Cell Calcium 40 (2006) 11–21

Modulation of calcium signalling by dominant negative splice variantof ryanodine receptor subtype 3 in native smooth muscle cells

Fabrice Dabertrand a, Jean-Luc Morel a,∗, Vincenzo Sorrentino b,Jean Mironneau a, Chantal Mironneau a, Nathalie Macrez a

a Laboratoire de Signalisation et Interactions Cellulaires, CNRS UMR5017, Universite Bordeaux 2, 146 rue Leo Saignat,33076 Bordeaux Cedex, France

b Molecular Medecine Unit, Department of Neuroscience, University Hospital of Sienna, Via A. Moro, 53100 Siena, Italy

Received 19 October 2005; received in revised form 21 December 2005; accepted 16 March 2006Available online 4 May 2006

Abstract

The ryanodine receptor subtype 3 (RYR3) is expressed ubiquitously but its physiological function varies from cell to cell. Here, wei 2+

oswiCnt©

1

maRtecsCaoain

0d

nvestigated the role of a dominant negative RYR3 isoform in Ca signalling in native smooth muscle cells. We used intranuclear injectionf antisense oligonucleotides to specifically inhibit endogenous RYR3 isoform expression. In mouse duodenum myocytes expressing RYR2ubtype and both spliced and non-spliced RYR3 isoforms, RYR2 and non-spliced RYR3 were activated by caffeine whereas the spliced RYR3as not. Only RYR2 was responsible for the Ca2+-induced Ca2+ release mechanism that amplified Ca2+ influx- or inositol 1,4,5-trisphosphate-

nduced Ca2+ signals. However, the spliced RYR3 negatively regulated RYR2 leading to the decrease of amplitude and upstroke velocity ofa2+ signals. Immunostaining in injected cells showed that the spliced RYR3 was principally expressed near the plasma membrane whilst theon-spliced isoform was revealed around the nucleus. This study shows for the first time that the short isoform of RYR3 controls Ca2+ releasehrough RYR2 in native smooth muscle cells.

2006 Elsevier Ltd. All rights reserved.

. Introduction

Ryanodine receptors (RYRs) form a family of sarcoplas-ic reticulum (SR) Ca2+ channels. The three RYRs (RYR1-3)

re engaged in the complexity of Ca2+ signalling [1–3]. FourYR monomers are associated in homo- or heterotetramers

o form functional channels [4]. RYRs encode two differ-nt Ca2+ signals: Ca2+ waves that are propagated into theell and stochastic Ca2+ release events visualized as Ca2+

parks [5,6]. The RYR1 and RYR2 subtypes encode botha2+ sparks and Ca2+ waves respectively in skeletal [7,8]nd in cardiac myocytes [5]. In smooth muscle, the presencef both RYR1 and RYR2 is required to encode Ca2+ sparksnd Ca2+ waves [9]. In mouse duodenum myocytes, express-ng RYR2 and RYR3 but lacking RYR1, Ca2+ sparks haveot been observed [10].

∗ Corresponding author. Tel.: +33 5 5757 1232; fax: +33 5 5757 1227.E-mail address: jean-luc.morel@umr5017.u-bordeaux2.fr (J.-L. Morel).

The RYR3 subtype is expressed ubiquitously but its func-tion is not well elucidated. The function of RYR3 hasbeen compared to that of RYR1, mainly because these sub-types are co-expressed in skeletal muscle. In the skeletalcell line 1B5 expressing only RYR3, RYR3 can be acti-vated by pharmacological agents such as caffeine but can-not induce excitation–contraction coupling [11]. In the samecells, spontaneous Ca2+ sparks can be encoded by RYR3,yet both amplitude and duration of these Ca2+ events arelarger with a reduced spatial diffusion as compared withthose of Ca2+ events occuring in RYR1-expressing cells [8].In non-excitable cells, such as HEK293, spontaneous Ca2+

events are observed in RYR3 expressing cells [12]. Recently,RYR3 has been implicated in pacemaker Ca2+ activity inboth T-lymphocytes [13] and interstitial cells of Cajal [14].In non-pregnant myometrial cells that express only RYR3,Ca2+ spark activity was not detected and caffeine induceda Ca2+ signal only after Ca2+ overloading of the SR [15].Comparison between vascular myocytes from control and

143-4160/$ – see front matter © 2006 Elsevier Ltd. All rights reserved.oi:10.1016/j.ceca.2006.03.008

12 F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21

RYR3 knock-out mice, suggests an inhibitory effect of RYR3on Ca2+ signals [16]. Finally, by expressing RYR3 in engi-neered cells, it has been proposed that the level of expressionof RYR3 can control the resting intracellular Ca2+ concen-tration ([Ca2+]i) [17].

Several studies described the expression of splice variantsof RYR3 in different species without determining their func-tions in Ca2+ signalling [18–20]. The first exhaustive study ofRYR3 alternative splicing shows the existence of a dominantnegative isoform. Actually, its expression in HEK293 cellsindicates that this short isoform of RYR3 is not a functionalCa2+ channel but inhibits Ca2+ release when it is co-expressedwith full length RYR3 and decreases [3H]-ryanodine bind-ing when it is coexpressed with RYR2 [21]. However, so farno evidence of physiological relevance of RYR3 alternativesplicing has been proposed.

Physiologically, RYRs are responsible for the Ca2+-induced Ca2+ release (CICR) mechanism as demonstrated inskeletal and cardiac muscles [22,23]. RYRs are also involvedin mediator-induced Ca2+ responses by amplifying inositol-1,4,5-trisphosphate (InsP3)-dependent Ca2+ responses orCa2+ influx through voltage-gated Ca2+ channels via theCICR mechanism [24,25]. Finally, mediators can activateRYRs via cyclic ADP-ribose that has thus been proposedto be the endogenous second messenger to stimulate RYR[26,27].

pitPoeaOiC

2

2

aA0

lcls0swb

Table 1Sequences of antisense oligonucleotides designed against RYR3 isoforms

Name Sequence Position in XM 619795

asRYR3 ACTTAGCCATGACACCAG 11756–11772asRYR3L GAACCTCAGGTTGTAGAA 11194–11211asRYR3S CAGTGACCAATAAC 11169–11175 · · ·

11263–11277asSCB CAGCACTATCAGTACGAC X

Tissues were placed in an enzyme-free solution and tritu-rated using a fire-polished Pasteur pipette to release cells.Cells were seeded at a density of 103 cells/mm2 on glassslides. Myocytes were maintained in short term primary cul-ture in medium M199 containing 5% foetal calf serum (FCS),20 units/ml penicillin, and 20 �g/ml streptomycin. Cells werekept in an incubator gassed with 95% air and 5% CO2at 37 ◦C. The myocytes were cultured in this medium for4 days.

2.2. Microinjection of oligonucleotides

Phosphorothioate antisense oligonucleotides (denotedwith the prefix “as”) used in the present study were designedfrom the obtained sequences and blasted in GenebankTM totest their specificity towards RYR3. Sequences of antisenseoligonucleotides are listed in Table 1. Oligonucleotides wereinjected into the nucleus of myocytes by a manual injec-tion system with femtotips II (Eppendorf) [28]. The area ofinjection is a imprinted square on glass slide. The myocyteswere then cultured for 2–4 days in culture medium, and theglass slides were transferred into the perfusion chamber forphysiological experiments. To mark injected cells, antisenseoligonucleotides were 5′-Cy5 indocarbocyanin-labelled dur-ing synthesis by Eurogentec (Serain, Belgium). Injected cellswere localized by Cy5 indocarbocyanin fluorescence emitteda

2

aeffoDPistfsSfA(

The present study was performed to demonstrate theresence and the relevance in Ca2+ signalling of the dom-nant negative RYR3 isoform in native cells. We investigatedhe expression and distribution of RYR3 isoforms by RT-CR and immunostaining. We designed specific antisenseligonucleotides. With these antisense oligonucleotides, thexpression of each RYR3 isoform was sequentially inhibitednd their function was determined by Ca2+ measurement.ur study shows that a short isoform of RYR3 is expressed

n duodenum myocytes and decreases the efficiency of theICR mechanism by a negative modulation of RYR2.

. Experimental procedures

.1. Cell preparation

The investigations conform to the European Communitynd French guiding principles for the care and use of animals.uthorization to perform animal experiments (A-33-063-03) was obtained from the prefecture de la Gironde (France).

C57Bl6 mice (12–24 weeks) were killed by cervical dis-ocation. The longitudinal layer of duodenal smooth mus-le was cut into several pieces and incubated for 10 min inow Ca2+ (40 �M) physiological solution (Hanks’ balancedalt solution). Then 0.6 mg/ml collagenase (EC 3.4.24.3),.15 mg/ml pronase E (EC 3.4.24.31), and 1 mg/ml bovineerum albumin were added at 37 ◦C for 10 min. The solutionas then removed, and the pieces of duodenum were incu-ated again in a fresh enzyme solution at 37 ◦C for 10 min.

t 680 ± 32 nm (excitation 647 nm).

.3. RT-PCR

In order to determine the presence of RYR3 splice vari-nts, all myocytes of one dissociation were used and thexperiment was repeated six times. Total RNA was extractedrom myocytes and tissues using the RNA preparation kitrom Epicentre (Madison, WI), following the instructionsf the supplier. The RNA concentration was determined atO260 nm with a Eppendorf Biophotometer (Eppendorf, Leecq, France). To control the decrease of RNA expression in

njected cells (10–30 cells), RNA was prepared from the cellseeded inside (injected cells) and outside (non-injected cells)he imprinted square on glass slide [9]. The PCR was per-ormed as previously detailed [10]. Briefly, the reverse tran-cription reaction was performed on 50 ng of RNA using theensiscript-RT kit (Qiagen, Hilden, Germany). PCR was per-ormed on 0.5 �l of cDNA with a thermal cycler (Eppendorf).mplification products were separated by electrophoresis

2% agarose gel) and visualized by ethidium bromide (EtBr)

F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21 13

staining under UV illumination. Gels were photographedwith EDAS120 and analyzed with KDS1D 2.0 software(Kodak Digital Science, Paris, France).

Sense (s) and antisense (as) primer pairs specific forRYR2 were previously described in [9]. Two primerpairs specific for the dominant negative splicing site ofRYR3, were designed on mouse RYR3 sequence depositedin GenebankTM sequence data base (accession number:AF111166) with Lasergene software (DNASTAR, Madison,WI). The nucleotide sequence and length of the expected PCRproducts (in parentheses) for each primer pair were respec-tively: 8AP1 (s) CAAGGACGAACCCCCAACATTAG;8AP1 (as) CACCATCGCTTCTTCCTCGTCA (462 bp, fulllength) and 8AP2 (s) GGAGGAGGGGCAAACAGAC-TACC; 8AP2 (as) GGAAAAGATGGCGTGTTGATTACC(566 bp, full length).

2.4. DNA sequencing

After electrophoresis, the amplified DNA fragments werecleaned and purified with the Qiaquick gel extraction kit (Qia-gen). PCR fragments were sequenced by the GenomExpresssequencing service (Meylan, France).

2.5. Cytosolic Ca2+ measurements

s4a1sPFfipavflFwcclrtpmflap2(bea

indicated on the records. All experiments were carried out at26 ± 1 ◦C.

2.6. RYR immunostaining

Immunostaining protocol has been described previously[15]. Briefly, myocytes were washed with PBS, fixed with4% (v/v) formaldehyde and 0.05% glutaraldehyde for 10 minat room temperature, and permeabilized in PBS containing3% FCS and 1 mg/ml of saponin for 20 min. Cells werenext incubated with PBS, saponin (1 mg/ml) and anti-RYR3or anti-RYR (clone C3.33) antibodies overnight at 4 ◦C.Then cells were washed and incubated with the appropriatesecondary alexa488-antibody during 45 min at room tem-perature. After washing in PBS, slides were mounted invectashield (Valbiotech). Images of the stained cells wereobtained with a MRC 1024ES confocal microscope. Fluo-rescence was acquired on each cell from a z-series analysis(20 ± 5 sections) using Lasersharp software (Bio-Rad). Flu-orescence was estimated by grey level analysis using IDLsoftware (RSI) in 0.5 �m confocal sections and expressedby volume unit. Cells were compared by keeping acquisitionparameters constant (such as grey scale, exposure time, irisaperture, gain and laser power).

2.7. Chemicals and drugs

Nl((aaasARia

2

bS

3

3i

Ru

Cells were loaded by incubation in a physiologicalolution containing 2 �M fluo-4-acetoxymethylester (fluo--AM) for 20 min at 37 ◦C. These cells were washed andllowed to cleave the dye to the active fluo-4 compound for0 min. Images are acquired using the image series or line-can mode of a confocal Bio-Rad MRC1024ES (Bio-Rad,aris, France) connected to a Nikon Diaphot microscope.luo-4 was excited at 488 nm, and emitted fluorescence wasltered and measured at 540 ± 30 nm. Image series is com-osed by images of the same confocal section of the cell takent 1.2 s intervals. To analyze the variation of fluorescence, thealue of fluorescence of each myocyte (F) was divided by theuorescence of the first frame (F0, baseline) and reported as/F0 in a time-course graph. Before applying the mediator,e verified that myocyte fluorescence was stable on 4–6 suc-

essive frames. Images acquired in the line-scan mode wereomposed of lines scanned at a rate of 2 ms/scan. Scannedines were plotted vertically, and each line was added to theight of the preceding line to form the line-scan image. Inhese images, time increased from the left to the right and theosition along the scanned line was given by vertical displace-ent. Fluorescence signals were expressed as pixel per pixeluorescence ratios (F/F0), where F is the fluorescence duringresponse and F0 is the rest-level fluorescence of the sameixel. Image processing was performed by using Lasersharp000 software (Bio-Rad) and analysis by using IDL softwareRSI Boulder, CO). Background fluorescence was minimizedy specific adjustment of MRC1024ES acquisition param-ters. Caffeine, acetylcholine (ACh) and BayK8644 werepplied by pressure ejection from a glass pipette for the period

Collagenase was obtained from Worthington (Freehold,J). Fluo-4-AM was from Teflab (Austin, TX). Alexa-

abelled secondary antibodies were from Molecular ProbesLeiden, The Netherlands). Caffeine was from MerckNogent sur Marne, France). Medium M199, streptomycinnd penicillin were from Invitrogen (Cergy Pontoise, France)nd vectashield (AbCys, Paris). Primers were synthesizednd purchased from Invitrogen and phosphorothioate anti-ense oligonucleotides from Eurogentec (Seraing, Belgium).ll other chemicals were from Sigma. The monoclonal anti-YR antibody (clone C3.33) was directed against the cardiac

soform of RYR (RYR2) [29] and specificity of the anti-RYR3ntibody has been previously reported [15].

.8. Data analysis

Data are expressed as means ± S.E.; n represents the num-er of tested cells. Significance was tested by means oftudent’s test. p-Values < 0.05 were considered as significant.

. Results

.1. Characterization of the dominant negative RYR3soform

In mouse duodenum myocytes, expression of RYR2 andYR3 subtypes has been described previously [10]. In rabbitterus, seven spliced variants of RYR3 have been identi-

14 F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21

Fig. 1. Expression of RYR3 isoforms and effects of antisense oligonucleotides revealed by RT-PCR. (A) cDNA fragments were amplified from cortex (Br),cerebellum (Co), heart (He), soleus (So), diaphragm (Di) tissues and from urinary bladder (Ub), duodenum (Du) and myometrium (My) myocytes. (B) RYR3isoforms were amplified from duodenum myocytes injected with asSCB, asRYR3, asRYR3L, asRYR3S and asRYR2 and non-injected myocytes (CTL). (C)RYR2 subtype amplifications were obtained from cells injected with asSCR, asRYR2, asRYR3, asRYR3L, asRYR3S and non-injected cells (CTL). Fragmentsof cDNA were separated on a 2% agarose gel, visualized by stained with EtBr and shown as a contrasted image. Molecular size standard was indicated in bp.cDNA fragments were obtained by RT-PCR using 8AP2 primer pair (35 cycles, 60 ◦C). The ladder was indicated (L) and was the 100–1000 bp ladder with10 bands. Here, only the part of gel containing RYR3 isoforms or RYR2 subtype amplicons was represented. In (B–C), myocytes were used after 3 days ofculture.

fied and one of the alternative spliced site, AS8a, confersa dominant negative function to the spliced isoform [21].Expression of RYR3 alternative splicing (AS8a site) wasinvestigated in mouse tissues with two different pairs of PCRprimers that flank AS8a putative site in RYR3 mouse cDNA.Each pair of primers revealed two amplicons (Fig. 1A). Thedifference between both amplicons was 87 base pairs (bp)potentially corresponding to a sequence of 29 amino acids asdescribed in the rabbit [21]. Sequencing of amplicons frommouse duodenum myocytes was performed and sequenceswere aligned with DNAstar software using clustal method.The longer sequence RYR3L and the published mouse RYR3cDNA (AF111116) were identical. In the smaller amplicon,named RYR3S, a sequence of 87 bp was lost (nucleotides929–1015 in AF111116) which corresponded to the alterna-tive spliced sequence described in rabbit RYR3. In mouse,the RYR3S amplicon was found in skeletal, cardiac andsmooth muscles and also in cerebellum but not in cortex sam-ples (Fig. 1A). The ratio between fluorescence intensity ofRYR3S and RYR3L amplicons suggests that RYR3S was themajor isoform expressed in smooth muscles, heart and soleuswhereas it was the minor isoform expressed in cerebellumand diaphragm. As duodenum myocytes highly expressedthe RYR3 isoforms, we examined the function of RYR3 iso-forms in freshly dissociated and primary cultured duodenummyocytes by using an antisense oligonucleotide strategy.

3o

aT

of asRYR3S, from 22 to 14 mers, to inhibit the expression ofRYR3S amplicons specifically (data not shown). As previ-ously reported [9,30], 3 days after intra-nuclear injection ofasRYR3 in smooth muscle cells, expression of RYR3 mRNAand protein were maximally inhibited. Under similar condi-tions, the effects of asRYR3L and asRYR3S (Table 1) wereinvestigated by RT-PCR. As shown in myocytes injected withthe scrambled antisense oligonucleotides (asSCB, Table 1),nuclear injection did not modify the expression of mRNAencoding RYR3 isoforms or RYR2 subtype (Fig. 1B and C).Intranuclear injection of asRYR3 inhibited the expression ofboth RYR3 isoforms whilst expression of RYR2 mRNA wasnot affected. The asRYR3L selectively inhibited the expres-sion of the RYR3L mRNA without affecting the expression ofRYR3S mRNA whereas the asRYR3S selectively inhibitedthe expression of the RYR3S mRNA without change in theexpression level of RYR3L mRNA (Fig. 1B). We also ver-ified that injection of asRYR2 specifically inhibited RYR2mRNA expression (Fig. 1C) without modification of mRNAexpression level of both RYR3 isoforms (Fig. 1B).

Immunostaining of duodenum myocyte RYR3 proteinswith an anti-RYR3 antibody that recognized both RYR3L andRYR3S isoforms revealed that asRYR3L and asRYR3S par-tially inhibited RYR3 expression (Fig. 2A). Specific RYR3immunostaining was decreased by about 50% by each anti-sense oligonucleotide, suggesting a similar expression leveloa(iIci

.2. Selective inhibition of RYR3 isoforms by antisenseligonucleotides

To select the best antisense oligonucleotides directedgainst the short isoform of RYR3 (asRYR3S, as indicated inable 1), we tested by RT-PCR the ability of several lengths

f each spliced variant in duodenum myocytes. It was notice-ble that asRYR3 largely inhibited RYR3 immunostainingFig. 2A) in a manner similar to that obtained with co-njection of 10 �M asRYR3L + 10 �M asRYR3S (Fig. 2A).n asRYR3S-injected myocytes, immunostaining was prin-ipally revealed around the nucleus whereas in asRYR3Lnjected myocytes, RYR3 immunostaining was localized near

F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21 15

Fig. 2. Effects of antisense oligonucleotides on RYR3 isoform expression revealed by immunostaining in cultured duodenum myocytes. Typical confocalsections showing immunostaining obtained (A) with anti-RYR3 antibody (1:100) in non-injected cells and asRYR3, asRY3L or asRYR3S-injected myocytesand (B) with anti-RYR2 antibody (C 3.33 clone, 1:1000). Images were contrasted with confocal assistant 4.2 software. The same correction factors were appliedon all the images. Compiled data of specific fluorescence [(Fluo-NSF)/�m3] observed with anti-RYR3 and anti-RYR2 antibodies in non-injected cells (openbars) and injected cells (filled bars), respectively. Data are mean ± S.E.M. with the number of tested cells indicated in parentheses (�, p < 0.05). Myocytes wereused after 3 days of culture.

the plasma membrane suggesting specific subcellular local-ization for long and short isoforms of RYR3. Injection ofasRYR3, asRYR3L and asRYR3S did not affect the expres-sion levels of RYR2 mRNA (Fig. 1C) and protein (Fig. 2B), asshown by immunostaining with the anti-RYR antibody (cloneC3.33) directed against the cardiac RYR subtype. Finally,injection of asRYR2 did not modify RYR3 isoform expres-sion as revealed by immunostaining of RYR3 by the specificanti-RYR3 antibody (Fig. 2A). In addition, immunostainingwith the C3.33 antibody was homogeneous in the duodenummyocytes, suggesting expression of RYR2 in the whole SR.

3.3. Role of RYR3 isoforms on caffeine-induced Ca2+

response

Caffeine is known to activate RYR subtypes by increasingtheir sensitivity to Ca2+ activation. Application of 10 mM caf-feine in non-injected cells induced a transient Ca2+ responsewhich was totally inhibited in the presence of 1 �M ryan-odine for 30 min (Fig. 3A). Nuclear injection of a scrambledantisense oligonucleotide did not modify the caffeine-induced Ca2+ response as shown in Fig. 3. In asRYR3- andasRYR3S-injected cells, the amplitude of caffeine-induced

16 F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21

Fig. 3. Effects of antisense oligonucleotides directed against the RYR3 iso-forms on Ca2+ responses evoked by caffeine. (A) Typical Ca2+ responseinduced by 10 mM caffeine in non-injected duodenum cells (in control con-ditions and in the presence of 1 �M ryanodine for 30 min) and in injected cells(asSCB, asRYR3, asRYR2 + asRYR3S, asRYR2 + asRYR3L). (B) Com-piled data showing the amplitude of Ca2+ responses evoked by 10 mMcaffeine in non-injected cells (open bar) and in cells injected with 10 �MasSCB or 10 �M asRYR antisense oligonucleotides (filled bars). Data aremean ± S.E.M. with the number of tested cells indicated in parentheses.Myocytes were loaded with Fluo-4-AM (2 �M) and used 3 days after injec-tion (�, p < 0.05).

Ca2+ responses was significanlty increased (Fig. 3B)suggesting an inhibitory effect of endogenous RYR3S onCa2+ release. In asRYR2- and asRYR2 + asRYR3S-injectedcells, the Ca2+ release induced by caffeine was signifi-cantly decreased (Fig. 3). However, a small Ca2+ responseremained indicating an implication of the RYR3L isoform incaffeine-induced Ca2+ response. This result was confirmedby injection of asRYR3L which partially decreased caffeine-induced Ca2+ release and by a significant difference betweenCa2+ responses measured in asRYR3- and asRYR3S-injectedcells (asRYR3-injected cells F/F0 = 5.38 ± 0.58 ratio units,n = 17 versus asRYR3S-injected cells 6.84 ± 0.44, n = 32,p < 0.05, Fig. 3B). It was noticeable that amplitudes of Ca2+

release measured in asRYR2- and asRYR2 + asRYR3S-

injected cells were similar (Fig. 3B). This result suggestedthat the RYR3L isoform was not functionally regulated by theRYR3S isoform. Finally, the absence of Ca2+ release inducedby caffeine in asRYR3L + asRYR2-injected cells confirmedthat RYR3S could not encode Ca2+ release (Fig. 3B).

In line-scan mode, it is possible to record fast Ca2+

events and measure the kinetics of these signals. In myocytesinjected with asRYR3S or asRYR3, the increase of amplitudeof caffeine-induced Ca2+ responses was correlated with anincrease in upstroke velocity (Fig. 4). In contrast, the injectionof asRYR3L decreased the kinetic parameters as observed inimage series mode. The injection of asRYR2 also decreasedsignificantly the upstroke velocity of caffeine-induced Ca2+

wave (asRYR2-injected cells: 3.21 ± 1.4 �F/F0/s, n = 14 ver-sus non-injected cells: 8.63 ± 1.5 �F/F0/s, n = 13, p < 0.05).A similar result was observed in cells injected with 10 �MasRYR2 + 10 �M asRYR3S (upstroke velocity of caffeine-induced Ca2+ wave: 4.65 ± 0.9 �F/F0/s, n = 8).

The SR Ca2+ loading was principally due to the SERCAactivation responsible for Ca2+ store refilling. The effectof a SERCA inhibitor was investigated to check the effectof asRYR3 nuclear injection on Ca2+ store refilling. Ca2+

responses evoked by 1 �M thapsigargin were identical incells injected with either asRYR3, asRYR3L or asRYR3Sand in non-injected cells, whereas the caffeine-induced Ca2+

response was completely blocked 3 min after thapsigarginaim

rTidraR

3

ircmai(acciiiri

pplication (Fig. 5). This result suggests that Ca2+ store refill-ng is not different in asRYR3-injected and in non-injected

yocytes.In duodenum, we have shown that caffeine-induced Ca2+

elease was principally due to RYR2 subtype activation [10].he present results suggest that the short isoform of RYR3

s able to inhibit RYR2 activity selectively, leading to aecrease of both amplitude and upstroke velocity of Ca2+

elease induced by caffeine. Since RYRs are physiologicallyctivated by the CICR mechanism, we tested the ability ofYR3 isoforms to regulate this mechanism.

.4. Role of RYR3 isoforms in CICR mechanism

The CICR mechanism is activated by a local increase inntracellular Ca2+ concentration. BayK8644 is a dihydropy-idine that increases the activity of L-type voltage-gated Ca2+

hannels and induces a Ca2+ influx that can activate the CICRechanism [9]. Application of 100 nM BayK8644 inducedtransient Ca2+ response whose amplitude was decreased

n the presence of 1 �M ryanodine in non-injected cellsFig. 6A). This result indicates that the CICR mechanism wasctivated by BayK8644. The injection of antisense oligonu-leotides did not modify Ca2+ influx by voltage-gated Ca2+

hannels as shown by the similar amplitude of BayK8644-nduced Ca2+ responses in the presence of ryanodine obtainedn injected (F/F0 = 1.32 ± 0.31 ratio units, n = 15) and non-njected cells (F/F0 = 1.37 ± 0.46 ratio units, n = 12). Ca2+

esponses induced by 100 nM BayK8644 were significantlyncreased in asRYR3-injected cells (Fig. 6A and B). Injection

F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21 17

Fig. 4. Effects of asRYR3 on upstroke velocity of Ca2+ responses evoked by caffeine in line-scan mode. (A) Typical Ca2+ responses evoked by 10 mM caffeinein non-injected and asRYR3S injected myocytes observed in the line-scan mode and represented by 3D process obtained with IDL software. (B) Compileddata showing the amplitude and upstroke velocity of caffeine-induced Ca2+ responses observed in line-scan mode in non-injected myocytes (open bars) and inmyocytes injected with 10 �M of each indicated antisense oligonucleotide (hatched bars). Data are means ± S.E.M. with the number of tested cells indicatedin parentheses. Myocytes were loaded with Fluo-4-AM (2 �M) and used 3 days after injection (�, p < 0.05).

of 10 �M asRYR3L did not modify the BayK8644-inducedCa2+ response whereas injection of 10 �M asRYR3S sig-nificantly increased this Ca2+ response (Fig. 6). The ampli-tude of BayK8644-induced Ca2+ responses was significantlydecreased in asRYR2-injected cells and in myocytes injectedwith a combination of 10 �M asRYR2 + 10 �M asRYR3L(Fig. 6B). The Ca2+ responses evoked in asRYR2-injectedcells and in asRYR2 + asRYR3L were not significantly dif-ferent and were similar to Ca2+ responses obtained in non-injected cells in the presence of ryanodine. This result sug-gests that the CICR mechanism mainly depends on activationof the RYR2 subtype.

CICR mechanism can also be activated by InsP3-dependent Ca2+ release. In mouse duodenum myocytes,acetylcholine (ACh) induced an InsP3-dependent Ca2+

response which was amplified by a RYR-dependent Ca2+

release [31]. Application of 1 �M ACh induced a tran-sient Ca2+ signal in non-injected and injected myocytes(Fig. 7). A change of InsP3R expression by injection ofantisense oligonucleotides could be excluded as immunos-taining obtained with a specific anti-InsP3R antibody innon-injected cells was similar to that obtained in asRYR3or asRYR2-injected cells (data not shown). A significantincrease of ACh-induced Ca2+ responses was measuredin myocytes injected with asRYR3 or asRYR3S whereasinjection of asRYR3L did not modify the ACh-inducedCdt

were not significantly different from those obtained in thepresence of 1 �M ryanodine (30 min) in non-injected cells(Fig. 7B), indicating that RYR2 was activated by Ca2+ releasevia InsP3R activation.

4. Discussion

In this study, we described the physiological relevanceof alternative splicing of the RYR3 subtype in native mouseduodenum myocytes. The expression of the short isoform ofRYR3, lacking exon 70 (XM 619795 sequence), decreasedthe ability of RYR2 subtype to release stored Ca2+ by a CICRmechanism.

4.1. Alternative splicing encoding RYR3S leads to anon-functional channel

Splicing of RYR3 subtype has been investigated and clas-sified in several species. Here, we investigated the expressionof one particular alternative splicing site (namely AS8a) inmice [21]. This in-frame splicing site induces the deletion ofone exon that codes a putative transmembrane segment. Thesequence of the potentially spliced mouse cDNA is 100%similar to the rabbit sequence, and the spliced exon (exon70, in mice corresponding to exon 92 in humans) containsats

a2+ response (Fig. 7). ACh-induced Ca2+ responses wereecreased in myocytes injected with asRYR2 or a combina-ion of asRYR2 + asRYR3L (Fig. 7B). These Ca2+ signals

predicted transmembrane segment. We found this alterna-ive splicing in different smooth muscles but also in heart,keletal muscle and cerebellum but not in cortex. Seven other

18 F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21

Fig. 5. Effects of antisense oligonucleotides directed against the RYR3 iso-forms on Ca2+ responses evoked by thapsigargin. (A) Typical Ca2+ responseinduced by 1 �M thapsigargin 3 min after 10 mM caffeine application in non-injected duodenum cells and in asRYR3-injected cells. (B) Compiled datashowing the maximal amplitude of Ca2+ responses evoked by 1 �M thap-sigargin in non-injected cells (open bar) and in cells injected with asRYRantisense oligonucleotides (filled bars). Data are mean ± S.E.M. with thenumber of tested cells indicated in parentheses. Myocytes were loaded withFluo-4-AM (2 �M) and used 3 days after injection (�, p < 0.05).

alternative splicing sites of RYR3 have been described inrabbit uterus [21]. Two frameshift sites (AS2 and AS5) poten-tially encoded truncated proteins without the pore-formingregion and without a role in Ca2+ release. A similar frameshiftsite is also described in mouse and human brain [19,20]. Inthe mouse brain, only one frameshift splicing site has beenpreviously reported [19]. Two in-frame deletions were alsofound (AS6 and AS7) that could potentially modify the reg-ulation of RYR3 (corresponding to AS1 and AS2 in mink)[18].

In native cells, antisense oligonucleotides strategy is use-ful to induce differential inhibition of each isoform obtainedby alternative splicing [32,33]. With this method, we inves-tigated the function of the short isoform of RYR3 producedby alternative splicing of exon 70 on Ca2+ responses inducedby caffeine in duodenum myocytes.

After inhibition of both RYR2 subtype and non-splicedRYR3 isoform, caffeine did not activate any Ca2+ responsesuggesting that the short isoform of the RYR3 subtypedid not form a functional Ca2+ channel. This is in agree-ment with previous experiments, performed in HEK293

Fig. 6. Effects of antisense oligonucleotides on BayK8644-induced Ca2+

responses. (A) Typical Ca2+ responses evoked by 100 nM BayK8644 innon-injected myocytes (in control conditions and in the presence of ryan-odine) and in cells injected with 10 �M of each antisense oligonucleotide.(B) Compiled data showing the amplitude of Ca2+ responses evoked by100 nM BayK8644 in non-injected (in control conditions, open bar and inthe presence of ryanodine, hatched bar) and injected cells with antisenseoligonucleotides (filled bar). Data are mean ± S.E.M. with the number oftested cells indicated in parentheses. Myocytes were loaded with Fluo-4-AM (2 �M) and used 3 days after injection (�, p < 0.05).

cells indicating that the short isoform of RYR3 does notform a functional channel [21]. In RyR2 subunit, an I-domain (amino acid 3722–4610) has been shown to beinvolved in Ca2+ channel function [34]. The 29 amino acidsequence (amino acid 4492–4520) spliced in RyR3S is con-served in non-spliced RyR3 and RyR2 (homology 86%)and belongs to the I-domain of RyR2. Therefore, the lackof these 29 amino acids in RyR3S could lead to a non-functional channel by an alternative splicing of a trans-membrane segment or by a disruption of a cytoplasmicdomain modulating the channel activity. Alternative splic-ing of Ca2+ channels seems to be a very important regulatorysystem of Ca2+ signalling. Recently, the alternative splicingof InsP3R2 was described and encoded a non-functional shortisoform without InsP3 binding and Ca2+ release abilities. ThisInsP3R2 isoform, when it was re-expressed with full lengthInsP3R2 isoform, decreased stimulus-induced cluster forma-tion and reduced store-operated Ca2+ entry [35]. Voltage-dependent Ca2+ channel CaV 1.2 alternative splicing is mod-ified during heart failure suggesting potential physiopatho-logical relevance of such Ca2+ channel alternative splicing[36].

F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21 19

Fig. 7. Effects of antisense oligonucleotides on ACh-induced Ca2+

responses. (A) Typical Ca2+ responses induced by 1 �M ACh in non-injectedcells (in control conditions and in the presence of ryanodine) and in cellsinjected with 10 �M of each antisense oligonucleotides. (B) Compiled datashowing the amplitude of Ca2+ responses evoked by 1 �M ACh in non-injected cells (in control conditions, open bar and in the presence of 1 �Mryanodine, hatched bar) and in cells injected with 10 �M asRYR antisenseoligonucleotides (filled bar). Data are mean ± S.E.M. with the number oftested cells indicated in parentheses. Myocytes were loaded with Fluo-4-AM (2 �M) and used 3 days after injection (�, p < 0.05).

4.2. Full length RYR3 encodes a Ca2+ signal

After inhibition of both RYR2 and RYR3 short isoformexpressions, caffeine was able to activate reduced and slowCa2+ responses. This indicates that the activation of theRYR3 long isoform might release stored Ca2+ as reportedin skeletal muscle [37] or after expression of this isoformin HEK293 cells [38,14]. In vascular myocytes injected withasRYR1 + asRYR2 or in uterine myocytes that expressed onlythe RYR3 subtype, we have previously shown that RYR3 canbe activated by caffeine only after Ca2+-overloading of the SR[39,15]. In the present study, in asRYR2-injected duodenummyocytes, caffeine activated Ca2+ release in a physiologi-cal solution (2 mM CaCl2) suggesting that the RYR3 longisoform was activated by caffeine under physiological Ca2+

conditions. The protocol used to increase SR Ca2+ loading[15] has no effect on the amplitude of activated Ca2+ sig-nals in duodenum myocytes [Dabertrand, Morel, unpublisheddata]. Moreover, both amplitude and upstroke velocity of theCa2+ response were higher (1.5–2 times) than in myometriummyocytes after the Ca2+-overloading protocol. This suggeststhat the SR in duodenum myocytes could be Ca2+ overloaded

in a normal physiological solution. Further experiments withSR-tagged Ca2+ probes are necessary to investigate more pre-cisely the SR Ca2+ loading. Another explanation could bethat other spliced variants of RYR3 with different regula-tions might be expressed. The other in-frame splicing sites(AS6 and AS7 in rabbit) are respectively linked to putativeregions of Ca2+ and calmodulin binding domains [21]. Adifference of alternative splicing between myometrium andduodenum in these domains could affect the regulation ofRYR3. In other native cells such as neuron and neonatalskeletal muscle, the contribution of RYR3 to Ca2+ releasewas demonstrated [40], but the expression of different iso-forms was not explored. Here, we have shown by RT-PCRthat RYR3 isoforms were potentially not equally expressedin different cell types. Therefore, the RYR3-dependent Ca2+

release observed in other cells would potentially depend onthe expression level of the full length RYR3 isoform.

4.3. RYR3S decreases RYR2-dependent Ca2+ release

We show that expression of the short isoform of RYR3down-regulated the ability of RYR2 to induce Ca2+ releaseduring caffeine stimulation. Actually, the increase in ampli-tude and upstroke velocity of Ca2+ waves in asRYR3-injectedcells (both spliced and non-spliced isoforms were deleted)and in asRYR3S-injected cells indicates that the short RYR3iHacaiotRaciidbeoavlttemocarbi

soform is able to decrease RYR2-dependent Ca2+ release. InEK293 cells, interactions between tagged RYR2 subtype

nd both RYR3 isoforms have been shown by immunopre-ipitation [4,21]. Here, we suggest that this interaction hasfunctional interest in native cells. There was no signif-

cant difference between caffeine-induced Ca2+ responsesbtained in asRYR2- and asRYR2 + asRYR3S. This indicateshat: (1) the interactions between long and short isoforms ofYR3 have no functional consequences in native myocytesnd/or (2) this interaction was not observed in native cells inontrast to what was reported in HEK293 cells overexpress-ng RYR3 long isoform [21]. Although we were not able tommunoprecipitate RYR2 or RYR3 subtypes in native duo-enum myocytes this latter hypothesis can be corroboratedy immunostaining experiments. RYR2 and RYR3 were co-xpressed in non-injected cells. Thus, subcellular localizationf RYR isoforms suggests that interactions between RYR2nd RYR3 short isoform or RYR2 and RYR3 long isoform areery likely while interactions between RYR3 short and RYR3ong isoforms are unlikely. Indeed, immunostaining revealedhat the RYR3 short isoform was selectively expressed nearhe plasma membrane whilst the RYR3 long isoform wasxpressed around the nucleus. Such subcellular localizationay also explain the inhibitory effect of RYR3 short isoform

n the CICR mechanism because this isoform is localized inellular regions also expressing voltage-gated Ca2+ channelsnd the proteins involved in InsP3 transduction pathway. Theelevance of RYR isoform localization is further supportedy data in airways myocytes showing that the RYR1 subtypes localized near the plasma membrane whereas RYR3 is

20 F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21

principally expressed around the nucleus [41]. In cardiacCajal cells, RYR2 and RYR3 are not expressed in the samepart of the SR and this differential localization has beenproposed to explain the propagation of Ca2+ signals [42].

4.4. RYR3S expression decreases CICR efficiency

The physiological relevance of the main finding of thepresent report is linked to the modulation of the CICR mech-anism. In smooth muscle, the trigger for RYR opening isessentially an increase in intracellular Ca2+ concentrationinduced by activation of voltage-gated Ca2+ channels orInsP3R [31,43]. Our results show that inhibition of the RYR3short isoform can amplify the CICR mechanism activated byCa2+ entry or InsP3-dependent Ca2+ release. A non specificeffect of antisense oligonucleotides can be excluded becauseinjection did not modify Ca2+ influx and InsP3-dependentCa2+ release: Ca2+ responses activated by BayK8644 andACh in asRYR2-or asRYR3-injected cells and in non-injectedcells were similar in the presence of ryanodine. Changes in SRCa2+ loading could also be ruled out because the thapsigargin-induced Ca2+ response in injected cells was not different fromthat observed in non-injected cells. Moreover, an increase ofRYR2-dependent Ca2+ release by inhibition of RYR3 is alsoreported in RYR3-knock out mouse cerebral arteries [16] orb

hdma

A

dcEdo

R

[6] N. Macrez, J. Mironneau, Local Ca2+ signals in cellular signalling,Curr. Mol. Med. 4 (2004) 263–275.

[7] M.G. Klein, H. Cheng, L.F. Santana, Y.H. Jiang, W.J. Lederer, M.F.Schneider, Two mechanisms of quantized calcium release in skeletalmuscle, Nature 379 (1996) 455–458.

[8] C.W. Ward, F. Protasi, D. Castillo, et al., Type 1 and type 3 ryanodinereceptors generate different Ca2+ release event activity in both intactand permeabilized myotubes, Biophys. J. 81 (2001) 3216–3230.

[9] F. Coussin, N. Macrez, J.L. Morel, J. Mironneau, Requirement ofryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ releasein vascular myocytes, J. Biol. Chem. 275 (2000) 9596–9603.

[10] J.L. Morel, L. Rakotoarisoa, L.H. Jeyakumar, S. Fleischer, C. Miron-neau, J. Mironneau, Decreased expression of ryanodine receptorsalters calcium-induced calcium release mechanism in mdx duodenalmyocytes, J. Biol. Chem. 279 (2004) 21287–21293.

[11] J.D. Fessenden, Y. Wang, R.A. Moore, C.R. Chen, P.D. Allen, I.N.Pessah, Divergent functional properties of ryanodine receptor types1 and 3 expressed in a myogenic cell line, Biophys. J. 79 (2000)2509–2525.

[12] D. Rossi, I. Simeoni, M. Micheli, et al., RyR1 and RyR3 isoformsprovide distinct intracellular Ca2+ signals in HEK 293 cells, J. CellSci. 115 (2002) 2497–2504.

[13] S. Kunerth, M.F. Langhorst, N. Schwarzmann, et al., Amplificationand propagation of pacemaker Ca2+ signals by cyclic ADP-riboseand the type 3 ryanodine receptor in T cells, J. Cell Sci. 117 (2004)2141–2149.

[14] M. Aoyama, A. Yamada, J. Wang, et al., Requirement of ryanodinereceptors for pacemaker Ca2+ activity in ICC and HEK293 cells, J.Cell Sci. 117 (2004) 2813–2825.

[15] J. Mironneau, N. Macrez, J.L. Morel, V. Sorrentino, C. Mironneau,

y injection of asRYR3 in rat duodenum myocytes [30].In conclusion, we show that the RYR3 short isoform may

ave a physiological function in native smooth muscle byecreasing the CICR mechanism efficiency. By specificallyodulating RYR2 function, alternative splicing of RYR3 isregulator of Ca2+ signalling.

cknowledgements

This work was supported by grants from Centre Nationale la Recherche Scientifique (CNRS), Association Francaiseontre les Myopathies (AFM), and Centre National destudes Spatiales (CNES), France. The authors thank N. Bien-on for secretarial assistance and J.L. Lavie for developmentf image analysis using IDL software.

eferences

[1] M. Fill, J.A. Copello, Ryanodine receptor calcium release channels,Physiol. Rev. 82 (2002) 893–922.

[2] M.J. Berridge, P. Lipp, M.D. Bootman, The versatility and universal-ity of calcium signalling, Nat. Rev. Mol. Cell Biol. 1 (2000) 11–21.

[3] M.J. Berridge, M.D. Bootman, H.L. Roderick, Calcium signalling:dynamics, homeostasis and remodelling, Nat. Rev. Mol. Cell Biol.4 (2003) 517–529.

[4] B. Xiao, H. Masumiya, D. Jiang, et al., Isoform-dependent formationof heteromeric Ca2+ release channels (ryanodine receptors), J. Biol.Chem. 277 (2002) 41778–41785.

[5] M.B. Cannell, H. Cheng, W.J. Lederer, The control of calciumrelease in heart muscle, Science 2685 (1995) 1045–1049.

Identification and function of ryanodine receptor subtype 3 in non-pregnant mouse myometrial cells, J. Physiol. 538 (2002) 707–716.

[16] M. Lohn, W. Jessner, M. Furstenau, et al., Regulation of calciumsparks and spontaneous transient outward currents by RyR3 in arte-rial vascular smooth muscle cells, Circ. Res. 89 (2001) 1051–1057.

[17] C.F. Perez, J.R. Lopez, P.D. Allen, Expression levels of RyR1 andRyR3 control resting free Ca2+ in skeletal muscle, Am. J. Physiol.Cell Physiol. 288 (2005) C640–C649.

[18] G. Marziali, D. Rossi, G. Giannini, A. Charlesworth, V. Sorrentino,cDNA cloning reveals a tissue specific expression of alternativelyspliced transcripts of the ryanodine receptor type 3 (RyR3) calciumrelease channel, FEBS Lett. 394 (1996) 76–82.

[19] R. Miyatake, A. Furukawa, M. Matsushita, et al., Tissue-specificalternative splicing of mouse brain type ryanodine receptor/calciumrelease channel mRNA, FEBS Lett. 395 (1996) 123–126.

[20] T. Leeb, B. Brenig, cDNA cloning and sequencing of the humanryanodine receptor type 3 (RYR3) reveals a novel alternative splicesite in the RYR3 gene, FEBS Lett. 423 (1998) 367–370.

[21] D. Jiang, B. Xiao, X. Li, S.R. Chen, Smooth muscle tissues expressa major dominant negative splice variant of the type 3 Ca2+ releasechannel (ryanodine receptor), J. Biol. Chem. 278 (2003) 4763–4769.

[22] T. Murayama, Y. Ogawa, Roles of two ryanodine receptor isoformscoexisting in skeletal muscle, Trends Cardiovasc. Med. 12 (2002)305–311.

[23] D.M. Bers, Cardiac excitation–contraction coupling, Nature 415(2002) 198–205.

[24] F.X. Boittin, N. Macrez, G. Halet, J. Mironneau, Norepinephrine-induced Ca2+ waves depend on InsP3 and ryanodine receptor activa-tion in vascular myocytes, Am. J. Physiol. 277 (1999) C139–C151.

[25] S. Arnaudeau, F.X. Boittin, N. Macrez, J.L. Lavie, C. Mironneau,J. Mironneau, L-type Ca2+ release channel-dependent hierarchicalCa2+ signalling in rat portal vein myocytes, Cell Calcium 22 (1997)399–411.

[26] A. Galione, H.C. Lee, W.B. Busa, Ca2+-induced Ca2+ release in seaurchin egg homogenates: modulation by cyclic ADP-ribose, Science253 (1991) 1143–1146.

F. Dabertrand et al. / Cell Calcium 40 (2006) 11–21 21

[27] A.H. Guse, Regulation of calcium signaling by the second messen-ger cyclic adenosine diphosphoribose (cADPR), Curr. Mol. Med. 4(2004) 239–248.

[28] N. Macrez-Lepretre, F. Kalkbrenner, G. Schultz, J. Mironneau,Distinct functions of Gq and G11 proteins in coupling alpha1-adrenoreceptors to Ca2+ release and Ca2+ entry in rat portal veinmyocytes, J. Biol. Chem. 272 (1997) 5261–5268.

[29] S.L. Carl, K. Felix, A.H. Caswell, et al., Immunolocalization of sar-colemmal dihydropyridine receptor and sarcoplasmic reticular triadinand ryanodine receptor in rabbit ventricle and atrium, J. Cell Biol.129 (1995) 672–682.

[30] N. Fritz, N. Macrez, J. Mironneau, L.H. Jeyakumar, S. Fleischer,J.L. Morel, Ryanodine receptor subtype 2 encodes Ca2+ oscillationsactivated by acetylcholine via the M2 muscarinic receptor/cADP-ribose signalling pathway in duodenum myocytes, J Cell Sci. 118(2005) 2261–2270.

[31] J.L. Morel, N. Macrez, J. Mironneau, Specific Gq protein involve-ment in muscarinic M3 receptor-induced phosphatidylinositol hydrol-ysis and Ca2+ release in mouse duodenal myocytes, Br. J. Pharmacol.121 (1997) 451–458.

[32] S.D. Wilton, F. Lloyd, K. Carville, et al., Specific removal ofthe nonsense mutation from the mdx dystrophin mRNA usingantisense oligonucleotides, Neuromuscul. Disord. 9 (1999) 330–338.

[33] P. Sazani, R. Kole, Therapeutic potential of antisense oligonu-cleotides as modulators of alternative splicing, J. Clin. Invest. 112(2003) 481–486.

[34] C.H. George, H. Jundi, N.L. Thomas, M. Scoote, N. Walters, A.J.Williams, F.A. Lai, Ryanodine receptor regulation by intramolecularinteraction between cytoplasmic and transmembrane domains, Mol.Biol. Cell 15 (2004) 2627–2638.

[35] M. Iwai, Y. Tateishi, M. Hattori, A. Mizutani, T. Nakamura, A.Futatsugi, T. Inoue, T. Furuichi, T. Michikawa, K. Mikoshiba, Molec-ular cloning of mouse type 2 and type 3 inositol 1,4,5-trisphosphatereceptors and identification of a novel type 2 receptor splice variant,J. Biol. Chem. 280 (2005) 10305–10317.

[36] Y. Yang, X. Chen, K. Margulies, V. Jeevanandam, P. Pollack, B.A.Bailey, S.R. Houser, L-type Ca2+ channel alpha 1c subunit isoformswitching in failing human ventricular myocardium, J. Mol. CellCardiol. 32 (2000) 973–984.

[37] M.W. Conklin, C.A. Ahern, P. Vallejo, V. Sorrentino, H. Takeshima,R. Coronado, Comparison of Ca2+ sparks produced independentlyby two ryanodine receptor isoforms (type 1 or type 3), Biophys. J.78 (2000) 1777–1785.

[38] S.R. Chen, X. Li, K. Ebisawa, L. Zhang, Functional characterizationof the recombinant type 3 Ca2+ release channel (ryanodine receptor)expressed in HEK293 cells, J. Biol. Chem. 272 (1997) 24234–24246.

[39] J. Mironneau, F. Coussin, L.H. Jeyakumar, S. Fleischer, C. Miron-neau, N. Macrez, Contribution of ryanodine receptor subtype 3 toCa2+ responses in Ca2+-overloaded cultured rat portal vein myocytes,J. Biol. Chem. 276 (2001) 11257–11264.

[40] V. Sorrentino, Ryanodine receptor type 3: why another ryanodinereceptor isoform? Front. Biosci. 8 (2003) d176–d182.

[41] W. Du, J.A. Stiber, R.B. Paul, M. Gerhard, J.P. Eur, Ryanodine recep-tors in muscarinic receptor-mediated bronchoconstriction, J. Biol.Chem. 280 (2005) 26287–26294.

[42] B.D. Stuyvers, W. Dun, S. Matkovich, V. Sorrentino, P.A. Boyden,H.E. Ter Keurs, Ca2+ sparks and waves in canine purkinje cells. Atriple layered system of Ca2+ activation, Circ. Res. 97 (2005) 35–43.

[43] J.L. Morel, N. Macrez-Lepretre, J. Mironneau, Angiotensin II-activated Ca2+ entry-induced release of Ca2+ from intracellular storesin rat portal vein myocytes, Br. J. Pharmacol. 118 (1996) 73–78.