10and 300 lmol/l, and for DMSO treatment between 10 and 500 mmol/l.

CAT and b-galactosidase reporter gene assay. After incubation, amnionprimary cells were washed twice with PBS and treated with 700 ll cell lysisbuffer for 1 h at 4 �C. The lysed cells were scraped off and centrifuged at950g for 5 min at 4 �C. CAT was measured by an immunoenzymatic assay(Roche Diagnostics, Meylan, France) on 200 ll of supernatant. In all thestudies, CAT assays were normalized to b-galactosidase activity deter-mined according to the manufacturer’s instructions. For this purpose,20 ll of the supernatants was incubated with assay reagent based on anoriginal protocol.

Statistical methods. Results expressed as means ± SD were an averageof 10 different experiments per condition. Comparison of means was madeby analysis of variance and Fisher’s t test using the Statview II 1.03software (Abacus Concepts Inc., Berkeley, CA, USA). For all the studiesvalues were considered significantly different when p < 0.05.

Results

Identification of the molecular and metabolic actors of

retinoid pathway in human term fetal membranes

To evaluate the expression pattern of nuclear receptors,binding proteins, and enzymes of retinoid signaling path-ways in human fetal membranes, RT-PCR assays were firstperformed on total mRNA extracted from primary culturesof amniotic cells, established WISH cell line, term native

G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216 1211

amnion, and chorion. Similar cell and tissue pattern expres-sions were found for the amnion (n = 10), the chorion(n = 10), the primary (n = 10), and established (n = 10) cellcultures. They all presented similar positive expression forRARa, RARc, RXRa, ADH4, DHRS4, DHRS9,RODH4, EPIM, RALDH1, CYP26B1, CRBP1, andCRABP2. The mRNAs of RARb, RXRb, RXRc,ADH1A, RALDH4, CYP26A1, CYP26C1, and CRBP2were never detected in any of the human fetal membranesat cellular and tissular levels. ADH3 was only expressedin the chorion. RALDH2 and CRABP1 were expressedin all the tissues and in the amnion primary cultures butnot in the WISH cell line. RALDH3 was only expressedin the chorion and the WISH cell line (Fig. 2, Table 2,and data not shown).

Using frozen sections, we checked the protein expressionand localization of RARa, RARc, and RXRa, the tran-scripts of which were previously described. We foundRARa, RARc, and RXRa expressed in epithelial part ofamnion (respectively, Fig. 3A–C) and in the chorion(respectively, Fig. 3E–G). Analysis of primary cultures ofamnion confirmed the presence of RARa, RARc, andRXRa (respectively, Fig. 3I–K). This RARa, RARc, andRXRa immuno-labeling also appeared in WISH cell linecultures (respectively, Fig. 3M–O). Together, all the immu-no-cyto and histochemistry assays confirmed the presenceof the three nuclear receptor proteins RARa, RARc, andRXRa previously identified in RT-PCR. No modificationin expression patterns was found before or after labor forany of the molecular and metabolic actors tested.

Study of retinoic acid generation from retinol by amnion

primary cells

The production of active retinoids by amnion primarycells after incubation with retinol was studied using tran-sient transfections of a retinoid-sensitive reporter genebased on CAT expression (see Fig. 4A and B). First we

Amnion

Chorion

S R A R A R A R B R A R G R XR A R XR B R XR G A D H 1A A D H 3 A D H 4 D H R S 4 D H R S 9 R OD H 4 EP I M

Amniotic Primary Culture

Fig. 2. Expression patterns of nuclear receptors, retinoid binding proteins, anddetermined by RT-PCR on total mRNA extracted from 10 fetal membranescontrol (36B4) was performed under the same conditions; using specific primerwas performed in the absence of oligonucleotide or matrix. Abbreviations: ADCRBP, cellular retinol binding protein; CYP26, cytochrome p450 retinoichydroxysteroid dehydrogenase; RARA, retinoic acid receptor alpha; RARB, reretinaldehyde dehydrogenase; RODH4, microsomol NAD+-dependent retinoreceptor beta; RXRG, retinoid X receptor gamma; SDR, short-chain dehydro

checked that the naıve amnion primary cells (or amnionprimary cells transfected with an empty vector) did notproduce CAT. CAT production by cells transfected withthe DR5-tk-CAT plasmid and not treated was consideredas the basal level for comparison with and detection ofinduction recorded following exposure to retinoids. All-trans RA treatment (1 lmol/l) for 24 h increased CATresponse (2.7 ± 0.1-fold induction), demonstrating the cel-lular functionality of retinoic acid signaling at the cellularlevel. After retinol (1 lmol/l) treatment CAT productionwas also significantly enhanced (1.8 ± 0.1) but not as muchas with stimulation with 1 lmol/l RA (Fig. 4A). CAT pro-duction (reflecting active retinoids generation) was mea-sured with different retinol concentrations ranging from10�10 to 10�3 mol/l. Retinol treatment increased CAT gen-eration dose-dependently (Fig. 4B). The maximal CATinduction was obtained with 1 mmol/l retinol and the halfmaximal induction [EC50] of CAT was experimentallydeduced to be 20 nmol/l, which is a classical value alreadydescribed in enzymatic retinoic acid generation from reti-nol (see Fig. 4B). ATRA treatment also increased CATgeneration dose-dependently (Fig. 4C). The maximalCAT induction was obtained with 1 lmol/l ATRA andthe half maximal induction [EC50] of CAT was experimen-tally deduced to be 1 nmol/l (compare 20 nmol/l with reti-nol). In addition, we found that primary amnion cellsgenerated only the all-trans isomer of the retinoic acid fromretinol (unpublished data obtained from high-performanceliquid chromatography experiments).

To confirm that active retinoids were generated andcatabolized by enzymatic conversion from retinol, we test-ed potential impairment of these reactions by inhibitingADH, RALDH, and CYP26, respectively, by ethanol, bis-diamine, and ketoconazole (using nontoxic concentrations,see Materials and methods) as shown in Fig. 4A. Ethanol(100 mmol/l) caused a statistically significant decrease inretinoic acid production by primary amnion cells, causingonly 49.2% of the induction observed in cells incubated

R A LD H 1 R A LD H 2 R A LD H 3 R A LD H 4 C YP 2 6 A C YP 2 6 B C YP 2 6 C C R B P 1 C R B P 2 C R A B P 1 C R A B P 2 3 6 B 4 N C

enzymes in human fetal membranes at term. The expression patterns wereand 10 primary cultures of amniotic cells using specific primers. Positives for the housekeeping gene 36B4 (219 base pairs). Negative control (NC)H, alcohol dehydrogenase; CRABP, cellular retinoic acid binding protein;acid inducible; DHRS, dehydrogenase/reductase short-chain; EPIM, 3tinoic acid receptor beta; RARG, retinoic acid receptor gamma; RALDH,l dehydrogenase 4; RXRA, retinoid X receptor alpha; RXRB, retinoid Xgenase/reductase.

Tab

le2

RT

-PC

Rp

rofi

lo

fn

ucl

ear

rece

pto

rsan

dre

tin

ol

met

abo

lic

enzy

mes

infe

tal

mem

bra

nes

Gen

esR

AR

aR

AR

bR

AR

cR

XR

aR

XR

bR

XR

cA

DH

1AA

DH

3A

DH

4D

HR

S4

DH

RS

9R

OD

H4

Am

nio

n+

�+

+�

��

�+

++

+C

ho

rio

n+

�+

+�

��

++

++

+A

mn

ion

+ch

ori

on

+�

++

��

�+

++

++

Am

nio

np

rim

ary

cell

s+

�+

+�

��

�+

++

+W

ISH

+�

++

��

��

++

++

EP

IMR

AL

DH

1R

AL

DH

2R

AL

DH

3R

AL

DH

4C

YP

26A

1C

YP

26B

1C

YP

26C

1C

RB

P1

CR

BP

2C

RA

BP

1C

RA

BP

2

Am

nio

n+

++

��

�+

�+

�+

+C

ho

rio

n+

++

+�

�+

�+

�+

+A

mn

ion

+ch

ori

on

++

++

��

+�

+�

++

Am

nio

np

rim

ary

cell

s+

++

��

�+

�+

�+

+W

ISH

++

�+

��

+�

+�

�+

1212 G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

with 1 lmol/l of retinol alone (Fig. 4A). Cells treated with100 lmol/l of bisdiamine also produced significantly loweramounts of retinoic acid, producing only 48.1% of retinol-treated cells. By contrast, cells treated with 300 lmol/l ofketoconazole (inhibitor of retinoic acid degradation byCYP26s) produced greater amounts of retinoic acid(111.5% of ATRA-treated cells). The absolute values ofinternal standard (not dependent upon the enzymatic con-version caused by ADH, RALDH, and CYP26) did notchange in response to ethanol, bisdiamine, or ketoconazoletreatments (data not shown), showing the specific effect ofethanol, bisdiamine, and ketoconazole on inhibition of ret-inoic acid generation and degradation.

The transcriptions of CRBP1 and CRABP2 aredescribed as regulated by retinoic acid [27,28]. Wepreviously established the presence of their transcripts inprimary culture of amniotic cells. Therefore, a semi-quan-titative analysis of mRNA levels of these two genes wasassayed to confirm the generation of active retinoids fromretinol in primary amnion cells using this alternativemethod, complementary to the transient transfection of areporter plasmid. After induction of primary amnion cul-ture cells with 1 lmol/l Rol and all-trans RA, a significantinduction of CRBP1 and CRABP2 was observed, respec-tively, a 4.30- and 2.87-fold induction for RA and 3.25-and 1.88-fold for retinol (Fig. 5 and data not shown).

Discussion

Vitamin A and its active derivatives the retinoids arefundamental nutrients for the development of the mamma-lian embryo and fetus [29]. The fetal/amniotic membranesplay an important role in the regulation of the transportand metabolism of maternal nutrients transferred to thefetus. Abnormalities in structures or functions of fetalmembranes can be detrimental to fetal development. Curi-ously, little is known about retinol metabolism and the ret-inoid acid molecular pathway in human fetal membranes.

For the first time, we show that the human primaryamniotic cells are able to produce retinoids at functionallevels from retinol, already reported to be present in humanamniotic fluid and membranes [22,23]. Three other mam-malian placental structures have also been shown to pro-duce retinoic acid from retinol: the mouse yolk sac [30],the porcine yolk sac [31], and human trophoblastic cells[21]. In humans, both placental structures involved innutrient transport between fetal and maternal compart-ments are able to produce functional retinoids. For eachdetermination, induction obtained from retinol was alwaysless than with all-trans retinoic acid exposure. The enzymesinvolved in retinol conversion such as ADHs, SDRs, andRALDHs are saturable [18]. Moreover, intracellular reti-nol can be metabolized via different alternative pathwayssuch as esterification. Our preliminary results revealed thatthe enzymes involved in retinyl ester formation (lecithinretinol acyl transferase [32] and diacylglycerol O-acyl trans-ferase [33]) and release (retinyl ester hydrolase [34]) were

Fig. 3. Immuno-labeling of nuclear receptor RAR and RXR proteins in human fetal membranes at term. RARa (A, E, I, and M), RARc (B, F, J, and N),and RXRa (C, G, K, and O) immuno-localizations (green fluorescence staining) were performed in human amnion (A–D), human chorion (E–H), primaryculture of amnion cells (I–L), and established WISH cell line (M–P). Cell nuclei were visualized with DAPI (blue staining) (A–P). Negative controls for thethree antibodies used were presented in D, H, L, and P. Acquisitions were made under standard fluorescence Axiophot microscope (Zeiss). Magnificationsfor A–H: x 200, for I–P: x 400. Scale bar: 20 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web versionof this paper.)

G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216 1213

expressed in human amniotic membranes. Together, thesetwo reasons could explain why retinol is only partially usedto form retinoic acid. These structures appear to be highlyimportant in retinoid metabolism. Another precursor ofretinoic acid, b-carotene, was previously reported to playa potential role in the prevention of preterm rupture offetal membranes [35]. Note that we also detected theexpression of the enzyme b-carotene-15,15 0-dioxygenasecatalyzing the key step of the cleavage of b-carotene intotwo molecules of retinal [36] in the amniotic part of humanterm fetal membranes (our unpublished data).

Our present work also demonstrates that the molecularactors of the retinoid signaling pathway are present andfunctional in the human amniotic fetal membranes at tissueand cellular levels. With the extra-villous and villoustrophoblastic compartment [37] these structures becomethe second extra-embryonic site able to support molecularretinoid action. These results also add new members to the

known nuclear receptors expressed in human fetal mem-branes, i.e., glucocorticoid, progesterone [6], peroxisomeproliferators-activated [9], and liver X receptors [13]. Thepresence of RXR gives molecular support to the generationof active heterodimers, PPAR/RXR, and LXR/RXR [14],in these extra-embryonic structures.

Our study also clearly establishes that generation ofretinoic acid from retinol can be impaired by a toxinsuch as ethanol. Prenatal ethanol exposure can causedevelopment retardation and malformations in humanoffspring. During human gestation, the fetal membranecells may be exposed to detrimental maternal conditionsincluding alcohol abuse. Ethanol reduced intercellularspace and podocyte exchange surface, reducing the ionictransfer through the human amniotic membrane fromnormal pregnancies at term [38]. Similar impairedstructural and functional development of extra-embryon-ic membranes was found after ingestion of alcohol by

CAT activity normalized by β-Gal activity (% of basal CAT activity)

0

50

100

150

200

250

300

10-10 10-9 10-8 10-7 10-6 10-5 10-4 10-3

Retinol concentration mol/L0

EC50 = 20 nmol/L

CAT activity normalized by β-Gal activity

9088

183

10096

300

269

0

50

100

150

200

250

300

350

Ethanol100mmol/L

Bisdiamine100µmol/L

Ketoconazole300µmol/L

DMSO100mmol/L

Retinol1mmol/L

ATRA1µmol/L

NC

Retinol 1mM

(a) (a)(a) (a)

(d)

(b)

(c)

Fold induction of CAT activity normalized by β-Gal activity

ATRA

10-10 10-9 10-8 10-7 10-6 10-60

Retinol

0

0,5

1

1,5

2

2,5

3

Concentrationmol/L

A

B

C

Fig. 4. Metabolic parameters of retinol activation into retinoic acid in primary cultures of amnion cells. Primary amnion cells were transiently transfected witha retinoic-responsive CAT reporter gene (DR5-tk-CAT). The induction of CAT is expressed as the ratio between treated and control cells. CAT productionwas determined after 24-h incubation and normalized to b-galactosidase activity. Each value represents the mean ± SD of 10 experiments. The top panel (A)indicates the inhibition by different toxins of activation of retinol into retinoic acid. The different superscripts (a–d) indicate statistical differences between thedifferent incubation conditions tested (p < 0.05). The middle panel (B) represents the dose dependent activation by retinol of retinoic acid-responsive reporter.The bottom panel (C) indicates the dose dependent activation by all-trans retinoic acid of a retinoic acid-responsive reporter.

1214 G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

CRBP-1

36B4

CRABP-2

36B4

I 1 3.25 1 1.88

D R N RD N

I

Fig. 5. Induction of retinoic acid target genes in primary culture ofamnion cells. Primary cultures of amnion cells were cultivated with1 lmol/l of retinol for 24 h. RT-PCR for CRBP1, CRABP1, and 36B4 wasthen carried out. Band intensities were analyzed by densitometry andnormalized against the 36B4 band. Abbreviations: D, DMSO; R, all-trans

retinol; N, negative control; I, fold of induction.

G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216 1215

pregnant mice [39]. Links have been established betweenalcohol abuse, fetal malformations (fetal alcoholic syn-drome or FAS), and impaired retinoid metabolism [40].Previous studies [21,41] and our present work have dem-onstrated the interference of alcohol in the synthesis offunctional retinoids from retinol in the extra-embryonictissues. We suggest that impairment of fetal membraneretinoid metabolism by maternal ethanol ingestion mayprovide a novel additional explanation for the genesisof FAS pathology by impairment of fetal membranephysiology. This perturbation may be additional to thosealready known for ethanol as regards fetal membranes:production of free radicals produced by ethanol metabo-lism inducing lipid peroxidation of the cell membranes,inhibition by ethanol of ATPase activity located in themicrovilli side cell membrane and mitochondrial mem-branes, and disturbance by ethanol of pinocytosis andstorage vesicle transport [39].

In conclusion, our study identifies the molecular actorsof retinoid metabolism and signaling pathway in humanfetal membranes. These results suggest that endogenousand amniocyte-derived retinoids may have active roles inthe physiology of the human amniotic membranes. Altera-tions of this metabolic and molecular pathway may be det-rimental during human gestation and may offer amolecular basis for the explanation of human fetal mem-brane pathology.

Acknowledgments

The authors thank Loıc Blanchon for his valuable con-tribution in reviewing the manuscript, and all the midwiveswhose professional skill and generous cooperation madethis study possible.

References

[1] V. Sapin, L. Blanchon, A.F. Serre, D. Lemery, B. Dastugue, S.J.Ward, Use of transgenic mice model for understanding the placen-tation: towards clinical applications in human obstetrical pathologies?Transgenic Res. 10 (2001) 377–398.

[2] G.M. Gude, J.L. Stevenson, P. Murthi, S. Rogers, J.D. Best, B.Kalionis, R.G. King, Expression of GLUT12 in the fetal membranesof the human placenta, Placenta 26 (2005) 67–72.

[3] G.D. Bryant-Greenwood, The extracellular matrix of the human fetalmembranes: structure and function, Placenta 19 (1998) 1–11.

[4] J.C. Cross, D. Baczyk, N. Dobric, M. Hemberger, M. Hughes, D.G.Simmons, H. Yamamoto, J.C. Kingdom, Genes, development andevolution of the placenta, Placenta 24 (2003) 123–130.

[5] L. Blanchon, J.L. Bocco, D. Gallot, A.M. Gachon, D. Lemery, P.Dechelotte, B. Dastugue, V. Sapin, Co-localization of KLF6 andKLF4 with pregnancy-specific glycoproteins during human placentadevelopment, Mech. Dev. 105 (2001) 185–189.

[6] F.A. Patel, J.W. Funder, J.R. Challis, Mechanism of cortisol/progesterone antagonism in the regulation of 15-hydroxyprostaglan-din dehydrogenase activity and messenger ribonucleic acid levels inhuman chorion and placental trophoblast cells at term, J. Clin.Endocrinol. Metab. 88 (2003) 2922–2933.

[7] K. Sun, L. Myatt, Enhancement of glucocorticoid-induced 11beta-hydroxysteroid dehydrogenase type 1 expression by proinflammatorycytokines in cultured human amnion fibroblasts, Endocrinology 144(2003) 5568–5577.

[8] W.L. Whittle, W. Gibb, J.R. Challis, The characterization of humanamnion epithelial and mesenchymal cells: the cellular expression,activity and glucocorticoid regulation of prostaglandin output,Placenta 21 (2000) 394–401.

[9] E.B. Berry, R. Eykholt, R.J. Helliwell, R.S. Gilmour, M.D. Mitchell,K.W. Marvin, Peroxisome proliferator-activated receptor isoformexpression changes in human gestational tissues with labor at term,Mol. Pharmacol. 64 (2003) 1586–1590.

[10] L.R. Dunn-Albanese, W.E. Ackerman 4th, Y. Xie, J.D. Iams, D.A.Kniss, Reciprocal expression of peroxisome proliferator-activatedreceptor-gamma and cyclooxygenase-2 in human term parturition,Am. J. Obstet. Gynecol. 190 (2004) 809–816.

[11] M. Lappas, M. Permezel, H.M. Georgiou, G.E. Rice, Regulation ofproinflammatory cytokines in human gestational tissues by peroxi-some proliferator-activated receptor-gamma: effect of 15-deoxy-Del-ta(12,14)-PGJ(2) and troglitazone, J. Clin. Endocrinol. Metab. 87(2002) 4667–4672.

[12] M. Blumenstein, J.M. Bowen-Shauver, J.A. Keelan, M.D. Mitch-ell, Identification of suppressors of cytokine signaling (SOCS)proteins in human gestational tissues: differential regulation isassociated with the onset of labor, J. Clin. Endocrinol. Metab. 87(2002) 1094–1097.

[13] G. Marceau, D.H. Volle, D. Gallot, D.J. Mangelsdorf, V. Sapin, J.M.Lobaccaro, Placental expression of the nuclear receptors for oxyster-ols LXRalpha and LXRbeta during mouse and human development,Anat. Rec. A Discov. Mol. Cell Evol. Biol. 283 (2005) 175–181.

[14] J. Bastien, C. Rochette-Egly, Nuclear retinoid receptors and thetranscription of retinoid-target genes, Gene 328 (2004) 1–16.

[15] P. Lefebvre, P.J. Martin, S. Flajollet, S. Dedieu, X. Billaut, B.Lefebvre, Transcriptional activities of retinoic acid receptors, VitamHorm. 70 (2005) 199–264.

[16] V. Sapin, R.-J. Begue, B. Dastugue, P. Chambon, P. Dolle, Retinoidsand mouse placentation, Troph. Res. 12 (1998) 49–67.

[17] V. Sapin, P. Bouillet, M. Oulad-Abdelghani, B. Dastugue, P. Cham-bon, P. Dolle, Differential expression of retinoic acid-inducible (Stra)genes during mouse placentation, Mech. Dev. 92 (2000) 295–299.

[18] M. Liden, U. Erikson, Understanding retinol metabolism-structureand function of retinol dehydrogenases, J. Biol. Chem. (2006), Epubahead of print.

[19] M. Taimi, C. Helvig, J. Wisniewski, H. Ramshaw, J. White, M.Amad, B. Korczak, M. Petkovich, A novel human cytochrome P450,CYP26C1, involved in metabolism of 9-cis and all-trans isomers ofretinoic acid, J. Biol. Chem. 279 (2004) 77–85.

[20] V. Sapin, S. Chaib, L. Blanchon, M.C. Alexandre-Gouabau, D.Lemery, F. Charbonne, D. Gallot, B. Jacquetin, B. Dastugue, V. Azais-Braesco, Esterification of vitamin A by the human placenta involvesvillous mesenchymal fibroblasts, Pediatr. Res. 48 (2000) 565–572.

[21] L. Blanchon, P. Sauvant, C. Bavik, D. Gallot, F. Charbonne, M.C.Alexandre-Gouabau, D. Lemery, B. Jacquetin, B. Dastugue, S. Ward,V. Sapin, Human choriocarcinoma cell line JEG-3 produces andsecretes active retinoids from retinol, Mol. Hum. Reprod. 8 (2002)485–493.

1216 G. Marceau et al. / Biochemical and Biophysical Research Communications 346 (2006) 1207–1216

[22] J.C. Wallingford, A. Milunsky, B.A. Underwood, Vitamin A andretinol-binding protein in amniotic fluid, Am. J. Clin. Nutr. 38 (1983)377–381.

[23] M. Nozaki, J. Kawahara, R. Muramatsu, M. Usui, Quantitativedetermination of vitamin A levels in frozen preserved human amnioticmembrane, Nippon Ganka Gakkai Zasshi 109 (2005) 727–735.

[24] I.D. Neeper, D.L. Patton, C.C. Kuo, Cinematographic observationsof growth cycles of Chlamydia trachomatis in primary cultures ofhuman amniotic cells, Infect. Immun. 58 (1990) 2042–2047.

[25] F. Chiambaretta, F. De Graeve, G. Turet, G. Marceau, P. Gain, B.Dastugue, D. Rigal, V. Sapin, Cell and tissue specific expression ofhuman Kruppel-like transcription factors in human ocular surface,Mol. Vis. 10 (2004) 901–909.

[26] S. Mader, J.Y. Chen, Z. Chen, J. White, P. Chambon, H. Gronemeyer,The patterns of binding of RAR, RXR and TR homo- and heterodi-mers to direct repeats are dictated by the binding specificites of theDNA binding domains, EMBO J. 12 (1993) 5029–5041.

[27] R. Faraonio, M. Galdieri, V. Colantuoni, Cellular retinoic-acid-binding-protein and retinol-binding-protein mRNA expression in thecells of the rat seminiferous tubules and their regulation by retinoids,Eur. J. Biochem. 211 (1993) 835–842.

[28] A. Astrom, U. Pettersson, J.J. Voorhees, Structure of the humancellular retinoic acid-binding protein II gene. Early transcriptionalregulation by retinoic acid, J. Biol. Chem. 267 (1992) 25251–25255.

[29] M. Clagett-Dame, H.F. DeLuca, The role of vitamin A in mamma-lian reproduction and embryonic development, Annu. Rev. Nutr. 22(2002) 347–381.

[30] C. Bavik, S.J. Ward, D.E. Ong, Identification of a mechanism tolocalize generation of retinoic acid in rat embryos, Mech. Dev. 69(1997) 155–167.

[31] V. Parrow, C. Horton, M. Maden, S. Laurie, E. Notarianni,Retinoids are endogenous to the porcine blastocyst and secreted bytrophectoderm cells at functionally active levels, Int. J. Dev. Biol. 42(1998) 629–632.

[32] S.M. O’Byrne, N. Wongsiriroj, J. Libien, S. Vogel, I.J. Goldberg, W.Baehr, K. Palczewski, W.S. Blaner, Retinoid absorption and storageis impaired in mice lacking lecithin: retinol acyltransferase (LRAT), J.Biol. Chem. 280 (2005) 35647–35657.

[33] M.D. Orland, K. Anwar, D. Cromley, C.H. Chu, L. Chen, J.T.Billheimer, M.M. Hussain, D. Cheng, Acyl coenzyme A dependentretinol esterification by acyl coenzyme A: diacylglycerol acyltransfer-ase 1, Biochim. Biophys. Acta 1737 (2005) 76–82.

[34] T. Linke, H. Dawson, E.H. Harrison, Isolation and characterizationof a microsomal acid retinyl ester hydrolase, J. Biol. Chem. 280 (2005)23287–23294.

[35] B.M. Barrett, A. Sowell, E. Gunter, M. Wang, Potential role ofascorbic acid and beta-carotene in the prevention of pretermrupture of fetal membranes, Int. J. Vitam. Nutr. Res. 64 (1994)192–197.

[36] C. Kiefer, S. Hessel, J.M. Lampert, K. Vogt, M.O. Lederer, D.E.Breithaupt, J. von Linting, Identification and characterization of amammalian enzyme catalyzing the asymmetric oxidative cleavage ofprovitamin A, J. Biol. Chem. 276 (2001) 14110–14116.

[37] A. Tarrade, C. Rochette-Egly, J. Guibourdenche, D. Evain-Brion,The expression of nuclear retinoid receptors in human implantation,Placenta 21 (2000) 703–710.

[38] A. Guiet-Bara, M. Bara, Ethanol effect on the ionic transfer throughisolated human amnion. II. Cellular targets of the in vitro acuteethanol action and of the antagonism between magnesium, taurineand ethanol, Cell. Mol. Biol. 39 (1993) 715–722.

[39] Y. Xu, R. Xiao, Y. Li, Effect of ethanol on the development ofvisceral yolk sac, Hum. Reprod. 20 (2005) 2509–2516.

[40] R.D. Zachman, M.A. Grummer, The interaction of ethanol andvitamin A as a potential mechanism for the pathogenesis offetal alcohol syndrome, Alcohol. Clin. Exp. Res. 22 (1998)1544–1556.

[41] X.D. Wang, Chronic alcohol intake interferes with retinoid metab-olism and signalling, Nutr. Rev. 57 (1999) 51–59.